Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Ecclesiastes 3:1 1 To every thing there is a season, and a time to every purpose under the heaven: ©2000 Timothy G. Standish Initiation of Transcription Timothy G. Standish, Ph. D. ©2000 Timothy G. Standish All Genes Can’t be Expressed At The Same Time Some gene products are needed by all cells all the time. These constitutive genes are expressed by all cells. Other genes are only needed by certain cells or at specific times, expression of these inducible genes is tightly controlled in most cells. For example, pancreatic b cells make insulin by expressing the insulin gene. If neurons expressed insulin, problems would result. ©2000 Timothy G. Standish Operons Are Groups Of Genes Expressed By Prokaryotes The genes grouped in an operon are all needed to complete a given task Each operon is controlled by a single control sequence in the DNA Because the genes are grouped together, they can be transcribed together then translated together ©2000 Timothy G. Standish The Lac Operon Genes in the lac operon allow E. coli bacteria to metabolize lactose Lactose is a sugar that E. coli is unlikely to encounter. Production of lactose metabolizing enzymes when not needed would be wasteful Metabolizing lactose for energy only makes sense when two criteria are met: 1 Other more readily metabolized sugar (glucose) is unavailable 2 Lactose is available ©2000 Timothy G. Standish The Lac Operon - Parts The lac operon is made up of a control region and four genes The four genes are: – LacZ - b-galactosidase - Hydrolizes the bond between galactose and glucose – LacY - Codes for a permease that lets lactose across the cell membrane – LacA - Transacetylase - An enzyme whose function in lactose metabolism is uncertain – Repressor - A protein that works with the control region to control expression of the operon ©2000 Timothy G. Standish The Lac Operon - Control The control region is made up of two parts: 1 Promoter – These are specific DNA sequences to which RNA Polymerase binds so that transcription can occur – The lac operon promoter also has a binding site for another protein called CAP 2 Operator – The binding site of the repressor protein – The operator is located downstream (in the 3’ direction) from the promoter so that if repressor is bound RNA Polymerase can’t transcribe ©2000 Timothy G. Standish The Lac Operon: When Glucose Is Present But Not Lactose Come on, let me through Hey man, I’m constitutive Repressor CAP Binding Repressor mRNA RNA Pol. Promoter Operator LacZ LacY LacA Repressor No way Jose! Repressor CAP ©2000 Timothy G. Standish The Lac Operon: When Glucose And Lactose Are Present Great, I can transcribe! Hey man, I’m constitutive Repressor CAP Binding RNA Pol. Promoter Operator X Repressor mRNA Repressor Repressor LacZ LacY RNA LacA Pol. Repressor This lactose has bent me out of shape CAP Some transcription occurs, but at a slow rate ©2000 Timothy G. Standish The Lac Operon: When Lactose Is Present But Not Glucose Hey man, I’m constitutive Repressor CAP Binding CAP Bind to me Polymerase Yipee…! RNA Pol. Promoter Operator cAMP X Repressor mRNA LacZ RNA LacA Pol. LacY Repressor CAP cAMP Repressor Repressor This lactose has bent me out of shape cAMP CAP ©2000 Timothy G. Standish The Lac Operon: When Neither Lactose Nor Glucose Is Present Hey man, I’m constitutive Repressor CAP Binding CAP Bind to me Polymerase RNA Pol. Alright, I’m off to the races . . . Come on, let me through! Promoter Operator LacZ LacY LacA Repressor cAMP Repressor mRNA Repressor STOP Right there Polymerase CAP cAMP cAMP CAP ©2000 Timothy G. Standish The Trp Operon Genes in the trp operon allow E. coli bacteria to make the amino acid tryptophan Enzymes encoded by genes in the trp operon are all involved in the biochemical pathway that converts the precursor chorismate to tryptophan. The trp