Download Document

Chapter 13:
Genetic Engineering
How could you get a desired trait without directly
manipulating the organisms’ DNA?
• Selective Breeding
- choosing organisms with desired traits to
produce the next generation
• Breeding the winners of a horse race
• Selecting a person with a certain eye color or
features
• Taking the seeds from the
Great
Pumpkin
Hybridization
• Crossing organisms of different traits to produce a
hardier product
Ex. A mule is a cross of a horse and a donkey –
Sturdy and surefooted
Hybrid corn – tastes good and is more resistant to
disease.
Hybrid potatoes (Burbank)- disease resistant,
exported to Ireland to fight blight disease
Inbreeding
• Maintaining the present genes by breeding
only within the population
• Ex. Pedigree animals
• Risk that recessive traits show
up that may be lethal or harmful.
• Problems with certain breeds, for example hip
problems in German shepards
Increasing variations by
Inducing mutations
•
•
•
•
By using known mutagens, attempt to force
mutations to occur
Radiation & Chemicals
Not a sure bet nor do you know what you are
going to get
Polyploidy (3N or 4N) plants have resulted
from this – larger & hardier
Bacteria that can digest oil, too
Glofish: the first genetically modified animal to
be sold as a pet
Researchers in Singapore added a
fluorescence gene from a sea coral to zebra
danio eggs to produce glofish.
Now let’s manipulate the genes by
altering the organism’s DNA
• Genetic Engineering – science involved in the
ability to manipulate genes/DNA
• Purpose:
– Cure disease (Cystic Fibrosis)
– Treat genetic disorders (Hemophilia, diabetes)
– Improve food crops (better tasting, longer shelf life,
fungus resistance…)
– Improve human life in general
•
•
•
•
•
The Tools:
DNA Extraction – Chemical procedure (we’ll do this)
Restriction enzymes – molecular scissors that cut DNA
at specific nucleotide sequences
Gel Electrophoresis – method to analyze fragments of
DNA cut by restriction enzymes through a gel made of
agarose (molecular sieve)
DNA Ligase – molecular glue that puts pieces of DNA
together
Polymerase Chain Reaction (PCR)- molecular copy
machine. Makes millions of copies of DNA/hr
Let’s suppose that you are a diabetic and can not
make your own insulin. What are you to do?
• Inject insulin of course but from what
source?
• Old method was to use sheep insulin. Costly
and labor intensive
• New method: Let bacteria with a human
insulin producing gene make it for you
The Method:
• Transformation of a bacterium to
produce human insulin
1. Extract the total genomic DNA from a
healthy human
2. Using a restriction enzyme, cut the
insulin producing gene out of a the
DNA
What are restriction enzymes?
• Bacterial enzymes – used to cut bacteriophage DNA
(viruses that invade bacteria).
• Different bacterial strains express different
restriction enzymes
• Restriction enzymes recognize a specific short
nucleotide sequence
• For example, Eco RI recognizes the sequence:
• 5’ - G A A T T C - 3’
• 3’ - C T T A A G - 5’
• Pandindrones same base pairing forward and
backwards
Let’s try some cutting:
•
•
•
Using this piece of DNA, cut it with Eco RI
• G/AATTC
GACCGAATTCAGTTAATTCGAATTC
CTGGCTTAAGTCAATTAAGCTTAAG
•
•
GACCG/AATTCAGTTAATTCG/AATTC
CTGGCTTAA/GTCAATTAAGCTTAA/G
What results is:
• GACCG AATTCAGTTAATTCG AATTC
• CTGGCTTAA GTCAATTAAGCTTAA G
Sticky end
Sticky end - tails of
DNA – easily bind to
other DNA strands
Blunt & Sticky ends
• Sticky ends – Creates an overhang.
• Blunts- Enzymes that cut at precisely opposite
sites without overhangs. SmaI is an example of an
enzyme that generates blunt ends
3. Cut cloning vector:
• Use bacterial plasmids
– Plasmids will be cut with the same
restriction enzyme used to cut the desired
gene
• 4. Ligation - Donor gene (desired gene) is then
spliced or annealed into the plasmid
using DNA ligase as the glue.
Recombinant DNA - DNA with new piece
of
genetic information on it
• 5. Plasmid is then returned to bacterium and
reproduces with donor gene in it.
Transgenic organism – organism with
foreign
DNA incorporated in its
genome (genes)
• 6. Bacterium reproduces and starts producing
human insulin gene which we harvest from them.
Recombinant DNA
Donor Gene
Practical Use of DNA technology
1. Pharmaceutical products – insulin, HBCF
(human blood clotting factor)
2. Genetically engineered vaccines –
Introduced viral proteins will trigger an
immune response and the production of
antibodies
3. Increasing agricultural yields –
– New strains of plants – GMO – Genetically modified
organism
– Insect resistant plants – Insert gene that kills larvae
when larvae try to eat the plant – Not always specific to
harmful species!! – Monarch problem
– Disease resistance – Fungal resistance in tomatoes, corn,
soybean
– Herbicide resistance - *Round Up won’t harm the good
plants, only the bad plants (weeds) – cheaper and less
labor extensive than weeding
– Getting genes from Nitrogen fixing bacteria inserted into
plants – fix their own nitrogen (a must for plants) in N
poor soils
– Salt tolerant plants – can grow plants where high
concentrations of salt in the air or soil
• Improve quality of produce
- Slow down the ripening process – ship
when un-ripened, to market when ripe
- Enhance color of produce
- Reduce hairs or fuzz on produce
- Increase flavor
- Frost resistance
Parts of the world with Vitamin A
deficiency related health issues
Would you believe that once upon a time carrots were white
or purple? Orange-coloured carrots are the product of a
mutation selected by a Dutch horticulturist a few hundred
years ago because it was the colour of the Dutch Royal House
of Orange-Nassau!
The negatives
• Problem with transgenic foods is that an introduced
gene may produce a protein that someone may be
sensitive to.
• FDA does not require that on a label (here in the
US)
• If a label starts with a “(8), then it’s a GMO product
– 84011 = GMO banana
• Also, may create “superweeds” that cross pollinate
with others & may take over environment