Download Fish and Shellfish Immunology

Fish & Shellfish Immunology 19 (2005) 153e163
www.elsevier.com/locate/fsi
Evaluation of DNA vaccination of spotted sand bass
(Paralabrax maculatofasciatus) with two major
outer-membrane protein-encoding genes
from Aeromonas veronii
Roberto Carlos Vazquez-Juareza,*, Marta Gomez-Chiarrib,
Hugo Barrera-Saldañac, Norma Hernandez-Saavedraa,
Silvie Dumasd, Felipe Ascencioa
a
Centro de Investigaciones Biológicas del Noroeste (CIBNOR), Departamento de Patologı´a
Marina, La Paz, BCS, Mexico
b
University of Rhode Island, Department of Fisheries, Animal and Veterinary Science, Kingston, RI, USA
c
Universidad Autónoma de Nuevo León, Facultad de Medicina, Monterrey, NL, Mexico
d
Centro Interdisciplinario de Ciencias Marinas del IPN (CICIMAR), La Paz, BCS, Mexico
Received 11 August 2004; revised 6 October 2004; accepted 17 December 2004
Abstract
Genes encoding two major outer membrane proteins (OMPs) of the bacterial pathogen Aeromonas veronii, Omp38
and Omp48, were used to construct DNA vaccines. The protective effect of such vaccines against motile aeromonad
septicaemia was evaluated in spotted sand bass (Paralabrax maculatofasciatus), an endemic species of the Mexican
Northwest Pacific coast and a potential resource for the aquaculture industry. Weak protein expression, as determined
by immunoblotting, was observed after transfection of eukaryotic cells with the DNA vaccines. Fish immunized with
a single intramuscular injection of 20 mg of the omp38 and omp48 DNA vaccines showed slightly, but significantly
elevated serum antibody levels 4 and 6 weeks after vaccination, compared to fish vaccinated with the control plasmid
pcDNA3.1. Spotted sand bass vaccinated with the omp38 and omp48 DNA vaccines and challenged with A. veronii by
intraperitoneal route recorded a relative percent survival (RPS) between 50 and 60%. Histopathological signs of motile
aeromonad septicaemia were observed in around 40% of omp38 and omp48-vaccinated fish and 80% of pcDNA3.1vaccinated control fish. The results indicate that P. maculatofasciatus vaccinated with a single dose of DNA plasmids
* Corresponding author. Centro de Investigaciones Biológicas del Noroeste (CIBNOR), Av. Mar Bermejo 195, Col. Playa Palo
Santa Rita, P.O. Box 128, La Paz, B.C.S. 23090, Mexico. Tel.: C52 612 123 8484x3334; fax: C52 612 125 3625.
E-mail address: [email protected] (R.C. Vazquez-Juarez).
1050-4648/$ - see front matter Ó 2005 Elsevier Ltd. All rights reserved.
doi:10.1016/j.fsi.2004.12.007
154
R.C. Vazquez-Juarez et al. / Fish & Shellfish Immunology 19 (2005) 153e163
encoding the major OMPs from A. veronii shows partial protection against infection and mortality by A. veronii
experimental infection.
Ó 2005 Elsevier Ltd. All rights reserved.
Keywords: Genetic immunization; Immune response; Outer membrane proteins; Bacterial antigens; Aeromonas spp.; Paralabrax
maculatofasciatus; Spotted sand bass; Fish immunology
1. Introduction
Aeromonas veronii is a Gram-negative bacterium that has been reported as an opportunistic pathogen
involved in human gastroenteritis and extraintestinal infections [1]; and together with Aeromonas
hydrophila is the causative agent of bacterial hemorrhagic septicaemia (motile aeromonad septicaemia) of
numerous cultured fish species [2,3].
The spotted sand bass (Paralabrax maculatofasciatus) is an endemic fish of the Northwest Pacific coast
of Mexico and is considered a candidate species for the aquaculture industry. As occurs for other
economically important cultured fish species, bacterial diseases mainly caused by Vibrio spp. and
Aeromonas spp. (including A. veronii and A. hydrophila) are a major problem in spotted sand bass farming
[3]. Although several studies have shown that different vaccine formulations including subunit, whole killed
and live attenuated vaccines may provide protection against A. veronii or A. hydrophila infections [4e7],
there are currently no vaccines commercially available against these important pathogens. Although
attenuated live vaccines stimulate an effective immune response, these vaccines may represent a risk of
residual and reverted virulence. On the other hand, while inactivated vaccines are safer, they are usually
poorer immunogens. Consequently, current vaccine research is oriented to replace conventional vaccines
with new more effective and safe approaches, such as DNA vaccines [8,9].
Starting with the article by Anderson et al. [10], several other reports have demonstrated the effectiveness
of DNA vaccination in fish against viral infections, including infectious hematopoietic necrosis virus
(IHNV) and viral hemorrhagic septicaemia virus (VHS) [11,12]. Little is known, however, about the
feasibility of DNA vaccination against bacterial pathogens in fish.
