Download Physiologia Plantarum

Copyright C Physiologia Plantarum 2002
ISSN 0031-9317
PHYSIOLOGIA PLANTARUM 115: 125–136. 2002
Printed in Denmark – all rights reserved
Expression of nitrate transporter genes in tomato colonized by an
arbuscular mycorrhizal fungus
Ulrich Hildebrandta, Elmon Schmelzerb and Hermann Bothea,*
a
Botanisches Institut, Universität zu Koeln, Gyrhofstr. 15, D-50923 Köln, Germany
Max-Planck Institut für Züchtungsforschung, Carl-von-Linné-Weg 10, D-50829 Köln, Germany
*Corresponding author, e-mail: hermann.bothe/uni-koeln.de
b
Received 25 July 2001; revised 15 November 2001
PCR amplifications using tomato DNA and degenerate
oligonucleotide primers allowed identification of a new putative nitrate transporter, termed NRT2;3. Its sequence
showed typical motifs of a high affinity nitrate transporter
of the Major Facilitator Superfamily (MFS). The formation
of its mRNA was positively controlled by nitrate, and negatively by ammonium, but not by glutamine. In situ hybridization experiments showed that this transporter was mainly
expressed in rhizodermal cells. Results from expression
studies with two other nitrate transporters, LeNRT1;1 and
LeNRT2;1, were essentially in accord with data of the
literature. In roots colonized by the arbuscular mycorrhizal
fungus Glomus intraradices Sy167, transcript formation of
NRT2;3 extended to the inner cortical cells where the
fungal structures, arbuscules and vesicles, were concentrated.
Northern analyses indicated that the expression of only
NRT2;3 among the transporters assayed was higher in
AMF colonized tomato roots than in non-colonized controls.
AMF-colonization caused a significant expression of a nitrate reductase gene of G. intraradices. The results may
mean that AMF-colonization positively affects nitrate uptake from soil and nitrate allocation to the plant partner,
probably mediated preferentially by LeNRT2;3. In addition,
part of the nitrate taken up is reduced by the fungal partner
itself and may then be transferred, when in excess, as
glutamine to the plant symbiotic partner.
Introduction
More than 80% of the higher plants are capable of forming a symbiosis with arbuscular mycorrhizal fungi
(AMF). The hyphae of the fungi exploit water and nutrients from soil particles more efficiently than the roots,
and these components are effectively transferred from
the fungi to the plant (Smith and Read 1997). This is
undoubtedly the case for phosphate nutrition (Pearson
and Jakobsen 1993), and likely happens also for Kπ,
Zn2π, Cu2π and other elements (Kothari et al. 1991). As
regard to phosphate, studies have reached the molecular
level. A specific AMF phosphate translocator was shown
to be expressed upon mycorrhizal colonization, whereas
the plant phosphate translocator counterparts were repressed (Harrison and van Buuren 1995, Liu et al. 1998).
For nitrogen, physiological data on nitrate uptake are
somewhat equivocal (Hawkins and George 1999) but determinations of the 15NO3– and 15NH4π uptake rates
indicated a significant contribution of AMF also to the
N-budget of the plants (Johansen et al. 1992, Frey and
Schuepp 1993, Tobar et al. 1994, Bago et al. 1996, Subramanian and Charest 1998). Expression studies using
Physiol. Plant. 115, 2002
gene probes specific for either fungal or maize nitrate
reductase indicated that transcript levels of the plant enzyme are lowered and those of the fungal counterpart
are enhanced upon mycorrhizal colonization (Kaldorf
et al. 1998). This was shown both by Northern analysis
and in situ hybridization experiments. The expression of
transporters catalysing the uptake of nitrate from the
soil across the plasmalemma of either plants or fungi
has not yet been investigated in the AMF symbiosis.
However, it has just been published that a putative nitrate transporter from Medicago truncatula is downregulated in roots when colonized by some, but not all
AMF (Burleigh 2001).
Nitrate uptake in plants is complex. This anion is
transferred across the plasmalemma of the root cells by a
2 Hπ/NO3– symport mechanism (Ullrich and Nowacky
1991) with the involvement of at least three kinetically
distinct transport systems (recent reviews: Crawford and
Glass 1998, Forde 2000). Two high affinity transport systems (the so-called HATSs) operate at concentrations
⬍100 mM. One of these is expressed in the absence of
125
nitrate and is therefore considered as being constitutive
(cHATS). Its activity is, however, enhanced several fold
by nitrate treatment at least in some plants. The other
high affinity system (iHATS) is strongly induced by incubating plants with nitrate and is negatively feedbackregulated by products of nitrate assimilation, in particular by ammonium and glutamine (Crawford and Glass
1998, Forde 2000). The low affinity transport system
(LATS) operates at NO3– concentrations ⬎1 mM, surprisingly displays linear NO3– uptake kinetics but is also
considered as an active Hπ-dependent system (Crawford
and Glass 1998, Forde 2000).
Recently, a flurry of reports came out on the cloning and
molecular characterization of genes encoding both high
and low affinity transporters (Crawford and Glass 1998,
Forde 2000). The nitrate transporters characterized so far
are 500–600 amino acids in length and possess two sets of
six transmembrane helices connected by a cytosolic loop.
Low affinity transporters are encoded by the NRT1 gene
family. These have been characterized in a variety of
plants including tomato in which at least two different
NRT1 genes occur. Transcript accumulation of
LeNRT1;2 was reported to be restricted to root hairs and
to be nitrate inducible whereas that of LeNRT1;1 is also
found in other root cells and is constitutively expressed
(Lauter et al. 1996). The NRT2 family of genes encodes
high affinity transporters with high sequence similarities
in plants, fungi and algae (Crawford and Glass 1998, Forde 2000) and its expression is under feedback repression
by N-metabolites resulting from nitrate reduction. The
NRT2 genes can also occur in multiple forms in organisms. In tomato (Ono et al. 2000), the two genes
LeNRT2;1 and LeNRT2;2 are highly similar in the coding
region, but have significant nucleotide differences in the
3ƒ-untranslated part. In root hairs of tomato, NRT2;1
seemingly is the predominantly expressed gene, and
mRNA formation of both genes appears to be co-ordinatively regulated (Ono et al. 2000). In barley, so far four
different NRT2 genes have been described, but it is predicted that the genome of this plant might contain at least
seven members of the NRT2 gene family (Trueman et al.
