Download Supplementary Information (doc 2382K)

Supporting Information for J. Liang et al. “Conditional Neuroligin-2
Knockout in Adult Medial Prefrontal Cortex Links Chronic Changes
in Synaptic Inhibition to Cognitive Impairments”
Six supporting figures (Figs. S1 to S6) and a detailed description of the experimental
procedures are provided in the Supporting Information.
SUPPLEMENTARY FIGURES and FIGURE LEGENDS
Figure S1: Method for whole-cell patch clamp recording of neurons in the mPFC
Micrographs of coronal mPFC slices with a patch pipette inserted into a pyramidal
neuron (red arrow) viewed by differential interference contrast optics (DIC, left panels)
or EGFP fluorescence (right panels) at low (4x, top) or high magnification (60x, bottom).
Coronal sections (300 m thickness) containing the mPFC were prepared from mice
which had received stereotaxic injection of AAVs expressing EGFP fused with either
active Cre- or truncated, inactive Cre-recombinase. Recording pipettes were targeted to
EGFP-positive pyramidal neurons located at layer 2/3 of the mPFC.
1
Figure S2: Conditional Nlgn2 KO in the mPFC reduces amplitude and frequency of
spontaneous IPSCs but not the tonic inhibitory current in acute mPFC slices
A-C, Analysis of spontaneous inhibitory postsynaptic currents (sIPSCs) in acute brain
slices of the mPFC (A, representative traces of patch-clamp recordings in the absence
of tetrodotoxin; B, quantifications of the mean [left] and cumulative distributions [right] of
sIPSC amplitudes; C, similar quantifications of the sIPSC frequencies). Recordings
were performed in layer 2/3 pyramidal neurons 6-7 weeks after stereotactic viral
infections.
D & E, Representative traces and quantifications of tonic inhibitory currents (IPSCs)
measured in voltage-clamp mode as the shift in holding current induced by addition of
the GABAA receptor antagonist bicuculline (20 M). Red dashed line indicates baseline
before and after bicuculline addition; note that bicuculline blocks extrasynaptic and
synaptic GABAA-receptors, and thus ablates both synaptic sIPSCs and extrasynaptic
baseline IPSCs.
Data in bar diagrams are means ± SEM; numbers in columns indicate the number of
neurons/mice analyzed. Statistical significance between groups was determined with
Student’s t-test (* p<0.05, ** p<0.01). Statistical significance between cumulative
distributions was calculated by the two-sample Kolmogorov–Smirnov test (*** p<0.01).
2
Figure S3: Conditional Nlgn2 KO in the mPFC did not alter passive neuronal
membrane properties
Membrane capacitance (Cm) and input resistance (Rm) of pyramidal mPFC neurons
were measured at either 2-3 weeks (A) or 6-7 weeks (B) after viral injections. Note that
the absence of a change suggests no changes in neuronal soma size and membrane
properties.
Data are means ± SEM; numbers in columns indicate the number of neurons/mice
analyzed. Student’s t-test was used for data analysis. No significant difference was
observed between control and Cre groups.
3
Figure S4: Conditional Nlgn2 KO in the mPFC does not impair fear memory
retrieval
(A) Schematics illustrating the two different fear-conditioning paradigms used. In the
standard protocol used for most experiments, mice were trained and tested after viral
injections into the mPFC. The fear memory impairment observed under this protocol
(see Fig. 4) could be due to deficiency at either the memory acquisition/encoding or
memory retrieval stages. In the post-training protocol (used here), mice received viral
injections after training. Therefore, in this protocol viral manipulations were initiated only
after acquisition and early encoding of memory, and the impairments observed with this
protocol likely reflect a deficiency in memory retrieval.
(B) With the post-training infection protocol, mPFC Nlgn2 cKO mice showed normal fear
memories to both the context and the auditory cue, demonstrating that the retrieval of
fear memories was not affected by the Nlgn2 cKO in the mPFC.
Data are means ± SEM; numbers in columns indicate the number of mice analyzed.