Outer membrane proteins (OMPs) are highly immunogenic bacterial components due to their exposed
epitopes on the cell surface. OMPs from Aeromonas spp. have been identified as suitable targets for vaccine
development in fish [5,6,13e15]. We have recently cloned and characterized the genes encoding the Omp38
and Omp48 proteins, which are the major OMPs from A. veronii [16]. In addition, our preliminary studies
indicate that these proteins seem to be involved in bacterial adhesion to cultured epithelial cells, which
make them suitable candidates for vaccine development [16,17].
Herein, we report the construction of DNA vaccines using omp38 and omp48 genes and its evaluation in
eliciting immune response and protection in spotted sand bass against A. veronii experimental infections.
2. Materials and methods
2.1. Bacterial strains and growth conditions
The A. veronii biotype veronii strain A186 used in the present study was obtained from the Microbial
Culture Collection of the Hospital of the University of Lund, Sweden, and was kindly provided by Prof. T.
Wadström. It was identified by its fatty acid profile (Sherlock System) at Auburn University, AL, USA
(Bacterial Strain Identification and Mutant Analysis Service). Escherichia coli DH5a (Stratagene, La Jolla,
R.C. Vazquez-Juarez et al. / Fish & Shellfish Immunology 19 (2005) 153e163
155
CA, USA) was used as a host for DNA manipulations. E. coli and A. veronii strains were grown at 37 (C in
Luria-Bertani (LB) medium supplemented with ampicillin (100 mg mlÿ1) when needed [18].
2.2. Construction and preparation of DNA vaccines
The genes coding for Omp38 and Omp48 were amplified from A. veronii A186 genomic DNA by the
polymerase chain reaction (PCR) with different sets of specific primers (Table 1) and cloned into the
eukaryotic expression vector pcDNA3.1 (Invitrogen, Frederick, MD, USA). This vector carries the human
cytomegalovirus (CMV) immediate early promoter, the bovine growth hormone (BGH) polyadenylation
signal for transcription termination, the ampicillin resistance gene and the ColE1 origin of replication for
maintenance in E. coli. The forward primers contained a BamHI restriction site, and a Kozak sequence
(CCACC) just before the start codon to ensure proper translation of prokaryotic genes in eukaryotic cells.
The reverse primers contained the C-terminal sequence of Omp38 and Omp48 including the translation
stop codon (Table 1). Appropriate primer pair combinations were used to amplify the coding sequence for
the primary (including the amino acid leader sequences) and mature forms of Omp38 and Omp48 proteins.
PCR reactions were performed with Pwo DNA polymerase (Roche, Indianapolis, IN, USA) and PCR
products were cloned into pGEM-T easy vector (Promega, Madison, WI, USA) according to the
manufacturer’s protocol. The genes were excised from the pGEM-T vectors by BamHI-NotI (omp38 gene)
or BamHI-EcoRI (omp48 gene) digestion, inserted into pcDNA3.1(C) and transformed into E. coli DH5a
(Fig. 1). Recombinant clones were selected by ampicillin resistance and confirmed by restriction analysis of
plasmids and DNA sequencing. Plasmids were named as follows: pOMP38P (primary Omp38), pOMP38M
(mature Omp38), pOMP48P (primary Omp48), and pOMP48M (mature Omp48) (Fig. 1). Plasmids were
purified with the EndoFree Plasmid Mega purification kit (Qiagen, Valencia, CA, USA) according to the
manufacturer’s instructions, aliquoted at 1 mg mlÿ1 in sterile endotoxin-free phosphate-buffered saline (PBS,
137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 2 mM KH2PO4, pH 7.4), and stored at ÿ20 (C until
further use.
2.3. In vitro expression of Omp38 and Omp48 in eukaryotic cells
The ability of the plasmids to express the Omp38 and Omp48 proteins in vitro was assessed in
transfected HeLa cells. The HeLa cells were grown to confluence at 37 (C (95% humidity and 5% CO2)
in 6-well culture plates in RPMI-1640 culture media supplemented with 10% fetal calf serum, 2 mM
ÿ1
L-glutamine, and gentamicin (40 mg ml ). The cells were transiently transfected with 2 mg of each plasmid
construction and pCDNA3.1 as a negative control by the cationic lipid method (Lipofectamine 2000,
Invitrogen). Simultaneously, the cells were co-transfected with the reporter plasmid pCMV-SPORT-bgal
Table 1
PCR primers used for amplification of omp38 and omp48 genes
Primer
Sequencea
38F1
38F2
38R
48F1
48F2
48R
GGATCCACCATGAAAAAGACAATTCTGGCTATTGC
GGATCCACCATGGCTGTCGTTTACGACAAAGACGG
TTAGAAGTTGTATTGCAGGGCAAC
GGATCCACCATGAAAATGAAAGCAAAGTGGCTCCC
GGATCCACCATGGTTGATTTCCACGGCTACATGCG
TTACCACCAAGCTTCCGCTTG
Sequences were taken from accession numbers AF538866 [16] and AF538867.
a
BamHI site and start codon are indicated in boldface and the Kozak sequence is italicised.