1996, Vidmar et al. 2000). The Arabidopsis genome project revealed the presence of two further NRT2 genes
(AtNRT2;3 and 2;4; Forde 2000) in addition to the already characterized two genes AtNRT2;1 and 2;2 (Filleur
et al. 1999, Zhuo et al. 1999). Thus the discovery of
further genes of both the NRT1 and NRT2 families would
not be unexpected for any plant.
In the present study, the sequences available in the
databanks were screened for conserved motifs of nitrate
transporters, which were used to develop primers suitable for the amplification of NRT segments by PCR.
This approach resulted in the identification of a new
putative high affinity nitrate transporter (LeNRT2;3)
with specific regulatory properties in its expression not
yet described for any other of the NRT gene families.
This publication mainly describes the results obtained
on the differential expression of NRT genes in AMF
colonized and control tomato plants.
126
Materials and methods
Plant and fungal material
Tomato (Lycopersicon esculentum Mill., var. Tamina GS,
Schmitz and Laux, D-Hilden, Germany) and the AMF
isolate Glomus intraradices Schenck & Smith INVAM
Sy167 were the symbiotic partners in the present study.
The greenhouse experiments were performed with surface-sterilized tomato seeds and G. intraradices inoculum
produced with Tagetes patula L. as a host plant (Kaldorf
et al. 1998). To ensure a high degree of mycorrhizal
colonization, tomato was grown under phosphate limitation. Plants were watered daily. The plants were supplied twice weekly with a 1: 1 diluted Hoagland’s nutrient solution (7.5 mM sodium nitrate, no phosphate, 30
ml per plant) and, additionally, once a month with this
solution plus 0.5 mM KH2PO4 as described in detail by
Kaldorf et al. (1998).
The degree of mycorrhizal colonization in root pieces
was determined microscopically by a modified version
of the gridline intersect method as described by Schmitz
et al. (1991).
Extraradical mycelia of G. intraradices Sy167 were isolated from pot cultures with two compartments, one for
growth of roots and mycorrhizal structures (root compartment) and the other (hyphal compartment) filled
with quartz sand (2–4 mm). Both were separated from
each other by a 30-mm nylon mesh (Hydrobios, Kiel,
Germany) penetrable only by hyphae, but not by roots.
Three months after inoculation, hyphae were harvested
from the quartz sand by differential wet-sieving with
sieves of varying pore sizes (1 mm, 0.08 mm). The mycelia retained on the 0.08 mm sieve were dried on a paper
towel for some seconds and immediately frozen in liquid
nitrogen prior to use.
Isolation of nucleic acids, Southern and Northern
analyses
Genomic DNA was isolated from tomato leaves as described by Raeder and Broda (1985) and RNA according to Nagy et al. (1988). For Southern experiments,
DNA samples were digested with different restriction enzymes at 37æC. DNA fragments (20 mg per lane) were
separated on an 0.8% agarose gel, transferred onto Biodyne B (Pall) nylon membranes using a vacuum blotting manifold (2016 VacuGeneXL Vacuum Blotting System, Pharmacia LKB) according to the manufacturer’s
protocol and fixed by UV-exposure. Hybridizations were
carried out with Digoxigenin labelled DNA-probes synthesized by incorporation of DIG-dUTP (from Roche,
D-Mannheim, Germany) by PCR. Hybridization (at
42æC, using DIG-Easy-Hyb, Roche, Germany) and filter
washing were carried out as recommended by the manufacturer (Roche). The DIG-labelled hybridized DNA
was detected immunologically by alkaline phosphatase
conjugated antibodies with CSPD or NBT/BCIP as substrate.
For Northern analyses, total RNA (20 mg laneª1) was
Physiol. Plant. 115, 2002
separated on 1.2% formaldehyde agarose gels in the
presence of ethidium bromide. Chemiluminescent and
colourimetric Northern blot analyses were carried out
at least three times with identical results in each case
using Digoxigenin-labelled riboprobes. The vectors
pCRII or pGEM-Teasy, containing the cloned PCRproducts were linearized and used as template for in vitro transcription with Sp6 or T7 RNA polymerase producing DIG-labelled antisense-RNA probes. Signal intensities were quantified with the Computer Program
NIH Image 1.62. After this hybridization with the gene
probe for one of the nitrate transporters or nitrite reductase, filters were stripped for a subsequent hybridization with an 18S-rRNA probe. This probe was obtained
by amplifying the nucleotides 1575–1783 (X51576) of the
tomato 18S-rRNA by PCR.
Synthesis of cDNA from tomato
cDNA from tomato root or shoot total RNA (2 mg per
reaction) was synthezised using the ‘SUPERSCRIPT
Preamplification System for First Strand cDNA Synthesis’ (Gibco BRL, Karlsruhe, Germany) according to
the manufacturer’s protocol. Subsequently, the obtained
cDNA was digested with RNase H (2 U per ml, Gibco
BRL) and purified using the QIAquick PCR Purification Kit (Qiagen, Hilden, Germany).
PCR protocols to amplify segments of nitrate
transporters
A PCR-based approach with a set of degenerate primers
was performed to amplify DNA segments of tomato
NRT1 and NRT2 homologues (PNT1: 5ƒ-ACGTATTTG
ACGGGAACNATGCAYYT-3ƒ and PNT2: 5ƒ-GCGCA
AA TTCCMTANCCCCAYTC-3ƒ, for members of the
NRT1-family; or PNT3: 5ƒ-TTCGTGTCGTGYCARR
AYTGGATG-3ƒ and PNT4: 5ƒ-CATGGATCCCC AYT
GNGGRAARTG-3ƒ for members of the NRT2-family).
Using tomato DNA as a template, PCR mainly yielded
amplification products of approximately 1.3 kb (PNT1/
PNT2) and 1.05 kb (PNT3/PNT4) in length applying a
‘touch-down’ method: 94æC, 4 min (94æC, 30 s; 54æC
[ª 2æC/cycle], 30 s; 72 æC, 60 s) for 7 cycles and (94æC, 30 s;
50æC, 30 s; 72æC, 60 s) for 33 cycles and 72æC, 5 min (TaqPolymerase and buffers by Promega Corp., Madison,
USA). With tomato root cDNA as a template, RACEPCR was performed to obtain the 3ƒ-UTR’s of members
of the NRT1 and NRT2-family (Frohman et al. 1988);
applying the following primers: RACE1: 5ƒ-CCACGAG
TCGACTCTAGAGCTCGGATCC TTTTTTTTTTT
TTTTTT-3ƒ; RACE2: 5ƒ-CCACGAGTCGACTCTAG3ƒ; RACE3: 5ƒ-CTCTAGAGCTCGGATCC-3ƒ as well as
the gene specific primers PNT5–7: GCGTGTACACTTCCAGTAATGTTAGT for LeNRT2;3, PNT5–6:
GGATGCACTCTTCCTGTTACATTTTG
for
Le
NRT2;2 and PNT2A: CAAAGTAACGGGGGATAAACCATG for LeNRT1;1.