Statistical significance between groups was determined with two-way ANOVA followed
by Bonferroni's multiple comparisons test (no significant differences noted).
4
Figure S5: Conditional Nlgn2 KO in the mPFC did not impair short-term fear
memory
Homozygous Nlgn2 cKO mice were injected with control or Cre AAVs, and trained two
weeks later for fear conditioning as in the standard protocol (Fig. S4). Different from the
standard protocol, however, mice were subjected to the fear memory tests starting
already 1 hour after training for the contextual fear memory test, followed at 2 hours
after training by the altered context and cued tone test. The mice exhibited normal
short-term fear memories in all tests. Data are means ± SEM; numbers in columns
indicate the number of mice analyzed. Statistical significance between groups was
determined with two-way ANOVA followed by Bonferroni's multiple comparisons test (no
significant differences noted).
5
Figure S6: Conditional Nlgn2 KO in the mPFC did not impair motor learning as
assayed on the rotarod
Homozygous Nlgn2 cKO mice were injected with control or Cre AAVs in the mPFC, and
subjected to Rotarod assays two weeks later. Data shown depict the retention time of
mice on an accelerating rotarod (0-45 rpm in 5 min) during motor learning over three
consecutive days with 3 trials per day. Data are means ± SEM (n = number of mice
analyzed). Statistical significance between groups was determined with two-way
ANOVA followed by Sidak's multiple comparisons test (no significant differences noted).
6
SUPPLEMENTARY DETAILED EXPERIMENTAL PROCEDURES
Nlgn2 cKO mouse generation and mouse husbandry. Nlgn2 cKO mice were
generated by homologous recombination in embryonic stem cells according to the
design shown in Figure 1A by Taconic Inc. (Hudson, NY). The neomycin resistance
gene cassette was removed by crossing the initially obtained mutant mice with mice
expressing Flp-recombinase in the germline (The Jackson Laboratory, Stock #003800).
Nlgn2 cKO mice were genotyped were genotyped with primers NL2F
(CAGAATGCCCTGAAGGACTGACTCTG)
and
NL2R
(GGCAATGTGGTAGCTGGAGAGAAGG) to produce a 163 base pair band for wild-type
allele versus a 243 base pair band for the conditional allele. Mice were housed under a
12 h light/dark cycle. Animal experiments were conducted following protocols approved
by Administrative Panel on Laboratory Animal Care at Stanford University. To minimize
the number of mice used for experiments, we used in the behavioral tests the same set
of mice for open field test, spontaneous alternation Y maze, three chamber social
interaction test and elevated plus maze test. Another set of mice was used for fearconditioning experiments, with separate sets of mice for the 2-3 and the 6-7 weeks after
Nlgn2 inactivation time points.
Virus preparation and stereotaxic injections. We constructed AAV vectors
expressing wild-type active Cre-recombinase and mutant-inactive Cre-recombinase
(used as a control), both fused to EGFP and adopted from previously described
lentiviruses with the same design1. All AAVs used the synapsin promoter for protein
expression. AAVs were packaged with AAV-DJ capsids and prepared as described2.
Genomic titers of AAVs were measured by quantitative real-time PCR, and adjusted to
2 x 1013 genomic copies/ml for stereotaxic injections. Anesthetized 7 week old
homozygous Nlgn2 cKO mice were bilaterally injected into the mPFC at two sites with a
glass pipette at a flow rate of 0.15 μl/min. Coordinates used for the stereotactic
injections were AP – 1.25 mm, ML ± 0.3 mm, DV – 1.0 mm and DV – 1.5 mm. The sites
at DV – 1.0 mm and DV – 1.5 mm both received 0.75 μl of viral injections.