156
R.C. Vazquez-Juarez et al. / Fish & Shellfish Immunology 19 (2005) 153e163
B
E
N
CMV
B
lp
B
(a)
B
lp
B
N
omp38P
omp38M
N
pcDNA3.1(+)
E
omp48P
omp48M
BGH pA
(b)
5.4 kb
E
Ampr
ColE1
B
pOMP38P
CMV
pOMP38M
CMV
pOMP48P
CMV
pOMP48M
CMV
N
lp
B
(c)
BGH pA
omp38P
N
BGH pA
omp38M
E
B
lp
omp48P
BGH pA
E
B
omp48M
BGH pA
Fig. 1. Schematic diagram for the construction of plasmids for DNA immunization. (a) The synthetic genes encoding for the primary
and mature Omp38 and Omp48 proteins were amplified by PCR and cloned in the vector pGEM-T. (b) The genes were inserted in
pcDNA3.1, which carries the human cytomegalovirus immediate early promoter (CMV); the bovine growth hormone polyadenylation
signal for transcription termination (BGH pA); the ampicillin resistance gene (Ampr); and the origin of replication for maintenance in
E. coli (ColE1). (c) The resulting plasmids contained the omp38 and omp48 genes, under the regulatory sequences of pcDNA3.1.
Abbreviations: lp: leader peptide, B: BamHI, N: NotI, E: EcoRI.
(Gibco BRL Life technologies, Frederick, MD, USA) as transfection efficiency control and to normalize
the protein expression data. b-Galactosidase activity was determined using chorophenol red-b-Dgalactopyranoside (CPRG, Roche) as substrate as previously described [19]. Protein expression was
assessed in HeLa cell lysates and supernatants from cultures, 48 h post-transfection, by Western blot as
described elsewhere [20], using rabbit polyclonal anti-Omp38 and anti-Omp48 antiserum. Slot blot was also
performed with the Bio-Dot SF microfiltration apparatus to concentrate the proteins on the membranes
(Bio-Rad, Hercules, CA, USA). Optical density of the blots was measured using the software Scion Image
(http://www.scioncorp.com). Protein expression data were expressed as relative optical units, consisting of
the ratio of the density of the blots to the b-galactosidase activity.
2.4. Fish
Spotted sand bass (P. maculatofasciatus) with an average weight of 10 g were held in 500 L tanks supplied
with running sand-filtered and UV-treated seawater at 24 (C, salinity 37 ppm, pH 8.2 and 7.25 mg lÿ1 of
R.C. Vazquez-Juarez et al. / Fish & Shellfish Immunology 19 (2005) 153e163
157
dissolved oxygen. The fish were daily fed ad libitum with 2e4 mm dry pelleted diet (56% protein, 22% lipid,
9% carbohydrate and 13% ash) during the acclimatization and the experimental periods.
2.5. Fish vaccination
Spotted sand bass were randomly divided into groups of 10 fish and vaccinated as follows: fish were
anaesthetized by immersion in a 100 mg mlÿ1 solution of tricaine methane sulfonate (MS-222) and
intramuscularly injected at the base of the dorsal fin with 20 mg of the specified DNA vaccine solution
(1 mg mlÿ1). Three replica groups of 10 fish per treatment were assessed. The treatment groups tested for
humoral immune response consisted of fish vaccinated with: (i) pOMP38P; (ii) pOMP48P; and two negative
control groups including (iii) pCDNA3.1 and (iv) sterile PBS. For evaluation of protective immunity
groups of 30 fish were assessed and an additional treatment group consisting of a mixture of pOMP38P and
pOMP48P was assayed.
2.6. Analysis of antibody response
Four and six weeks post-vaccination, five fish from each treatment group were assayed for antibody
response against Omp38 and Omp48 by enzyme-linked immunosorbent assay (ELISA). Omp38 and
Omp48 proteins were isolated and purified as described previously [16,17]. Fish were sacrificed by an
overdose of anaesthetic (MS-222, 500 mg mlÿ1) and the blood was collected directly from the heart. After
coagulation, the blood was centrifuged and the serum was collected and stored at ÿ80 (C. ELISA plates
(96-wells; Nunc MaxiSorp, San Diego, CA, USA) were coated overnight at 4(C with Omp38 and Omp48
proteins (10 mg mlÿ1) in 100-ml aliquots in carbonate buffer (15 mM Na2CO3, 35 mM NaHCO3, pH 9.6).
The plates were washed once with PBS containing 0.05% Tween 20 (PBSeTween) and then blocked with
3% bovine serum albumin (BSA) in PBS for 1 h at 22 (C. After washing with PBSeTween, serial dilutions
of the sera (1:10 and 1:100) obtained from individually vaccinated fish were added to triplicate wells of the
plates and incubated for 90 min at 37 (C. The plates were then washed twice and rabbit anti-spotted sand
bass immunoglobulins (1:2000) [21] were added to the plates and incubated for 2 h at 37 (C. After washing
three times, peroxidase-conjugated goat anti-rabbit IgG (1:2000) (Sigma Chemical Co., St. Louis, MO,
USA) was added to the wells and incubated for 2 h at 37 (C. After washing, the reaction was developed by
addition of 200 mm of o-phenylenediamine (Sigma) and 0.04% H2O2. After 30 min incubation in darkness
at 30 (C, the reaction was stopped by the addition of 5% H2SO4 and then the plates were read with
a microplate reader (Bio-Rad) at 492 nm.
