Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Chapter 17. Mutations AP Biology Adapted from: Kim Foglia, Explore Biology Universal code Code is redundant several codons for each amino acid “wobble” in the tRNA “wobble” in the aminoacyl-tRNA synthetase enzyme that loads the tRNA AP Biology Mutations Point mutations single base change base-pair substitution silent mutation no amino acid change redundancy in code missense change amino acid nonsense change to stop codon When do mutations affect the next generation? AP Biology Point mutation leads to Sickle cell anemia What kind of mutation? AP Biology Sickle cell anemia AP Biology Mutations Frameshift shift in the reading frame insertions changes everything “downstream” adding base(s) deletions AP Biology losing base(s) What’s the value of mutations? AP Biology Adapted from: Kim Foglia, Explore Biology Chapter 17. RNA Processing AP Biology Adapted from: Kim Foglia, Explore Biology Transcription -- another look The process of transcription includes many points of control when to start reading DNA where to start reading DNA where to stop reading DNA editing the mRNA protecting mRNA as it travels through cell AP Biology Primary transcript Processing mRNA protecting RNA from RNase in cytoplasm add 5’ cap add polyA tail remove introns AUG AP Biology UGA Protecting RNA 5’ cap added G trinucleoside (G-P-P-P) protects mRNA from RNase (hydrolytic enzymes) 3’ poly-A tail added 50-250 A’s protects mRNA from RNase (hydrolytic enzymes) helps export of RNA from nucleus UTR AP Biology UTR Dicing & splicing mRNA Pre-mRNA mRNA edit out introns splice together exons expressed sequences In higher eukaryotes AP Biology intervening sequences “AVERAGE”… “gene” = 8000b pre-mRNA = 8000b mature mRNA = 1200b protein = 400aa lotsa “JUNK”! 90% or more of gene can be intron no one knows why…yet there’s a Nobel prize waiting… Discovery of Split genes Richard Roberts NE BioLabs AP Biology Philip Sharp MIT 1977 | 1993 adenovirus common cold Splicing enzymes snRNPs small nuclear RNA RNA + proteins Spliceosome several snRNPs recognize splice site sequence cut & paste RNA as ribozyme AP Biology some mRNA can splice itself RNA as enzyme Ribozyme RNA as enzyme Sidney Altman Yale AP Biology Thomas Cech U of Colorado 1982 | 1989 Splicing details No room for mistakes! editing & splicing must be exactly accurate a single base added or lost throws off the reading frame AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|UCC|GAU|AAG|GGC|CAU Met|Arg|Ser|Asp|Lys|Gly|His AP Biology AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U Met|Arg|Val|Arg|STOP| Alternative splicing Alternative mRNAs produced from same gene when is an intron not an intron… different segments treated as exons Hard to define a gene! AP Biology Domains Modular architecture of many proteins AP Biology separate functional & structural regions coded by different exons in same “gene” The Transcriptional unit (gene?) enhancer 1000+b 20-30b 3' RNA TATA polymerase translation start TAC translation stop exons transcriptional unit 5' DNA ACT DNA UTR promoter UTR introns transcription start transcription stop 5' pre-mRNA AP Biology 5' GTP mature mRNA 3' 3' AAAAAAAA Any Questions?? AP Biology Adapted from: Kim Foglia, Explore Biology The Transcriptional unit enhancer exons 1000+b 20-30b 3' RNA TATA polymerase TAC transcriptional unit 5' DNA ACT introns 5' 3' 5' AP Biology 3'