For the production of specific DIG-and [35S]-labelled
Physiol. Plant. 115, 2002
riboprobes and in order to increase their specificity, the
following primers were used to produce shortened PCRproducts of the cloned segments devoid of the poly
A/T stretch of the nitrate transporter gene segments: RTHAT1B: ATGAGGAAGTGATTACAAATG
(LeNRT2;3); RTHAT2B: TTCCAGCGTATTGACAAGC (LeNRT2;2); RLEMIT1: CTTTGGAAATTGCTCATTCGA (LeNRT1;1).
The primers PL1 and PL2 (Kaldorf et al. 1998) were
used to amplify a 544-bp segment of the tomato nitrate
reductase gene whereas the primers TNIRF2 (CAGAARTGTMGNATGATGTGG)
and
TNIRR1
(TTCGGGCANCCNGTCCARTGCAT) served to amplify a 533-bp cDNA-segment of a nitrite reductase gene.
The obtained PCR-products were cloned into the vector pGEM-Teasy (Promega, Madison, USA). Their subsequent sequencing was carried out with an ABI
PRISM (Ready Reaction Dye Terminator Cycle Sequencing Kit (PE-Biosystems, Weiterstadt, Germany)
and an Applied Biosystems ABI PRISM (310 Genetic
Analyser. The NCBI (Bethesda, MD, USA) BLAST-server was used for sequence comparisons.
In situ hybridization experiments
Fixation of tomato root pieces with 1% glutaraldehyde,
embedding in Fibrowax (Plano, Twetzlar, Germany), and
sectioning of the Fibrowax embedded tissue were performed as described (Schmelzer et al. 1989). Longitudinal sections (12 mm) were adhered to poly -lysine coated
microscope slides. The sections were treated with pronase
and fixed with 1% glutaraldehyde. For the in situ hybridization experiments, sections were treated exactly as previously described (Kaldorf et al. 1998). The vectors
pCRII or pGEM-Teasy, containing the cloned PCRproducts, were linearized and used as templates for in vitro transcription with Sp6 or T7 RNA polymerase producing 35S-labelled sense and antisense-RNA probes. Signals were detected by microautoradiography (Schmelzer
et al. 1988) and quantified by the image analysis program
Image-ProR-Plus 4.1 (Media Cybernetics, Silver Spring,
MD, USA). Each in situ hybridization experiment was
performed at least three times with identical results.
Determination of nitrate reductase activity
NADH and NADPH-dependent NR activity of crude
extracts from leaves and roots of tomato and of the
extraradical mycelium of G. intraradices was measured
as described by Lohaus et al. (1998) and Kaldorf et al.
(1998).
Results
Identification of a new high affinity transporter,
LeNRT2;3, from tomato
The sequences deposited into the databanks allowed to
develop primers for NRT1, NRT2, and nitrite reductase
127
(NII). For nitrate reductase (NIA gene), primers were
available from the previous study (Kaldorf et al. 1998).
Using the primers PNT1 and PNT2 (see Materials and
methods) for the low affinity transporter NRT1 and genomic DNA as template, one PCR product of the right
size and composition was obtained in the case of Arabidopsis, whereas several products were detected for tomato DNA (Hildebrandt 2001). To differentiate NRT1
gene PCR-products from artifacts in tomato, a digoxigenin-labelled segment located internally in the one Arabidopsis PCR-product (nucleotides 441–739, L10357)
was synthesized and used to detect a NRT1 gene segment from tomato by heterologous probing. Cloning
and sequencing verified its identity as NRT1 gene segment from tomato. In the case of NRT2 gene segments,
the primers PNT3 and PNT4 provided several PCRproducts of similar size (1.0–1.1 kb) with genomic DNA
from Arabidopsis, tomato or Nicotiana plumbaginifolia
as template. After extraction from the gels, cloning and
sequencing, two different clones (termed T1–6 and T1–
7) were identified in the case of tomato (for the other
plants, see Hildebrandt 2001). Partial sequencing of
these clones revealed an identity of only 85% among
them in this DNA area. The clone T1–6 was 99% identical (674 bp determined) whereas T1–7 showed 85%
identity (in 396 bp) to both LeNRT2;1 and LeNRT2;2
sequences of the databanks. To obtain more specific
probes for differentiating among them, the untranslated,
less conserved 3ƒ-terminal region was employed for getting PCR-products by the RACE-technique (Frohman
et al. 1988) with the use of specific primers (for their
composition see Materials and methods). This approach
provided a 470-bp segment of LeNRT1;1, a 374-bp PCR
product of LeNRT2;2 and a further one, with 431 bp,
of a gene termed LeNRT2;3 with distinct sequence dissimilarities. In the case of the latter two, the sequence
identities in the putatively transcribed region were only
77% on the DNA and 86% on the amino acid level suggesting that a new gene had been found with LeNRT2;3.
To demonstrate that these clones were indeed from tomato, genomic DNA from this plant was used for Southern blot analysis with probes of the 374 bp PCR product
of LeNRT2;2 and of the 431 bp of LeNRT2;3. Indeed,
two completely different hybridization patterns were obtained (Fig. 1).
To verify that LeNRT2;3 was, in fact, a new nitrate
transporter homologue, a cDNA clone with the complete coding sequence, obtained by PCR, revealed the
following structure: The length was 1646 bp with an
ORF of 531 amino acids and with 12 putative transmembrane helices, including a distinct connecting cytosolic loop between domains 6 and 7. The hydropathy
plot (data not shown) closely resembled that of
GmNRT2 (Amarasinghe et al. 1998). The sequence
identity, on the amino acid level, was 89% to LeNRT2;1,
88% to LeNRT2;2 and at least 72% to the nitrate transporters from other plants GmNRT2, AtNRT2;1,
AtNRT2;2, OsNRT2. The motifs AGWGNMG typical
for nitrate transporters (Trueman et al. 1996) and
128
GAICDMLGPR, specific to members of MFS (Forde
2000) were present; and the conserved protein kinase C
recognition motifs were exactly as described in Forde
(2000). The sequence is available under the accession
number AY038800.