Slice electrophysiology. Coronal brain slices (300 μm) containing the mPFC were cut
with a vibratome in ice cold solution comprising (in mM): 75 sucrose, 85 NaCl, 2.5 KCl,
1.3 NaH2PO4, 4 MgSO4, 0.5 CaCl2, 24 NaHCO3, 25 D-glucose saturated with 95%
O2/5% CO2 and transferred to a holding chamber containing artificial cerebrospinal fluid
(ACSF) composed of (in mM): 126 NaCl, 2.5 KCl, 1 NaH2PO4, 1.3 MgSO4, 2.5 CaCl2,
26.2 NaHCO3, 11 D-glucose to recover for 30 min at 31 oC and followed by at least one
hour recovery at room temperature before being transferred to a recording chamber
continually perfused (~1 ml/min) with oxygenated ACSF (maintained at 26-28 oC). All
whole-cell voltage-clamp recordings were made with 2.3-3 MΩ pipettes. Internal
solutions for IPSCs and mIPSCs contained (in mM): 120 CsCl, 5 NaCl, 10 HEPES, 10
EGTA, 1 MgCl2, 3 Mg-ATP, 0.3 GTP, 10 QX-314. Neurons were clamped at -70 mV; for
mIPSCs, 20 μM CNQX, 50 μm APV and 1 μm tetrodotoxin were included in the ACSF.
7
Internal solutions for EPSCs contained (in mM): 125 K-gluconate, 20 KCl, 4 Mg-ATP,
0.3 Na-GTP, 10 Na2-phosphocreatine, 0.5 EGTA, 10 HEPES, 10 QX-314. Neurons
were clamped at -70 mV; for mEPSCs, 50 μM picrotoxin, 50 μm APV and 1 μm
tetrodotoxin were included in the ACSF. For measurements of the E/I ratio, the internal
solution contained (in mM): 125 K-gluconate, 20 KCl, 4 Mg-ATP, 0.3 Na-GTP, 10 Na2
phosphocreatine, 0.5 EGTA, 10 HEPES, 10 QX-314. Neurons were first clamped at the
-60 mV to record EPSC, and then clamped at 0 mV for IPSC; 50 μm APV was included
in ACSF. The equilibrium potentials were validated with the antagonist for GABA(A)
receptor picrotoxin or AMPA receptor CNQX, respectively. Stimulations were applied to
layer I of the prefrontal cortex with a matrix stimulator electrode [MX21AES (DH1), FHC
Inc., ME]. The ratio of excitatory to inhibitory synaptic currents (the E/I ratio) was
calculated by dividing the amplitudes of EPSCs by the amplitudes of IPSCs from the
same cell recorded at the same stimulation intensity. Statistically, all mIPSC and
mEPSC data were analyzed with Student’s t-test and by two-way ANOVA as noted;
evoked current amplitudes and E/I ratios were analyzed with two-way ANOVA followed
by Bonferroni’s post hoc tests.
Fear conditioning. Mice were housed individually after viral injections, and handled
daily for 5 days prior to training. On training day, mice were placed in a fear conditioning
chamber (H10-11M-TC, Coulbourn Instruments, PA) located in the center of a sound
attenuating cubicle (Coulbourn Instruments). The conditioning chamber was cleaned
with 10% ethanol to provide a background odor. A ventilation fan provided a
background noise at ~55 dB. After a 2-min exploration period, 3 tone-footshock pairings
separated by 1 min intervals were delivered. The 85-dB 2-kHz tone lasted for 30 s and
the footshocks were 0.75 mA and lasted for 2 s. The foot shocks co-terminated with the
tone. The mice remained in training chamber for another 30 s before being returned to
home cages. In context test, mice were placed back into the original conditioning
chamber for 5 min. For the altered context and tone tests, the same type of conditioning
chamber were modified by changing its metal grid floor to a plastic sheet, white metal
side walls to plastic walls decorated with red stripes, background odor of ethanol to
vanilla. The ventilation fan was turned off to reduce background noise. Mice were
placed in the altered chamber for 5 min to measure the freeze level in the altered
context and after this 5-min period a tone (85 dB, 2 kHz) was delivered for 1 min to
measure the freeze to tone. The behavior of the mice was recorded with the
Freezeframe software and analyzed with Freezeview software (Coulbourn Instruments).
Motionless bouts lasting more than 1 s were considered as freeze. Data were analyzed
with two-way ANOVA followed by Bonferroni's multiple comparisons test.
