Download A metabolic perturbation by U0126 identifies ... glutamine in resveratrol-induced cell death.

A metabolic perturbation by U0126 identifies a role for
glutamine in resveratrol-induced cell death.
MASSACHWVIuf
OF Tm''""
by
Amy Marie Nichols
JUL 14 2
B.S. Biomedical Engineering
Washington University in Saint Louis, 2003
SUBMITTED TO THE DEPARTMENT OF BIOLOGICAL ENGINEERING IN
PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY IN BIOLOGICAL ENGINEERING
ARCHVES
AT THE
MASSACHUSETTS INSTITUTE OF TECHNOLOGY
JUNE 2011
© 2011 Massachusetts Institute of Technology. All Rights Reserved.
A2
Author:
Department of Biological Engineering
May 19,2011
Certified by
Michael R. Freeman
Professor of Surgery, Harvard Medical School
Thesis Supervisor
//
Certified by
Forest White
Professor of Biological Engineering
Thesis Supervisor
Approved by:
C
K. Dane Wittrup
Chairman, Department Committee on Graduate Students
2
Thesis Committee
Douglas A. Lauffenburger
Whitaker Professor of Biological Engineering, Chemical Engineering, and Biology
Thesis Committee Chairman
Michael R. Freeman
Professor of Surgery, Harvard Medical School
Thesis Supervisor
Forest M. White
Professor of Biological Engineering
Thesis Supervisor
Michael B. Yaffe
Professor of Biological Engineering
Thesis Committee Member
4
A metabolic perturbation by U0126 identifies a role for
glutamine in resveratrol-induced cell death.
By
Amy Marie Nichols
Submitted to the Department of Biological Engineering on
May 19, 2011 in Partial Fulfillment of the Requirements
for the Degree of Doctor of Philosophy in Biological Engineering
ABSTRACT
Recent evidence demonstrates a correlative relationship between metabolic disorders and cancer
prevalence. In addition, cholesterol lowering statins and the antidiabetes medication metformin
both act as chemopreventive agents in prostate and other cancers. The natural compound
resveratrol has similar properties: increasing insulin sensitivity, suppressing adipogenesis, and
killing cancer cell lines in vitro. However, in vivo tumor xenografts acquire resistance to
resveratrol by an unknown mechanism, while mouse models of metabolic disorders still respond
to the compound. Given the metabolic implications of these data and the role of metabolism in
prostate cancer incidence, we evaluated resveratrol in an in vitro disease progression model of
prostate cancer and found that castration-resistant human prostate cancer C4-2 cells are more
sensitive to resveratrol-induced apoptosis than isogenic androgen-dependent LNCaP cells.
Inhibiting downstream pro-survival signaling with the MEK inhibitor U0126 rescued the C4-2
cells from resveratrol-induced death, however other MEK inhibitors did not recapitulate this
response. In fact, U0126 acted independently of MEK, inhibiting mitochondrial function and
shifting cells to aerobic glycolysis. Mitochondrial activity of U0126 arose through
decomposition, producing both mitochondrial fluorescence and cyanide, a known inhibitor of
complex IV. Applying U0126 mitochondrial inhibition to C4-2 cell apoptosis, we investigated
the role of mitochondrial metabolism and focused on how glutamine supplementation of citric
acid cycle intermediate a-ketoglutarate may be involved. Suppression of the conversion of
glutamate to a-ketoglutarate with the transaminase inhibitors cycloserine and amino oxyacetate
rescued C4-2 cells from resveratrol-induced death. In addition, reducing extracellular glutamine
concentration in the culture medium also inhibited apoptosis. These results imply resveratrolinduced death is dependent on glutamine metabolism, a pathway dysregulated in a variety of
cancers linked to oncogenic signaling. Further work on resveratrol and metabolism in cancer is
warranted to ascertain if the glutamine dependence has clinical implications.
Thesis Supervisor: Michael R. Freeman
Title: Professor of Surgery, Harvard Medical School
Thesis Supervisor: Forest M. White
Title: Professor of Biological Engineering
Table of Contents
5
A BSTRA CT ...................................................................................................................................
9
of
Figures................................................................................................................................
List
10
List of Tables ...............................................................................................................................
11
A bbreviations ..............................................................................................................................
13
Chapter 1: Introduction ..........................................................................................................
13
The Prostate .............................................................................................................................
14
Treatm ent Strategies .............................................................................................................
15
Signaling in Prostate Cancer ..............................................................................................
16
Cancer..........................................................................
Dietary Contribution to Prostate
17
Diet and Cancer .......................................................................................................................
18
..........................................................................................................
Cancer
Metabolism and
21
R eferences.................................................................................................................................
29
...............................................................................................................
Chapter 2: M ethods
29
Reagents....................................................................................................................................
30
Cell culture ...............................................................................................................................
30
Western blotting ......................................................................................................................
31
N ucleosom e ELISA .............................................................................................................
31
Cell counting ............................................................................................................................
31
Reactive oxygen species assay..............................................................................................
31
............................
Lactic acid assay ....................
32
Im munofluorescence imaging..............................................................................................
32
.....................................................................................................................
Cell fractionation
33
Fluorophore purification and characterization................................................................
33
Y east cultures and fluorescence m easurem ents................................................................
34
M itochondrial potential with JC1......................................................................................
34
A TP levels w ith Cell TiterG lo............................................................................................
34
Live cell im aging ......................................................................................................................
34
Lactic acid dehydrogenase activity assay ..........................................................................
35
Crystal violet staining...........................................................................................................
35
In vitro fluorophore generation.........................................................................................
35
Cyanide assay protocol........................................................................................................
Chapter 3: Phenotypic Differentiation Between LNCaP and C4-2 cells, a model of Prostate
37
Cancer Progression.....................................................................................................................
37
3.1 Introduction .......................................................................................................................
39
3.2 R esults.................................................................................................................................
45
3.3 D iscussion ...........................................................................................................................
50
ork.....................................................................................................................
W
Further
3.4
51
3.5 R eferences...........................................................................................................................
57
Chapter 4: U 0126 is a m itochondrial inhibitor ..................................................................
57
4.1 Introduction .......................................................................................................................
. ...... 60
4.2 R esults... ............................................................................................................
U 0126 Correlating Fluorescence.........................................................................................
U 0126 and M itochondrial Inhibition..................................................................................
62
64
U 0126 M itochondrial Inhibition is Biologically Relevant..................................................
Chemical M echanism of M itochondrial Inhibition................................................................
66
68
4.3 D iscussion ...........................................................................................................................
4.4 Further work......................................................................................................................
4.5 R eferences...........................................................................................................................
5 G lutam ine Metabolism and Resveratrol Toxicity ................................................................
5.1 Introduction .......................................................................................................................
5.2 R esults.................................................................................................................................
70
73
73
77
77
78
Glucose Inhibition Hypothesis ...........................................................................................
80
5.3 D iscussion ...........................................................................................................................
5.4 Further work......................................................................................................................
5.5 R eferences...........................................................................................................................
Chapter 6: Concluding Rem arks...........................................................................................
In vitro disease progression model of prostate cancer......................................................
Secondary m echanism of action of U0126.............................................................................
Understanding resveratrol in biological systems..............................................................
Convergence of U0126 and resveratrol ............................................................................
Cancer research and the need for shifting paradigm s .......................................................
References...............................................................................................................................
A ppendix....................................................................................................................................
Extraneous Data: U0126 Fluorophore as a Fluorescent Mitochondrial Marker ............
Endnotes .................................................................................................................................
84
86
89
93
93
94
95
96
101
101
105
105
106
8
List of Figures
Figure 3-1...................................................................................................
40
F igure 3-2 ........................................................................................................................
42
F igu re 3-3 ............................................................................................................................
44
Figure 3-4.....................................................................................................46
Figure 3-5......................................................47
Figu re 3-6 ...............................................................................................................................
49
Figu re 4-1......................................................................................................................................6
1
Figu re 4-2......................................................................................................................................63
F igure 4-3......................................................................................................................................65
F igu re 4-4......................................................................................................................................67
F igu re 4-5 .................................................................................................................................................................
69
Figure 5-1..........................................................................................................................79
Figure 5-2...........................................................81
Figure 5-3.................................................................................................................................83
Figure 5-4.................................................................................................
85
Figure 5-5.................................................................................................
87
Figure 5-6.................................................................................................
88
Figure A-1...................................................................................................................................105
List of Tables
T able 4-1..................................................................................................
59
T able 4-2...................................................................................................
72
Abbreviations
ADT - androgen deprivation therapy
AhR - aryl-hydrocarbon receptor
AICAR - 5 -Aminoimidazole-4-carboxamide ribotide
AIF - apoptosis initiating factor
AMPK -5' AMP-activated protein kinase
AOA - amino oxyacetate
AR - androgen receptor
ATP - adenosine triphosphate
DNA - Deoxyribonucleic acid
DON - 6-diazo-5-oxo-L-norleucine
EGF - epidermal growth factor
EGFR - epidermal growth factor receptor
ELISA - enzyme linked immunosorbent assay
ER - endoplasmic reticulum
FCCP - carbonyl cyanide-p-trifluoromethoxyphenylhydrazone
KO - knock out
LDH - lactic acid dehydrogenase
MAPK - mitogen-activated protein kinase
MnSOD - Manganese superoxide dismutase
NADH - reduced nicotinamide adenine dinucleotide
NE - neuroendocrine
PAR - poly ADP ribose
PARP - poly ADP ribose polymerase
PBS - phosphate buffered saline
PCR - polymerase chain reaction
P13K - phosphoinositide-3-kinase
PIP3 - dephosphorylates phosphatidylinositol (3,4,5)-trisphosphate
PSA - prostate specific antigen
PTEN - phosphatase and tensin homolog
ROS - reactive oxygen species
TCA - citric acid cycle
UDP-GlcNAC - UDP-glucosamine
WT - wild type
a-KG - alpha-ketoglutarate
12
Chapter 1: Introduction
Prostate cancer is the leading diagnosed cancer and the second leading cause of cancer
related death in American men (1). Prostate specific antigen (PSA) is the major clinical
biomarker used to detect prostate cancer in patients and PSA expression is driven by the major
hormone receptor in the prostate called the androgen receptor (AR) (2). Elevated circulating
PSA leads to clinical follow up with a tissue biopsy to grade the abnormal growth and determine
the appropriate therapeutic strategy (3). While PSA measurement is the clinical standard, it is
also controversial because the test can detect disease in asymptomatic patients who may never
progress to a clinically relevant stage. PSA screening has doubled diagnoses (4), but 20-50
patients must be diagnosed to prevent one prostate cancer related fatality (5)(6). Current
guidelines suggest monitoring for prostate cancer from age 50 to 75, though not all organization
endorse the use of PSA testing (7)(8)(9). Analysis of autopsy data indicates as much as 75% of
histologically identifiable prostate cancer may never progress to warrant clinical intervention
(10). Current efforts in prostate cancer research are focused on finding novel biomarkers and
diagnostics to delineate which patients will progress to aggressive disease.
The Prostate
The prostate is an excretory gland that produces the prostatic fluid. The prostate exports
high levels of citrate extracted from the citric acid (TCA) cycle as a component of the prostatic
fluid (11). Citrate production from the prostatic mitochondria is elevated due to low expression
of aconitase, the enzyme responsible for the conversion of citrate to isocitrate, thereby
accumulating adequate citrate for export (12, 13) by cation dependent transporters. In patients
with prostate cancer, citrate levels in the prostatic fluid decrease and imaging techniques can
measure lowered citrate as a clinical diagnostic for disease (14). Citrate is also the initial
substrate for lipid and cholesterol synthesis and intrinsically high levels of citrate in the prostate
may drive the biosynthetic processes critical to tumor growth. Elevated lipid production through
the overexpression of fatty acid synthase in prostate cancer progression has been documented in
tumor samples (15). Prostate specific metabolism including adapted use of the TCA cycle to
produce citrate may be one variable of interest in understanding the high incidence of disease in
this organ.
Treatment Strategies
Current prostate cancer treatments for early stage disease include directed radiation or
surgical resection to destroy or remove the diseased tissue. If the disease has progressed outside
the organ, is inoperable, or returns following radiation/ surgery the current clinical standard of
care is androgen deprivation therapy (ADT). Current ADT practices include a combination of
chemical or physical castration with androgen receptor inhibitors, flutamide (16) or bicalutamide
(17). The inhibitors are meant to counteract any low level of hormone still being produced in the
body. These strategies show marked decreases in PSA levels shortly after treatment begins, but
are only effective for six months to two years before PSA levels resurge and treatment options
are severely limited.
While ADT is effective for a short duration, the therapy has profound side effects on
patients and greatly impacts their quality of life. Specifically, ADT induces a variety of
metabolic syndrome phenotypes including weight gain and insulin resistance(1 8). In addition,
patients lose lean muscle mass, increase their risk of heart attacks, and fractures (18). The
metabolic side effects of ADT are particularly intriguing given that metabolic syndrome is linked
to increased risk of many types of cancer (19) and specifically disease progression in prostate
cancer (20). These data imply ADT treatment of the disease may inherently induce disease
progression and increase prostate cancer mortality.
Limited treatment options for advanced and aggressive prostate cancer have led to the
development of novel therapeutics to target the hypothesized mechanisms of PSA recurrence.
Current theories surrounding rebounding PSA levels include intra-organ hormone production
(21), ligand independent activation of the receptor (22), or hypersensitivity of the AR to low
ligand concentrations (23). Intra-organ hormone production is inhibited by the CYP17 inhibitor
Abiraterone and this agent is showing efficacy in clinical trials (24). Ligand independent
activation of the AR may be inhibited by a sponge derived compound which binds the Nterminus of the protein (25). This sponge compound can inhibit splice variants of the AR
lacking the ligand binding domain (26). Recurrent activation of the AR has lead to development
of higher potency AR inhibitors that are effective in cell lines, mouse models and humans (27,
28). All of these drugs suppress AR transcriptional activity temporarily, but PSA levels rebound
and the disease do not go into remission.
Signaling in Prostate Cancer
In the 1940s, prostate cancer disease was discovered to be sensitive to androgen levels in
the blood, androgenic signaling in cells, and the androgen receptor (29). The androgen receptor
is a transcription factor in the nuclear receptor gene family and is activated by the hormone
androgen. The androgen receptor was cloned in the late 1980s (30) and has become the most
heavily studied biochemical pathway in the field of prostate cancer research. Dogmatically, the
AR is believed to be a centrally important protein in prostate cancer through the regulation of
large transcriptomes during the course of disease progression (31). The role of the AR and its
downstream gene targets in prostate cancer initiation and progression to lethal disease are still
incompletely understood. Androgens have been linked to the induction of lipogenic genes
including FAS, HMG-CoA, and SREBP (32) which are linked to a shift in prostate metabolism
and disease development. While the androgen receptor is traditionally considered to mediate
pro-growth stimuli, recent work has implied the AR may also have a tumor suppressor function
as well consistent with its role as a mediator of prostatic epithelial cell differentiation (33). A
multitude of proteins bind AR as coactivators and corepressors a scenario that complicates a
mechanistic understanding of the role of the AR in cancer (34). In addition, the alterations in
genomic silencing through DNA methylation can shift the program induced by the AR to
enhance disease (35).
Other important signaling nodes in prostate cancer cells include phosphoinositide-3kinase (P13K) which can be constitutively active when its downstream inhibitor phosphatase and
tensin homolog (PTEN) is lost, a common occurrence in advanced prostate cancer (36). PTEN
dephosphorylates phosphatidylinositol (3,4,5)-trisphosphate (PIP3) produced by P13K to inhibit
downstream activation of Akt, a potent survival kinase linked to lipogenesis (37). Even in wild
type PTEN cancer cells, PI3K/Akt signaling can be activated by the epidermal growth factor
receptor (EGFR) and other growth factor receptors and cytokine receptors. Proteins within this
pathway can be mutated, overexpressed, or aberrantly activated in prostate cancer (38) (39).
Additional growth factor pathways have been implicated in prostate cancer development and
aggressiveness, including IGFR (40) and IL6 (22).
Another downstream effecter of growth factor signaling is the MEK/ERK kinase cascade.
The MEK/ERK pathway is a member of the mitogen-activated protein kinase family and
propagates upstream signals with switch like kinetics driving downstream pro-growth, prosurvival transcription (41). MEK/ERK activation is correlated with prostate cancer disease
progression (42) and MEK inhibition reduces breast cancer xenograft growth (43). In vivo MEK
inhibition experiments have not been performed in prostate cancer models providing a potential
novel approach for combating prostate cancer disease progression. MEK/ERK is a pro-survival,
pro-growth kinase cascade inducing of API transcription factors and gene expression (44) and
has the potential be an important pro-survival signal for tumor cells in vivo.
Cellular signaling events found in vitro have been evaluated in a variety of clinical
samples, but unbiased screening for common node perturbations in clinical samples has only
recently become available. Specifically, DNA sequencing technology has evolved to allow for
genomic profiling of numerous tumors and has provides insight into the heterogeneity of prostate
cancer (45). One study found extensive upregulation of MYC and P13K in tandem (46). MYC
is an oncogenic transcription factor regulating lipogenesis and metabolism related genes. MYC
overexpression in cell lines enhances their death response to metabolic perturbations like
glutamine deprivation (47) and may indicate a potential weakness to target in vivo. Profiling
individual tumors may help physicians design effective therapies to target specific altered
signaling pathways as demonstrated by Erlotinib's efficacy against activating EGFR mutations
(48). In prostate cancer, the coordinated loss of PTEN and overexpression of MYC defines a
subset of patients (46) who might benefit from new profiling technologies and potentially
metabolism targeted therapies.
Dietary Contribution to Prostate Cancer
Androgen and growth factor signaling were the major nodes investigated to treat prostate
cancer over the last ten years, but epidemiological data indicates external variables such as diet,
life style, and behaviors may play a major role in prostate cancer incidence. Specifically,
prostate cancer incidence is significantly higher in western developed nations. Increased
incidence partially correlates with screening, but epidemiological studies of migrant populations
reveal an environmental dependence. Japanese men immigrating to the San Francisco Bay area
had a five fold increase in prostate cancer incidence compared to their counterparts living in
Japan as documented in 1975 by the California Department of Public Health (49). Many other
studies have followed and illustrate a consistent trend of increased prostate cancer incidence in
immigrant populations compared to their native counterparts when they move to western
industrialized nations (50)(5 1). Understanding the basis for this potential dietary, societal, or life
style component of prostate cancer induction may lead to effective chemopreventive strategies to
decrease incidence or keep disease from progressing in the majority of the population.
Diet and Cancer
Immigration to the United States correlates with a shift in dietary consumption and
lifestyle (52). Obesity in the US has significantly increased from 1988 - 2008 (53). In
developing nations, dietary shifts in food consumption are speculated to link with an increased
incidence of cancer and preventative dietary recommendations may be effective (54). Increased
processed sugar and cholesterol intakes have been linked to metabolic disorders (55-57) such as
obesity which has in turn been linked to increased cancer risk (19). In prostate cancer, a recent
meta-analysis of cohort datasets found a 15-20% increased mortality and 21% increased disease
recurrence in prostate cancer for individuals for every 5kg/m2 increase in body mass index (19).
Other studies have found an inverse correlation between prostate cancer incidence and obesity
(58) creating confusion, but recent data have shown strong positive correlations between risk of
advanced disease and obesity (20).
Given the prevalence of metabolic disorders, large cohort studies have searched for links
between metabolism and cancer by evaluating cancer risk in patients taking statins, a cholesterol
lowering drug. A European study found a correlation between decreased prostate cancer
incidence and statin use (59) (60), though the latest US cohort data set was unable to make any
conclusions about prostate cancer and statins. However, the US cohort did report statins prevent
other types of cancer (61).
Inconclusive links between statins and prostate cancer may be
influenced by over diagnosis with PSA testing or failure to detect benign disease which may
never progress to be clinically relevant. Additionally, the cholesterol uptake inhibitor Ezetibibe
can inhibit prostate cancer xenograft growth and vascularization in a mouse model supporting a
role for cholesterol metabolism in cancer growth (62, 63). Clearly, more data needs to be
collected and analyzed before conclusions can be drawn about statins as chemopreventives.
