Download DNA Test – Study Guide KEY Explain the research of the following

DNA Test – Study Guide KEY
1. Explain the research of the following scientists:
a. Griffith: worked with pneumonia bacteria and mice to track how
infection occurs. Results: Harmless bacteria that were exposed to heatkilled harmful bacteria were transformed to harmful bacteria.
b. Avery: Used enzymes to break down pneumonia bacteria. Results: DNA
is the transforming factor that causes infection.
c. Hershey and Chase: Worked with bacteriophages (viruses that infect
bacteria only). Results: DNA from virus is what causes viral infections.
d. Franklin and Wilkins: Used X-Ray diffraction to take photos of DNA.
e. Watson and Crick: Credited with discovering DNA double helix structure
since they could analyze X-ray diffraction photos.
f. Chargaff: Discovered rules of base pairing. A=T, G=C
2. What is the role of DNA?
The role of DNA is to store and transfer genetic information like a library.
3. What is a nucleotide and what are the three parts to it?
A nucleotide is a monomer of a nucleic acid (DNA and RNA). The three parts of
a nucleotide are the 5-carbon sugar, phosphate group, and nitrogenous base.
4. What two nitrogenous bases are purines? Pyrimidines?
Purines = Adenine and Guanine
Pyrimidines = Thymine and Cytosine
5. What type of bonds hold DNA together and where are they located?
Hydrogen bonds: between the nitrogenous bases
Covalent bonds: between the sugar and phosphate backbone
6. List the steps to DNA replication.
1. Helicase breaks the hydrogen bonds between base pairs and “unzips” DNA.
2. DNA polymerase adds new DNA nucleotides to DNA template strands.
3. DNA polymerase releases once it reaches the end of the DNA strands. Create
two semi-conservative DNA strands.
7. What do the following enzymes do during DNA replication?
a. Helicase: Breaks hydrogen bonds between nitrogenous base pairs,
“unzips” DNA strands.
b. DNA polymerase: Adds new DNA nucleotides to template strands of DNA.
c. Ligase: Bonds lagging strand Okazaki fragments together.
8. What does semi-conservative mean?
Term used to explain that the new strands of DNA made contain half of the
original strand. Half of the parent strand is conserved.
9. What are the three differences between DNA and RNA?
DNA has a deoxyribose sugar. RNA has a ribose sugar.
DNA is double stranded. RNA is single stranded.
DNA uses thymine. RNA used uracil.
10. What are the three types of RNA used during protein synthesis and explain their
function?
mRNA – messenger RNA, recipe to make proteins
rRNA – ribosomal RNA, found in ribosomes
tRNA – transfer RNA, transfers amino acids to ribosomes
11. What is a codon and where is it found?
A codon is a 3 letter sequence found in mRNA.
12. What is an anti-codon and where is it found?
An anti-codon is a 3 letter sequence found in tRNA.
13. Write the mRNA strand for this DNA strand: TACGGCATGAACGTAGCTAGCACT
AUG-CCG-UAC-UUG-CAU-CGA-UCG-UGA
14. What are the amino acids that correspond to the mRNA strand you just made?
Met-Pro-Tyr-Leu-His-Arg-Ser-STOP
15. List the steps to transcription.
1. Takes place in the nucleus
2. RNA polymerase binds to promoter, “unzips” DNA
3. RNA polymerase adds RNA nucleotides to the DNA template
4. RNA polymerase reaches the STOP codon and releases
5. mRNA needs to add a poly A tail and cap before going to cytoplasm
16. List the steps to translation.
1. Takes place on a ribosome in the nucleus
2. Ribsome subunits bind together, tRNA binds to START (AUG) codon
3. tRNA brings amino acids to the ribosomes
4. tRNA reaches STOP codon and releases from ribosome
5. Ribosome breaks down back into subunits
17. What are the roles of the following proteins do during protein synthesis?
a. RNA polymerase: binds to promoter on DNA, “unzips” DNA, adds RNA
nucleotides
b. Ribosomes: Protein factory found in the cytoplasm
18. What is the purpose of the human genome project?
Map out chromosomes to help find cures/prevention for diseases.