The expression of the different transporters in tomato
tissues
For the hybridization experiments, digoxigenin labelled
probes were generated for NRT1;1 (432 bp), NRT2;2
(374 bp), NRT2;3 (431 bp), nitrate reductase (NIA, 544
bp) and nitrite reductase (NII, 533 bp) by PCR. In
Southern experiments using the PCR products, signal
intensities were at least 103 weaker in heterologous hybridization with any combination of the three transporters NRT1;1, NRT2;2 or NRT2;3 than in homologous probing (Hildebrandt 2001). Northern experiments showed that the gene expression of these three
transporters as well as of NIA and NII underwent diurnal fluctuations (Hildebrandt 2001) as known from data
of others (Forde 2000, Ono et al. 2000). In roots, NIA
expression was maximal at 3 pm and that of NII at 6
pm. The expression of LeNRT1;1 was highest in the
morning until 3 pm and declined in the evening, whereas
Northern blot intensities were still high in the evening in
the case of NRT2;3. To have standardized material, 12to 14-week-old plants were incubated for 5 days with the
different N-sources prior to harvest between 5 and 7 pm,
and stored in the deep-freezer until the isolation of
RNA.
In Northern experiments with total RNA isolated
from roots of this material (Fig. 2), formation of
NRT1;1, NRT2;2 and NRT2;3 and, as a control, of NII
transcripts, were positively regulated by nitrate but negatively regulated by ammonium in this case, except for
NRT1;1. Incubation with both nitrate and ammonium
resulted in expression levels being intermediate of the
application with nitrate or ammonium alone. Glutamine
depressed the transcript levels of NII, NRT1;1 and
NRT2;2, but remarkably not of NRT2;3 (Fig. 2, lane 2).
This lane indicates that glutamine even appeared to induce its level. The Northern hybridization data of Fig.
2 were reproducibly observed in different experiments
using two independent plant batches. In the same root
material, nitrate reductase activity, determined by the
formation of nitrite from nitrate, was highest in nitrate
incubated roots (about 1 mmol hª1 gª1 FW). This rate
was only 1/4 as high in glutamine- and 1/10 in ammonium-incubated roots (Hildebrandt 2001).
In roots, intensive hybridization bands were detectable
in the case of the new high affinity transporter NRT2;3
and weaker ones with NRT2;2, whereas no signals were
obtained with RNA from leaves. In contrast, bands for
NRT1;1 were seen in roots and leaves, albeit with lower
signal intensities in leaves than in roots. To verify this
by a more sensitive approach, total RNA was isolated
from roots, flowers, leaves and young fruits of tomato
and translated to cDNA using the primer RACE1. The
Physiol. Plant. 115, 2002
Fig. 1. Genomic Southern blot analysis of
tomato nitrate transporter genes
LeNRT2;2 and LeNRT2;3. Tomato
genomic DNA (20 mg laneª1) was
digested (6 h, 37æC) with EcoRI (lane 1),
EcoRV (lane 2) and HindIII (lane 3),
fractionated on a 0.8% agarose gel and
transferred onto a nylon membrane. Blot
A was probed with a partial LeNRT2;3
cDNA clone (431 bp) and blot B with a
374-bp LeNRT2;2 cDNA clone. Blot B
showed a very similar pattern as
described for LeNRT2;2 (Ono et al. 2000).
RT-PCR experiments confirmed that NRT1;1 was expressed in all parts of the plant. This approach also confirmed that NRT2;1 was not expressed in any of the aerial parts of the plants, even when nested PCR was employed. For NRT2;3, a weak signal was detectable,
however, only in the case of young fruits in this nested
PCR experiment (not shown, but see Hildebrandt 2001).
Antisense and sense probes of NRT1;1 and NRT2;3
were developed to analyse mRNA transcript formation
in young tomato roots by in situ hybridization experiments. In order to get high expression levels of the nitrate transporters, 12-week-old tomato plants were kept
in N-deficient medium for 1 week and then incubated in
Hoagland solution supplemented with 7.5 mM nitrate
for 6 h. The differences in the labelling on the microscopic slides obtained with the antisense and sense probe
indicated that the transcript level of NRT1;1 was high
in all young root cells close to the tip, including rhizodermal and inner cells, but was restricted to the inner cortical cells in root segments at the hair zone (Fig. 3I).
Transcript formation of NRT2;3 was also high in all
cells close to the root tip. In more differentiated root
tissue, next to the root hair zone, silver grain deposition
due to NRT2;3 expression was confined to rhizodermal
Fig. 2. The formation of tomato root
mRNA of nitrate transporters and nitrite
reductase in dependence of the N-source
in the medium. Twelve-week-old tomato
plants were incubated with 1: 1 diluted
Hoagland nutrient solution, pH 6.0,
supplemented with the different N-sources
for 6 days. Lane 1; no extra nitrogen,
only 0.042 mM from (NH4)6Mo7O27. H2O,
lane 2: plus 7.5 mM glutamine, lane 3:
3.75 mM nitrate and 3.75 mM glutamine,
lane 4: 7.5 mM ammonium, lane 5: 3.75
mM ammonium and 3.75 mM nitrate and
lane 6: 7.5 mM nitrate. For these
Northern blots, root total RNA (20 mg
laneª1, isolated from three plants per
lane) was hybridized to probes for
LeNRT1;1, LeNRT2;2, LeNRT2;3 and
tomato NII (Ω nitrite reductase). Details
are described in Materials and methods.
Physiol. Plant. 115, 2002
129
cells (Fig. 3II). The preparation method did not preserve
root hairs, therefore any expression could not be studied
there. Since hybridization with the sense probe as control gave high background labelling in all cells, silver
grains in the antisense and sense probed samples were
counted in 100 mm2 areas using a computer imaging program (Table 1A). The data obtained from these quantifications confirmed within the statistic significance the
conclusions just drawn from the visual inspections of the
in situ hybridizations on the microscopic slides.