From a molecular biology perspective, cholesterol levels can influence cellular signaling
networks by altering membrane structures and altered signaling dynamics can affect processes
like metabolism (64). Specifically, cholesterol levels in cellular membranes can modulate lipid
raft structures (65), influence growth factor receptor mobility (66), and activate kinases like Akt
(67). The potential integration of dietary cholesterol with tumorogenic signaling cascades
warrants additional consideration of statins and other cholesterol lower drugs as
chemopreventives.
Beyond statins, the drug metformin is prescribed to many diabetic patients to increase
their insulin sensitivity by activating the AMP kinase, but may also reduce cancer incidence.
From cohort studies, metformin use correlates with decreased incidence of prostate cancer (68)
implying it may be a suitable chemopreventive. The prolonged use of statins and metformin and
association with decreased cancer incidence support the potential for further investigation and
development of metabolism oriented drugs. While small molecule drugs like statins and
metformin may function as chemopreventives or chemotherapeutics, perhaps the larger
implication of these data is the importance of explicit dietary interventions to decrease cancer
incidence as well as metabolic syndrome and cardiovascular disease.
Metabolism and Cancer
One of the earliest observations about cancer and metabolism was made by Otto Warburg
in the 1920s when he reported the increased metabolic rate of cancer cells (69). Warburg
postulated respiration was no longer necessary, but in fact many cancer cells have functional
mitochondria [reviewed in (70)]. Interest in metabolism and cancer has resurged in recent years
thanks to work linking metabolism to cell signaling (71) (68) along with the epidemiological
evidence mentioned previously. From a therapeutic perspective, in vivo manipulation of cancer
metabolism has been attempted with a few drugs including 2-deoxyglucose (72), 6-diazo-5-oxoL-norleucine (DON) (73), and dichloracetate (74). 2-deoxyglucose and DON are glucose and
glutamine analogs, respectively, and demonstrate some efficacy (72) (73) especially when
combined (75). In contrast, dichloracetate operates by shifting metabolism from glycolysis to
oxidative phosphorylation, in direct contrast to cancer cell metabolic preferences. Dichloracetate
is currently in clinical trials (74) and hopefully only one of many new metabolism based
chemotherapeutic approaches. Beyond small molecule drugs, tumor specific metabolism favors
specific imaging technologies based on the acidity of the tumor microenvironment (76) and
metabolite differences (14, 76). Precise imaging of tumors with metabolism based technologies
could help with surgical extraction, diagnosis, and monitoring. Prostate cancer is
characteristically a slow growing disease and monitoring abnormal growth at high resolution
may assist in defining the appropriate subset for aggressive treatment while maintaining the
quality of life for many others.
Glucose is the major source of carbon and energy for proliferating cells engaged in
biosynthetic processes like lipid synthesis and glycosylation. Glucose is broken down in
glycolysis generating ATP, NADH, and pyruvate. Pyruvate is then further decomposed by either
lactic acid dehydrogenase to produce lactic acid or the citric acid (TCA) cycle to generate ATP
and biosynthetic precursors such as citrate and malate. Even though the breakdown of glucose is
well studied, recent work implies pyruvate can be generated without ATP production by an
alternative pathway and potentially enhance biosynthetic rates (77). This novel pathway may be
critical in fast growing, heavily biosynthetic cancer cells.
The other major carbon source for cells is glutamine. Glutamine is imported into cells for
many biosynthetic processes including amino acid and nucleotide base synthesis, and as a major
nitrogen source. In addition, glutamine can be used in a process called glutaminolysis to
enhance lipogenesis. Glutaminolysis is the break down of glutamine into glutamate then aketoglutarate which can be routed into the TCA cycle [reviewed in (78)]. Glutamine
supplementation of the TCA cycle helps maintain substrate flux while citrate is diverted to feed
catabolic processes including lipid and cholesterol synthesis (79). In vitro cell culture medium is
supplemented with glutamine at 2mM along with glucose to improve cellular proliferation rates
(80), but the level of glutamine exceeds the in vivo plasma concentration of 0.5mM (81). The
process of glutaminolysis has been documented in prostate cancer cells in culture and linked to
the transcription factor MYC which regulates glutaminase, the enzyme responsible to converting
glutamine to glutamate (82). Additionally, glutaminolysis in breast cancer is hormone
responsive (83) and in prostate cancer is an inherent part of normal metabolism for citrate export
(12, 13). The role of glutamine both in culture and in vivo may be crucial to the normal function
of the prostate as well as the increased lipogenesis seen in prostate cancer. Further investigation
into glutamine metabolism in prostate cancer seems warranted based on the potential role of
metabolism in this disease system.
Systemic glutamine levels are generally important in cancer, especially in late stage
patients suffering from cachexia. Cachexia is the loss of muscle mass, weight, and extreme
fatigue associated with a variety of disease processes which eat away at the body's fuel reserves.
It is characterized by low glutamine levels in the blood and subsequent immune system
suppression and organ failure [reviewed in (84)]. Glutamine depletion from the circulation is
hypothesized to occur in cancer due to high uptake and excessive consumption of the amino acid
by tumor cells (84). Combating the effects of cachexia with glutamine supplementation has
produced mixed results and may simultaneously fuel tumor growth while improving patient
quality of life (84).
Prostate cancer is a high impact disease in the United States. Current diagnostics cannot
delineate patients with indolent verse aggressive disease, and classic therapeutics are ineffective
in the latter case. Novel strategies are needed to effectively manage and treat prostate cancer and
one proposed approach is long term chemopreventive drugs to suppress disease initiation and
progression. However, for rationally designed chemopreventives to be effective, we must first
understand the variables driving the disease at the molecular, cellular, organ, systemic, and
societal levels. Over these various orders of magnitude the common theme of metabolism
emerges. Cell signaling events at the molecular level are classically linked to abnormal cellular
proliferation but these signals can also drive and be influenced by metabolic processes such as
cholesterol production, membrane lipid composition, and intra-organ hormone production. At
the organ level, the prostate is already primed metabolically to produce excess citrate which can
be rerouted as a precursor for lipid and cholesterol synthesis. Enhanced biosynthesis from citrate
is known to correlate with prostate cancer and enhanced cellular proliferation rates implying the
organ may be predisposed to inducing disease. From a systemic and societal perspective,
prostate cancer risk is associated with dietary trends and the life style of the western
industrialized world where excess consumption of high fat, high cholesterol foods is common.
Integrating the impact and importance of metabolism across multiple orders of magnitudes
supports a substantial role for metabolism in prostate cancer and further research efforts on the
topic.
The significance of metabolism in prostate cancer evolved throughout the time I worked
on my thesis and emerged within my work, but I started in a very different place. Initially, my
work focused on understanding the role of kinases and signaling networks in prostate cancer
disease progression. The goal was to identify nodes and weakness in late stage disease which
could be targeted therapeutically. While perturbing an in vitro model of disease progression with
small molecule inhibitors against a single kinase target, it became clear the drugs hit additional
targets and shifted cell metabolism. Intrigued by the implications of these observations and the
emerging literature about metabolism in cancer, I choose to pursue the secondary effect of an
inhibitor known as U0126. The work evolved and expanded to illustrate a substantial differential
mitochondrial function in disease progression consistent with the increased biosynthetic
production of lipids and cholesterol previously witnessed in prostate cancer tumor samples.
Overall, the work contained herein followed a nontraditional path, but coalesces to support the
overarching role of metabolism in prostate cancer initiation and progression.
References
1. Jemal A, Siegel R, Ward E, Hao Y, Xu J, Thun MJ. Cancer statistics, 2009. CA Cancer J Clin.
2009 Jul-Aug;59(4):225-49.
2. Chan DW, Bruzek DJ, Oesterling JE, Rock RC, Walsh PC. Prostate-specific antigen as a
marker for prostatic cancer: A monoclonal and a polyclonal immunoassay compared. Clin Chem.
1987 Oct;33(10):1916-20.
3. Freedland SJ. Screening, risk assessment, and the approach to therapy in patients with prostate
cancer. Cancer. 2011 Mar 15;117(6):1123-35.
4. Heijnsdijk EA, der Kinderen A, Wever EM, Draisma G, Roobol MJ, de Koning HJ.
Overdetection, overtreatment and costs in prostate-specific antigen screening for prostate cancer.
Br J Cancer. 2009 Dec 1;101(11):1833-8.
5. Welch HG, Albertsen PC. Prostate cancer diagnosis and treatment after the introduction of
prostate-specific antigen screening: 1986-2005. J Natl Cancer Inst. 2009 Oct 7; 101(19):1325-9.
6. Draisma G, Boer R, Otto SJ, van der Cruijsen IW, Damhuis RA, Schroder FH, de Koning HJ.
Lead times and overdetection due to prostate-specific antigen screening: Estimates from the
european randomized study of screening for prostate cancer. J Natl Cancer Inst. 2003 Jun
18;95(12):868-78.
7. Tang P, Sun L, Uhlman MA, Robertson CN, Polascik TJ, Moul JW. Prostate-specific antigen
velocity based risk-adapted discontinuation of prostate cancer screening in elderly men. BJU Int.
2010 Nov 2
8. Harris R, Lohr KN, Beck R, Fink K, Godley P, Bunton AJ. . 2002 Oct
9. Wolf AM, Wender RC, Etzioni RB, Thompson IM, D'Amico AV, Volk RJ, Brooks DD, Dash
C, Guessous I,Andrews K, DeSantis C, Smith RA, American Cancer Society Prostate Cancer
Advisory Committee. American cancer society guideline for the early detection of prostate
cancer: Update 2010. CA Cancer J Clin. 2010 Mar-Apr;60(2):70-98.
10. Etzioni R, Cha R, Feuer EJ, Davidov 0. Asymptomatic incidence and duration of prostate
cancer. Am J Epidemiol. 1998 Oct 15;148(8):775-85.
11. Costello LC, Franklin RB. The clinical relevance of the metabolism of prostate cancer; zinc
and tumor suppression: Connecting the dots. Mol Cancer. 2006 May 15;5:17.
12. Costello LC, Franklin RB. The intermediary metabolism of the prostate: A key to
understanding the pathogenesis and progression of prostate malignancy. Oncology. 2000
Nov;59(4):269-82.
13. Costello LC, Franklin R, Stacey R. Mitochondrial isocitrate dehydrogenase and isocitrate
oxidation of rat ventral prostate. Enzyme. 1976;21(6):495-506.
14. Heerschap A, Jager GJ, van der Graaf M, Barentsz JO, de la Rosette JJ, Oosterhof GO,
Ruijter ET, Ruijs SH. In vivo proton MR spectroscopy reveals altered metabolite content in
malignant prostate tissue. Anticancer Res. 1997 May-Jun;17(3A):1455-60.
15. Mycielska ME, Broke-Smith TP, Palmer CP, Beckerman R, Nastos T, Erguler K, Djamgoz
MB. Citrate enhances in vitro metastatic behaviours of PC-3M human prostate cancer cells:
Status of endogenous citrate and dependence on aconitase and fatty acid synthase. Int J Biochem
Cell Biol. 2006;38(10):1766-77.
16. Irwin RJ, Prout GR,Jr. A new antiprostatic agent for treatment of prostatic carcinoma. Surg
Forum. 1973;24:536-7.
17. Furr BJ, Valcaccia B, Curry B, Woodburn JR, Chesterson G, Tucker H. ICI 176,334: A novel
non-steroidal, peripherally selective antiandrogen. J Endocrinol. 1987 Jun;1 13(3):R7-9.
18. Taylor LG, Canfield SE, Du XL. Review of major adverse effects of androgen-deprivation
therapy in men with prostate cancer. Cancer. 2009 Jun 1;115(11):2388-99.
19. Cao Y, Ma J. Body-mass index, prostate cancer-specific mortality and biochemical
recurrence:A systematic review and meta-analysis. Cancer Prev Res (Phila). 2011 Jan 13
20. Freedland SJ, Platz EA. Obesity and prostate cancer: Making sense out of apparently
conflicting data. Epidemiol Rev. 2007;29:88-97.
21. Mizokami A, Koh E, Izumi K, Narimoto K, Takeda M, Honma S, Dai J, Keller ET, Namiki
M. Prostate cancer stromal cells and LNCaP cells coordinately activate the androgen receptor
through synthesis of testosterone and dihydrotestosterone from dehydroepiandrosterone. Endocr
Relat Cancer. 2009 Dec;16(4):1139-55.
22. Kim 0, Jiang T, Xie Y, Guo Z, Chen H, Qiu Y. Synergism of cytoplasmic kinases in IL6induced ligand-independent activation of androgen receptor in prostate cancer cells. Oncogene.
2004 Mar 11;23(10):1838-44.
23. Gregory CW, Johnson RTJr, Mohler JL, French FS, Wilson EM. Androgen receptor
stabilization in recurrent prostate cancer is associated with hypersensitivity to low androgen.
Cancer Res. 2001 Apr 1;61(7):2892-8.
24. Danila DC, Morris MJ, de Bono JS, Ryan CJ, Denmeade SR, Smith MR, Taplin ME, Bubley
GJ, Kheoh T, Haqq C, Molina A, Anand A, Koscuiszka M, Larson SM, Schwartz LH, Fleisher
M, Scher HI. Phase II multicenter study of abiraterone acetate plus prednisone therapy in patients
with docetaxel-treated castration-resistant prostate cancer. J Clin Oncol. 2010 Mar
20;28(9):1496-501.
25. Sadar MD, Williams DE, Mawji NR, Patrick BO, Wikanta T, Chasanah E, Irianto HE, Soest
RV, Andersen RJ. Sintokamides A to E, chlorinated peptides from the sponge dysidea sp. that
inhibit transactivation of the N-terminus of the androgen receptor in prostate cancer cells. Org
Lett. 2008 Nov 6;10(21):4947-50.
26. Watson PA, Chen YF, Balbas MD, Wongvipat J, Socci ND, Viale A, Kim K, Sawyers CL.
Constitutively active androgen receptor splice variants expressed in castration-resistant prostate
cancer require full-length androgen receptor. Proc Natl Acad Sci U S A. 2010 Sep
28;107(39):16759-65.
27. Scher HI, Beer TM, Higano CS, Anand A, Taplin ME, Efstathiou E, Rathkopf D, Shelkey J,
Yu EY, Alumkal J, Hung D, Hirmand M, Seely L, Morris MJ, Danila DC, Humm J, Larson S,
Fleisher M, Sawyers CL, Prostate Cancer Foundation/Department of Defense Prostate Cancer
Clinical Trials Consortium. Antitumour activity of MDV3 100 in castration-resistant prostate
cancer: A phase 1-2 study. Lancet. 2010 Apr 24;375(9724):1437-46.
28. Tran C, Ouk S, Clegg NJ, Chen Y, Watson PA, Arora V, Wongvipat J, Smith-Jones PM, Yoo
D, Kwon A, Wasielewska T, Welsbie D, Chen CD, Higano CS, Beer TM, Hung DT, Scher HI,
Jung ME, Sawyers CL. Development of a second-generation antiandrogen for treatment of
advanced prostate cancer. Science. 2009 May 8;324(5928):787-90.
29. Wattenberg CA. Carcinoma of the prostate gland, and benefits of diethylstilbestrol or
orchiectomy. Mo Med. 1945 Aug;42:482-5.
30. Norris JS, Kohler PO. Characterization of the androgen receptor from a syrian hamster
ductus deferens tumor cell line (DDT1). Science. 1976 May 28;192(4242):898-900.
31. Chen H, Libertini SJ, George M, Dandekar S, Tepper CG, Al-Bataina B, Kung HJ, Ghosh
PM, Mudryj M. Genome-wide analysis of androgen receptor binding and gene regulation in two
CWR22-derived prostate cancer cell lines. Endocr Relat Cancer. 2010 Oct 5;17(4):857-73.
32. Heemers H, Vanderhoydonc F, Roskams T, Shechter I, Heyns W, Verhoeven G, Swinnen JV.
Androgens stimulate coordinated lipogenic gene expression in normal target tissues in vivo. Mol
Cell Endocrinol. 2003 Jul 31;205(1-2):21-31.
33. Niu Y, Altuwaijri S, Lai KP, Wu CT, Ricke WA, Messing EM, Yao J, Yeh S, Chang C.
Androgen receptor is a tumor suppressor and proliferator in prostate cancer. Proc Natl Acad Sci
U S A. 2008 Aug 26;105(34):12182-7.
34. Heemers HV, Tindall DJ. Androgen receptor (AR) coregulators: A diversity of functions
converging on and regulating the AR transcriptional complex. Endocr Rev. 2007 Dec;28(7):778808.
35. Wang Q, Li W, Zhang Y, Yuan X, Xu K, Yu J, Chen Z, Beroukhim R, Wang H, Lupien M,
Wu T, Regan MM, Meyer CA, Carroll JS, Manrai AK, Janne OA, Balk SP, Mehra R, Han B,
Chinnaiyan AM, Rubin MA, True L, Fiorentino M, Fiore C, Loda M, Kantoff PW, Liu XS,
Brown M. Androgen receptor regulates a distinct transcription program in androgen-independent
prostate cancer. Cell. 2009 Jul 23;138(2):245-56.
36. Bertram J, Peacock JW, Fazli L, Mui AL, Chung SW, Cox ME, Monia B, Gleave ME, Ong
CJ. Loss of PTEN is associated with progression to androgen independence. Prostate. 2006 Jun
15;66(9):895-902.
37. Porstmann T, Griffiths B, Chung YL, Delpuech 0, Griffiths JR, Downward J, Schulze A.
PKB/Akt induces transcription of enzymes involved in cholesterol and fatty acid biosynthesis via
activation of SREBP. Oncogene. 2005 Sep 29;24(43):6465-81.
38. Peraldo-Neia C, Migliardi G, Mello-Grand M, Montemurro F, Segir R, Pignochino Y,
Cavalloni G, Torchio B, Mosso L, Chiorino G, Aglietta M. Epidermal growth factor receptor
(EGFR) mutation analysis, gene expression profiling and EGFR protein expression in primary
prostate cancer. BMC Cancer. 2011 Jan 25; 11:31.
39. Shah RB, Ghosh D, Elder JT. Epidermal growth factor receptor (ErbB1) expression in
prostate cancer progression: Correlation with androgen independence. Prostate. 2006 Sep
15;66(13):1437-44.
40. Krueckl SL, Sikes RA, Edlund NM, Bell RH, Hurtado-Coll A, Fazli L, Gleave ME, Cox ME.
Increased insulin-like growth factor I receptor expression and signaling are components of
androgen-independent progression in a lineage-derived prostate cancer progression model.
Cancer Res. 2004 Dec 1;64(23):8620-9.
41. Huang CY, Ferrell JE,Jr. Ultrasensitivity in the mitogen-activated protein kinase cascade.
Proc Natl Acad Sci U S A. 1996 Sep 17;93(19):10078-83.
42. Gioeli D, Mandell JW, Petroni GR, Frierson HF,Jr, Weber MJ. Activation of mitogenactivated protein kinase associated with prostate cancer progression. Cancer Res. 1999 Jan
15;59(2):279-84.
43. Hoeflich KP, O'Brien C, Boyd Z, Cavet G, Guerrero S, Jung K, Januario T, Savage H,
Punnoose E, Truong T, Zhou W, Berry L, Murray L, Amler L, Belvin M, Friedman LS, Lackner
MR. In vivo antitumor activity of MEK and phosphatidylinositol 3-kinase inhibitors in basal-like
breast cancer models. Clin Cancer Res. 2009 Jul 15;15(14):4649-64.
44. Schubbert S, Shannon K, Bollag G. Hyperactive ras in developmental disorders and cancer.
Nat Rev Cancer. 2007 Apr;7(4):295-308.
45. Taylor BS, Schultz N, Hieronymus H, Gopalan A, Xiao Y, Carver BS, Arora VK, Kaushik P,
Cerami E, Reva B, Antipin Y, Mitsiades N, Landers T, Dolgalev I, Major JE, Wilson M, Socci
ND, Lash AE, Heguy A, Eastham JA, Scher HI, Reuter VE, Scardino PT, Sander C, Sawyers CL,
Gerald WL. Integrative genomic profiling of human prostate cancer. Cancer Cell. 2010 Jul
13;18(1):11-22.