2.7. Experimental A. veronii challenge and evaluation of immunoprotection
Since acute disease caused by A. veronii is strongly stress-associated in nature, it was difficult to achieve
the required level of bacterial challenge. In a preliminary assay we determined the median lethal dose
(LD50) to be approximately 5 ! 106 cfu fishÿ1. Four weeks post-vaccination fish were anaesthetized and
challenged by intraperitoneal inoculation with 50 ml of 1 ! 108 cfu mlÿ1 (5 ! 106 cfu fishÿ1) of A. veronii
cell suspension. Bacterial suspension was prepared as follows: A. veronii was grown overnight in LB broth
at 37 (C, harvested by centrifugation (1500 ! g for 20 min) and washed with PBS buffer three times.
Bacteria were suspended in PBS buffer and adjusted to an absorbance value of 1 at 540 nm, which
correspond to a cell density of approximately 108 cfu mlÿ1. To confirm the bacterial concentration, the
number of cfu mlÿ1 were counted by spreading 0.1 ml of 10-fold serial dilutions of bacterial suspension on
LB agar plates, which were incubated overnight at 37 (C. Cumulative mortality and clinical signs were
recorded daily for three weeks post-challenge and dead fish were autopsied to determine the cause of death
158
R.C. Vazquez-Juarez et al. / Fish & Shellfish Immunology 19 (2005) 153e163
and for the presence of A. veronii in the tissues by bacterial culture in McConkey agar. The relative percent
survival (RPS) was calculated according to Amend [22]:
% mortality in vaccinated
RPSZ1 ÿ
100
% mortality in control fish
At the end of the experiment, fish that survived the bacterial challenge were euthanized as mentioned
above and samples from kidney, intestine, liver, and spleen were dissected for histopathological analysis.
Vaccine efficacy was determined by comparing the RPS and the histopathological damage among
experimental treatments.
2.8. Statistical analysis
Data from protein expression and antibody response assays were statistically analysed using one-way
analysis of variance (ANOVA), and the Student’s t-test was conducted where significance was detected at
the P ! 0.05 level. Cumulative percent mortality was analysed by the G-test (P ! 0.05).
3. Results
3.1. In vitro expression of Omp38 and Omp48
The genes coding for the primary and mature forms of Omp38 and Omp48 were used to construct DNA
vaccines against A. veronii (Fig. 1). In order to test the ability of the constructed DNA vaccines to express
the various forms of Omp38 and Omp48 in a eukaryotic environment, HeLa cells were transfected with
pOMP38P, pOMP48P, pOMP38M, pOMP48M, and the negative control pcDNA3.1. After 48 h of
incubation, cell extracts and culture supernatants were analysed by Western blot and slot blot with antiOmp38 and anti-Omp48 antisera. The presence of primary and mature forms of Omp38 and Omp48 could
not be detected by Western blots (data not shown). As shown in Fig. 2, the proteins were only detected in
the cell lysates by slot blot assay. The expression level was low since high amounts of cell lysate (50 mg)
needed to be loaded and vacuum concentrated on the slots to obtain faint signals, which are not present in
the vector controls. The b-galactosidase activity measurements indicated that the transfection was effective
and homogenous among the various transfections (data not shown). Albeit Omp38 and Omp48 expression
was low, it was significant compared to the pcDNA3.1 control. The expression level of the primary form of
Omp48 was higher than the corresponding mature form. Conversely, the expression of mature form of
Omp38 was higher than the corresponding primary form (Fig. 2).
3.2. Antibody response to DNA immunization
The humoral immune response of spotted sand bass to immunization with the Omp38 and Omp48 DNA
vaccines was assessed by ELISA four and six weeks after vaccination. Fish injected intramuscularly with
pOMP38P and pOMP48P produced very low levels of anti-Omp38 and anti-Omp48 antibodies (Fig. 3).
Antibody levels against Omp38 and Omp48 were statistically significant at the serum dilution 1:10 in
vaccinated fish in relation to PBS buffer or pcDNA3.1 negative controls; however, no statistical differences
were observed between the antibody levels at dilutions of 1:100 or higher (data not shown).
159
R.C. Vazquez-Juarez et al. / Fish & Shellfish Immunology 19 (2005) 153e163
HeLa cell lysates
pcDNA3.1 pOMO38P
pOMP38M
Omp38
pcDNA3.1 pOMO48P pOMP48M
b
1.4
Relative optical units
HeLa cell lysates
1.2
1.2
b’
0.8
0.8
0.6
0.6
0.4
c’
1
c
1
Omp48
a’
0.4
a
0.2
0.2
0
0
Fig. 2. Analysis of in vitro expression of Omp38 and Omp48 from DNA constructs in transfected HeLa cells. Cell lysate proteins
(50 mg per slot) were concentrated with a slot blot apparatus and probed with the respective anti-serum. Purified Omp38 and Omp48
(1 mg per slot) and pcDNA3.1-transfected cell lysates were used as positive and negative controls, respectively (upper panels). Protein
expression data were expressed as relative optical units, consisting of the ratio of the density of the blots to the b-galactosidase activity.