Comparison of the expression of nitrate transporters in
AM colonized and control plants
For these experiments, 14-week-old plants were used
with a degree of mycorrhizal colonization of 78 ∫ 3%
and contents of arbuscules of 45 ∫ 8%, vesicles of 67 ∫
5% and intraradical hyphae of 77 ∫ 3%. Control plants
had at best 4% of all these structures and were therefore
considered as non-mycorrhizal. Plants had about the
same developmental stage (beginning of the formation
of red berries in the lowest inflorescence), but flowers
had developed 1 week earlier in AMF plants than in
the controls. The day before harvest the plants had been
supplemented with 30 ml of a 1 : 1 water-diluted Hoagland solution. For NRT1;1, no distinct signals were obtained in mycorrhizal roots and non-mycorrhizal controls in the in situ hybridization experiments under these
conditions. Completely different results were obtained
for NRT2;3. In mycorrhizal roots, transcripts of
NRT2;3 were clearly detectable in the inner cortical cells
in tissues close to the root hair zone (Fig. 4A) whereas
Fig. 3. The distribution of LeNRT1;1 and LeNRT2;3 mRNA in tomato root tissue. LeNRT1;1 mRNA accumulates in epidermal cells of
young roots and in cortical cells of older root tissues whereas LeNRT2;3 mRNA was detectable only in the cells of the rhizodermis as shown
by in situ hybridization. Twelve-week-old non-mycorrhizal tomato plants were grown for 1 week in a N-deficient nutrient solution. Six hours
before harvest the plants were transferred into a 7.5-mM NO3–-containing nutrient solution. The bright band seen in B is due to artificial
folding of the tissue. (I) In situ hybridization of antisense (A and C) and sense (B and D) LeNRT1;1 probe to longitudinal sections of
tomato root tissues close to the root tip (A and B) and to regions close to the side root formation zone (C and D). (II) In situ hybridization
of antisense (E and G) and sense (F and H) LeNRT2;3 probe to longitudinal sections of tomato root tissues close to the root tip (E and F)
and to regions close to the side root formation zone (G and H).
130
Physiol. Plant. 115, 2002
Table 1. Quantification of the signals of the in situ hybridization in root cortical and rhizodermal cells with the probes for LeNRT1;1 (low
affinity transporter) and LeNRT2;3 (high affinity transporter). For each value, the number of silver grains was counted in an area of 100
mm2 (n Ω 10, standard deviations given). For 12-week-old plants, counts for both NRT1;1 and NRT2;3 were done in the rhizodermis and
inner cortex of the differentiating zone close to the root tip and at the height of the root hair zone in non-mycorrhizal plants. For 14-weekold plants, silver grain depositions due to NRT2;3 were determined at the height of the root hair zone in both mycorrhizal and nonmycorrhizal plants.
Antisense probe
Rhizodermis
Sense probe
Cortex
Background
Rhizodermis
Cortex
Background
12-week-old plants
NRT 1;1
Differentiating zone
Root hair zone
75 ∫ 26
10 ∫ 3
8 ∫4
50 ∫ 14
8 ∫4
3 ∫2
15 ∫ 6
8 ∫5
15 ∫ 11
10 ∫ 5
2 ∫1
3 ∫2
NRT2;3
Differentiating zone
Root hair zone
43 ∫ 18
49 ∫ 5
9 ∫5
7 ∫4
2 ∫2
4 ∫1
5 ∫4
4 ∫2
7 ∫6
8 ∫2
2 ∫1
4 ∫2
63 ∫ 36
10 ∫ 3
35 ∫ 14
30 ∫ 6
32 ∫ 14
18 ∫ 4
23 ∫ 9
16 ∫ 3
11 ∫ 2
20 ∫ 4
14-week-old plants, root hair zone
NRT2;3
Mycorrhizal
120 ∫ 25
Nonmycorrhizal
111 ∫ 32
Fig. 4. Comparison of the mRNA transcript distribution of
LeNRT2;3 in mycorrhizal and non-mycorrhizal tomato. (I) In situ
hybridization of antisense (A and C) and sense (B and D) probe of
LeNRT2;3 to longitudinal sections of mycorrhizal (A and B) and
non-mycorrhizal root tissues (C and D) at the root hair zone. (II)
In situ hybridization of LeNRT2;3 antisense (A) and sense (B)
probe to longitudinal sections of non-mycorrhizal tissue at the root
tip.
Physiol. Plant. 115, 2002
131
only background signals were obtained in roots of control plants (Fig. 4B). In AMF colonized roots, fungal
structures (arbuscules, vesicles) were also seen in this
area but without any specific enrichment of the silver
grain distribution in their vicinity. The signal density was
also high in the outer cortical and in the rhizodermal
cells. These statements are corroborated by the statistical evaluation of the computer counts (Table 1B). A 3to 4-fold higher intensity of silver grain deposition was
detectable in the cortical cells of mycorrhizal roots than
in those of the control plants. In situ hybridization experiments performed with sections of aerial parts
(leaves, stems, flowers, young fruits) of AMF colonized
and control plants did not provide specific silver grain
depositions for both NRT2;3 and NRT2;1 (not documented).
Northern analyses were an alternative to reveal any
difference in the mRNA formations of nitrate transporters in AMF and control plants. Hybridization signal intensities obtained with isolated RNA and the antisense probes for NRT1;1 and NRT2;2 were essentially
the same in both root materials (Fig. 5). However, distinct differences were found both in the visible appearance and in the densitometrical determination in the
case of NRT2;3 (Fig. 5).
This difference in the Northern experiments was particularly impressive when three different RNA concen-
trations were blotted (Fig. 6). The signal intensity almost
linearly increased with the amount of RNA blotted.
More noteworthy, NRT2;3 transcript amounts in AMF
roots were almost 2-fold higher than in non-colonized
controls (Fig. 6).
The expression of nitrate and nitrite reductase genes in
AMF colonized tomato
RNA samples from 14-week-old mycorrhizal tomato
roots (⬎ 80% mycorrhizal colonization) and controls (⬍
2% colonization) were hybridized with the digoxigeninlabelled probes for either nitrate or nitrite reductases in
Northern blot experiments. Statistically significant differences were not detected for mRNA formation in roots or
shoots in three different experiments analysing in total 12
mycorrhizal and 12 control plants (Hildebrandt 2001). In
contrast, significant differences were seen in the Northern
blots with the Glomus riboprobe for nitrate reductase
(Fig. 7). The signal intensity with RNA from AMF colonized roots was approximately five times higher than that
in the controls. The finding that low intensity signals were
detected in the hybridizations of RNA from non-mycorrhizal plants with the Glomus probe probably reflects the
lack of absolute specificity of the probe. When the Glomus
NIA probe was hybridized with the tomato NIA probe in
control experiments, a low level of cross-hybridization
Fig. 5. Northern blot analysis of nitrate
transporter genes (LeNRT1;1, LeNRT2;2
and LeNRT2;3) in mycorrhizal and nonmycorrhizal tomato roots. Total RNA was
isolated from 14-week-old tomato plants
and hybridized with the digoxigeninlabelled probes of the nitrate transporters
(Fig. 5A). Subsequently, the filters were
stripped and hybridized to a 18S-rRNA
riboprobe for control of equal loading.