46. Clegg NJ, Couto SS, Wongvipat J, Hieronymus H, Carver BS, Taylor BS, Ellwood-Yen K,
Gerald WL, Sander C, Sawyers CL. MYC cooperates with AKT in prostate tumorigenesis and
alters sensitivity to mTOR inhibitors. PLoS One. 2011 Mar 4;6(3):e 17449.
47. Wise DR, DeBerardinis RJ, Mancuso A, Sayed N, Zhang XY, Pfeiffer HK, Nissim I,
Daikhin E, Yudkoff M, McMahon SB, Thompson CB. Myc regulates a transcriptional program
that stimulates mitochondrial glutaminolysis and leads to glutamine addiction. Proc Natl Acad
Sci U S A. 2008 Dec 2;105(48):18782-7.
48. Rosell R, Moran T, Queralt C, Porta R, Cardenal F, Camps C, Majem M, Lopez-Vivanco G,
Isla D, Provencio M, Insa A, Massuti B, Gonzalez-Larriba JL, Paz-Ares L, Bover I, GarciaCampelo R, Moreno MA, Catot S, Rolfo C, Reguart N, Palmero R, Sanchez JM, Bastus R, Mayo
C, Bertran-Alamillo J, Molina MA, Sanchez JJ, Taron M, Spanish Lung Cancer Group.
Screening for epidermal growth factor receptor mutations in lung cancer. N Engl J Med. 2009
Sep 3;361(10):958-67.
49. Dunn JE. Cancer epidemiology in populations of the united states--with emphasis on hawaii
and california--and japan. Cancer Res. 1975 Nov;35(1 1 Pt. 2):3240-5.
50. Rastogi T, Devesa S, Mangtani P, Mathew A, Cooper N, Kao R, Sinha R. Cancer incidence
rates among south asians in four geographic regions: India, singapore, UK and US. Int J
Epidemiol. 2008 Feb;37(1):147-60.
51. Lee J, Demissie K, Lu SE, Rhoads GG. Cancer incidence among korean-american
immigrants in the united states and native koreans in south korea. Cancer Control. 2007
Jan;14(1):78-85.
52. Finkelstein EA, Strombotne KL. The economics of obesity. Am J Clin Nutr. 2010
May;91(5):1520S-4S.
53. Ogden CL, Lamb MM, Carroll MD, Flegal KM. Obesity and socioeconomic status in adults:
United states, 2005-2008. NCHS Data Brief. 2010 Dec;(50)(50):1-8.
54. Divisi D, Di Tommaso S, Salvemini S, Garramone M, Crisci R. Diet and cancer. Acta
Biomed. 2006 Aug;77(2):118-23.
55. Duffey KJ, Gordon-Larsen P, Steffen LM, Jacobs DR,Jr, Popkin BM. Drinking caloric
beverages increases the risk of adverse cardiometabolic outcomes in the coronary artery risk
development in young adults (CARDIA) study. Am J Clin Nutr. 2010 Oct;92(4):954-9.
56. Della-Morte D, Gardener H, Denaro F, Boden-Albala B, Elkind MS, Paik MC, Sacco RL,
Rundek T. Metabolic syndrome increases carotid artery stiffness: The northern manhattan study.
Int J Stroke. 2010 Jun;5(3):138-44.
57. Towfighi A, Saver JL, Engelhardt R, Ovbiagele B. A midlife stroke surge among women in
the united states. Neurology. 2007 Nov 13;69(20):1898-904.
58. Parekh N, Lin Y, Dipaola RS, Marcella S, Lu-Yao G. Obesity and prostate cancer detection:
Insights from three national surveys. Am J Med. 2010 Sep;123(9):829-35.
59. Breau RH, Karnes RJ, Jacobson DJ, McGree ME, Jacobsen SJ, Nehra A, Lieber MM, St
Sauver JL. The association between statin use and the diagnosis of prostate cancer in a
population based cohort. J Urol. 2010 Aug;184(2):494-9.
60. Murtola TJ, Tammela TL, Maattanen L, Huhtala H, Platz EA, Ala-Opas M, Stenman UH,
Auvinen A. Prostate cancer and PSA among statin users in the finnish prostate cancer screening
trial. Int J Cancer. 2010 Oct 1;127(7):1650-9.
61. Jacobs EJ, Newton CC, Thun MJ, Gapstur SM. Long-term use of cholesterol-lowering drugs
and cancer incidence in a large united states cohort. Cancer Res. 2011 Feb 22
62. Pelton K, Di Vizio D, Insabato L, Schaffner CP, Freeman MR, Solomon KR. Ezetimibe
reduces enlarged prostate in an animal model of benign prostatic hyperplasia. J Urol. 2010
Oct;184(4):1555-9.
63. Solomon KR, Pelton K, Boucher K, Joo J, Tully C, Zurakowski D, Schaffner CP, Kim J,
Freeman MR. Ezetimibe is an inhibitor of tumor angiogenesis. Am J Pathol. 2009
Mar;174(3):1017-26.
64. Ushio-Fukai M, Hilenski L, Santanam N, Becker PL, Ma Y, Griendling KK, Alexander RW.
Cholesterol depletion inhibits epidermal growth factor receptor transactivation by angiotensin II
in vascular smooth muscle cells: Role of cholesterol-rich microdomains and focal adhesions in
angiotensin II signaling. J Biol Chem. 2001 Dec 21;276(51):48269-75.
65. Waugh MG, Lawson D, Hsuan JJ. Epidermal growth factor receptor activation is localized
within low-buoyant density, non-caveolar membrane domains. Biochem J. 1999 Feb 1;337 ( Pt
3)(Pt 3):591-7.
66. Orr G, Hu D, Ozcelik S, Opresko LK, Wiley HS, Colson SD. Cholesterol dictates the
freedom of EGF receptors and HER2 in the plane of the membrane. Biophys J. 2005
Aug;89(2):1362-73.
67. Zhuang L, Kim J, Adam RM, Solomon KR, Freeman MR. Cholesterol targeting alters lipid
raft composition and cell survival in prostate cancer cells and xenografts. J Clin Invest. 2005
Apr;115(4):959-68.
68. Monami M, Colombi C, Balzi D, Dicembrini I, Giannini S, Melani C, Vitale V, Romano D,
Barchielli A, Marchionni N, Rotella CM, Mannucci E. Metformin and cancer occurrence in
insulin-treated type 2 diabetic patients. Diabetes Care. 2011 Jan;34(1):129-31.
69. Warburg 0. On the origin of cancer cells. Science. 1956 Feb 24;123(3191):309-14.
70. Moreno-Sanchez R, Rodriguez-Enriquez S, Marin-Hernandez A, Saavedra E. Energy
metabolism in tumor cells. FEBS J. 2007 Mar;274(6):1393-418.
71. Christofk HR, Vander Heiden MG, WuN, Asara JM, Cantley LC. Pyruvate kinase M2 is a
phosphotyrosine-binding protein. Nature. 2008 Mar 13;452(7184):181-6.
72. Stein M, Lin H, Jeyamohan C, Dvorzhinski D, Gounder M, Bray K, Eddy S, Goodin S,
White E, Dipaola RS. Targeting tumor metabolism with 2-deoxyglucose in patients with
castrate-resistant prostate cancer and advanced malignancies. Prostate. 2010 Sep
15;70(13):1388-94.
73. Lynch G, Kemeny N, Casper E. Phase II evaluation of DON (6-diazo-5-oxo-L-norleucine) in
patients with advanced colorectal carcinoma. Am J Clin Oncol. 1982 Oct;5(5):541-3.
74. Michelakis ED, Sutendra G, Dromparis P, Webster L, Haromy A, Niven E, Maguire C,
Gammer TL, Mackey JR, Fulton D, Abdulkarim B, McMurtry MS, Petruk KC. Metabolic
modulation of glioblastoma with dichloroacetate. Sci Transl Med. 2010 May 12;2(3 1):3 1ra34.
75. Qin JZ, Xin H, Nickoloff BJ. 2-deoxyglucose sensitizes melanoma cells to TRAIL-induced
apoptosis which is reduced by mannose. Biochem Biophys Res Commun. 2010 Oct
15;401(2):293-9.
76. Vavere AL, Biddlecombe GB, Spees WM, Garbow JR, Wijesinghe D, Andreev OA,
Engelman DM, Reshetnyak YK, Lewis JS. A novel technology for the imaging of acidic prostate
tumors by positron emission tomography. Cancer Res. 2009 May 15;69(10):4510-6.
77. Vander Heiden MG, Locasale JW, Swanson KD, Sharfi H, Heffron GJ, Amador-Noguez D,
Christotk HR, Wagner G, Rabinowitz JD, Asara JM, Cantley LC. Evidence for an alternative
glycolytic pathway in rapidly proliferating cells. Science. 2010 Sep 17;329(5998):1492-9.
78. Shanware NP, Mullen AR, Deberardinis RJ, Abraham RT. Glutamine: Pleiotropic roles in
tumor growth and stress resistance. J Mol Med. 2011 Mar;89(3):229-36.
79. Kovacevic Z, McGivan JD. Mitochondrial metabolism of glutamine and glutamate and its
physiological significance. Physiol Rev. 1983 Apr;63(2):547-605.
80. Eagle H, Oyama VI, Levy M, Horton CL, Fleischman R. The growth response of mammalian
cells in tissue culture to L-glutamine and L-glutamic acid. J Biol Chem. 1956 Feb;218(2):607-16.
81. Preuss HG, Bise BB, Schreiner GE. The determination of glutamine in plasma and urine.
Clin Chem. 1966 Jun; 12(6):329-37.
82. Gao P. Tchernyshyov I, Chang TC, Lee YS, Kita K, Ochi T, Zeller KI, De Marzo AM, Van
Eyk JE, Mendell JT, Dang CV. c-myc suppression of miR-23a/b enhances mitochondrial
glutaminase expression and glutamine metabolism. Nature. 2009 Apr 9;458(7239):762-5.
83. Forbes NS, Meadows AL, Clark DS, Blanch HW. Estradiol stimulates the biosynthetic
pathways of breast cancer cells: Detection by metabolic flux analysis. Metab Eng. 2006
Nov;8(6):639-52.
84. Kuhn KS, Muscaritoli M, Wischmeyer P, Stehle P. Glutamine as indispensable nutrient in
oncology: Experimental and clinical evidence. Eur J Nutr. 2010 Jun;49(4):197-2 10.
28
Chapter 2: Methods
The following methods and reagents were employed in the work that follows. Most
methods are standard biochemical assays learned from working in the laboratory and reading
journal articles. At times, commercial kits were acquired to simplify and increase the accuracy
of the assays. Two specific protocols were adapted from the literature and optimized to fit the
requirements of the work including: lactic acid assay and cyanide detection kit. In addition, all
extractions and analysis of the fluorescence generated from U0126 was built off basic
purification protocols from the literature, but adopted to the system in question. All protocols
are listed according to their first appearance in the ensuing experimental results of Chapter 3, 4,
and 5.
Reagents
All cell lines (LNCaP, HEK293T, HELA, DU145, COS) were acquired from American
Type Culture Collection (ATCC) with the exception of the C4-2 cells which were a gift from
Dan Gioeli from University of Virginia. BY4741 yeast and Protein BCA kit were obtained from
Thermo Fisher Scientific (Huntsville, AL). Resveratrol, PD98059, PD325901, PD184161,
U0126, JC-1 Mitochondrial Membrane Potential Assay Kit, LDH Cytotoxicitiy assay kit,
roscovitine, and olomoucine were obtained from Cayman Chemicals (Ann Arbor, MI). U0124
and U0125 were obtained from EMD Chemicals (Darmstadt, Germany). SL327 was obtained
from Tocris Bioscience (Ellisville, MO). Mitotracker CMXRos, H2DCFDA, 200mM Lglutamine, RPMI 1640, DMEM low glucose, and McCoy's medium were obtained from
Invitrogen (Carlsbad, CA). Recombinant human EGF was obtained from R&D Systems
(Minneapolis, MN). Vectashield mounting medium for fluorescence with DAPI was obtained
from Vector Laboratories (Burlingame, CA). Sodium oxamate, FCCCP, Antimycin A, 2-deoxyD-glucose, O-(carboxymethyl)hydroxylamine hemihydrochloride (AOAA), L-cycloserine, 6diazo-5-oxo-L-norleucine (DON), dimethyl 2-oxoglutarate, crystal violet, AICAR, Chk2
Inhibitor II, tunicamycin, Superoxide dismutate (#S-215), glucosamine, nocodazole, colchicine
and trypan blue were obtained from Sigma (Saint Louis, MO). Oligomycin was obtained from
Cell Signaling Technologies (Danvers, MA). CellTiter Glo Luminescent Cell Viability Assay
was obtained from Promega (Madison, WI). Antibodies against cleaved PARP (#9541), Lamin
A/C (#2032), p4 4 / 4 2 MAPK (ERK1/2) (#4695), and phospho-p44/42 MAPK (ERK1/2) (#9101),
total EGFR (#2232), ATM/ATR substrate motif (#2851), ASCT2(V05 1) (#5345), phos (T68)Chk2 (#2661), phos(T389) p70S6K (#9205), phos(T172)-AMPK(#2535), CHOP (#2895),
phos(S209) eiF4e (#9741), ,anti-mouse IgG, HRP-linked (#7076) and anit-rabbit IgG, HRPlinked (#7074) were obtained from Cell Signaling Technologies (Danvers, MA). Antibody
against a-tubulin (TU-02, sc-8035) was obtained from Santa Cruz Biotechnology (Santa Cruz,
CA). Antibodies against p-actin (AC-15) and MnSOD (2A1) were obtained from Abcam
(Cambridge, MA).
Cell culture
LNCaP, C4-2 were grown in RPMI 160 medium with 2mM L-glutamine 10% heat
inactivated fetal bovine serum, 100units/mL penicillin and 100pg/mL streptomycin.
DU145, HELA, COS, Hek293T were grown in low glucose DMEM with 10% heat inactivated
fetal bovine serum and 100units/mL penicillin and 10Opg/mL streptomycin.
T24 were grown in McCoy's 5A medium with 10% heat inactivated fetal bovine serum,
100units/mL penicillin and 100 ig/mL streptomycin. All cells were maintained in a 37C
humidified incubator with 5% C02.
For experiments, cells were plated at 2.5e4 cells/cm 2 and allowed to attach to plate for 48
hours in full growth media. Then cells were placed in serum free media for 12 hours prior to
drug exposure for an additional 9-60 hours.
Western blotting
Cells were lysed for westerns in lysis buffer (50mM
p-glycerophosphate,
10mM Sodium
pyrophosphate, 30mM sodium fluoride, 50mM Tris pH 7.5, 1%Triton X-100, 150mM NaCl,
1mM benzamidine, 2mM EGTA, 100ptM sodium orthovanadate with Complete Mini protease
inhibitors from Roche.) Samples were spun to pellet insoluble components and protein was
quantified with Protein BCA kit from Thermo.
Cleared lysates were run on ReadyGel format from Biorad. Proteins were transferred to
PVDF membranes and block in 5% milk or 5% BSA in accordance with manufacturer's
recommendations. Primary antibodies were diluted in blocking solution at 1:2000 with the
exception of a-tubulin (1:10,000) and p-actin (1:20,000) and incubated at 4C overnight.
Secondary antibodies were diluted at 1:2500 in PBS-0. 1%tween and incubated for 1 hour at
room temperature. Blots were visualized on film with Western Lightning Chemiluminescence
Reagent from Perkin Elmer.
Nucleosome ELISA
Nucleosome Cell Death ELISA kit was acquired from Roche Applied Sciences
(Indianapolis, IN) and used according to the instructions. Cells were lysed after 12 hours of
resveratrol treatment with incubation buffer supplied in the kit. Lysed cells were pelleted with a
12,000rpm centrifugation for 20 minutes. Supernatant was diluted 1:10 in incubation buffer and
100ul of dilutes samples was incubated in ELISA wells. ELISA was quantified with a FLUOstar
Omega plate reader by absorbance at 415nm.
Cell counting
Media was removed and reserved. Trypsin was added to the plate and once cells rounded,
trypsin was neutralized with serum containing media and added to the reversed media. Cells
were pelleted with a 5min spin at 1000rpm and resuspended in an appropriate volume of PBS.
Cells were then diluted 1:2 in trypan blue and counted with a hemocytometer.
Reactive oxygen species assay
Reactive oxygen species were assays from live cells with the fluorescent indicator
H2DCFDA. Cells were plated in black 96 well plates, allowed to adhere for 48 hours, and serum
starved for 12 hours. A solution of H2DCFDA at 7.7mg/mL was prepared in 0.1M sodium
carbonate and then diluted to 1pM in PBS to create a working solution. Cells were incubated in
1p M H2DCFDA for 15 minutes after serum starvation. Following incubation, new warmed
culture media with DMSO or 1OpM U0126 was exchanged for the working solution. Cells were
monitored for ROS generation by fluorescence excitation of 490nm and emission at 420nm at
indicated time points.
Lactic acid assay
Assay was adapted from (1). Briefly, cells were incubated under desired conditions for
24 hours. Media was collected from the plates and spun at 12,000g to pellet any floating cells or
debris. Media was dilutes 1:4 for use in the assay. Assay contains 100pL of cleared/ diluted
media in 280mM hydrazine, 467mM glycine, 2.6mM ethylenediaminetetraacetic acid, 2.5mM
p-
nicotinamide adenine dinucleotide and 250 units of L-lactic dehydrogenase. Absorbance was
monitored at 340nm continuously in a FLUOstar Omega plate reader every thirty seconds for 1
hour. Steady state absorbance values for each condition were normalized to cell protein content.
Immunofluorescence imaging
For U0126 fluorescence analysis, cells were plated on glass cover slips at a density of
1x10 4 cells/cm 2 . For mitochondrial visualization, MitoTracker CMXRos was dosed into the
media at 1OOnM for 15 minutes prior to experiment termination. At indicated time cells were
fixed in 3% paraformadehyde for 5 minutes, rinsed in phosphate buffered saline (PBS) and
mounted on microscope slides with Vectorshield mounting media with DAPI. Slides were
analyzed on a Zeiss Microscope (Burlingame, CA).
For staining protocols with ASCT2 and the in vivo purified fluorophore, after fixation
cover slips were blocked for 1 hour in 0.5% bovine serum albumin (BSA) in PBS. Primary
antibody was incubated at 1:100 dilution for ASCT2 or with purified fluorophore (amount
recovered from one confluent plate exposed to lOM U0126 for 12 hours) in 0.5% BSA, PBS
for 1 hour. Slides were washed and ASCT2 stained slides were incubated with cy3-anti rabbit
secondary for 30 minutes in 0.5% BSA, PBS. After extensive washing with PBS, cover slips
were mounted on microscope slides with VectorShield mounting media with DAPI. Slides were
analyzed on a Zeiss Microscope (Burlingame, CA).
ASCT2 localization was scored manually on a Zeiss Microscope by counting nuclei and
the presence or absence of punctate ASCT2 staining associated with each nuclei. For each
condition (done in biological triplicates) 100 or more cells were scored from a minimum of ten
fields.
Cell fractionation
A cell fractionation kit was acquired from MitoSciences (Eugene, OR) and used a
directed. C4-2 cells were serum starved and then incubated with 1OuM U0126 for 12 hours.
Cells were collected and lysed following the kit instructions.
Fluorophore purification and characterization
Cells were scrapped off plates and lysed in phosphate buffered saline with 1%NP-40
with protease inhibitors for 20 minutes on ice. Fluorophore intensity was measured on a
FLUOstar Omega plate reader with an excitation filter of 355nm and an emission filter of 460nm.