Statistical differences were found between treatments with different superscripts (P ! 0.05).
3.3. Protection of spotted sand bass from A. veronii challenge
Spotted sand bass immunized with the DNA vaccines encoding for OMPs were assessed for protection
against A. veronii intraperitoneal challenge. As shown in Table 2, mortalities following exposure to the
bacteria were lower in fish vaccinated with pOMP38P or pOMP48P, compared to those of the control
1.4
b
Optical Density at 492 nm
1.2
b
b
b
PBS
pcDNA3.1
pOMP38P
1
pOMP48P
0.8
a
a
a
a
0.6
0.4
0.2
0
4 weeks
6 weeks
Time post-vaccination
Fig. 3. ELISA detection of anti-Omp38 and anti-Omp48 antibodies in serum from fish immunized with plasmid DNA vaccines and
control fish injected with PBS or plasmid control. Each column represents the mean optical density (OD) among replica groups measured
at a serum dilution of 1:10 G S.D. Statistical differences were found between treatments with different superscripts (P ! 0.05).
160
R.C. Vazquez-Juarez et al. / Fish & Shellfish Immunology 19 (2005) 153e163
Table 2
Cumulative percent mortality and relative percent survival (RPS) of vaccinated spotted sand bass, P. maculatofasciatus, following
intraperitoneal challenge with A. veronii
Fish injected with:
Cumulative percent mortalitya
(dead fish/total injected fish)
RPSb
PBS buffer
pcDNA3.1
pOMP38P
pOMP48P
pOMP38P C pOMP48P
41.4% (12/29)
43.3% (13/30)
20% (6/30)
17.2% (5/29)
16.6% (5/30)
e
e
53.8%
60.2%
61.6%
a
b
Values are cumulated percent of mortality recorded three weeks after challenge.
Relative to pcDNA3.1 control.
groups injected with PBS buffer or pcDNA3.1 alone. The pOMP38P and pOMP48P vaccines protected
fish to a similar extent, with a RPS of 53.8% and 60.2%, respectively. The mixture of pOMP38P and
pOMP48P vaccines did not elicit an enhanced protective effect with its RPS being similar to that of the
individual vaccines (Table 2). Histopathological analyses of vaccinated and non-vaccinated control fish
that survived the bacterial challenges revealed signs of tissue lesions resulting from A. veronii infection
(data not shown). Major lesions were observed in the kidney, liver and spleen, including severe necrosis
and hemorrhagic infiltration. The presence of elevated numbers of melanomacrophages was observed in
the spleen. Percentages of fish that presented the histological alterations were 80, 83, 41, 37, and 38 for
fish vaccinated with PBS buffer, pcDNA3.1, pOMP38P, pOMP48P and the mixture of vaccines,
respectively.
4. Discussion
Vaccination with OMPs has been shown to be effective against Aeromonas salmonicida and A. hydrophila
infections in fish [5,6,13e15]. However, the need for isolation and purification of the antigens prior to
vaccination makes these subunit vaccines costly. DNA vaccines offer a more economic alternative to fish
vaccination [10e12], therefore, in this study DNA immunization was employed as an alternative approach
to standard immunization protocols. In this work, we investigated the potential for genetic immunization
against motile aeromonad septicaemia using the genes encoding for two major outer membrane proteins
from A. veronii, Omp38 and Omp48.
We show here that immunization of spotted sand bass with these two DNA vaccines induced partial
protection against experimental challenge with A. veronii. The moderate success of the Omp38 and
Omp48 DNA vaccines to elicit a considerable antibody response and efficient protection could be due to:
(1) low levels of protein expression in fish tissue; or (2) low levels of antigenicity of the expressed
proteins, because of the possibility that the proteins are not expressed in the proper conformation.
Although the expression vector used to construct these DNA vaccines was able to drive the expression of
Omp38 and Omp48 in HeLa cells in culture (which can resemble the eukaryotic background of fish cells),
the levels of expression of these two prokaryotic proteins were very low in whole cell lysates. In addition,
as expected for expression vector lacking secretion signal sequence, proteins were absent in the cell
culture medium. Inclusion of the sequences coding for the native leader peptides of Omp38 and Omp48
in the constructs did not cause major differences in the levels of expression between the primary and
mature forms of the proteins. Thus, the presence or absence of the native leader peptide did not influence
the expression level of the proteins in the eukaryotic cells. Since heterologous expression of viral antigenic
proteins under the control of the CMV promoter has been achieved in fish cells [10e12], it could be
R.C. Vazquez-Juarez et al. / Fish & Shellfish Immunology 19 (2005) 153e163
161
speculated that the low protein expression obtained in this work is due to the intrinsic features of the
omp38 and omp48 genes, such as preference codon usage or mRNA stability, instead of regulatory
sequences found in the expression vector pcDNA3.1. A number of studies have demonstrated that there
is a good correlation between the codon bias of genes encoding for viral, bacterial, and parasitic antigens
and its level of expression [23e29]. The antibody titres in the serum of spotted sand bass against Omp38
and Omp48 could be considered a weak immune response since antibodies were detected only at the low
serum dilution of 1:10 at four and six weeks post-vaccination. The low antibody response in genetic
immunization has been associated with low levels of antigen expression in the host tissue. Several studies
have found that codon usage optimization has an enhancing effect on expression levels and
immunogenicity of DNA candidate vaccines [23e29].