operon is controlled in two ways: – Using a repressor that works in exactly the opposite way from the lac operon repressor – Using a special attenuator sequence ©2000 Timothy G. Standish The Tryptophan Biochemical Pathway COO- Glutamine Glutamate + Pyruvate COO- CH2 5-Phosphoribosyla-Pyrophosphate NH2 COO- HO H O C H Anthranilate synthetase (trpE and D) Chorismate OH OH -2O PO 3 CH2 C C C -OOC OH PPi Anthranilate synthetase -2O P 3 O CH2 Antrhanilate H CH2 C N-(5’-Phosphoribosyl)Anthranilate isomerase Indole- H Enol-1-oH H C 3’-glycerol phosphate synthetase N Carboxyphenylamino H H -1-deoxyribulose phosphate Glyceraldehyde- Tryptophan synthetase (trpB and A) H 3-phosphate Serine H2O -OOC C C HN N-(5’H Phosphoribosyl) -anthranilate OH H H N-(5’-Phosphoribosyl)-anthranilate OH isomerase Indole-3’-glycerol OH OH phosphate synthetase (trpC) CO2+H2O -2O PO 3 O -OOC C H C H N H Indole-3-glycerol phosphate CH2 NH3+ Tryptophan synthetase N H Indole N H Tryptophan ©2000 Timothy G. Standish The Trp Operon: When Tryptophan Is Present Hey man, I’m constitutive Repressor RNA Pol. Foiled Again! Promo. Operator Lead. Aten. trpE trpD trpC trpB trpA Repressor Trp Repressor mRNA STOP Right there Polymerase Repressor Trp ©2000 Timothy G. Standish The Trp Operon: When Tryptophan Is Absent Hey man, I’m constitutive RNA RNA Operator Repressor Promo. Lead. Aten. trpE trpD trpC trpBPol.trpA Pol. Repressor mRNA I need tryptophan Repressor needs his little buddy tryptophan if I’m to be stopped Repressor ©2000 Timothy G. Standish Attenuation The trp operon is controlled both by a repressor and attenuation Attenuation is a mechanism that works only because of the way transcription and translation are coupled in prokaryotes Therefore, to understand attenuation, it is first necessary to understand transcription and translation in prokaryotes ©2000 Timothy G. Standish Transcription And Translation In Prokaryotes 5’ 3’ 3’ 5’ RNA Pol. Ribosome mRNA Ribosome 5’ ©2000 Timothy G. Standish The Trp Leader and Attenuator Met-Lys-Ala-Ile-Phe-ValAAGUUCACGUAAAAAGGGUAUCGACA-AUG-AAA-GCA-AUU-UUC-GUALeu-Lys-Gly-Trp-Trp-Arg-Thr-Ser-STOP CUG-AAA-GGU-UGG-UGG-CGC-ACU-UCC-UGA-AACGGGCAGUGUAUU 1 2 CACCAUGCGUAAAGCAAUCAGAUACCCAGCCCGCCUAAUGAGCGGGCUUUU 3 4 Met-Gln-Thr-Gln-Lys-Pro UUUU-GAACAAAAUUAGAGAAUAACA-AUG-CAA-ACA-CAA-AAA-CCG trpE . . . Terminator ©2000 Timothy G. Standish The mRNA Sequence Can Fold In Two Ways 1 1 2 2 3 3 4 4 Terminator hairpin ©2000 Timothy G. Standish The Attenuator When Starved For Tryptophan 5’ 3’ 3’ Help, I need Tryptophan RNA Pol. 2 Ribosome 5’ 3 4 1 ©2000 Timothy G. Standish The Attenuator When Tryptophan Is Present 5’ 3’ 3’ Ribosome 5’ 2 RNA Pol. 3 4 1 ©2000 Timothy G. Standish Expression Control In Eukaryotes Some of the general methods used to control expression in prokaryotes are used in eukaryotes, but nothing resembling operons is known Eukaryotic genes are controlled individually and each gene has specific control sequences preceding the transcription start site In addition to controlling transcription, there are additional ways in which expression can be controlled in eukaryotes ©2000 Timothy G. Standish Eukaryotes Have Large Complex Genomes The human genome is about 3 x 109 base pairs or ≈ 1 m of DNA Because humans are diploid, each nucleus contains 6 x 109 base pairs or ≈ 2 m of DNA Some gene families are located close to one another on the same chromosome Genes with related functions appear to be distributed almost at random throughout the the genome ©2000 Timothy G. Standish Highly Packaged DNA Cannot be Expressed Because of its size, eukaryotic DNA must be packaged Heterochromatin, the most highly packaged form of DNA, cannot be transcribed; therefore expression of genes is prevented Chromosome puffs on some insect chomosomes illustrate areas of active gene expression ©2000 Timothy G. Standish Only a Subset of Genes