Signal intensities were quantified
densitometrically. In Fig. 5B the signal
intensities obtained with RNA from nonmycorrhizal roots were arbitrarily set to 10
in each case, which allows a direct
comparison with the values obtained for
mycorrhizal samples. NM Ω nonmycorrhizal sample, M Ω mycorrhizal
samples, Wi Ω non-mycorrhizal plants
incubated with 7.5 mM nitrate for 6 h prior
to the isolation of the mRNA from the
roots.
132
Physiol. Plant. 115, 2002
Fig. 6. Northern blot analysis of the
specific nitrate transporter, LeNRT2;3, in
dependence of the amount of RNA
blotted. (A) amount of RNA loaded, (B)
Signal intensity obtained by hybridizing
with digoxigenin labelled LeNRT2;3
probe, (C) Densitometric quantification of
the signal.
was detectable (⬍ 5% signal intensity compared to that in
homologous hybridization).
The formation of nitrite from nitrate catalysed by nitrate reductase was determined in crude extracts from
roots and leaves (Table 2). The activity was both NADPHand NADH-dependent with no large differences in the effectiveness of both donors. The slightly higher activity in
AMF plants may be due to the enzyme contribution by
the fungal partner. Table 2 also indicates that the enzyme
was measurable in extraradical hyphae, which had been
grown separated from the roots in the compartment system (George et al. 1992). The RFLP-analysis of DNA
from spores isolated from the root-free compartment as
described in Hildebrandt et al. 2001, verified that the tomato plants had indeed been grown with Glomus intraradices Sy167 and not with any cross-contaminant.
Discussion
The present investigation confirmed that the nitrate
transporter composition of plants can be complex
(Crawford and Glass 1998, Forde 2000). For tomato, the
two described low affinity transporters NRT1;1 and
NRT1;2 (Lauter et al. 1996) and one (NRT2 : 2) of the
two closely related high affinity transporters (Ono et al.
2000) were also detected in the present, PCR-based assay. The gene LeNTR2;3 was not yet described and likely
encodes a high affinity transporter. It possesses the
structure of the Major Facilitator Superfamily (MFS)
and also the typical signature motifs of the high affinity
Fig. 7. Northern blot analysis of Glomus intraradices Sy167 nitrate
reductase mRNA levels in mycorrhizal and non-mycorrhizal tomato Fourteen week old plants were used and a pool of 20 mg total
root RNA from 3 plants laneª1 were blotted. After stripping, the
filters were hybridized with a probe for 18S-rRNA as a control for
equal loading. The data below the figure represent mean values and
standard deviations from the two different lanes.
Physiol. Plant. 115, 2002
nitrate transporters within this superfamily (Trueman
et al. 1996). In the dendrogram (Fig. 8), it clusters in between the characterized high affinity nitrate transporters
of Glycine max (Amarasinghe et al. 1998) and Nicotiana
plumbaginifolia (Krapp et al. 1998).
As stated for all nitrate transporters (Forde 2000), the
tree of sequence relationship does not give hints on the
substrate specificity of an uncharacterized member. The
expression of NRT2;3 is controlled by nitrate. This is a
special feature of nitrate transporters since others, like
the sulphate or phosphate transporters, are not induced
by their substrates but are only de-repressed by their deficiency (Forde 2000). The expression of LeNRT2;3 is
negatively controlled by ammonium but, remarkably,
not by glutamine. All other nitrate transporters from
any plant described so far are controlled by the availability of glutamine. The detection of a new high affinity
transporter, NRT2;3, is not unexpected, since about
70% of the PCR subclones obtained from a root cDNA
library of mature tomato could be identified as
LeNRT2;2, whereas LeNRT2;1 appeared to be almost
exclusively confined to root hairs (Ono et al. 2000).
The in situ hybridization experiments in roots often
suffer from a large background level of the silver grain
depositions. In the present study, depositions were too
massive close to the root tip (calyptra) as to detect specific differences there. In slightly older root tissues, the
data obtained in general matched with results of in situ
hybridization experiments published for other plants so
far. The NRT1;1 probe of tomato is closely related to
Arabidopsis NRT1;1 (Ω CHL1, Huang et al. 1996)
which was found to be expressed in the rhizodermal cells
in young root tissue, and only in the cortex and endodermis more distant from the tip (Huang et al. 1996). In
line with this, LeNRT1;1 transcripts were also detected
in the cortical cells in more differentiated root tissue in
the present study. Rhizodermal cells, however, did not
show a specific enrichment in older tissue in the present
study. In contrast, NRT1;2 of Arabidopsis (Huang et al.
1999) and its homologue from rice OsNRT1 (Lin et al.
2000) remained confined to the rhizodermis. With respect to the high affinity transporters, in situ hybridization experiments have only been performed with
NRT2;1 from Nicotiana plumbaginifolia (Krapp et al.
1998) which resides in all layers of the root tip and is
133
Table 2. Specific activities of nitrate reductase in AMF colonized and control plants of tomato. The data are given in mmol gª1 FW hª1.
Means ∫ are given for 16 independent measurements for the plant material. For the experiments with the extraradical hyphae was n Ω 6.
Source of plant and fungal material
Specific activity
NADH-dependent
Leaves, mycorrhizal plants
Leaves, control plants
Roots, mycorrhizal plants
Roots, control plants
Extraradical hyphae of Glomus intraradices Sy167
1.95
1.68
0.49
0.32
1.13
restricted to the lateral root primordia and rhizodermis
in older roots which was also seen for the new tomato
NRT2;3 in the present study. Most interestingly, the expression of LeNRT2;3 extended to the inner cortical
cells when the roots were colonized by AMF structures.
