Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
May, 12th 2007 Magistère of Biotechnologies, University of Orsay Pierre ABADIE INRA Bordeaux-Aquitaine, UMR Santé Végétale DOWNY MILDEW ADAPTATION TO FUNGICIDE PRESSURE: FITNESS STUDY BIOLOGICAL CYCLE OF PLASMOPARA VITICOLA AND ASSOCIATED SYMPTOMS Oomycota family (brown algae) Biotrophic parasite, introduced in France in 1878 SCIENTIST CONTEXT AND GOALS Since 1996, massive use of the fungicide famoxadone Consequence: resistant pathogen strains of Plasmopara viticola quickly emerged Resistance to famoxadone is due to a punctual mutation (G143A) in the mitochondrial gene coding the cytochrome b General goal: acquire data on spreading and maintainance of P. viticola resistant strains, in the optic of improving fungicides application management. My training period goal: studying fitness of resistant and sensitive strains to famoxadone -> Is there a cost of resistance? THE COMPETITION TEST Goal: following the evolution of sensitive/resistant strains proportions during 8 cycles Cycle 0 Reinoculation on leaves (1 week) 5 couples R/S 3 initial mixes - 20%R 80%S - 50%R 50%S - 80%R 20%S Cycle 1 5 couples R/S 3 mixes - ?%R ?%S - ?%R ?%S - ?%R ?%S FUNGICIDE SCREENING QUANTITATIVE PCR (1 week) To estimate Visual notation to estimate resistant and resistant and sensitive sensitive percentages percentages Cycle 8 STRAINS COUPLES CARACTERISTICS INOCULATION ON LEAVES Inoculation of 24 drips of 15µL, adjusted to 40,000 sporangias/mL One week at 22°C Sporulation FUNGICIDE SCREENING Inoculation on leaves disks sprayed with famoxadone (100mg/mL) Visual notation BIOLOGICAL RESULTS BIOLOGICAL MEASURES STANDARDIZATION - Good correlation between the percentage of resistant and the notation scale (linear correlation) - At 40,000 sporangias/mL, notation extended from 0 to 5 BIOLOGICAL COMPETITION TEST (first assay) No significant variation detected Statistical work required BIOLOGICAL COMPETITION TEST (second assay) Statistical work required but general tendencies observed Diminution of resistant proportion in 3 couples QUANTITATIVE PCR MEASURES Goal: determination of the resistant and sensitive strains rates in the biological competition test mixes (to improve fungicide screening measures) Experiment progress: the protocol is set up, first results coming soon… Protocol: « Sybr green » fluorescent probe is used P. viticola DNA is extracted from the leaves used in the competition test 2 primers couples: one that is specific to P. viticola cytochrome b gene, and another one specific to resistant P. viticola strains cytochrome b gene allele 30 cycles of PCR amplification QUANTITATIVE PCR MEASURES (5’) 1021 TTATGCGTGATGTAAATAACGGTTGGTTAATTCGATATATACATGCGAATGGTGCATCTT 1081 TTTTTTTTATTGTTGTATATATACATATTTTTAGGGGTTTGTATTACGGATCTTATATTA 1141 CACCTAGAGAAGCTTTATGGTGTTCAGGGGTAATTATTTTTATTTTAATGATGGCGACTG 1201 CATTTATGGGTTATGTTTTGCCTTGGGGACAAATGAGTTTTTGGGGTGCAACAGTTATTA 1261 CAAATTTATTCTCGGCTATCCCATTAATTGGAAAAGAAGTTGTTGACTGGTTATGGGGTG 1321 GATTCGCCGTTGATAATCCAACATTAAATCGTTTTTTTAGTTTACATTTCACCTTTCCAT 1381 TTGTAATTGTAGGGGCTGTACTAATACATTTAATTTTATTACATGAGGTAGGTTCAAATA (3’) G : SNP G143A leading to resistant phenotype : unspecific primers amplifying R and S : resistant-specific primers DISCUSSION AND PERSPECTIVES Previous data on fitness didn’t show any significant global differences between resistant and sensitive strains In this study, the competition test seems to corroborate previous fitness data: low-fitness strains are less competitive Costs of resistance may have been detected But: statistical work is required Waiting for Q-PCR measures to improve the results Realize a model of evolution of resistant and sensitive strains mixes including fitness data