It should be taken into consideration that a single immunization dose was applied without further
booster vaccinations. Although it has been argued that booster vaccinations may not be needed in the case
of DNA vaccines, primed-boosted vaccinations may be necessary to enhance the antigenicity of bacterial
antigens such as Omp38 and Omp48 [30,31]. It is also possible that lack of secretion of the antigens may
have influenced the magnitude of the humoral immune response. After intramuscular injection, plasmid
DNA enters the myocytes by an unknown mechanism. Once the antigen is expressed, it is released from the
myocytes either as a secreted protein or due to cell damage and/or death and then it is internalised by
antigen presenting cells [32]. Although considerable humoral immune response can be obtained against
OMP antigens that lack secretion signals [20,33], it has been recently reported that the antibody response is
dramatically increased when antigens are expressed as extracellular proteins from plasmid expression
vectors carrying the appropriate signal sequence [34e36]. Plasmid DNA vaccines tested in this work did not
carry a signal sequence to express the antigen as extracellular protein and it should be considered for further
vaccine development based on omp38 and omp48 genes.
It is noteworthy that despite the failure of the Omp38 and Omp48 DNA vaccines to induce a significant
antibody immune response, these DNA vaccines were able to confer moderate levels of protection to
experimental challenge with A. veronii, including a reduction in the number of fish with histopathological
alterations. These protection levels are similar to those obtained in Atlantic salmon (Salmo salar L.)
immunized with iron-regulated outer membrane proteins (IROMPs) [13,15], rainbow trout (Oncorhynchus
mykiss) vaccinated with a 28 kDa OMP (porin) from A. salmonicida [14], or mice genetically immunized
with the genes coding OMPs from chlamydial pathogens [33,37]. It has been stated that specific antibodies
might play a role in the prevention of bacteria from adhering and penetrating the epithelium of the fish gills,
skin and fins during the first stages of infection, and afterwards in the opsonization of the bacteria for
elimination by phagocytosis [38]. However, there are several conflicting reports regarding the correlation
between protection of fish against Aeromonas spp. infections and the level of serum specific antibody
[7,15,39e42]. The low level of antibody response elicited by the Omp38 and Omp48 DNA vaccines suggest
that cellular immunity might be involved in the protection of P. maculatofasciatus.
It should be noted that the 60% minimum mortality rate required to calculate the RPS according to
Amend [22] was not achieved in the controls, reaching only 41.4 and 43.3% with PBS and pcDNA3.1,
respectively, which could be leading to an overestimate of the RPS data. Thus, the moderate RPS values
obtained in the present study should be taken cautiously. The assessment of vaccination efficiency against
motile aeromonads in terms of protection has not been satisfactory because effective and reproducible
challenge in experimental laboratory or field trials has been a difficult task [43].
In conclusion, the results presented here demonstrate that DNA vaccination of spotted sand bass,
P. maculatofasciatus, with the major OMP-encoding genes from A. veronii, failed to induce a significant
humoral immune response but conferred partial protection against A. veronii experimental infection.
Further vaccine designs and vaccination trials should focus on improving the levels of expression and
antigenicity of these DNA vaccines. Two main factors are recommended to take into consideration: (1)
codon usage optimization of the genes for efficient translation and stability of the mRNA; and (2)
162
R.C. Vazquez-Juarez et al. / Fish & Shellfish Immunology 19 (2005) 153e163
inclusion of a strong heterologous signal sequence to enhance antigen secretion. To the best of our
knowledge this study represents the first report of fish DNA vaccination with genes encoding for
bacterial OMPs.
Acknowledgements
This work was supported by the CIBNOR fiscal project PAC-11. R.C. Vázquez-Juárez is the recipient of
a doctoral fellowship (CONACyT grant 121100). We thank to M.A. Guzman for assistance with HeLa cells
culture and G. Roldán (UABCS) for help with fish protection experiments. We also wish to thank A.G.
Torres (M&I, University of Texas Medical Branch, Galveston, TX) for reviewing the manuscript and
providing helpful ideas.
References
[1] Janda JM, Abbott SL. Evolving concepts regarding the genus Aeromonas: an expanding panorama of species, disease
presentations, and unanswered questions. Clinical Infectious Diseases 1998;27:332e44.
[2] Austin B, Adams C. Fish pathogens. In: Austin B, Altwegg M, Gosling PJ, Joseph S, editors. The genus Aeromonas. New York:
John Wiley and Sons; 1996. p. 197e243.
[3] Austin B, Austin DA. Bacterial fish pathogens: disease in farmed and wild fish. New York: Springer Verlag; 1999.
