Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
What is DNA? • Deoxyribo-Nucleic Acid • Long molecule made of different chemicals called Adenine, Thymine, Guanine, and Cytosine A T T A G C C C C G ATGCCTAAGTACCGTA T T A A A G •Salk Institute Mobile Lab What is DNA? • Deoxyribo-Nucleic Acid • Long molecule made of different chemicals called Adenine, Thymine, Guanine, and Cytosine • Shaped like a twisted ladder Career Spotlight! – Double HelixGeneticists Molecular study the structure of DNA involved in different diseases •Salk Institute Mobile Lab What does DNA do? • Your DNA determines your PHENOTYPE – Instruction book for your cells My DNA • Each instruction is called a GENE • Genes are the recipes for Proteins • All your genes together is called your GENOME • How your cells read your Genome depends in part on your (and your cells’) environment •Salk Institute Mobile Lab Reading DNA • PORFAVORNOHABLECUANDO ESTOYHABLANDO. • ATACGGGCTAGCCTGACGTCA GTTTAAAAGCCCTG. •Salk Institute Mobile Lab Reading DNA PUT A HAT ON YOUR HEAD TGACGTAAAGCTTGACCTA PUT A BAT ON YOUR HEAD TGACATAAAGCTTGACCTA • Career MUTATION! Spotlight! Genetic Counselors figurein outyour GENES MUTATIONShelp arepeople changes if they might pass a that may be inherited disease mutation to their future children – Even small changes in DNA can have big effects – Human DNA is ALL >99% identical! •Salk Institute Mobile Lab Where is DNA? • DNA is found in the cells of every living organism – There are different types of cells • Animal cells DNA found in nucleus (Eukaryotic) • Plant cells • Bacteria cells - DNA floating loose (Prokaryotic) } •Salk Institute Mobile Lab What color is DNA? •Salk Institute Mobile Lab