A similar pattern was described for a hexose transporter
in AMF colonized and control plants of Medicago truncatula (Harrison 1996). For a phosphate transporter
(LePT1), a specific enrichment was detected even in the
arbuscule containing cells (Rosewarne et al. 1999). The
∫ 0.11
∫ 0.09
∫ 0.10
∫ 0.11
∫ 0.16
Specific activity
NADPH-dependent
1.89
1.47
0.33
0.23
1.16
∫ 0.14
∫ 0.13
∫ 0.08
∫ 0.08
∫ 0.20
methods employed in the present study did not permit
such a fine resolution within the tissue structures. However, they allowed to conclude that AMF colonization
caused an increase in the transcripts of different translocators in the interior of the root parenchyma but never
beyond the endodermis into the stele. The data from the
situ hybridization experiments with LeNRT2;3 are in
line with the results from Northern hybridizations which
also show an enrichment of its transcripts in AMF tomato but not in control plants.
Fig. 8. Phylogenetic tree of amino acid
sequences of different high affinity nitrate
transporters with the position of the new
LeNRT2;3. The phylogram was
constructed using  4.0b6 (Swofford
1999) applying the mean character distance
matrix and the neighbour joining tree
construction method. The bar beneath
the tree represents distance between amino
acid sequences indicating the number of
substitution events. Accession numbers of
the used sequences are given in brackets.
134
Physiol. Plant. 115, 2002
In contrast to the previous results obtained with AMF
colonized maize (Kaldorf et al. 1998), plant nitrate reductase transcripts and activities were not significantly
reduced by the AMF colonization in the tomato roots
currently assayed. This may be a plant specific trait and/
or may also be variable with the plant/AMF growth
state. Consistently with the previous data obtained with
maize (Kaldorf et al. 1998), fungal nitrate reductase
transcripts were synthesized in significant amounts in
AMF colonized tomato roots. This might reflect the fact
that the fungal partner takes over a major portion of
nitrate reduction with the colonization of the roots.
Such a statement can also be reconciled with the findings
that the transcript levels of a plant specific nitrate transporter, LeNRT2;3, were higher in AM colonized roots
than in controls. Assuming that enzyme synthesis parallels transcript formation, the results may reflect that the
total nitrate acquisition is drastically improved by the
AMF colonization under the experimental conditions
employed. Both symbiotic partners may benefit from the
improved nitrate reduction. The observation that
NRT2;3 transcripts are not repressed by glutamine may
fit in this context. We venture to speculate from all these
findings that the fungal partner transfers the excess of
nitrate and glutamine not needed for its own growth to
the plant partner.
In the present investigation, the expression of the
fungal counterparts of the nitrate transporters could not
be studied. Despite of many attempts, the fungal transporters were not found by either heterologous probing
or by PCR amplifications of the fungal DNA using degenerate oligonucleotide primers. PCR amplifications
were successful with fungal nitrate reductase (Kaldorf
et al. 1998) which was, however, the only case. The sequence comparisons (Kaldorf et al. 1994) showed that
the Glomus nitrate reductase gene has fewer similarities
to the enzyme from other fungi (Neurospora, Aspergillus) than to that of higher plants. Other AMF enzymes
are seemingly evolutionarily more distant from those of
other fungi which may be the reason that only few AMF
genes (⬍ 100) have been identified and sequenced until
now. Differential display techniques could be a tedious
avenue to identify AMF nitrate transporters. Alternatively, genomic sequencing upstream and downstream of
the NIA gene could be rewarding, since the genes coding
for nitrate uptake and assimilation cluster in several organisms including fungi (Marzluf 1997, Jargeat et al.
2000).
Acknowledgements – This work was kindly supported by grants
from the Deutsche Forschungsgemeinschaft.
References
Amarasinghe BHRR, de Bruxelles GL, Braddon M, Onyeocha I,
Forde BD, Udvardi MK (1998) Regulation of GmNRT2 expression and nitrate transport activity in roots of soybean (Glycine
max). Planta 206: 44–52
Bago B, Vierheilig H, Piché Y, Aczon-Aguilar C (1996) Nitrate dePhysiol. Plant. 115, 2002
pletion and pH-changes induced by extraradical mycelium of
the arbuscular mycorrhizal fungus Glomus intraradices grown in
monoxenic culture. New Phytol 133: 273–280
Burleigh SH (2001) Relative quantitative RT-PCR to study the expression of plant nutrient transporters in arbuscular mycorrhizas. Plant Sci 160: 899–904
Crawford NM, Glass ADM (1998) Molecular and physiological aspects of nitrate uptake in plants. Trends Plant Sci 3: 389–395
Filleur S, Daniel-Vedele F (1999) Expression analysis of a highaffinity nitrate transporter isolated from Arabidopsis thaliana by
differential display. Planta 207: 461–469
Forde BG (2000) Nitrate transporters in plants: structure, function
and regulation. Biochim Biophys Acta 1465: 219–235
Frey B, Schuepp H (1993) Acquisition of nitrogen by external hyphae of arbuscular mycorrhizal fungi associated with Zea mays
L. New Phytol 124: 221–250
Frohman MA, Dush MK, Martin GR (1988) Rapid production of
full-length cDNA’s from rare transcripts: amplification using a
single gene-specific oligonucleotide primer. Proc Natl Acad Sci
USA 85: 8998–9002
George E, Häusler K, Vetterlein D, Gorgus E, Marschner H (1992)
Water and nutrient translocation by hyphae of Glomus mosseae.
Can J Bot 70: 2130–2137
Harrison MJ (1996) A sugar transporter from Medicago truncatula:
altered expression pattern in roots during vesicular arbuscular
(VA) mycorrhizal associations. Plant J 9: 491–503
Harrison MJ, van Buuren M (1995) A phosphate transporter from
the mycorrhizal fungus Glomus versiforme. Nature 378: 626–629
Hawkins H-J, George E (1999) Effect of plant nitrogen status on the
contribution of arbuscular mycorrhizal hyphae to plant nitrogen
uptake. Physiol Plant 105: 694–700
Hildebrandt U (2001) Untersuchungen zur molekularbiologischen
Charakterisierung der Nitratassimilation in der Symbiose
zwischen dem arbuskulären Mykorrhiza-Pilz Glomus und Tomate. PhD thesis The University of Cologne, http://www.ub.unikoeln.de/ediss/archiv/11v4094.pdf
Hildebrandt U, Janetta K, Ouziad F, Renne B, Nawrath K, Bothe
H (2001) Arbuscular mycorrhizal colonization of halophytes in
Central European salt marshes. Mycorrhiza 10: 175–183
Huang N-C, Chiang C-S, Crawford NM, Tsay Y-F (1996) CHL 1
encodes a component of the low-affinity nitrate uptake system
in Arabidopsis and shows cell type-specific expression in roots.