[4] Hernanz MC, Flano DC, Lopez FP, Villena CA, Anguita CJ, Cascon SA, et al. Molecular characterization of the Aeromonas
hydrophila aroA gene and potential use of an auxotrophic aroA mutant as a live attenuated vaccine. Infection and Immunity
1998;66:1813e21.
[5] Fang HM, Ling KC, Ge R, Sin M. Enhancement of protective immunity in blue gourami, Trichogaster trichopterus (Pallas),
against Aeromonas hydrophila and Vibrio anguillarum by A. hydrophila major adhesion. Journal of Fish Diseases 2000;23:137e45.
[6] Rahman MH, Kawai K. Outer membrane proteins of Aeromonas hydrophila induce protective immunity in goldfish. Fish and
Shellfish Immunology 2000;10:379e82.
[7] Chandran MR, Aruna BV, Logambal SM, Michael RD. Immunisation of Indian major carps against Aeromonas hydrophila by
intraperitoneal injection. Fish and Shellfish Immunology 2002;13:1e9.
[8] Heppell J, Davis HL. Application of DNA vaccine technology to aquaculture. Advanced Drug Delivery Reviews 2000;43:29e43.
[9] Kwang J. Fishing for vaccines. Nature Biotechnology 2000;18:1145e6.
[10] Anderson ED, Mourich DV, Fahrenkrug SC, LaPatra S, Shepherd J, Leong JA. Genetic immunization of rainbow trout
(Oncorhynchus mykiss) against infectious hematopoietic necrosis virus. Molecular Marine Biology and Biotechnology
1996;5:114e22.
[11] Lorenzen N, Lorenzen E, Einer-Jensen K, Heppell J, Wu T, Davis H. Protective immunity of VHS in rainbow trout
(Oncorhynchus mykiss, Walbaum) following DNA vaccination. Fish and Shellfish Immunology 1998;8:261e70.
[12] Corbeil S, LaPatra SE, Anderson ED, Jones J, Vincent B, Hsu YL, et al. Evaluation of the protective immunogenicity of the N, P,
M, NV and G proteins of infectious hematopoietic necrosis virus in rainbow trout Oncorhynchus mykiss using DNA vaccines.
Diseases of Aquatic Organisms 1999;39:29e36.
[13] Hirst ID, Ellis AE. Iron-regulated outer membrane proteins of Aeromonas salmonicida are important protective antigens in
Atlantic salmon against furunculosis. Fish and Shellfish Immunology 1994;4:29e45.
[14] Lutwyche P, Exner MM, Hancock RE, Trust TJ. A conserved Aeromonas salmonicida porin provides protective immunity to
rainbow trout. Infection and Immunity 1995;63:3137e42.
[15] Bricknell IR, King JA, Bowden TJ, Ellis AE. Duration of protective antibodies, and the correlation with protection in Atlantic
salmon (Salmo salar L.) following vaccination with an Aeromonas salmonicida vaccine containing iron-regulated outer membrane
proteins and secretory polysaccharide. Fish and Shellfish Immunology 1999;9:139e51.
[16] Vazquez-Juarez RC, Barrera-Saldana HA, Hernandez-Saavedra NY, Gomez-Chiarri M, Ascencio F. Molecular cloning,
sequencing and characterization of omp48, the gene encoding for an antigenic outer membrane protein from Aeromonas veronii.
Journal of Applied Microbiology 2003;94:908e18.
[17] Vázquez-Juárez RC, Romero-Geraldo MJ, Ascencio F. Adhesive properties of a LamB-like outer membrane protein and its
contribution to Aeromonas veronii adhesion. Journal of Applied Microbiology 2004;96:700e8.
[18] Sambrook J, Fristsch EF, Maniatis T. Molecular cloning: a laboratory manual. New York: Cold Spring Harbor Laboratory
Press; 1989.
R.C. Vazquez-Juarez et al. / Fish & Shellfish Immunology 19 (2005) 153e163
163
[19] Eustice DC, Feldman PA, Colberg-Poley AM, Buckery RM, Neubauer RH. A sensitive method for the detection of betagalactosidase in transfected mammalian cells. Biotechniques 1991;11:739e43.
[20] Penttila T, Vuola JM, Puurula V, Anttila M, Sarvas M, Rautonen N, et al. Immunity to Chlamydia pneumoniae induced by
vaccination with DNA vectors expressing a cytoplasmic protein (Hsp60) or outer membrane proteins (MOMP and Omp2).
Vaccine 2001;19:1256e65.
[21] Whittington RJ. Purification and partial characterisation of serum immunoglobulin of the European perch (Perca fluviatilis L.).
Fish and Shellfish Immunology 1993;3:331e43.
[22] Amend DF. Potency testing of fish vaccines. In: Anderson DP, Hennessen H, editors. Fish biologics: serodiagnostics and vaccines.
Developments in biological standardisation. Basel: Karger; 1981. p. 447e54.
[23] Andre S, Seed B, Eberle J, Schraut W, Bultmann A, Haas J. Increased immune response elicited by DNA vaccination with
a synthetic gp120 sequence with optimized codon usage. Journal of Virology 1998;72:1497e503.