Open field test. White colored plastic boxes were used as the open field chambers
(dimension: 34 × 34 × 40 cm). Mice were individually placed into the center of the
chambers and allowed to freely explore for 10 min. The locomotion and exploratory
behaviors of mice were recorded with a tracking system Viewer III (BIOBSERVE). The
8
traveling distance and the time spent in center area were analyzed. The center area
was defined as the 17 × 17 cm central section of the chambers. The total traveling
distance was used to evaluate locomotor activity and the time spent in center area was
commonly used to estimate the anxiety level in an open environment. Data were
analyzed with Student’s t-test.
Spontaneous alternation Y maze. A light grey plastic Y maze was used to evaluate
spatial working memory. The maze consisted of three arms separated by 120 degrees
(dimensions of each arm: 40 × 10 × 17 cm). Mice were individually placed in the distal
end of one arm and allowed to freely explore the whole maze for 10 min. Completed
arm entry was defined as the entering of a whole mouse including its tail into an arm.
The sequences and total numbers of arm entries were recorded and analyzed with
Viewer III tracking system. Visiting all three different arms consecutively was termed a
‘correct’ trial, and visiting one arm twice or more in three consecutive entries was
termed wrong trial. We calculated the correct alternation percentage as (number of
correct trials/total number of correct and wrong trials) × 100. Data were analyzed with
Student’s t-test.
Three chamber social interaction test. Social interaction was evaluated in a
transparent three-chamber box as described3 (The dimension of each chamber was 60
× 30 × 30 cm). Mouse was placed in the central chamber for a 5-min habituation. After
the habituation, another mouse (intruder) was placed inside an upside-down wire mesh
pencil cup located in one of the side chambers (named as social chamber). The
intruders were of the same gender, same species and at similar age to the test mouse.
An identical pencil cup was placed in the other side chamber (named as non-social
chamber), underneath which a plastic object with the same color and size to the intruder
mouse was placed. After that, the doors to the side chambers were opened and the test
mouse was allowed to freely travel among the three chambers for 5 minutes. The time
durations that the mice spent in each of the chambers were recorded and analyzed with
Viewer III tracking system. The data of time duration were analyzed using two-way
ANOVA, with Treatment as the within-subjects factor and Chamber condition as the
between-subjects factor. Significant main effects in the ANOVA were followed by
Bonferroni multiple-comparison post hoc tests. The data of social interaction index were
analyzed with Student’s t-test.
Elevated plus maze test.The elevated plus maze test was conducted as described4.
The grey-painted maze had four 30 × 8 cm arms. Two of them were open arms without
walls and other two were enclosed by 10 cm high walls. The maze was elevated 40 cm
over the floor. At the beginning of the tests, mice were individually placed at the junction
of an open and a closed arms, facing the open arm. Then the mice were allowed to
freely move in the whole maze for 10 min. The time durations mice spent in the open vs.
9
the closed arms were recorded by Viewer III tracking system. Data were analyzed with
Student’s t-test.
Rotarod test. An accelerating rotarod designed for mice (IITC Life Science) was used.
The training consisted of three trials per day over the course of 3 days. The rotarod was
activated after placing mice on the motionless rod. The rod accelerated from 5 to 50
revolutions per min in 5 min. Each trial ended when a mouse fell off, made one
complete backward revolution while hanging on, or reached 300 s. The time to fall off
the rod or to turn one full revolution was measured. Data were analyzed with two-way
ANOVA followed by Sidak's multiple comparisons test.
Immonohistochemistry. Mice were perfused under anesthesia with 10 ml of PBS
followed by 50 ml of fixative (4% paraformaldehyde diluted in PBS). The brains were
removed and post-fixed for 3 hours at room temperature and then incubated in 30%
sucrose overnight before being sectioned at 40 μm-thick nesses on a cryostat. The freefloating brain sections were incubated in blocking solution containing 10% house serum,
0.2% bovine serum albumin and 2% Triton X-100 for 1h at room temperature and then
incubated with the primary antibody for c-Fos (rabbit, Calbiochem, 1:2000) or GAD65
(mouse, Hybridoma Bank 1:1000) overnight at 4 oC. After washes, the sections were
incubated with florescent secondary antibody for 2h at room temperature. After
extensive washes, the sections were mounted onto glass slides with Vectashield
mounting medium. Microphotos were taken with Olympus BX61VS microscope or
LeicaTCS SP2 confocal microscope. The number of neurons, intensity and size of
synaptic puncta were analyzed with NIH Image J software. Data were analyzed with
Student’s t-test.