For fluorophore characteristics, cells were lysed in phosphate buffered saline with 1%
NP-40. Cleared supernatant was heated to 95C for 1min and then put on ice to precipitate
proteins. Proteins were removed with 5 minute 12,000g spin. Supernatant was then combined
with a 1/10 volume of saturated ammonium acetate solution to precipitate the fluorophore into a
hydrophobic drop on the surface. The hydrophobic precipitate was captured and used for
excitation/ emission characterization on a Spectramax M2E Molecular Devices (Sunnyvale, CA).
Yeast cultures and fluorescence measurements
Yeast were grown in standard media containing: 1%yeast extract, 2% peptone, and 2%
dextrose or on plates containing: 1%yeast extract, 2% peptone, 2% dextrose, and 2% agar.
Yeast were streaked onto plates and allowed to grow into colonies for 48 hours. Liquid cultures
were inoculate with single colonies and grown at 30*C with 300rpm for 24 hours. For
fluorescence generation experiments, yeast were grown 1mL cultures in the presence of 0.001%
DMSO or 10pM U0126 for 24 hours. Cultures were collected and cell concentration was
measured by OD600. Individual culture volumes were adjusted to standardize total cells assayed
across all conditions. Cells were then pelleted and lysed in 500uL 1%NP40 in phosphate
buffered saline with mechanical disruption from glass beads (sigma # G8772) by vortexing for 3,
1 minute intervals. Cellular debris was pelleted by centrifugation at 12,000g for 5 minutes and
supernatant was assayed on a FLUOstar Omega plate reader with excitation and emission filters
of 355nm/460nm, respectively.
STE7 knockout (STE7 KO) BY4741 yeast strain was verified by polymerase chain
reaction (PCR) with primers designed in the upstream and downstream sequence surrounding the
STE7 wild type (WT) gene, and within the STE7 WT gene or the KanMX cassette. Primers
were designed by Dr Samuel Hasson (NIH) with Clone Manager Suite 7 and include:
KanMXForward: ATGCGCCAGAGTTGTTTC; KanMXReverse:
AACTCACCGAGGCAGTTC; UpstreamForward: GCCCATCTGATGGATTAG;
DownstreamReverse: GGTGAAACACAGGCTAAC; STE7Forward:
TGGCGTACTAAATGGCTTGG; and STE7Reverse: TGCCTTCACCACAGTTCC. Yeast
DNA template for PCR was prepared from individual yeast colonies of WT or STE7 KO.
Colonies were collected from YPD agar plates, resuspended in 10pL of 0.02M sodium hydroxide,
and heated to 95C for 10 minutes. PCR was performed with Platinum PCR SuperMix High
Fidelity (Invitrogen), 3ptL of yeast DNA template, and primers at a final concentration of 200nM.
Amplified DNA from PCR reactions was electrophoresed on 0.7% agarous gels and visualized
with SYBR Gold Nuclei Acid Gel Stain (Invitrogen) under ultraviolet light.
Mitochondrial potential with JC1
At the 12 hours after drug exposure, JCl dye was added to culture media and incubated
for 15 minutes in a 37C humidified incubator. Media and dye were removed and cells were
washed three times with JC-1 wash buffer. Fluorescence was measured with the 485/520 and
544/590 filter sets on the FLUOstar Omega plate reader. Control wells treated with drugs, but
not JC1 were run in parallel and corresponding fluorescent readings were subtracted from stained
wells. Mitochondrial potential was calculated as the ratio between (544/590 - background) /
(485/520 - background).
ATP levels with Cell TiterGlo
Cells were plated in white, opaque 96 well plates and treated with drugs for 9 hours. Cell
TiterGlo reagent was added directly to the wells and incubated for 2 minutes on an orbital rotator
plate. Luminescence was measured over ten minutes on the FLUOstar Omega plate reader.
Steady state values were compared after normalization with protein concentrations from adjacent
wells under the same drug treatment conditions.
Live cell imaging
Images of live cells were taken on a Zeiss Axiovert 40C microscope connected to a
computer which acquired and saved the images.
Lactic acid dehydrogenase activity assay
LDH activity was measured following the directions on the Cayman LDH cytotoxicity
assay kit. Briefly, cells were plated and treated with sodium oxamate for 12 hours at variable
concentrations. Cells from 6 well plates were lysed in 200uL in PBS containing 0.1% Triton X100 and diluted 1:10 in PBS with appropriate sodium oxamate concentration to match culture
conditions. Resulting cleared supernatant was combined with LDH reaction buffer provided in
the kit and absorbance at 490nm was monitored every 20 seconds for 20min on a FLUOstar
Omega plate reader. LDH activity was calculated from the slope of the early linear kinetic phase
and normalized to the vehicle treated control sample.
Crystal violet staining
Media was removed from the cells and stained with 0.5% crystal violet in 25% methanol
for 30 minutes. Cells were washed extensively with water and plates were allowed to dry. Dye
was solubilized from dried plates with 10% acetic acid for 20 minutes and absorbance was
quantified at 595nm on a FLUOstar Omega plate reader.
In vitro fluorophore generation
To generate fluorescence from U0126 in an Eppendorf tube, the following components
were mixed and allowed in incubate at room temperature for 1 hour. 50pL of PBS, 1L of
10mM U0126 dissolved in DMSO or 2pL of 100U/gL superoxide dismutase (Sigma #S-2515) or
luL of 10mM EUK134 and 2pL of hydrogen peroxide, 30% by weight (Sigma #216763). All
permutations of reactions were run in parallel and after 1 hour incubation samples were read on a
fluorimeter with excitation of 320nm and emission 51 Onm.
Cyanide assay protocol
Adapted from (2). Briefly, C4-2 cells were plated, serum starved and treated with 10, 20,
or 40ptM U0126 for 24 hours. Cells were scrapped off plates and pelleted. Cells were lysed with
120piL of 1%NP-40 in PBS for 30 minutes and centrifuged to remove insoluble material. An
aliquot of supernatant was removed for protein quantification by BCA. All samples had protein
contents within 10%. 20uL of supernatant was added to the following reaction mixture: 200 L
of 0.01M potassium phosphate, pH 7.4, 200gL pyridoxal phosphate (0.5mg/mL) and 20pL of
water. The reaction was incubated in a heat block at 80C for 45 minutes and then allowed to
cool to room temperature. Reactions were acidified with 200pL of 10% trichloroacetic acid and
spun at 1500g for 5 minutes to pellet insoluble debris. 57 L of the acidified reaction was mixed
with 143p.L of 2M potassium acetate pH 3.8. Fluorescence was measured from the potassium
acetate mixture by exciting at 320nm and recording emission at 427nm. Each set of samples was
run with a standard curve of sodium cyanide samples and the standard curve was used to convert
experimental sample fluorescence to cyanide concentrations. Each condition was run in
biological triplicates.
References
1. Gutmann I, Wahlefeld A. 1-(+)Lactate: Determination with lactate dehydrogenase and NAD.
In: Bergmeyer H, editor. Methods of Enzymatic Analysis. 2nd ed. ed. New York: Academic
Press; 1974; p. 1464-8.
2. Suzuki 0, Hattori H, Oya M, Katsumata Y. Direct fluorometric determination of cyanide in
human materials. Forensic Sci Int. 1982 Mar-Apr; 19(2):189-95.
Chapter 3: Phenotypic Differentiation Between LNCaP and C4-2 cells, a model of Prostate
Cancer Progression
The objective of the experiments in Chapter 3 was to determine a phenotypic assay that
could identify distinguishing characteristics between the human LNCaP and C4-2 cells line,
which represent early and late stage prostate cancer, respectively. While evaluating cell survival,
I found a differential toxicity to a natural compound, resveratrol, and several responsive
signaling nodes differentially induced between the two cell lines.
3.1 Introduction
In comparison to some other solid tumor systems, there are a limited number of human
prostate cancer cell lines that can be cultivated in vitro and that serve as models for the disease.
LNCaP, PC3, and DU145 are frequently used in vitro models of prostate cancer and they
represent different phases of the disease. However, there are physiologic limitations to each of
these lines. The LNCaP cell line was derived from a lymph node metastasis (1), but displayed
hormone dependence in mouse xenografts (2). In contrast, the PC3 cells were derived from a
bone metastasis (source, ATCCC). Notably, PC3 and DU145 do not express the androgen
receptor (AR), which is expressed in most castrate-resistant prostate cancers in humans. The AR
is the sole member of the nuclear receptor protein family that processes androgenic signals.
Recent progress in prostate cancer research has produced a number of new cell line models with
their own caveats. In the following experiments, I've focused primarily on the LNCaP cell line
which is AR-positive is androgen dependent for its growth in vitro and in mouse xenografts (2).
Conventionally used as a model of early disease, the LNCaP cells display several
contradictory phenotypes in culture. LNCaP cells are able to survive androgen and trophic factor
withdrawal in culture (3, 4) and yet are highly sensitive to phosphoinositide-3 kinase (P13K)
inhibition; P13K inhibitors rapidly induce cell death (5). The LNCaP cells exhibit constitutive
P13K and Akt activation due to loss of the P13K suppressor, phosphatase and tensin homolog (6).
LNCaP cells also harbor a mutated androgen receptor with less substrate specificity than the wild
type protein, allowing it to bind a variety of steroidal hormones including estrogen(7). From a
morphological standpoint, LNCaP cells are also quite distinct from standard prostate epithelial
cells in that they display a long spindle shape with frequent extension of cell processes similar to
neurites { {214 Shen,R. 1997}}. LNCaP cells can be induced to undergo differentiation toward a
neuroendocrine (NE) phenotype in serum free conditions and in response to other culture
manipulations. LNCaP cells in NE-inducing medium are characterized by a circular cell body(8)
and extensive process extension {{214 Shen,R. 1997}}. The clinical relevance of NE features in
prostate adenocarcinoma is still being debated; however human prostate tumors with extensive
patterns of NE differentiation are clinically aggressive (9).
Despite the limitations of the LNCaP cell line model, it has been extensively studied in
the literature, with over 4000 citations in the NCBI Pubmed database. A variety of sub-lines
have been derived from the original LNCaP line and some of these resemble disease progression
to a castrate-resistant state. One model of disease progression was produced by Leland Chung's
laboratory by serially passaging LNCaP cells through mice to select for increasingly aggressive
variants (10). The result of this work was the production of two LNCaP sublines, the C4-2 and
the C4-2b. In vivo, the latter cell line metastasizes to bone, a phenotype of late stage prostate
cancer. In contrast, the C4-2 cells can grow in a castrated mouse without metastasizing (10) and
represent the stage of prostate cancer progression known as castration resistance.
Pairing the LNCaP and C4-2 cells is a powerful tool for examining critical signaling
nodes involved in disease progression without the genomic variation inherent to independently
derived cell lines. The LNCaP/ C4-2 pair have limited mRNA differences, with only 14 to 158
differentially expressed genes identified from array experiments (11-13). Other reported
differences in C4-2 in relation to LNCaP cells include reduced mitochondrial DNA stability and
decreased respiration (14), increased glucose transporter expression (15), and increased
expression of the mitochondrial enzyme creatine kinase (16).
Additional work has evaluated alterations in signaling networks and found differential
sensitivity to HER2 inhibitors (17), increased levels of IGFR1 (18)}, and decreased PKCp[
protein levels in the C4-2 cells compared to the LNCaP cells (19). Cellular signaling from
receptor tyrosine kinases such as HER2 and IGFR1 have been implicated in a variety of cancer
types and are under clinical investigation as therapeutic targets (20). Possibly the most profound
differential signaling found in the LNCaP/ C4-2 pair is a shift from AKT dependence in the
LNCaP cells to mTOR dependence in the C4-2 cells, correlating with a decreased sensitivity to
the androgen receptor antagonist, Casodex (21).(22)
In cell culture assays, C4-2 cells display survival phenotypes common in other aggressive
cancer cell lines when challenged with tumor necrosis factor a-related apoptosis-inducing ligand
(TRAIL) (23), TNFa (24), radiation/ DNA damage response (25), and COX-2 inhibitors
(22). Intriguingly, two investigations showed the inverse relationship, increased sensitivity in
the C4-2 cells compared to the LNCaP cells, when challenged with a natural product, Honokiol,
(26) and to a DNA base analog that inhibits thymidine synthesis (27). These latter observations
are potentially relevant to targeting advanced prostate cancer in patients if they can be translated
into clinically relevant scenarios. C4-2 cells also express several biomarkers characteristic of
disease progression in patient tumor specimens, including CD26 protein (28, 29), upregulated
voltage gate sodium channels (30), and the gene PC-1 (31).
In these studies, I chose the LNCaP/C4-2 progression model as an efficient and plastic
tool to learn about cellular responses to external stimuli. The overall objective was to survey
metabolic pathways in these cells to identify differential nodes in the context of a tumor cell
survival phenotype. The general goal was to gain insight into metabolic perturbations that are
potentially relevant for prostate cancer chemoprevention and therapy.
3.2 Results
LNCaP and C4-2 cells display subtle morphological distinctions in culture. Despite their
epithelial origin, LNCaP cells have an elongated spindle shape, similar to fibroblasts, while the
C4-2 cells are rounder and more compact on standard tissue culture plates. At 70-80%
confluence, C4-2 cells grow in a more compact monolayer compared to LNCaP cells. The
splitting ratio to maintain the two lines in parallel for experimental setups requires a higher
dilution for the C4-2 compared to the LNCaP cells, roughly 1:4 verses 1:3 when split every three
days consistent with the increased growth rate of the C4-2 documented in the literature (21).
Under standard culture conditions, the C4-2 cells acidify their culture media faster compared to
LNCaP cells in a manner consistent with an increased growth rate (21). Morphology, growth
rates, and metabolic observations imply that the C4-2 cells have a subtly shifted phenotype
compared to the LNCaP cells, which may be relevant to the castration resistance of C4-2 cells
seen in mice xenografts and seen clinically with disease progression.
A
C4-2
LNCaP
0
W00
250 kDa
150
100 0-
CACDC
M
-250 kDa
U)
75
-150
-100
+0
- 75
0
Oo
-50
50
Cn
G)
C0
p-actin
-
p-actin
50 ng/ml EGF Time Course
C
C4-2
LNCaP
O
D
DOD
|
D
0
a
CDO
CD C
Total EGFR
p-actin
Figure 3-1: Epidermal growth factor signaling response in LNCaP and C4-2
cells. (a) Phosphotyrosine proteins under basal and 5 minutes of 50ng/mL EGF
stimulation in the C4-2 and LNCaP cells. (b)Phosphotyrosine proteins following 5,
30 or 60 minute stimulation with 50ng/mL of EGF stimulation in the C4-2 and
LNCaP cells. T (c) otal EGFR levels between the LNCaP and C4-2 at baseline and
following EGF treatment.
Divergence in growth rate and metabolism can be linked to growth factor receptor
signaling from autocrine or paracrine activation by cytokines or constitutive activation by
genomic mutations (20). Prostate cancer cells respond to transforming growth factor a, an
epidermal growth factor receptor (EGFR) ligand, by proliferating (6). To investigate the
divergence of the C4-2 and LNCaP cells, I evaluated EGFR signaling in both cell lines. Cells
were plated sub-confluent and serum starved for 12 hours prior to expose to saturating levels
(50ng/mL) of the EGFR ligand, epidermal growth factor (EGF). Activation of receptor tyrosine
kinase activity on downstream substrates was monitored with a phosphotyrosine specific
antibody (4G10) by immunoblotting of whole cell lysates, figure 3-la. The phosphotyrosine
protein level was increased under both basal and ligand stimulated conditions in the C4-2
compared to the LNCaP cells. Examining the dissipation of phosphotyrosine signaling over 1
hours of treatment showed longer signal persistence in the C4-2 cells compared to the LNCaP
cells, figure 3-1b. Total EGFR protein level was approximately the same between the two cell
lines, figure 3.1 c. These data suggest that the C4-2 cells exhibit a hypersensitivity to EGF as
well as increased autocrine signaling, which may result in a survival and growth advantage
relevant to disease progression.
To understand the relevance of EGFR hypersensitivity in the C4-2 cells compared to the
LNCaP cells, I chose to evaluate EGF rescue of a pro-apoptotic stimulus by EGF. The pro-death
stimulus I used was a natural compound, resveratrol, which is cytotoxic to DU145 prostate
cancer cells, but the cell toxicity can be mitigated by EGF stimulation (32). Resveratrol (50pM)
induced elevated programmed cell death in C4-2 compared to LNCaP cells, as measured by
cleaved poly ADP ribose polymerase (PARP) and nucleosome ELISA, figure 3-2a, b. Cell death
was suppressed in C4-2 cells by EGF treatment applied 6 or 9 hours after resveratrol exposure,
figure 3-2c.
All treatment conditions produced a similar decline in viable cell number at 24
hours, figure 3-2d. These data suggest that resveratrol is able to differentiate between early and
late stage disease and is selectively toxic in the more aggressive cell line, the C4-2.
To probe the mechanism behind the higher sensitivity of the C4-2 verses LNCaP cells, I
investigated the signaling events reported in the literature to link resveratrol and EGFR signaling.
Specifically, the MEK/ERK pathway has been documented as a critical node in cell survival
following resveratrol treatment (33) and is an important downstream node from growth factor
receptors implicated in prostate cancer (34). Intriguingly, inhibition of MEK with the MEK
C4-2
0
0
0000
0
0
LNCaP
MN
00L=L=L=L
~~
0
1.4-
0 0
V
1.2-
0
1-
C4-2
-+-
---
+
LNCaP
C4-2 EGF
LNCaP EGF
Cleaved Parp -J 0.8- a-tubulin
0) 0.6-
4000'01
I 1.111,11W
=0~.w
m
--...-
0.4-
z0
EGF 9 hours
post-Resveratrol
I
2.50
*
"
o
o
2-
0
1.50
00
0
DMSO 5pM 10pM 25pM 50pM
[Resveratrol]
EGF 6 hours
post-Resveratrol
I
10.50-
25pM
0.2-
DMVSO
25pM
[Resveratrol]
C4-2 EGF Figure 3-2: Resveratrol induced death
in the LNCaP and C4-2 cells. (a) LNCaP
C4-2
and C4-2 cells in serum free conditions
LNCaP EGF were treated with resveratrol for 12 hours
and death was assayed by western
LNCaP
blotting and probe with cleaved PARP. (b)
Suppression of apoptosis with EGF
stimulation at 6 and 9 hours after
resveratrol dosing. Cell death was
measured by nucleosome ELISA at 12
hours. (c) Resverarol induced death in
the LNCaP and C4-2 cells at 24 hours
after resveratrol treatment by viable cell
counting with trypan blue.
inhibitor U01261 reduced PARP cleavage and DNA fragmentation Figure 3-3a, c. But other
MEK inhibitors of similar potencies and specificities did not reproduce the UO 126 result, figure
3-3a. This finding suggested that inhibition of resveratrol-induced apoptosis by U0126 was
independent of MEK and instead was operating through another mechanism. The mechanism of
action of U0126 in this context and its physiological relevance is further explored in Chapter 4.
The C4-2 cells' increased sensitivity to resveratrol accentuates the essence of cancer
research: How can aggressive cells be selectively targeted to inhibit metastasis and cancer related
death? To elucidate potential nodes where resveratrol may function, I cataloged known
resveratrol targets from the literature2. A subset of these resveratrol sensitive nodes include:
DNA damage response (35), SIRTI (36), AMPK (37), and COX2 (38) and all of these targets
are hypothesized to bind directly with resveratrol, with the exception of AMPK. Many other
proteins are proposed to be involved in resveratrol-induced death, however, given the
multiplicity of cell lines employed in these reports and the inherent variation in biological
systems between laboratories, I chose to focus on the direct targets.
DNA damage is a current chemotherapeutic approach and kills cancer cells by inducing
DNA damage response machinery and cell cycle checkpoints (39). DNA damage response
pathways are often deregulated in cancer allowing cells to bypass checkpoints (40). Resveratrol
is hypothesized to cleave DNA in a copper-dependent manner and activate ATM, one of the
DNA damage kinases (35). To evaluate the DNA damage response, I measured phosphorylation
of the ATM downstream substrate Chk2 on threonine 68, an ATM induced phosphorylation site
(41), and found a robust activation, figure 3-4a. As a measure of the overall network behavior, I
employed a motif-specific antibody for ATM/ATR kinase substrates and probed whole cell
lysate over a 180 minute time course, figure 3-4b. Intriguingly, the C4-2 cells displayed a
different band pattern compared to the LNCaP cells in response to resveratrol treatment, figure
3-4b. A protein band at -37kDa was uniquely activated in the C4-2 cells. Direct identification
of the band was not possible due to poor immunoprecipitation properties of the antibody. An in
silico analysis using a published mass spectrometry dataset (42) did not produce any viable
candidate proteins.