is Expressed at any Given Time It takes lots of energy to express genes Thus it would be wasteful to express all genes all the time By differential expression of genes, cells can respond to changes in the environment Differential expression, allows cells to specialize in multicelled organisms. Differential expression also allows organisms to develop over time. ©2000 Timothy G. Standish Control of Gene Expression Cytoplasm Packaging Degradation DNA Transcription Transportation Modification RNA RNA Processing mRNA G G AAAAAA Nucleus Export Degradation etc. AAAAAA Translation ©2000 Timothy G. Standish Logical Expression Control Points Increasing cost DNA packaging Transcription RNA processing mRNA Export mRNA masking/unmasking and/or modification mRNA degradation Translation Protein modification Protein transport Protein degradation The logical place to control expression is before the gene is transcribed ©2000 Timothy G. Standish Three Eukaryotic RNA Polymerases 1 RNA Polymerase I - Produces rRNA in the nucleolus, accounts for 50 - 70 % of transcription 2 RNA Polymerase II - Produces mRNA in the nucleoplasm - 20 - 40 % of transcription 3 RNA Polymerase III - Produces tRNA in the nucleoplasm - 10 % of transcription ©2000 Timothy G. Standish A “Simple” Eukaryotic Gene Transcription Start Site 3’ Untranslated Region 5’ Untranslated Region Introns 5’ Exon 1 Int. 1 Promoter/ Control Region Exon 2 3’ Int. 2 Exon 3 Exons Terminator Sequence RNA Transcript ©2000 Timothy G. Standish Enhancers DNA Many bases 5’ 3’ Enhancer 5’ Promoter TF Transcribed Region 3’ TF 5’ TF TF RNA RNA Pol. Pol. 5’ 3’ RNA ©2000 Timothy G. Standish Eukaryotic RNA Polymerase II RNA polymerase is a very fancy enzyme that does many tasks in conjunction with other proteins RNA polymerase II is a protein complex of over 500 kD with more than 10 subunits: ©2000 Timothy G. Standish Eukaryotic RNA Polymerase II Promoters Several sequence elements spread over about 200 bp upstream from the transcription start site make up RNA Pol II promoters Enhancers, in addition to promoters, influence the expression of genes Eukaryotic expression control involves many more factors than control in prokaryotes This allows much finer control of gene expression ©2000 Timothy G. Standish Initiation T. F. Promoter T. F. RNA Pol. II RNA Pol. II mRNA 5’ ©2000 Timothy G. Standish Eukaryotic Promoters Promoter 5’ Exon 1 Sequence elements TATA ~200 bp “TATA Box” Initiator Transcription start site SSTATAAAASSSSSNNNNNNNNNNNNNNNNNYYCAYYYYYNN (Template strand) ~-25 -1+1 S = C or G Y = C or T N = A, T, G or C ©2000 Timothy G. Standish Initiation TFIID Binding TFIID “TATA Box” Transcription start site TBP Associated Factors (TAFs) -1+1 TATA Binding Protein (TBP) ©2000 Timothy G. Standish Initiation TFIID Binding Transcription start site TFIID -1+1 80o Bend ©2000 Timothy G. Standish Initiation TFIIA and B Binding TFIID TFIIB Transcription start site -1+1 TFIIA ©2000 Timothy G. Standish Initiation TFIIF and RNA Polymerase Binding TFIID TFIIB Transcription start site -1+1 TFIIA TFIIF RNA Polymerase ©2000 Timothy G. Standish Initiation TFIIE Binding TFIIF TFIIB RNA Polymerase -1+1 TFIIA TFIIE TFIID Transcription start site TFIIE has some helicase activity and may by involved in unwinding DNA so that transcription can start ©2000 Timothy G. Standish Initiation TFIIH and TFIIJ Binding TFIIJ TFIIH TFIIF TFIIB P TFIIA PP RNA Polymerase -1+1 TFIIE TFIID Transcription start site TFIIH has some helicase activity and may by involved in unwinding DNA so that transcription can start ©2000 Timothy G. Standish Initiation TFIIH and TFIIJ Binding TFIIJ TFIIH TFIIF TFIIB P PP -1+1 TFIIE TFIID Transcription start site RNA Polymerase TFIIA ©2000 Timothy G. Standish Initiation TFIIH and TFIIJ Binding Transcription start site P -1+1 PP RNA Polymerase ©2000 Timothy G. Standish ©2000 Timothy G. Standish