[24] Uchijima M, Yoshida A, Nagata T, Koide Y. Optimization of codon usage of plasmid DNA vaccine is required for the effective
MHC class I-restricted T cell responses against an intracellular bacterium. Journal of Immunology 1998;161:5594e9.
[25] Nagata T, Uchijima M, Yoshida A, Kawashima M, Koide Y. Codon optimization effect on translational efficiency of DNA
vaccine in mammalian cells: analysis of plasmid DNA encoding a CTL epitope derived from microorganisms. Biochemical and
Biophysical Research Communications 1999;261:445e51.
[26] zur Megede J, Chen MC, Doe B, Schaefer M, Greer CE, Selby M, et al. Increased expression and immunogenicity of sequencemodified human immunodeficiency virus type 1 gag gene. Journal of Virology 2000;74:2628e35.
[27] Stratford R, Douce G, Zhang-Barber L, Fairweather N, Eskola J, Dougan G. Influence of codon usage on the immunogenicity of
a DNA vaccine against tetanus. Vaccine 2000;19:810e5.
[28] Narum DL, Kumar S, Rogers WO, Fuhrmann SR, Liang H, Oakley M, et al. Codon optimization of gene fragments encoding
Plasmodium falciparum merzoite proteins enhances DNA vaccine protein expression and immunogenicity in mice. Infection and
Immunity 2001;69:7250e3.
[29] Cid-Arregui A, Juarez V, zur Hausen H. A synthetic E7 gene of human papillomavirus type 16 that yields enhanced expression of
the protein in mammalian cells and is useful for DNA immunization studies. Journal of Virology 2003;77:4928e37.
[30] Skinner MA, Ramsay AJ, Buchan GS, Keen DL, Ranasinghe C, Slobbe L, et al. A DNA prime-live vaccine boost strategy in mice
can augment IFN-gamma responses to mycobacterial antigens but does not increase the protective efficacy of two attenuated
strains of Mycobacterium bovis against bovine tuberculosis. Immunology 2003;108:548e55.
[31] Vordermeier HM, Lowrie DB, Hewinson RG. Improved immunogenicity of DNA vaccination with mycobacterial HSP65 against
bovine tuberculosis by protein boosting. Veterinary Microbiology 2003;93:349e59.
[32] Donnelly JJ, Liu MA, Ulmer JB. Antigen presentation and DNA vaccines. American Journal of Respiratory and Critical Care
Medicine 2000;162:S190e3.
[33] Zhang DJ, Yang X, Shen C, Brunham RC. Characterization of immune responses following intramuscular DNA immunization
with the MOMP gene of Chlamydia trachomatis mouse pneumonitis strain. Immunology 1999;96:314e21.
[34] Smooker PM, Steeper KR, Drew DR, Strugnell RA, Spithill TW. Humoral responses in mice following vaccination with DNA
encoding glutathione S-transferase of Fasciola hepatica: effects of mode of vaccination and the cellular compartment of antigen
expression. Parasite Immunology 1999;21:357e64.
[35] Svanholm C, Bandholtz L, Lobell A, Wigzell H. Enhancement of antibody responses by DNA immunization using expression
vectors mediating efficient antigen secretion. Journal of Immunological Methods 1999;228:121e30.
[36] Price BM, Galloway DR, Baker NR, Gilleland LB, Staczek J, Gilleland Jr HE. Protection against Pseudomonas aeruginosa
chronic lung infection in mice by genetic immunization against outer membrane protein F (OprF) of P. aeruginosa. Infection and
Immunity 2001;69:3510e5.
[37] Zhang D, Yang X, Berry J, Shen C, McClarty G, Brunham RC. DNA vaccination with the major outer-membrane protein gene
induces acquired immunity to Chlamydia trachomatis (mouse pneumonitis) infection. Journal of Infectious Diseases
1997;176:1035e40.
[38] Yin Z, Lam TJ, Sin YM. The role of specific antiserum of catfish, Clarias gariepinus, as a defence against Aeromonas hydrophila.
Fish and Shellfish Immunology 1996;6:57e69.
[39] McCarthy DH, Amend DF, Johnson KA, Bloom JV. Aeromonas salmonicida: determination of antigen associated with protective
immunity and evaluation of an experimental bacterin. Journal of Fish Diseases 1983;6:155e74.
[40] Olivier G, Evelyn TP, Lallier R. Immunogenicity of vaccines from a virulent and avirulent strain of Aeromonas salmonicida.
Journal of Fish Diseases 1985;8:43e55.
[41] Baba T, Imamura J, Izawa K, Ikeda K. Cell-mediated protection in carp, Cyprinus carpio L., against Aeromonas hydrophila crude
lipopolysaccharide. Journal of Fish Diseases 1988;11:171e8.
[42] Palm Jr RC, Landolt ML, Busch RA. Route of vaccine administration: effects on the specific humoral response in rainbow trout
Oncorhynchus mykiss. Diseases of Aquatic Organisms 1998;33:157e66.
[43] Stevenson RMW. Vaccination against Aeromonas hydrophila. In: Ellis AE, editor. Fish vaccination. New York: Academic Press;
1988. p. 112e23.