Quantitative Immunoblotting. Brain tissue from mPFC was homogenized in lysis
buffer (1% of SDS, 10 mM Tris), mixed with 6× loading buffer (0.5 M tris, 60% glycerol,
10% SDS, 10% -mercaptoethanol, and 0.01% bromophenol blue), and denatured at
100oC for 20 min. After centrifugation at 14,000 rpm for 30 min, the supernatants were
collected. DC protein assay kit (Sigma) was used to measure the protein concentration.
Equal amount of total protein of each sample was loaded for SDS-PAGE and
immunoblotting. The primary antibodies used in the study were anti-Nlgn2 (rabbit,
Alomone Labs, 1:1000) and anti actin (mouse, Sigma, 1:4000). Blots were digitized with
Li-CORimaging system and quantified with NIH image software. All band intensities
were normalized to that of control sample.
Quantitative real-time PCR quantification of mRNA Level. Homozygous Nlgn2 cKO
mice were injected into the mPFC with control or cre AAVs. Two weeks later, mice were
either left undisturbed in their home cages (Naïve), or were subjected to standard fear
conditioning training (Trained). 30 min after the beginning of training, naïve and trained
mice were sacrificed by isoflurane inhalation. The ACC region was immediately
dissected out, and total mRNA was extracted with an RNAqueous micro kit (Life
10
Technologies) for qRT-PCR quantification of the expression level of three immediate
early genes, c-Fos, Egr1 and Npas4. The mRNA level of individual genes was then
analyzed by one-step quantitative real time PCR system with pre-made TaqMan® gene
expression assays on Applied Biosystems 7900HT Fast Real-Time PCR System. The
assay for c-Fos includes forward prime, CTG GAT TTG ACT GGA GGT CTG, reverse
primer, CTG ATG CTC TTG ACT GGC TC and probe, 56-FAM/TTC ACC CTG
/ZEN/CCC CTT CTC AAC G/3IABkFQ; The assay for Egr1 includes forward prime,
CTG CTT CAT CGT CTT CCT CTG, reverse primer, GTG TTG GGA GTA GGA AAG
GTG and probe, 56-FAM/CAG TCC CAT /ZEN/CTA CTC GGC TGC G/3IABkFQ; The
assay for Npas4 includes forward prime, TGA AGA CCA GTT GAC TCC ATG, reverse
primer, TGT TCA GAT GAG CCT GGA ATG and probe, 56-FAM/TAC TTC CCA
/ZEN/GCA CTG CCA CAT TCC /3IABkFQ. Data were analyzed with two-way ANOVA
followed by Bonferroni's multiple comparisons test.
SUPPLEMENTARY REFERENCES
1. Kaeser PS, Deng L, Wang Y, Dulubova I, Liu X, Rizo J, Südhof TC.RIM proteins
tether Ca2+ channels to presynaptic active zones via a direct PDZ-domain
interaction. Cell 2011; 144: 282-295.
2. Xu W, Morishita W, Buckmaster PS, Pang ZP, Malenka RC, Sudhof TC. Distinct
neuronal coding schemes in memory revealed by selective erasure of fast
synchronous synaptic transmission. Neuron 2012; 73: 990-1001.
3. Winslow JT. Mouse social recognition and preference. Curr Protoc Neurosci 2003;
Chapter 8: Unit 8 16.
4. Tye KM, Prakash R, Kim SY, Fenno LE, Grosenick L, Zarabi H et al. Amygdala
circuitry mediating reversible and bidirectional control of anxiety. Nature 2011; 471:
358-362.
11