Another target of resveratrol is SIRT 1. Several studies support SIRT 1 as the mediator of
resveratrol's mechanism (43). Recent work has shown AMPK to be the major effecter
pMRes
.~25
D~'
U)C4
004
ND
0
*~'-
400"M.
-.
eew
w"
wlMINen
MOON 0a Owsvw
Cleaved Parp
a-tubulin
30 min 12.5 ng/mL EGF
CD4
0
N-
0
Phos-Erk 1/2
-
~.
-
J=
E
l .
DMSO 25pM
Res
Erk-1/2
~a-tubulin
m
.
.
Res+ 10pM
U0216 U0216
* p<0.1, paired one-tailed T-test
Figure 3-3: U0126 specific reversion of resveratrol induced apoptosis in C4-2 cells.
(a) Dual treatment of resveratrol with 10pM U0126 or 20pM PD98059, but not other MEK
inhibitors reverted resveratrol induced cell death at 12 hours as assayed by western blot.
(b)Western blot establishing MEK inhibitors blocked phosphorylation of ERK under EGF
stimulation. (c) Nucleosome ELISA to confirm 10pM U0126 inhibits of resveratrol induced
apoptosis at 12 hours.
44
downstream of resveratrol in metabolic models. Specifically, in an AMPK null mouse model,
resveratrol showed no effect on suppressing weight gain on a high fat diet (37). AMPK is
activated under basal condition in the LNCaP and C4-2 cells and is slightly elevated upon
resveratrol treatment at very early time points figure 3-5a. Programmed cell death was partially
suppressed with an AMPK activator, AICAR, figure 3-5b. This effect was minimal and not
reproducible. The role of AMPK and the energy status of the cell will be further explored in
Chapters 4 and 5 of this text. A recent report documents the survival of both cell lines requires
AMPK activation as demonstrated in the literature with cytotoxic effects of an AMPK inhibitor,
compound C (44). Linking AMPK to survival in the LNCaP lines supports the clinical relevance
of these cell lines because of recent reports of metformin, an AMPK activator, reducing the
incidence of prostate cancer in diabetic patients (45).
Resveratrol is also known to induce endoplasmic reticulum (ER) stress leading to cell
death (46, 47). Evaluating ER stress in the cell lines showed the C4-2 cells were slightly more
sensitive to an ER stress agent tunicamycin compared to the LNCaP cells, figure 3-6a. In
addition, the level of ER stress induced by resveratrol was also elevated in the C4-2 compared to
the LNCaP cells, as measured by the induction of CHOP as a surrogate for ER stress, figure 36a,b. The CHOP protein expression data shows resveratrol has a minimal downstream effect on
ER stress and the tunicamycin data imply the C4-2 cells may be vulnerable to an unfolded
protein inducer.
Overall, the data in this chapter revealed a finite set of differences between the LNCaP
and C4-2 cells including: elevated autocrine signaling, differential DNA damage responses, and
sensitivity to resveratrol and tunicamycin. The distinctions between the cell lines support altered
metabolic rates and reinforce the signaling changes found in tumor samples spanning disease
progression.
3.3 Discussion
Growth factor signaling in cancer has many potential phenotypic outcomes including:
proliferation, survival, migration, and invasion [reviewed in (48)]. Growth factor signaling has
also been linked to ligand independent activation of the androgen receptor (49) and shifting cell
metabolism toward aerobic glycolysis (50). Increased autocrine signaling found in the C4-2
L.
0
0
L0
4.
S.0
-
U)
~L
oE
Ic
N.
0
Ad
J9C)
M
00
phos-Chk2
Cleaved PARP
phos-Chk2
a-tubulin
Ofoepsm. a-tubulin
ATM/ATR Substrate Antibody: 25 pM Resveratrol Stimulation
C4-2
LNCaP
-I
e eC
c c .S e -C
"
k0
E -g
E
.E
E
E
*E
E
E
E5
150ka--mm--
50 -
m ..
-
-
-,.;,
----
W--
Sample 1
Sample 2
.
-
--
---
-- - *-'*- -"A
-* Sample 1
Sample 2
37-
Sample I
Sample 2
----
--
p-actin
...........-
-
--...
w-
---
---
--
---
---
-.-
- --
Sample 1
--
--
Sample 2
Figure 3-4: DNA damage network response from resveratrol treatment. (a)Phos- Chk2
(T68) is activated by resveratrol treatment at 1 hour in C4-2 cells. (b)ATM/ATR substrate
antibody imaging of LNCaP verses C4-2 cells treated with 25uM resveratrol for the indicated
times. (c) Chk2 inhibitor 11 (C3742, Sigma) induced Chk2 phosphorylation and failed to alter
resveratrol induced death in C4-2 cells.
C4-2
LNCaP
L-
to
R*
L.
(4* T.
T-*
T-
ho-AP
10min0
40 minI
90""# 00 **"MPhos-AMPK
-...
----"11
-000WO
ww.ON...
LNCaP
C4-2
B
o
o~~
-U)
0
0
0N 2
N0
0PhsA
S
B
-
I
4O mO
f)
-p-actin
IVA"
0
C4-2
OcJN LO
0
K
a-tubulin
LNCaP
RIl(
N
LO
MOVAO
mo
1
4 r!"Cleaved
NowCleaved PARP
AMPK activator AICAR slightly inhibits resveratrol induced death by cleaved PARP staining
on western blot, but was only sporadically reproducible.
cells may explain the increased aggressiveness and castration resistance found in xenografts and
altered metabolism in culture (21). An increased metabolic state from autocrine signaling may
also explain the increased sensitivity to AMPK inhibitors (44) and ER stress inducers (51).
Overall, increased growth factor signaling in the C4-2 cells is relevant to prostate cancer disease
progression and rationalizes further studies with the LNCaP/ C4-2 model to understand the
associated phenotypic alterations.
Resveratrol is an intriguing natural compound linked to selectively killing cancer cells in
culture while sparing normal cells (52). How resveratrol can make the distinction is still
unknown and resveratrol had minimal efficacy at inhibiting xenograft growth. However,
resveratrol is known to reverse metabolic disorders in mouse models and inhibit tumor initiation
in carcinogenesis experiments (53). Resveratrol's perturbation of metabolism in vivo may
provide insight into how resveratrol selectively kills cancer cells. The increase autocrine
signaling and altered metabolism of the C4-2 cells makes a compelling case for resveratrol cell
toxicity to be partially dependent on cellular metabolism.
DNA damage response is critical to maintaining genomic stability and propagating
genetic material to the next generation of cells. DNA damaging agents, such as cisplatin, have
been the principal chemotherapeutic reagents to target fast dividing tumor cells. This strategy
has the unfortunate side effect of killing any fast dividing cell regardless of its tumorogenic
character. The DNA damage response of normal cells involves the activation of ATM/ATR and
propagation of signals downstream to p53 to induce cell cycle arrest until the damage is repaired.
If damage is not repairable, cells may initiate programmed cell death to avoid propagating DNA
errors. In cancer cells, DNA damage repair programs can be modified or nonfunctional allowing
cells to continue dividing with damaged DNA [reviewed in (54)].
Understanding how cells escape from DNA damage checkpoints is currently an active
area of investigation. DNA damage induced by resveratrol may be involved in the death
mechanism in the LNCaP/ C4-2 cells, but at this point the potential connection is unclear. The
alteration in DNA damage response signaling identified with the ATM/ATR motif antibody in
the LNCaP verses C4-2 cells is consistent with the decreased sensitivity to radiation and cisplatin
of the C4-2 cells (55) My data and the current literature warrants further comparison of these
lineage
A
.
E
C4-2
LNCaP
C.
0
z-J
Cleaved PARP
CHOP
a-tubulin
B
LNCaP
C4-2
IfD
0
0~
o
0
S
N)
O
0
o
0
CD
to~
0
sus Cleaved PARP
77""
CHOP
ax-tubulin
Figure 3-6: Endoplasmic reticulum stress induction by resveratrol. (a) ER stress was
analyzed on western blots by monitoring the level of CHOP protein induction. Cells were
serum starved for 12 hours and then dosed with tunicamycin at 1pg/mL or resveratrol (Res)
for (a)9 hours (b) 12 hours.
related cell lines to identify signaling nodes responsible for chemotherapeutic and radiation
resistance in advanced prostate cancer.
3.4 Further Work
This portion of my thesis work was an open ended search to find phenotypes and nodes
that could differentiate the two cell lines as a representation of disease progression. As with any
such scientific surveying approach, many avenues were partially investigated or left for future
exploration. One such avenue was the differential DNA damage responses between the two cell
lines and this avenue should be further investigated because of the diversity on DNA damaging
agents used clinically. In addition, with the development of new metabolic profiling
technologies to globally assay metabolites fluxes, unparalleled insights into disease progression
can now be obtained. Understanding metabolism in prostate cancer is particularly relevant due
to the dietary and known metabolic disorders shown to increase disease incidence. The LNCaP
C4-2 cell line model would be ideal for metabolic profiling due to isogenic status and few
documented gene expression alterations. Another conceivable node to evaluate in the system
might be creatine kinase, which is reported to be upregulated in the C4-2 cell line (16), is
involved in energy homeostasis, and is potentially inhibited by resveratrol (56). This connection
seems prudent due to the metabolic difference observed between the cell lines described here and
in the literature.
3.5 References
1. Horoszewicz JS, Leong SS, Chu TM, Wajsman ZL, Friedman M, Papsidero L, Kim U, Chai
LS, Kakati S, Arya SK, Sandberg AA. The LNCaP cell line--a new model for studies on human
prostatic carcinoma. Prog Clin Biol Res. 1980;37:115-32.
2. Horoszewicz JS, Leong SS, Kawinski E, Karr JP, Rosenthal H, Chu TM, Mirand EA, Murphy
GP. LNCaP model of human prostatic carcinoma. Cancer Res. 1983 Apr;43(4):1809-18.
3. Berchem GJ, Bosseler M, Sugars LY, Voeller HJ, Zeitlin S, Gelmann EP. Androgens induce
resistance to bcl-2-mediated apoptosis in LNCaP prostate cancer cells. Cancer Res. 1995 Feb
15;55(4):735-8.
4. Tang DG, Li L, Chopra DP, Porter AT. Extended survivability of prostate cancer cells in the
absence of trophic factors: Increased proliferation, evasion of apoptosis, and the role of apoptosis
proteins. Cancer Res. 1998 Aug 1;58(15):3466-79.
5. Lin J, Adam RM, Santiestevan E, Freeman MR. The phosphatidylinositol 3'-kinase pathway is
a dominant growth factor-activated cell survival pathway in LNCaP human prostate carcinoma
cells. Cancer Res. 1999 Jun 15;59(12):2891-7.
6. Wilding G, Valverius E, Knabbe C, Gelmann EP. Role of transforming growth factor-alpha in
human prostate cancer cell growth. Prostate. 1989;15(1):1-12.
7. Veldscholte J, Voorhorst-Ogink MM, Bolt-de Vries J, van Rooij HC, Trapman J, Mulder E.
Unusual specificity of the androgen receptor in the human prostate tumor cell line LNCaP: High
affinity for progestagenic and estrogenic steroids. Biochim Biophys Acta. 1990 Apr
9;1052(1):187-94.
8. Shen R, Dorai T, Szaboles M, Katz AE, Olsson CA, Buttyan R. Transdifferentiation of
cultured human prostate cancer cells to a neuroendocrine cell phenotype in a hormone-depleted
medium. Urol Oncol. 1997 Mar-Apr;3(2):67-75.
9. Marcu M, Radu E, Sajin M. Neuroendocrine transdifferentiation of prostate carcinoma cells
and its prognostic significance. Rom J Morphol Embryol. 2010;51(1):7-12.
10. Wu HC, Hsieh JT, Gleave ME, Brown NM, Pathak S, Chung LW. Derivation of androgenindependent human LNCaP prostatic cancer cell sublines: Role of bone stromal cells. Int J
Cancer. 1994 May 1;57(3):406-12.
11. Trojan L, Schaaf A, Steidler A, Haak M, Thalmann G, Knoll T, Gretz N, Alken P, Michel
MS. Identification of metastasis-associated genes in prostate cancer by genetic profiling of
human prostate cancer cell lines. Anticancer Res. 2005 Jan-Feb;25(1A):183-91.
12. Chen Q, Watson JT, Marengo SR, Decker KS, Coleman I, Nelson PS, Sikes RA. Gene
expression in the LNCaP human prostate cancer progression model: Progression associated
expression in vitro corresponds to expression changes associated with prostate cancer
progression in vivo. Cancer Lett. 2006 Dec 8;244(2):274-88.
13. Oudes AJ, Roach JC, Walashek LS, Eichner LJ, True LD, Vessella RL, Liu AY. Application
of affymetrix array and massively parallel signature sequencing for identification of genes
involved in prostate cancer progression. BMC Cancer. 2005 Jul 22;5:86.
14. Higuchi M, Kudo T, Suzuki S, Evans TT, Sasaki R, Wada Y, Shirakawa T, Sawyer JR,
Gotoh A. Mitochondrial DNA determines androgen dependence in prostate cancer cell lines.
Oncogene. 2006 Mar 9;25(10):1437-45.
15. Chandler JD, Williams ED, Slavin JL, Best JD, Rogers S. Expression and localization of
GLUTI and GLUT12 in prostate carcinoma. Cancer. 2003 Apr 15;97(8):2035-42.
16. Pang B, Zhang H, Wang J, Chen WZ, Li SH, Shi QG, Liang RX, Xie BX, Wu RQ, Qian XL,
Yu L, Li QM, Huang CF, Zhou JG. Ubiquitous mitochondrial creatine kinase is overexpressed in
the conditioned medium and the extract of LNCaP lineaged androgen independent cell lines and
facilitates prostate cancer progression. Prostate. 2009 Aug 1;69(11):1176-87.
17. Murillo H, Schmidt LJ, Tindall DJ. Tyrphostin AG825 triggers p38 mitogen-activated
protein kinase-dependent apoptosis in androgen-independent prostate cancer cells C4 and C4-2.
Cancer Res. 2001 Oct 15;61(20):7408-12.
18. Krueckl SL, Sikes RA, Edlund NM, Bell RH, Hurtado-Coll A, Fazli L, Gleave ME, Cox ME.
Increased insulin-like growth factor I receptor expression and signaling are components of
androgen-independent progression in a lineage-derived prostate cancer progression model.
Cancer Res. 2004 Dec 1;64(23):8620-9.
19. Jaggi M, Rao PS, Smith DJ, Hemstreet GP, Balaji KC. Protein kinase C mu is downregulated in androgen-independent prostate cancer. Biochem Biophys Res Commun. 2003 Jul
25;307(2):254-60.
20. Jones HE, Gee JM, Hutcheson IR, Knowlden JM, Barrow D, Nicholson RI. Growth factor
receptor interplay and resistance in cancer. Endocr Relat Cancer. 2006 Dec;13 Suppl 1:S45-5 1.
21. Ghosh PM, Malik SN, Bedolla RG, Wang Y, Mikhailova M, Prihoda TJ, Troyer DA,
Kreisberg JI. Signal transduction pathways in androgen-dependent and -independent prostate
cancer cell proliferation. Endoer Relat Cancer. 2005 Mar;12(1):119-34.
22. Shigemura K, Shirakawa T, Wada Y, Kamidono S, Fujisawa M, Gotoh A. Antitumor effects
of etodolac, a selective cyclooxygenase-II inhibitor, against human prostate cancer cell lines in
vitro and in vivo. Urology. 2005 Dec;66(6):1239-44.
23. Eid MA, Lewis RW, Kumar MV. Mifepristone pretreatment overcomes resistance of prostate
cancer cells to tumor necrosis factor alpha-related apoptosis-inducing ligand (TRAIL). Mol
Cancer Ther. 2002 Aug;1(10):831-40.
24. Ko S, Shi L, Kim S, Song CS, Chatterjee B. Interplay of nuclear factor-kappaB and B-myb in
the negative regulation of androgen receptor expression by tumor necrosis factor alpha. Mol
Endocrinol. 2008 Feb;22(2):273-86.
25. Xie BX, Zhang H, Yu L, Wang J, Pang B, Wu RQ, Qian XL, Li SH, Shi QG, Wang LL,
Zhou JG. The radiation response of androgen-refractory prostate cancer cell line C4-2 derived
from androgen-sensitive cell line LNCaP. Asian J Androl. 2010 May;12(3):405-14.
26. Hahm ER, Arlotti JA, Marynowski SW, Singh SV. Honokiol, a constituent of oriental
medicinal herb magnolia officinalis, inhibits growth of PC-3 xenografts in vivo in association
with apoptosis induction. Clin Cancer Res. 2008 Feb 15;14(4):1248-57.
27. Hasegawa M, Miyajima A, Kosaka T, Yasumizu Y, Tanaka N, Maeda T, Shirotake S, Ide H,
Kikuchi E, Oya M. Low dose docetaxel enhances the sensitivity of S-I in a xenograft model of
human castration resistant prostate cancer. Int J Cancer. 2011 Feb 23
28. Pro B, Dang NH. CD26/dipeptidyl peptidase IV and its role in cancer. Histol Histopathol.
2004 Oct;19(4):1345-51.
29. Wilson MJ, Ruhland AR, Quast BJ, Reddy PK, Ewing SL, Sinha AA. Dipeptidylpeptidase
IV activities are elevated in prostate cancers and adjacent benign hyperplastic glands. J Androl.
2000 Mar-Apr;21(2):220-6.
30. Bennett ES, Smith BA, Harper JM. Voltage-gated na+ channels confer invasive properties on
human prostate cancer cells. Pflugers Arch. 2004 Mar;447(6):908-14.
31. Zhang H, Wan LC, Wang J, Zhou JG, Huang CF. Effect of PC-1 gene expression on
migration ability of prostate cancer cells]. Ai Zheng. 2005 Sep;24(9):1043-7.
32. Shih A, Zhang S, Cao HJ, Boswell S, Wu YH, Tang HY, Lennartz MR, Davis FB, Davis PJ,
Lin HY. Inhibitory effect of epidermal growth factor on resveratrol-induced apoptosis in prostate
cancer cells is mediated by protein kinase C-alpha. Mol Cancer Ther. 2004 Nov;3(11):1355-64.
33. Kim AL, Zhu Y, Zhu H, Han L, Kopelovich L, Bickers DR, Athar M. Resveratrol inhibits
proliferation of human epidermoid carcinoma A431 cells by modulating MEKI and AP-1
signalling pathways. Exp Dermatol. 2006 Jul;15(7):538-46.
34. Kinkade CW, Castillo-Martin M, Puzio-Kuter A, Yan J, Foster TH, Gao H, Sun Y, Ouyang
X, Gerald WL, Cordon-Cardo C, Abate-Shen C. Targeting AKT/mTOR and ERK MAPK
signaling inhibits hormone-refractory prostate cancer in a preclinical mouse model. J Clin Invest.
2008 Sep; 118(9):3051-64.
35. Gatz SA, Keimling M, Baumann C, Dork T, Debatin KM, Fulda S, Wiesmuller L.
Resveratrol modulates DNA double-strand break repair pathways in an ATM/ATR-p53- and Nbs 1-dependent manner. Carcinogenesis. 2008 Mar;29(3):519-27.
36. Howitz KT, Bitterman KJ, Cohen HY, Lamming DW, Lavu S, Wood JG, Zipkin RE, Chung
P, Kisielewski A, Zhang LL, Scherer B, Sinclair DA. Small molecule activators of sirtuins
extend saccharomyces cerevisiae lifespan. Nature. 2003 Sep 11;425(6954):191-6.