Plant Cell 8: 2183–2191
Huang N-C, Liu K-H, Lo H-J, Tsay Y-F (1999) Cloning and functional characterization of an Arabidopsis nitrate transporter
gene that encodes a constitutive component of low affinity uptake. Plant Cell 11: 1381–1392
Jargeat P, Gay G, Debaud JC, Marmeisse R (2000) Transcription
of a nitrate redcutase gene isolated from the symbiotic basidiomycete fungus Hebeloma cylindrosporum does not require induction by nitrate. Mol Gen Genet 263: 948–956
Johansen A, Jakobsen I, Jensen ES (1992) Hyphal transport of 15Nlabelled nitrogen by a vesicular-arbuscular mycorrhizal fungus
and its effect on depletion of inorganic soil N. New Phytol 122:
281–288
Kaldorf M, Schmelzer E, Bothe H (1998) Expression of maize and
fungal nitrate reductase genes in arbuscular mycorrhiza. Mol
Plant Microbe Interact 11: 439–448
Kaldorf M, Zimmer W, Bothe H (1994) Genetic evidence for the
occurrence of assimilatory nitrate reductase in arbuscular mycorrhizal and other fungi. Mycorrhiza 5: 23–28
Kothari SK, Marschner H, Römheld V (1991) Contribution of the
VA mycorrhizal hyphae in acquisition of phosphorus and zinc
by maize grown in a calcareous soil. Plant Soil 131: 177–185
Krapp A, Fraisier V, Scheible W-R, Quesada A, Gojon A, Stitt
M, Caboche M, Daniel-Vedele F (1998) Expression studies of
Nrt2:1Np, a putative high-affinity nitrate transporter: evidence
for its role in nitrate uptake. Plant J 14: 723–731
Lauter F-R, Ninnemann O, Bucher M, Riesmeier JW, Frommer
WB (1996) Preferential expression of an ammonium transporter
and of two putative nitrate transporters in root hairs of tomato.
Proc Natl Acad Sci USA 93: 8139–8144
Lin C-M, Koh S, Stacey G, Yu S-M, Lin T-Y, Tsay Y-F (2000)
Cloning and functional characterization of a constitutively expressed nitrate transporter gene OsNRT1 from rice. Plant Physiol 122: 379–388
Liu H, Trieu AT, Blaylock LA, Harrison MJ (1998) Cloning and
135
characterization of two phosphate transporters from Medicago
truncatula roots: regulation in response to phosphate and to
colonization by arbuscular mycorrhizal (AM) fungi. Mol Plant
Microbe Interact 11: 14–22
Lohaus G, Büker M, Hussmann M, Heldt H-W (1998) Transport
of aminoacids with special emphasis on the synthesis and transport of asparagine in Illinois Low Protein and Illinois High Protein strains of maize. Planta 205: 181–188
Marzluf GA (1997) Genetic regulation of nitrogen metabolism in
the fungi. Microbiol Mol Biol Rev 61: 17–32
Nagy F, Kay S, Chua N-H (1988) Analysis of gene expression in
transgenic plants. In: Gelvin SB, Schilperoot RA (eds) Plant
Molecular Biology Manual. Kluwer, Dordrecht, Vol 4, pp 1–29
Ono F, Frommer WB, von Wirén N (2000) Coordinated diurnal
regulation of low-and high-affinity nitrate transporters in tomato. Plant Biol 2: 17–23
Pearson JN, Jakobsen I (1993) Symbiotic exchange of carbon and
phosphorus between cucumber and three mycorrhizal fungi.
New Phytol 124: 481–488
Raeder U, Broda P (1985) Rapid preparation of DNA from filamentous fungi. Lett Appl Microbiol 1: 17–20
Rosewarne GM, Barker SJ, Smith SE, Smith FA, Schachtman DP
(1999) A Lycopersicon esculentum phosphate transporter
(LEPT1) involved in phosphorus uptake from a vesicular-arbuscular mycorrhizal fungus. New Phytol 144: 507–516
Schmelzer E, Jahnen W, Hahlbrock K (1988) In situ localization of
light-induced chalcone synthase mRNA, chalcone synthase, and
flavonoid end products in epidermal cells of parsley leaves. Proc
Natl Acad Sci USA 85: 2989–2993
Schmelzer E, Krüger-Lebus S, Hahlbrock K (1989) Temporal and
spatial patterns of gene expression around sites of attempted
fungal infection in parsley leaves. Plant Cell 1: 993–1001
Schmitz O, Danneberg G, Hundeshagen B, Klingner A, Bothe H
(1991) Quantification of vesicular-arbuscular mycorrhiza by biochemical parameters. J Plant Physiol 139: 106–114
Smith SE, Read DJ (1997) Mycorrhizal Symbiosis 2nd edn. Academic Press, San Diego, CA
Subramanian KS, Charest C (1998) Arbuscular mycorrhizae and
nitrogen assimilation in maize after drought and recovery. Physiol Plant 102: 285–296
Swofford DL (1999) PAUP*. Phylogenetic analysis using parsimony
(* and other methods), Version 4. Sinauer Associates, Sunderland, MA
Tobar R, Azcon R, Barea JM (1994) Improved nitrogen uptake and
transport from 15N- labelled nitrate by external hyphae of arbuscular mycorrhiza under water-stressed conditions. New Phytol
126: 119–122
Trueman LJ, Richardson A, Forde BG (1996) Molecular cloning of
higher plant homologues of the high-affinity nitrate transporters
of Chlamydomonas reinhardtii and Aspergillus nidulans. Gene
175: 223–231
Ullrich W, Nowacky A (1981) Nitrate-dependent membrane potential changes and their induction in Lemna gibba G1. Plant Sci
Lett 22: 211–217
Vidmar JJ, Zhuo D, Siddiqi MY, Glass ADM (2000) Isolation and
characterization of HvNRT2.3 and HvNRT2.4 cDNAs encoding
high-affinity nitrate transporters from roots of barley. Plant
Physiol 122: 783–792
Zhuo D, Okamoto M, Vidmar JJ, Glass ADM (1999) Regulation
of a putative high-affinity nitrate transporter (Nrt2;1At) in roots
of Arabidopsis thaliana. Plant J 17: 563–568
Edited by J. K. Schjørring
136
Physiol. Plant. 115, 2002