37. Um JH, Park SJ, Kang H, Yang S, Foretz M, McBurney MW, Kim MK, Viollet B, Chung JH.
AMP-activated protein kinase-deficient mice are resistant to the metabolic effects of resveratrol.
Diabetes. 2010 Mar;59(3):554-63.
38. Subbaramaiah K, Chung WJ, Michaluart P, Telang N, Tanabe T, Inoue H, Jang M, Pezzuto
JM, Dannenberg AJ. Resveratrol inhibits cyclooxygenase-2 transcription and activity in phorbol
ester-treated human mammary epithelial cells. J Biol Chem. 1998 Aug 21;273(34):21875-82.
39. Cutts SM, Nudelman A, Rephaeli A, Phillips DR. The power and potential of doxorubicinDNA adducts. IUBMB Life. 2005 Feb;57(2):73-81.
40. Abraham RT. Cell cycle checkpoint signaling through the ATM and ATR kinases. Genes
Dev. 2001 Sep 1;15(17):2177-96.
41. Ahn JY, Schwarz JK, Piwnica-Worms H, Canman CE. Threonine 68 phosphorylation by
ataxia telangiectasia mutated is required for efficient activation of Chk2 in response to ionizing
radiation. Cancer Res. 2000 Nov 1;60(21):5934-6.
42. Matsuoka S, Ballif BA, Smogorzewska A, McDonald ER,3rd, Hurov KE, Luo J, Bakalarski
CE, Zhao Z, Solimini N, Lerenthal Y, Shiloh Y, Gygi SP, Elledge SJ. ATM and ATR substrate
analysis reveals extensive protein networks responsive to DNA damage. Science. 2007 May
25;316(5828):1160-6.
43. Lagouge M, Argmann C, Gerhart-Hines Z, Meziane H, Lerin C, Daussin F, Messadeq N,
Milne J, Lambert P, Elliott P, Geny B, Laakso M, Puigserver P, Auwerx J. Resveratrol improves
mitochondrial function and protects against metabolic disease by activating SIRTI and PGClalpha. Cell. 2006 Dec 15;127(6):1109-22.
44. Chhipa RR, Wu Y, Mohler JL, Ip C. Survival advantage of AMPK activation to androgenindependent prostate cancer cells during energy stress. Cell Signal. 2010 Oct;22(10):1554-61.
45. Monami M, Colombi C, Balzi D, Dicembrini I, Giannini S, Melani C, Vitale V, Romano D,
Barchielli A, Marchionni N, Rotella CM, Mannucci E. Metformin and cancer occurrence in
insulin-treated type 2 diabetic patients. Diabetes Care. 2011 Jan;34(1):129-31.
46. Park JW, Woo KJ, Lee JT, Lim JH, Lee TJ, Kim SH, Choi YH, Kwon TK. Resveratrol
induces pro-apoptotic endoplasmic reticulum stress in human colon cancer cells. Oncol Rep.
2007 Nov; 18(5):1269-73.
47. Huang TT, Lin HC, Chen CC, Lu CC, Wei CF, Wu TS, Liu FG, Lai HC. Resveratrol induces
apoptosis of human nasopharyngeal carcinoma cells via activation of multiple apoptotic
pathways. J Cell Physiol. 2011 Mar;226(3):720-8.
48. Janmaat ML, Giaccone G. Small-molecule epidermal growth factor receptor tyrosine kinase
inhibitors. Oncologist. 2003;8(6):576-86.
49. Culig Z, Hobisch A, Cronauer MV, Radmayr C, Trapman J, Hittmair A, Bartsch G, Klocker
H. Androgen receptor activation in prostatic tumor cell lines by insulin-like growth factor-I,
keratinocyte growth factor, and epidermal growth factor. Cancer Res. 1994 Oct 15;54(20):54748.
50. Kaplan 0, Jaroszewski JW, Faustino PJ, Zugmaier G, Ennis BW, Lippman M, Cohen JS.
Toxicity and effects of epidermal growth factor on glucose metabolism of MDA-468 human
breast cancer cells. J Biol Chem. 1990 Aug 15;265(23):13641-9.
51. Ozcan U, Cao Q, Yilmaz E, Lee AH, Iwakoshi NN, Ozdelen E, Tuneman G, Gorgun C,
Glimcher LH, Hotamisligil GS. Endoplasmic reticulum stress links obesity, insulin action, and
type 2 diabetes. Science. 2004 Oct 15;306(5695):457-61.
52. Aziz MH, Nihal M, Fu VX, Jarrard DF, Ahmad N. Resveratrol-caused apoptosis of human
prostate carcinoma LNCaP cells is mediated via modulation of phosphatidylinositol 3'kinase/Akt pathway and bcl-2 family proteins. Mol Cancer Ther. 2006 May;5(5):1335-41.
53. Yang CS, Landau JM, Huang MT, Newmark HL. Inhibition of carcinogenesis by dietary
polyphenolic compounds. Annu Rev Nutr. 2001;21:381-406.
54. Yoshida K, Miki Y. The cell death machinery governed by the p53 tumor suppressor in
response to DNA damage. Cancer Sci. 2010 Apr;101(4):831-5.
55. Smith DJ, Jaggi M, Zhang W, Galich A, Du C, Sterrett SP, Smith LM, Balaji KC.
Metallothioneins and resistance to cisplatin and radiation in prostate cancer. Urology. 2006
Jun;67(6):1341-7.
56. Miura T, Muraoka S, Fujimoto Y. Inactivation of creatine kinase induced by stilbene
derivatives. Pharmacol Toxicol. 2002 Feb;90(2):66-72.
56
Chapter 4: U0126 is a mitochondrial inhibitor
Given the contradictory inhibition of apoptosis with the inhibitor U0126 documented in
Chapter 3, I hypothesized U0126 has a secondary mechanism of action and in this chapter I
confirmed U0126 is a mitochondrial inhibitor. Mitochondrial inhibition was deduced from
culture media acidification and confirmed by measuring mitochondrial potential and
mitochondrial dependent ATP production in the presence of UO 126. Cells treated with U0126
become dependent on aerobic glycolysis and dual dosing U0126 with a lactate dehydrogenase
inhibitor produces synergistic cell death confirming the dependence. A chemical mechanism of
U0126's action is postulated and supported, but remains to be proven by structure activity
relationship data.
4.1 Introduction
MEK inhibition is a widely studied in biology due to the intriguing kinetic nature of the
mitogen-activated protein kinase (MAPK) cascades. The cascade involves three sequential
kinases and feedback amplification can lead to a binary output (1). The discovery and
characterization of the kinetics of the cascade elucidates how cells may receive, but selectively
propagate incoming signals from the environment. The MEK/ERK pathway is classically
defined as pro-growth and pro-survival and is implicated in tumor biology [reviewed in (2)].
Targeting MEK in cancer is one mechanism to combat constitutively active or hypersensitive
growth factor receptor signaling networks which lie upstream of multiple MAPK networks.
ERK is a particularly important target in prostate cancer where its activation is enhanced with
disease progression in patient tumor samples (3). In vitro cell culture experiments have
confirmed the role of MEK/ERK in androgen independent activation of PSA expression (4). The
biological and clinical relevance of MEK/ERK has led to the development of small molecule
inhibitors as tools to study the cascade.
One MEK inhibitor developed is U0126. Over 3500 papers have cited U0126 since it
was discovered in 1998, based on a search of the NCBI Pubmed database (5). The inhibitor is
employed in fields as diverse as neurobiology (6), development (7), adipogenesis (8), and cancer
(9). In vivo, U0126 has been used to treat mouse tumor xenografts (10) and ischemia/
reperfusion animal models (6) but has not progressed into clinical trials. U0126 is a widely
available compound with great utility in biological systems, but a subset of articles question the
specificity of the drug. Understanding the chemical structure, binding dynamics, and previous
literature provide a platform on which to further investigate and hypothesize other mechanisms
of action of U0126.
U0126 was produced from the reaction of a conjugated thiol with tetracyanoethane (5)
resulting in a symmetric structure and UO 126 inhibits recombinant MEK with an IC50 of 70nM
(5). Other derivatives of UO126 including U0125 and U0124 are produced from the same
tetracyanoethane reaction, but with different conjugated thiol compounds (5). U0125
demonstrates a ten fold lower affinity for MEK while U0124 has no inhibitory effect and is
considered a negative control compound. Based on structures, U0124 is much smaller and
potentially chemically distinct without the terminal benzene rings, Table 3-1. An additional
analog of UO 126, SL327, contains part of the structure of UO126 and displays similar binding
affinities for MEK (original article explaining SL327).
A variety of chemically distinct MEK inhibitors are also currently available on the
market including: PD98059, PD184161, and PD325901. The latter two compounds have
increased affinity for MEK with IC50 of 10-1OOnM (11) and 0.33nM, (12) respectively and
PD325901 has proceeded into clinical testing (13, 14). The oldest of the MEK inhibitor,
PD98059, is also well documented in the literature and based on NCBI Pubmed database
searching is the most employed MEK inhibitor in biology. PD98059 has a lower affinity for
MEK compared to U0126, with an IC50 of lOM (15), and is typically dosed between 2040AM
in cell culture. Given the diversity of inhibitors against MEK, U0126 and PD325901 stand out
because they both bind to the same structure on MEK as documented from crystal structure
analysis (16). Therefore PD325901 is an invaluable control compound for assaying other
functions of UO 126, and validating these function are independent of MEK.
The specificity of UO 126 for MEK1/2 is based on failure of the drug to inhibit a panel of
11 other kinases (5).
Other potential binding partners or cellular perturbations were not
considered in this report. Several subsequent studies have attributed other functions to U0126.
In 2003, a general study evaluated kinase inhibitor specificity against non-kinases, U0126
inhibited a-chymotripsin,
p-lactamase, and MDH with IC50 values
in the micromolar range, at
least two fold above the IC50 value for MEK1/2. In addition, these investigators hypothesized
Table 4-1: MEK inhibitors
H2
Mek Inhibitors
and measured an aggregation of U0126 particles in solution and postulated the aggregate was
responsible for enzyme inhibition. (17)
Other articles reported off target effects of UO 126 activating AMPK (7) and AhR (18)
and recommend caution when investigating the role of MEK in these signaling pathways. In
contrast, Yung et al found U0126, PD98059 and PD 184161 all kill cells under glucose free
conditions by inhibiting the F IF0atpase and ATP production by oxidative phosphorylation (19,
20). The authors concluded the mechanism of FlFOatpase inhibition is an indirect effect of MEK
(19, 20), however their data set is partially inconsistent and involves excess doses of all three
drugs. Further confusion about U0126 appeared in 2002 when Blank et al documented a
background fluorescence signal correlating with UO 126 treatment in flow cytometry experiments
(21). The authors showed a time, dose, and metabolism dependence to the fluorescence, but
failed to explain the source or cellular impact. Blank et al concluded U0126 should not be used
in flow cytometry experiments (21). These reports suggest a secondary or tertiary mechanism of
action of U0126 in biological systems.
The reported off target effects of UO 126 are an intrinsic liability of any small molecule
drug. Secondary targets of drugs should not be ignored, but provide rationale for careful and
explicit validation and interpretation of biological experiments. Further investigating target
independent effects of small molecule drugs may elucidate biological insights relevant to
interpreting past work and devising future experiments. Given the implication of a MEK
independent function of U0126 in suppressing resveratrol-induced death in the C4-2 cells, I
choose to evaluate how U0126 may further perturb biological systems.
4.2 Results
The U0126 alteration of cell death induced by resveratrol was documented in Chapter 3,
but the shift in apoptosis could not be attributed exclusively to MEK because other MEK
inhibitors failed to confirm the effect, figure 3-3a. The U0126 result implied either a pro-death
role for MEK consistent with current paradigms in neuroscience (6) or an off target effect of the
drug.
-
-- --------
DAPI
Mitotracker
CMXRos
FITC
Channel
Merge
o
o
0
a-tubulin
Lamin A/C
a-tubuin
nousamMn SOD
SLamnin A/C
3.5
3
2.5
2
1.5
1
0.5
94b~' ~,oCo
0
DMSO
U0126
Figure 4-1: U0126 is the only MEK inhibitors producing mitochondrial fluorescence. (a)
LNCaP cells labeled with Mitotracker CMXRos and DAPI staining display a specific
perinuclear fluorescence in the FITC channel after 12 hours of exposure to 10pM U0126. (b)
C4-2 cells were collected and fractioned with a Mitosciences kit. Fluorescence was found only
in the mitochondrial fraction and fractions were confirmed with western blotting. (c)Multiple
MEK inhibitors were incubated with C-2 cells for 12 hours, lysed and fluorescence of the
supernatant was assayed. (d) 10pM U0126 was dosed on a variety of mammalian cell lines
for 12 hours and cell lysates were assayed for fluorescence. (f) BY4741 WT and STE7
knockout (KO) yeast were grown in the presence of 10pM U0126 or DMSO for 24 hours and
fluorescence was quantitated from cell extracts.
U0126 Correlating Fluorescence
While investigating the role of U0126 in resveratrol-induced death 3, I detected a
perinuclear fluorescence signal in the FITC channel in the absence of a FITC secondary antibody
correlating with 1OpM UO 126 treatment alone, figure 4-la. The perinuclear fluorescence colocalized with a mitochondrial specific stain, MitoTracker CMXRos, figure 4-la and was only
present in the mitochondrial fraction from whole cell fractionation confirming mitochondrial
localization, figure 4-1b. The mitochondrial localization of U0126 dependent fluorescence
suggests U0126 may react in the mitochondria or perturb mitochondrial function. Other MEK
inhibitors (20pM PD98059, lpM PD325901 or 1pM PD184161) and analogs of U0126 (10pM
U0124, 10 gM U0125, or 10 M SL327) did not produce fluorescence, figure 4-1c. However,
multiple mammalian cell lines (HELA, COS, DU145, Hek293T) and yeast (BY47141) could
produce fluorescence when treated with 10 M U0126, figure 4-1d. I concluded the specific
structure of U0126 produces or induced fluorescence by a mechanism common to eukaryotic
cells.
To demonstrate U0126 induced fluorescence is independent of MEK, I acquired a STE7
knockout (KO) yeast strain from Open BioSystems (Thermo). STE7 is the yeast homolog of
MEK and the knockout is viable, providing a platform on which to test the fluorescence
dependence on MEK. Yeast knockout strains have the complete gene removed from the genome
and replaced with a KanMX cassette, removing any ambiguity about low gene expression
characteristic of siRNA or shRNA knockdown experiments in mammalian systems. The STE7
KO strain was verified by polymerase chain reaction (PCR) to ensure the correct insertion of the
KanMX cassette in the STE7 locus. STE7 KO and wild type (WT) yeast were cultured for 24
hours in complete medium in the presence of 10 M UO 126 or DMSO and then assayed for
fluorescence generation. Both yeast strains produced the same U0126 fluorescent product found
in the mammalian cells. These data indicate that STE7/MEK is not required for U0126 induced
fluorescence.
To characterize the fluorescence correlating with U0126 treatment, C4-2 whole cell
lysate was fractionated to remove insoluble lipids, membranes, proteins and salt. The final
extraction step was a 2:1:1 chloroform: methanol: water extraction in which the fluorescence
partitioned into the organic phase and the organic solvent was evaporated under vacuum.
Interestingly, the fluorescence was quenched when dissolved in chloroform or methanol. For
.........
..............................
A
2
c
B
3 LNCaP
C
E
0
*
EE
C4--
0
T
0 0
.8
0 1.4)
0
0
DMSO
z
-j
U0126
,
-
I-M
085
p<0.05, two-tailed
**
tstudent
4~0.4
0.61
T-test
-0.4
02
1.21.
7
CL
I -0..4K
0.6.6
D
0.
0j
0l.4
0
)
00.6
0
*
0.
0.x
A C4-2
C4-2 DMSO
U0126
005
~Z
Time in hours
10
Figure 4-2: Mitochondrial Inhibition by U0126. (a) Lactic acid levels in media from LNCaP
and 04-2 cells in serum free media exposed to 10pM U0126 for 24 hours (b) Mitochondrial
membrane potential and (c) mitochondrial dependent ATP levels in 04-2 cells exposed to
10pM U0126, 10pM U0125, 10pM U0124, 1pM PD325901, or 10pM SL327 for 12 or 9 hours
respectively. (d)Reactive oxygen species in C4-2 and LNCaP cells measured with
H2DCFDA were suppressed with 10pM U0126 treatment over a 12 hour time course.
fluorimetric characterization, the fluorescence fraction was dissolved in water and had excitation
and emission peaks of 365±5nmand 420±5nm, respectively. These excitation/ emission peaks
are characteristics of a conjugated Schiff base which has the general structure: (-N=C-C=C-N-)
and is found in lipid peroxidation and other oxidation products (22). However, lipid
peroxidation products are generally extracted from tissues and cell with 2:1 chloroform:
methanol extraction and have measureable fluorescence in the organic solvent mixture (22). The
properties of the fluorescence differ from traditional lipid peroxidation products because the
fluorescence is quenched in organic solvents, but the excitation/ emission characteristics are
within the range for a conjugate Schiff base (22).
Overall this data supports the structure of UO 126 as a critical element in the induction of
fluorescence because the analogs U0125, U0124, and SL327 were unable to induce fluorescence.
The identity of the fluorescence was undeterminable from the characterization, but may contain a
conjugated Schiff base producing solvent dependent fluorescence.
U0126 and Mitochondrial Inhibition
In addition to fluorescence, U0126 treatment altered cell morphology producing a
flattened cell shape (figure 4-3a) and acidified the culture media after 12 to 24 hours. Media
acidification suggests cells may excrete more lactic acid, the final product of aerobic glycolysis.
An absorbance based assay measured increased lactic acid content in the media of UO126 treated
cells at 24 hours compared to vehicle treated control cells, figure 4-2a. Integrating the increased
lactic acid excretion and the mitochondrial fluorescence, I postulated UO 126 may be a
mitochondrial inhibitor independent of MEK inhibition. In fact, UO 126 decreased both
mitochondrial membrane potential, figure 4-2b, and, figure 4-2c, mitochondrial produced ATP at
12 and 9 hours in the C4-2 cells, respectively. The time points were chosen to illustrate how the
mitochondrial inhibition may be relevant to resveratrol-induced death, which starts at 12 hours.
Other MEK inhibitors did not inhibit mitochondrial potential or ATP levels implying the
mitochondrial alterations were independent of MEK. In addition, reactive oxygen species (ROS)
were suppressed in C4-2 and LNCaP cells during the 12 hour exposure to UG 126 compared to
DMSO treated control cells, measured by H2DCFDA, figure 4-2d. This result is contradictory to
most mitochondrial inhibitors which increase ROS production (23), but may hint at an absorption
of ROS by U0126 resulting in modification or degradation of the inhibitor. Specifically, if
A
DMSO
10pM
U0126
1pM
PD325901
1pM
U0124
Medium
50mM
oxamate
I T24
o C4-2
1.2.
.0
U)0.80.6.
0.4
0.2
o
0
zq
C
1.4
U)
0)
0
4)
1.2
1
h
o DMSO
* 10 pM U0126
* 10 pM U0124
* 1 pM PD0325901
1.2
1
0.8
0.6
0.61
0.4
0.2-
0.2
02
0
Vehicle
Vehicle
50
37.5
25
12.5
Sodium Oxamate (mM)
oxamate
Figure 4-3: Biological Relevance of U0126 Mitochondrial Inhibition. (a)C4-2 cell
morphology at 48 hours after exposed to MEK inhibitors and the lactic acid dehydrogenase
inhibitor, sodium oxamate. (b)Cell viability at 48 hours in the C4-2 and T24 cell lines dosed
with Mek inhibitors: U0126 (U)or DMSO (D)and sodium oxamate (OX) at indicated
concentrations. (c) Cell viability from trypan blue cell counts of C4-2 cells exposed to Mek
inhibitors and sodium oxamate for 48 hours. (d)Lactic acid dehydrogenase enzyme rate from
C4-2 cells is inhibited by sodium oxamate predosed onto the cells and inhibitor concentration
was maintained in assay conditions.
UG 126 is able to react with reactive oxygen species, then it may then react with other proteins or
change its structure, perhaps becoming fluorescent. Overall, I concluded U0126 inhibits
mitochondrial function and increases aerobic glycolysis.
UO 126 Mitochondrial Inhibition is Biologically Relevant
All mammalian cells require either aerobic or anaerobic glycolysis to generate energy and
survive. Glycolysis can be auto inhibited if the end product pyruvate is not consumed by the
mitochondria or converted to lactate by lactate dehydrogenase (LDH) and results in cell death. If
U0126 substantially inhibits mitochondrial function and oxidative phosphorylation, then dosing
U0126 with an LDH inhibitor should result in synergistic death. This experiment parallels the
work done previously (19), where the authors demonstrate 50pM U0126 kills astrocytes in
glucose free medium in addition to other cell lines. In this paper death induction by UO 126 was
attributed to MEK because dosing other MEK inhibitors: PD98059 at 75 pM and PD 184161 at
1OgM produced similar results. However, the dosages in for all the inhibitors were substantially
higher than necessary to inhibit MEK/ERK. I move beyond the previous work to show that
U0126 suppression of mitochondrial function is independent of MEK and relevant at a
reasonable concentration of 1OpM. MEK independence is established with the inhibitor
PD325901 which binds to the same site on MEK (16), but with a 100 fold higher affinity (12)
and fails to produce the metabolic phenotypes of U0126.
To evaluate the MEK independence of U0126 on cell metabolism, I dosed U0126 with an
LDH inhibitor, sodium oxamate, on two cancer cell lines, the C4-2 cells and the T24 cells, a
bladder cancer cell line. In tandem, the MEK inhibitor, PD325901, or the U0126 analog U0124
were dosed as control compounds with and without sodium oxamate. Evaluating survival at 48
hours by crystal violet staining, figure 4-3b, and cell counting, figure 4-3c, U0126 induced
synergistic death in both the C4-2 and T24 cell lines while the control compounds did not.
The synergistic death from dual treatment of U0126 and sodium oxamate supports
U0126's function as a potent mitochondrial inhibitor. PD325901 did not induce death when
paired with sodium oxamate supporting U0126 acting independently of MEK to induce death.
This demonstration of synergistic cell death by U0126 in the presence of sodium oxamate
confirms previous reports (11, 24), but here I have also demonstrated independence from MEK.
...................
4.5
41
3.5
3
2.5
2
1.5
1
0.5
0
0
2
CD
2
+ + +
Q
L
CD2 2 2
L
CD
+ + +
+ + +
L+ + +
L L
qC*
LO - W)
:L L
Q
v-
6
U0126
EUK 134
cccP
Antimycin A
7
C)
Ascorbic
Acid
Oligomycin
54.5-
43.5 -
32.52-
o
U-
o Control
O 10 mM Eukl34
M 2 units/pl SOD
1.51-
0.50-
L.
Water
H2 0 2
U0126
H20 2
+ U0126
o2.5 "
0
2
2
E
1.5 *NM
4.5'"
0
o1o
,
).
0
00
0
DMSO 10 pM 10 pM U0126 +
U0126 EUK134EUK134
Figure 4-4: Invitro fluorescence generated from U0126. (a) Fluorescence generation from 3 hour
incubation of 10pM U0126 in COS cells with a variety of antioxidants and mitochondrial inhibitors. (b)
In vitro fluorescence generated from U01 26, hydrogen peroxide, and the MnSOD mimetic, Euk1 34, or
a purified bovine superoxide dismutase. (c) C4-2 cells treated with 10pM U0126, 10pM Euk134 or the
combination for 9 hours. Treatment of U0126 alone induced fluorescence and suppressed
mitochondrial potential, and the effects were enhanced with dual treatment with Euk1 34..
Chemical Mechanism of Mitochondrial Inhibition
To understand how UO 126 inhibits mitochondrial function, I attempted to determine if I
could inhibit U0126 dependent fluorescence generation in COS cells. Given the localization of
the fluorescence in the mitochondria and altered ROS levels with U0126 treatment, antioxidants
and mitochondrial inhibitors were employed to see if oxidative species or mitochondrial function
were responsible for fluorescence induction. Figure 4-4a shows fluorescence levels three hours
after U0126 and simultaneous antioxidant/ inhibitor treatment. Fluorescence was not inhibited
by ascorbic acid, oligomycin, FCCP, or antimycin A, but was enhanced by the MnSOD mimetic,
EUK134. MnSOD is a manganese dependent superoxide dismutase localized in the
mitochondria which scavenges free radicals to mitigate oxidative damage to cellular structures
[reviewed in (25)]. Superoxide dismutatases can also act as electron donors under certain
conditions (26).
Given the enhanced fluorescence with the MnSOD mimetic and the fluorescence
specificity for the structure of UO 126 compared to UO 125, I postulated UO 126 might be directly
modified to produce fluorescence in cells. Cyclization of U0126 has been investigated to
enhance MEK binding properties (27), but none of these products produced fluorescence when I
repeated the published reactions (data not shown). Attempting to modify U0126 by an
alternative reaction, I combined the following in vitro to mimic the mitochondrial environment:
U0126, hydrogen peroxide, and EUK134 and incubated the reaction for an hour. The reaction
produced a soluble fluorescent product and replacing EUK134 with a purified superoxide
dismutase from bovine erythrocytes produced a similar fluorescence. Fluorometric
characterization showed the fluorescence had excitation/ emission peaks of 320+/- 10nm and
510+/- 1Onm. Overall, I concluded U0126 is capable of becoming fluorescent in an oxidative
environment and has the potential to become the fluorescent species found in vivo.
Given the possible direct link between U0126 and induced fluorescence, I wanted to
determine if there was also a link between fluorescence generation and mitochondrial
dysfunction. To establish a correlating relationship between the latter two phenomena, I took
advantage of the ability of EUK134 to enhance fluorescence and determine if mitochondrial
function was further inhibited. EUK134 is a MnSOD mimetic which enhances U0126 induced
fluorescence (figure 4-4a). To test the relation between fluorescence and mitochondrial function,
C4-2 cells were cultured in serum free conditions with 10pIM U0126, 10pM EUK134 or the
U0126
N n
H2
Cyclization
H2
2
1N HCI
H.
Ef
(D 1400-0
E
12001000-
CU
800600-
E
0
400200-,
0
6
o
U
20000
40000
60000
8
80000
U
1
100000
Picomoles U0126
Figure 4-5: Chemical Modification of U0126 Hypothesis. (a) Chemical structure of U0126
and reported cyclization product of U0126 (Dunica, JV et al 1998). (b) Chemical structure of
a known fluorescent compound found in the fluorophore database online. (c) Cyanide ion
quantified from cell lysates after 12 hour exposure of C4-2 cells to 10pM, 20pM, 40pM of
U0126.
combination of the two for 9 hours. U0126 fluorescence was assayed prior to mitochondrial
membrane potential with JC-1 staining. EUK134 enhanced U0126 fluorescence and also further
inhibited mitochondrial function (figure 4-4). This data inversely correlates U0126 induced
fluorescence with mitochondrial function and implies the fluorescence relates to mitochondrial
inhibition. In addition, this data also supports mitochondrial inhibition by UO 126 being
independent of MEK.
Given the potential for UO 126 to become fluorescent through chemical modification, I
attempted to determine if a decomposition product could explain the mitochondrial inhibition.
U0126 has two nitrile groups on its backbone which are chemically incompatible with the
electron conjugation needed for fluorescence because nitrile groups are electronegative. By first
principles, the release of the nitrile groups could support fluorescence induction and
simultaneously generate cyanide, a mitochondrial complex IV inhibitor. This hypothesis was
supported by the structure of a known fluorophore C3-Thiacyanine Dye
(http://www.fluorophores.tugraz.at/),
figure 4-5b, which resembles one of the U0126 cyclization
products, figure 4-5a. Given this comparable compound, I hypothesized that one or both of the
nitrile group might be lost when U0126 decomposed or reacted in the mitochondria.
To test the hypothesis, I incubated 10pM, 20pM, or 40pM U0126 with C4-2 cells for 24
hours and collected whole cell lysates. Adapting a protocol from the literature, I assayed cyanide
ion levels 4 in the cell lysates and found increasing cyanide with increasing U0126 concentrations,
figure 4-5c. The concentration of cyanide in the cell lysates was significantly lower than the
theoretical limit, if all the U0126 had completely decomposed. The cyanide ion level measured
in the experiment may be underestimating the true cyanide level in cells because cyanide readily
degasses from cell culture media (28).
Overall, the results support U0126 inhibiting mitochondrial function at doses commonly
used in the literature and independently of MEK inhibition. U0126 may inhibit mitochondria by
reacting or degrading in the oxidative environment of the mitochondria releasing cyanide, an
inhibitor of complex IV. Understanding the behavior of U0126 in cells may help explain
previous and future contradictions about the role of MEK in biological systems where U0126 is
applied as a small molecule inhibitor.
4.3 Discussion
In this chapter, I confirmed the U0126-induced fluorescence reported previously by
Blank et al. (21) and the mitochondrial inhibition reported by Yung et al. (19). I provided a
substantive link between the two previous reports by localizing the fluorescence in the
mitochondria and demonstrating a possible reaction of UO 126 in the mitochondria to produce a
fluorescent species and release cyanide. I was able to decouple the MEK inhibition from the
action of U0126 in the mitochondria by employing the MEK inhibitor PD325901 which binds
MEK at the same site as U0126, but failed to induce the same metabolic phenotypes. The
composition of the fluorescence remains unknown, but the excitation and emission peaks
correspond to a conjugated Schiff base structure though the fluorescence was quenched in
organic solvents implying it is not a lipid peroxidation product. It is possible that a specific
decomposition of UO 126 could result in the conjugated Schiff base structure, but that was not
investigated here.
U0126 as a mitochondrial inhibitor has implications in experimental design, interpreting
published work, and therapeutic approaches. A selected example of how U0126 may confound
experimental interpretations is found in the ischemia reperfusion literature. Specifically,
mitochondrial inhibition may be responsible for the decrease in infarct size attributed to MEK in
brain ischemia/ reperfusion experiments performed with U0126 (6,29, 30). Other brain
ischemia/ reperfusion experiments with the mitochondrial uncoupler 2,4-dinitrophenol have
similar infarct reductions (31). This is one of many papers I have found which in light of
U0126's mitochondrial inhibition that calls into questions the conclusions of the study. The
convoluted function of UO 126 as both a mitochondrial and MEK inhibitor warrants validation of
U0126 based experiments with additional small molecule inhibitors or genetic knockdowns.
As a multifunctional drug, U0126 may be useful therapeutically for targeting cancer cells
like other "dirty drugs" documented in the literature such as the ABL inhibitor Imatinib
(Gleevec) (32). U0126 would inhibit both MEK and mitochondrial function, potentially slowing
growth rates in cancer cells. MEK is a particularly relevant target in prostate cancer where it can
be overexpressed (33). To determine if U0126 is a potential therapeutic, a kinetic and temporal
analysis would need to be undertaken to determine if mitochondrial inhibition varies between
cancer and normal cells.
In addition, I hypothesize that pairing U0126 with a clinical glycolysis
Table 4-2: U0126 and proposed analogs to verify the mechanism of mitochondrial
inhibition and fluorescence generation in cells.
U0126
Compound 1
I
Compound 2
H2
,&H
2
H2
H2
Compound 3
H
H2
inhibitor, like 2-deoxyglucose, might be relevant in vivo to target aggressive tumor cells due to
their higher metabolic rate
5
4.4 Further work
The major limitations I encountered in exploring the secondary effect of U0126 was a
lack of technical expertise in chemical synthesis. I attempted to produce an analog of U0126
lacking the nitrile groups on the back bone by substituting a dicyanoethane for the
tetracyanoethane used in the original synthesis scheme (5). However, the chemistry of
dicyanoethane is significantly different from tetracyanoethane and readily polymerizes in the
reaction conditions of 2N sodium hydroxide. To validate the release of cyanide and subsequent
cyclization to produce fluorescence, future work should produce a variety of analogs of UO 126
without the amine and nitrile groups on the backbone, Table 4-2. If the cyanide release
hypothesis is correct, compound 1, lacking the nitrile groups, should be unable to induce a
metabolic shift. Compounds 2 and 3 may inhibit or partially inhibit the chemical mechanism
involved in displacing the nitrile groups if cyclization is necessary. I would anticipate none of
the compounds would generate the same fluorophore as U0126, though compound 1 may
fluoresce like the in vitro product in cells or in acid alone. In addition, a second method should
be employed to verify the release of cyanide in cells such as GC/MS. GC/MS would avoid the
pitfalls of the chemical assay I used which may cross react with other molecules.
Understanding the structure, activity relationship of UO126 may allow for the rational
design of other drugs to inhibit mitochondrial function or generate new fluorescent mitochondrial
tags.
4.5 References
1. Huang CY, Ferrell JE,Jr. Ultrasensitivity in the mitogen-activated protein kinase cascade. Proc
Natl Acad Sci U S A. 1996 Sep 17;93(19):10078-83.
2. Roberts PJ, Der CJ. Targeting the raf-MEK-ERK mitogen-activated protein kinase cascade for
the treatment of cancer. Oncogene. 2007 May 14;26(22):3291-3 10.
3. Gioeli D, Mandell JW, Petroni GR, Frierson HF,Jr, Weber MJ. Activation of mitogenactivated protein kinase associated with prostate cancer progression. Cancer Res. 1999 Jan
15;59(2):279-84.
4. Bakin RE, Gioeli D, Bissonette EA, Weber MJ. Attenuation of ras signaling restores androgen
sensitivity to hormone-refractory C4-2 prostate cancer cells. Cancer Res. 2003 Apr
15;63(8):1975-80.
5. Favata MF, Horiuchi KY, Manos EJ, Daulerio AJ, Stradley DA, Feeser WS, Van Dyk DE,
Pitts WJ, Earl RA, Hobbs F, Copeland RA, Magolda RL, Scherle PA, Trzaskos JM.
Identification of a novel inhibitor of mitogen-activated protein kinase kinase. J Biol Chem. 1998
Jul 17;273(29):18623-32.
6. Maddahi A, Edvinsson L. Cerebral ischemia induces microvascular pro-inflammatory
cytokine expression via the MEK/ERK pathway. J Neuroinflammation. 2010 Feb 26;7:14.
7. LaRosa C, Downs SM. MEK inhibitors block AICAR-induced maturation in mouse oocytes
by a MAPK-independent mechanism. Mol Reprod Dev. 2005 Feb;70(2):235-45.
8. Donzelli E, Lucchini C, Ballarini E, Scuteri A, Carini F, Tredici G, Miloso M. ERK1 and
ERK2 are involved in recruitment and maturation of human mesenchymal stem cells induced to
adipogenic differentiation. J Mol Cell Biol. 2011 Jan 28
9. Tsurutani J, West KA, Sayyah J, Gills JJ, Dennis PA. Inhibition of the phosphatidylinositol 3kinase/Akt/mammalian target of rapamycin pathway but not the MEK/ERK pathway attenuates
laminin-mediated small cell lung cancer cellular survival and resistance to imatinib mesylate or
chemotherapy. Cancer Res. 2005 Sep 15;65(18):8423-32.
10. Marampon F, Gravina GL, Di Rocco A, Bonfili P, Di Staso M, Fardella C, Polidoro L,
Ciccarelli C, Festuccia C, Popov VM, Pestell RG, Tombolini V, Zani BM. MEK/ERK inhibitor
U0126 increases the radiosensitivity of rhabdomyosarcoma cells in vitro and in vivo by
downregulating growth and DNA repair signals. Mol Cancer Ther. 2011 Jan;10(1):159-68.
11. Klein PJ, Schmidt CM, Wiesenauer CA, Choi JN, Gage EA, Yip-Schneider MT, Wiebke EA,
Wang Y, Omer C, Sebolt-Leopold JS. The effects of a novel MEK inhibitor PD184161 on MEKERK signaling and growth in human liver cancer. Neoplasia. 2006 Jan;8(1):1-8.
12. Barrett SD, Bridges AJ, Dudley DT, Saltiel AR, Fergus JH, Flamme CM, Delaney AM,
Kaufman M, LePage S, Leopold WR, Przybranowski SA, Sebolt-Leopold J, Van Becelaere K,
Doherty AM, Kennedy RM, Marston D, Howard WA,Jr, Smith Y, Warmus JS, Tecle H. The
discovery of the benzhydroxamate MEK inhibitors CI-1040 and PD 0325901. Bioorg Med Chem
Lett. 2008 Dec 15;18(24):6501-4.
13. LoRusso PM, Krishnamurthi SS, Rinehart JJ, Nabell LM, Malburg L, Chapman PB,
DePrimo SE, Bentivegna S, Wilner KD, Tan W, Ricart AD. Phase I pharmacokinetic and
pharmacodynamic study of the oral MAPK/ERK kinase inhibitor PD-0325901 in patients with
advanced cancers. Clin Cancer Res. 2010 Mar 15;16(6):1924-37.
14. Haura EB, Ricart AD, Larson TG, Stella PJ, Bazhenova L, Miller VA, Cohen RB, Eisenberg
PD, Selaru P, Wilner KD, Gadgeel SM. A phase II study of PD-0325901, an oral MEK inhibitor,
in previously treated patients with advanced non-small cell lung cancer. Clin Cancer Res. 2010
Apr 15;16(8):2450-7.
15. Dudley DT, Pang L, Decker SJ, Bridges AJ, Saltiel AR. A synthetic inhibitor of the mitogenactivated protein kinase cascade. Proc Natl Acad Sci U S A. 1995 Aug 15;92(17):7686-9.
16. Fischmann TO, Smith CK, Mayhood TW, Myers JE, Reichert P, Mannarino A, Carr D, Zhu
H, Wong J, Yang RS, Le HV, Madison VS. Crystal structures of MEKI binary and ternary
complexes with nucleotides and inhibitors. Biochemistry. 2009 Mar 31;48(12):2661-74.
17. McGovern SL, Shoichet BK. Kinase inhibitors: Not just for kinases anymore. J Med Chem.
2003 Apr 10;46(8):1478-83.
18. Bachleda P, Dvorak Z. Pharmacological inhibitors of JNK and ERK kinases SP600125 and
U0126 are not appropriate tools for studies of drug metabolism because they activate aryl
hydrocarbon receptor. Gen Physiol Biophys. 2008 Jun;27(2):143-5.
19. Yung HW, Wyttenbach A, Tolkovsky AM. Aggravation of necrotic death of glucosedeprived cells by the MEKI inhibitors U0126 and PD 184161 through depletion of ATP.
Biochem Pharmacol. 2004 Jul 15;68(2):351-60.
20. Yung HW, Wyttenbach A, Tolkovsky AM. Aggravation of necrotic death of glucosedeprived cells by the MEKI inhibitors U0126 and PD 184161 through depletion of ATP.
Biochem Pharmacol. 2004 Jul 15;68(2):351-60.
21. Blank N, Burger R, Duerr B, Bakker F, Wohlfarth A, Dumitriu I, Kalden JR, Herrmann M.
MEK inhibitor U0126 interferes with immunofluorescence analysis of apoptotic cell death.
Cytometry. 2002 Aug 1;48(4):179-84.
22. Trombly R, Tappel A. Fractionation and analysis of fluorescent products of lipid
peroxidation. Lipids. 1975 Aug;10(8):441-7.
23. Chen Y, McMillan-Ward E, Kong J, Israels SJ, Gibson SB. Mitochondrial electron-transportchain inhibitors of complexes I and II induce autophagic cell death mediated by reactive oxygen
species. J Cell Sci. 2007 Dec 1;120(Pt 23):4155-66.
24. Hernlund E, Ihrlund LS, Khan 0, Ates YO, Linder S, Panaretakis T, Shoshan MC.
Potentiation of chemotherapeutic drugs by energy metabolism inhibitors 2-deoxyglucose and
etomoxir. Int J Cancer. 2008 Jul 15;123(2):476-83.
25. Holley AK, Dhar SK, St Clair DK. Manganese superoxide dismutase vs. p53: Regulation of
mitochondrial ROS. Mitochondrion. 2010 Nov; 10(6):649-6 1.
26. Johnson MA, Macdonald TL. Accelerated CuZn-SOD-mediated oxidation and reduction in
the presence of hydrogen peroxide. Biochem Biophys Res Commun. 2004 Nov 5;324(1):446-50.
27. Duncia JV, Santella JB,3rd, Higley CA, Pitts WJ, Wityak J, Frietze WE, Rankin FW, Sun JH,
Earl RA, Tabaka AC, Teleha CA, Blom KF, Favata MF, Manos EJ, Daulerio AJ, Stradley DA,
Horiuchi K, Copeland RA, Scherle PA, Trzaskos JM, Magolda RL, Trainor GL, Wexler RR,
Hobbs FW, Olson RE. MEK inhibitors: The chemistry and biological activity of U0126, its
analogs, and cyclization products. Bioorg Med Chem Lett. 1998 Oct 20;8(20):2839-44.
28. Arun P, Moffett JR, Ives JA, Todorov TI, Centeno JA, Namboodiri MA, Jonas WB. Rapid
sodium cyanide depletion in cell culture media: Outgassing of hydrogen cyanide at physiological
pH. Anal Biochem. 2005 Apr 15;339(2):282-9.
29. Wang ZQ, Chen XC, Yang GY, Zhou LF. U0126 prevents ERK pathway phosphorylation
and interleukin-Ibeta mRNA production after cerebral ischemia. Chin Med Sci J. 2004
Dec; 19(4):270-5.
30. Maddahi A, Edvinsson L. Enhanced expressions of microvascular smooth muscle receptors
after focal cerebral ischemia occur via the MAPK MEK/ERK pathway. BMC Neurosci. 2008
Sep 15;9:85.
31. Korde AS, Pettigrew LC, Craddock SD, Maragos WF. The mitochondrial uncoupler 2,4dinitrophenol attenuates tissue damage and improves mitochondrial homeostasis following
transient focal cerebral ischemia. J Neurochem. 2005 Sep;94(6):1676-84.
32. Bantscheff M, Eberhard D, Abraham Y, Bastuck S, Boesche M, Hobson S, Mathieson T,
Perrin J, Raida M, Rau C, Reader V, Sweetman G, Bauer A, Bouwmeester T, Hopf C, Kruse U,
Neubauer G, Ramsden N, Rick J, Kuster B, Drewes G. Quantitative chemical proteomics reveals
mechanisms of action of clinical ABL kinase inhibitors. Nat Biotechnol. 2007 Sep;25(9):103544.
33. Gioeli D, Mandell JW, Petroni GR, Frierson HF,Jr, Weber MJ. Activation of mitogenactivated protein kinase associated with prostate cancer progression. Cancer Res. 1999 Jan
15;59(2):279-84.
5 Glutamine Metabolism and Resveratrol Toxicity
The objective of Chapter 5 is to build on the role of U0126 as a mitochondrial inhibitor to
understand what nodes resveratrol targets in cancer cells. Investigating mitochondrial pathways
and divergence in cancer lead me to find a glutamine metabolism dependence of resveratrolinduced apoptosis.
5.1 Introduction
Resveratrol was chosen in Chapter 3 because it is selectively toxic to cancer cells and
resveratrol-induced apoptosis was previously attenuated with EGF stimulation (1) implying the
drug was relevant to the LNCaP/C4-2 model with differential growth factor signaling responses.
In the greater literature, resveratrol has been proposed as a chemopreventive for prostate cancer
(2) and has substantial efficacy in treating metabolic disorders in mouse models including
obesity, insulin resistance (3), and nonalcoholic fatty acid liver disease(4). Resveratrol's cancer
specific cytotoxicity and metabolic phenotype reversions imply resveratrol may target a cell
metabolism critical for cancer cell survival.
As mentioned in the introduction, cell metabolism in an evolving area of research for
cancer therapeutics and integrates into many oncogenic pathways (5-8). Activation of
phosphoinositide 3-kinase /AKT signaling can result in increased glucose import and
consumption (9), necessary in cancer cells to fuel to growth and proliferation. Another
oncogenic node, MYC can increase glutaminolysis and inducing glutamine addiction when
overexpressed (6) (10). Recent work shows P13K loss and MYC overexpression are
significantly correlated in a subset of tumor samples from prostate cancer patients (11). If
alterations in these nodes correlate with metabolic phenotypes in vivo, then this subset of
patients may benefit from metabolic interventions.
Glucose and glutamine fuel distinct cellular functions, but recent work in the literature
has demonstrated a co-dependence between the two metabolites. Specifically, glucose
deprivation leads to suppression of glutamine uptake through impaired glycosylation of growth
factor receptors which may drive the expression of glutamine transporters (12). The data implies
another mechanism of inhibiting glutamine uptake because glutamine transporters like ASCT2
are also glycosylated and may be lost from the cell surface by a similar mechanism. The
glutamine transporter ASCT2 has recently been implicated in uptake of leucine and regulation of
the mTOR signaling network (13) as well as being over expressed in cancer cell lines (14-16).
These studies provide an interesting and exciting avenue in which to ponder and evaluate
metabolism in cancer (17).
5.2 Results
Given that the MEK inhibitor U0126 is also a mitochondrial inhibitor, I wanted to
determine if explicit mitochondrial inhibition was relevant to the programmed cell death induced
by resveratrol. Common mitochondrial inhibitors including oligomycin, FCCP, antimycin A,
and rotenone did not alter resveratrol-induced programmed cell death, figure 5-1. These drugs
all inhibit mitochondrial membrane potential within one minute (18) in contrast to U0126 which
appears to take as long as 12 hours.
U0126 inhibits mitochondria and induces aerobic glycolysis, implying a shift in cell
metabolism. In cancer, mitochondrial function is altered to provide substrates for biosynthesis
rather than energy production [reviewed in (19)]. Specifically, cancer cells use the TCA cycle
substrate citrate for lipid synthesis, but must substitute a-ketoglutarate derived from glutamine
into the cycle to maintain the mass flux (19). Slow mitochondrial inhibition by U0126 may alter
flux of metabolites in and out of the mitochondria decreasing lipid synthesis and altering
glutamine consumption 6 .
If U0126 alters glutamine metabolism as a downstream effect of mitochondrial inhibition,
then perhaps resveratrol-induced death is dependent on glutamine metabolism. I tested the
dependence of resveratrol-induced death on the supplementation of TCA cycle intermediates by
targeting transaminases. Alanine and aspartate transaminases convert glutamate to aketoglutarate in the cytosol (aspartate transaminase also has a mitochondrial isoform) for import
into the mitochondria (20). Two transaminase inhibitors 7 , cycloserine (21) and amino oxyacetate
(AOA), inhibited programmed cell death by resveratrol at 12 hours as measured by PARP
cleavage and nucleosome ELISA, figure 5-2a, b. The inhibition of death was partially reversible
with the exogenous addition of dimethyl-a-ketoglutarte, which is membrane permeable.
Transaminases produce a-ketoglutarate indirectly from imported glutamine and some
cancer cells have increased glutamine uptake (19). To determine if glutamine levels were critical
for resveratrol-induced death, glutamine was removed or reduced in serum free media prior to
resveratrol treatment. Under these conditions, resveratrol failed to induce the same level of
................
-- -------
U)
+
C
+
Z0
E
(A
(0W
0)
I
0
)0
0
D
0
0
+
0
D
_ _
_
1 0
_ _C
_ _
_
_
_
_ _
_
)
eas C)0=
~
_ _
_
_ _
WCevdPR
Cleaved PARP
1i-7a-tubulin
Figure 5-1: Mitochondrial inhibitors fail to alter resveratrol induced death. C4-2 cells
were serum starved for 12 hours and treated with mitochondrial inhibitors at the indicated
concentrations and 25uM Resveratrol for an additional 12 hours. Death was assayed with
by western blot for cleaved PARP.
cleaved PARP at 12 hours, figure 5-3a. Supplementation of dimethyl-a-ketoglutarate in place of
the reduced glutamine concentrations recovered resveratrol-induced PARP cleavage, figure 5-3b.
In addition, C4-2 cells survived resveratrol treatment at 60 hours in glutamine free media
compared to 2mM glutamine as documented by crystal violet staining, figure 5-3c. Glutamine
free media did not induce morphological signs of distress in cells. Glutamine metabolism was
required for resveratrol-induced death because a non-metabolizable analog, 6-diazo-5-oxo-Lnorleucine (DON), failed to restore resveratrol-induced PARP cleavage in glutamine free media,
figure 5-3c. As an experimental control, I attempted to determine if cell cycle arrest could
suppress resveratrol-induced apoptosis. This seemed prudent because both transaminase
inhibitors and glutamine withdrawal are reported to induce cell cycle arrest (22, 23). Inhibition
with nocodazole (microtubule inhibitor), colchicine (tubulin inhibitor), roscovitine (CDK2
inhibitor) and olomoucine (CDC2/CDK2 inhibitor) did not suppress resveratrol-induced
apoptosis, figure 5-4a, b. In addition, necrotic cell death was measured by assaying for lactate
dehydrogenase enzyme activity in the culture medium at 12 hours after resveratrol exposure,
figure 5-4c. Glutamine free media and cycloserine treatment did not increase necrotic cell death
in a statistically significant manner. Overall, I conclude that resveratrol-induced programmed
cell death is dependent on the metabolism of glutamine, partially through a mitochondriadependent mechanism.
Glucose Inhibition Hypothesis
Glutamine utilization is increased in cancer cells and its uptake has also been linked to
glucose uptake (12), implying interdependence. In addition, resveratrol has been shown to
inhibit glucose uptake in cell culture (24, 25). To investigate the metabolic uptake state of the
cells, I assayed the phosphorylation of p70S6K at S68 which is quickly lost in both glucose and
glutamine deprivation (12, 13). Resveratrol rapidly decreased phosphorylation of p70S6K
within one hour of treatment in both the LNCaP and C4-2 cells, figure 5-5a. Resveratrol
dependent p70S6K dephosphorylation has been reported in the literature, but never linked to
glucose uptake inhibition (26, 27). Altered p70S6K phosphorylation at early time point
correlates with the temporal dynamics documented for p70S6K phosphorylation glutamine
withdrawal, supplementation experiments (13). Extrapolating my results with the literature
............
--
--
--------------
+ 25 pM Res
Cycloserine
-
-
Cleaved PARP
a-tubulin
+ 25 pM Res
AOAA
ON
Cleaved PARP
a-tubulin
NW
B
-
6**
4)
5
4
.C
3
0
**
p < 0.05, paired two-tailed T-test
Figure 5-2: Transaminase inhibitors block resveratrol induced apoptosis in C4-2 cells.
C4-2 cells were serum starved for 12 hours with transaminase inhibitors at the indicated
concentrations. After serum starvation, resveratrol was dosed at 25uM for an additional 12
hours. Death was assayed by blotting for (a)cleaved PARP and with (b)a nucleosome
ELISA kit.
supports resveratrol inhibiting glucose uptake, though I have not been able to assay this
phenomenon here.
Glucose uptake may also regulate glutamine uptake through the glycosylated transporter
ASCT2. Previous work on ASCT2 has found knockdown of the transporter inhibits survival in
some hepatoma cells (14, 28) and overexpression of the transporter in other cancer cell lines (15).
To evaluate if glutamine transporter levels are significantly different in my isogenic cell lines
model I evaluated ASCT2 protein expression levels by western blot, figure 5-5b. The C4-2 cell
express significantly higher levels of ASCT2 compared to the LNCaP cells and the level of
ASCT2 correlates with resveratrol sensitivity. Differential expression of ASCT2 may be
attributable to increased autocrine growth factor signaling in the C4-2 cell line because ASCT2
expression has been previously linked to EGFR signaling (7, 29). I hypothesize the C4-2 may
have increased glutaminolysis compared to the LNCaP cells due to elevated growth factor
signaling and increased protein expression of ASCT2. This hypothesis remains to be validated
in future work.
As a glycosylated glutamine transporter (30), ASCT2's cellular localization could act as a
metric for glycosylation or glutamine uptake inhibition. Immunofluorescence analysis of
ASCT2 showed a relocalization of the protein into an internal structure of the cell after 12 hours
of resveratrol treatment compared to control treated cells, figure 5-5c. Visual scoring for the
presence of internally localized ASCT2 revealed a statistically significant relocalization with
resveratrol treatment at 12 hours, figure 5-5d. The intracellular localization of the transporter
may result from the receptor being trapped in the Golgi due to improper or incomplete
glycosylation. Glycosylation might be inhibited indirectly by resveratrol through inhibiting
glucose uptake because glucose is the substrate for UDP-glucosamine (UDP-GlcNAC) synthesis.
The pretreatment of cells with 15mM GlcNAC 1 hour prior to resveratrol treatment decreased
internal accumulation of ASCT2, figure 5-5d, and apoptotic cell death at 12 hours, figure 5-5e.
Overall, these data support glucose uptake inhibition by resveratrol and the subsequent inhibition
of glutamine uptake by transporter downregulation. In a glutamine addicted cell, these
mechanisms may account for resveratrol's selective apoptosis in cancer cells. The work
presented here is preliminary and meant to provide a scaffold for future work.
A
0mm
0
(Io
2
o
0.1 mm
0
0.5 mM
2 mMIV
U)U)
U)
0o
U)n
O
U)
1.2-
00
00
M. MA(1
ILn C 2Ln
0
N4n
C3 C4 in
[GIn]
O
0I(
ao
1-
LnC
N
0.80.6-
Cleaved PARP
0.4-
a-tubulin
0.20-
B
0 mM GIn
[GIn]
0.5 mM
0.1 mM
.mM
2 mM Gln 2 mM Gin 0 mM Gin 0 mM Gin
+ Res
+ Res
DON
000
0
>++
*00
E N4
W
+
0
0 t
-n--w
0n
-4 D -
U)
+
Ln
00W
DON + Res
EI
E EUL C ~EE
inCMT
-
Cleaved PARP
-
a-tubulin
N
Cleaved PARP
..-.. -a-tubulin
Figure 5-3: Glutamine Dependence of Resveratrol Induced Death in C4-2 cells. (a)Cells were serum starved in media with
the glutamine concentrations indicated for 12 hours and then dosed with 25uM resveratrol for an additional 12 hours. Death was
assayed by cleaved PARP staining by western blotting. (b) Medium with low glutamine was supplemented with alphaketoglutarate and resveratrol mediated death was recovered. (c)Crystal violet staining of cell survival in OmM or 2mM glutamine
treated with DMSO or 25uM resveratrol for 60 hours. (d)Glutamine analog DON fails to reestablish resveratrol induced apoptosis
in glutamine/serum free medium.
5.3 Discussion
Overall, the U0126 mitochondrial inhibition and metabolic perturbation lead me to
consider the role of metabolism in resveratrol-induced death. Explicit mitochondrial inhibition
did not suppress apoptosis implying a potential role of metabolite flux through the mitochondria
which may be inhibited downstream of mitochondrial inhibition. Further work elucidated
resveratrol-induced apoptosis is dependent on glutamine metabolism, through suppression of
apoptosis with transaminase inhibitors and glutamine free media. In addition, I provided an
initial framework for how glutamine uptake may be altered by resveratrol through the regulation
of ASCT2 glycosylation.
From my data, I hypothesize that resveratrol is selectively toxic to cells with increased
glutaminolysis. In cancer cells addicted to glutamine, resveratrol may not be able to down
regulate overexpressed glutamine transporters fast enough to save cells from death. Building
from what is known in the literature, I postulate resveratrol may attempt to inhibit glutamine
metabolism through the scheme shown in figure 5-6. Resveratrol has been shown to inhibit
glucose uptake (24, 31) which can lead to loss of p70S6K phosphorylation (25, 32), the latter of
which I have documented in my cells. As glucose levels in the cell drop, glycosylation is
inhibited and plasma membrane levels of growth factor receptors and transporters are reduced
(12) including the glutamine importer ASCT2, as I have shown. Glutamine importers are
upregulated in a number of cancer cells lines (16, 33) possibly through autocrine growth factor
signaling (29) and lead to a glutamine "addiction" phenotype (6). The C4-2 cells have increased
protein expression of ASCT2 and increased autocrine signaling. Loss of glutamine influx may
inhibit glutathione, nucleotide, and amino acid synthesis resulting in the induction of autophagy
or apoptosis (34). Normal cells may be immune to the effects of resveratrol because of stress
response networks for efficiently down regulating metabolism, networks that may be lost in the
malignant phenotype.
Resveratrol has minimal efficacy in treating xenograft models of cancer (35), while it is
quite effective in reverting metabolic syndrome phenotypes in mice (3)(4). Resveratrol's
differential efficacy in vivo may be attributable to differential glutamine concentrations or
metabolism in poorly vascularized tumors verses normal organs. Intra-tumor glutamine
concentrations have been reported from 600gM to 300gM or undetectable (36-38), which may
.........
A
00
0MM
CO :L.
C4
XI . W
0
LO
0
)
N
00M
W)
in
C
L
Cleaved PARP
a-tubulin
I
1.8.
E
11
1.6-
0
1.4-
N
0.8.
<(
0
x
0
0
- 0.6.
-i Z 0.4-
E E
0 0
0
C4
0
0.2-
00Q
MM
0-
00 1
-
-
-
-
-
-
-
Cleaved PARP
a-tubulin
0 Not statistically different by
paired, one-tailed T-test
Figure 5-4: Cell cycle arrest inducers fail to suppress resveratrol induced apoptosis in
C4-2 cells. (a)Mitosis inhibitors (nocodazol and colchicine) and (b) cell cycle inhibitors
(olomoucine and roscovitine) failed to suppress resveratrol induced apoptosis. All drugs were
dosed at indicated concentrations at 12 hours prior to lysis. (c) Necrotic cell death was
estimated based on LDH enzyme activity in the culture medium at 12 hours after resveratrol
(Res) treatment.
be insufficient to drive resveratrol glutamine-dependent death. In addition, some tumors
collected from patients show a net efflux of glutamine (37). Therapeutically, resveratrol may be
more efficacious if tumor glutamine concentration or metabolism could be increased, but this
may also drive tumor cell and disease progression concurrently.
The proposed perturbation of glutamine metabolism by resveratrol may be relevant to
reports in research outside of cancer, specifically resveratrol's inhibition of glutamate toxicity
(39), and adipogenesis (40). Glutamate toxicity in neurons results from elevated glutamate
concentrations in the synaptic cleft and is modulated through the interaction with astrocytes (39).
Inhibiting glucose or glutamine uptake may alter the downstream flux of glutamate within this
dynamic system. Glutamine uptake can also be critical in adipocytes which need oxaloacetate
replenished in the TCA cycle to drive citrate release for production of fatty acids (41).
Resveratrol inhibits adipogenesis in culture models (40) and modulation of glucose/glutamine
metabolism could mechanistically account for this phenomenon. The proposal of glutamine
uptake inhibition by resveratrol supports and unifies a subset of resveratrol research and warrants
further development.
In summary, the work in this chapter exemplifies the role of altered metabolism in tumor
biology and presents a direction for the development of novel therapeutics. Resveratrol's
glutamine-dependent apoptosis in cancer cells correlates with the documented increase in
glutaminolysis in disease models and may account for resveratrol's selectively toxicity in cancer
cell lines. Further research should be conducted to determine if resveratrol's in vivo mechanism
of action is glutamine metabolism dependent. Overall, this work supports additional research into
glutaminolysis and metabolism in cancer and the development of glutamine targeted therapeutics.
5.4 Further work
The involvement of glutamine metabolism in resveratrol-induced death has been partially
demonstrated in this work, but further investigations are warranted. Specifically, glucose uptake
should be measured with resveratrol treatment to determine if this potential mechanism of action
is true in the C4-2/ LNCaP system. Additionally, glutamine import at late time points should be
measured to validate ASCT2 internalization correlates with decreased glutamine uptake. Also,
other transporters can import glutamine, the dependence of the resveratrol phenotype on ASCT2
- ..........
............................
-.......
......................
..
.....................
-...
.....
.......
- -- --------------------
C4-2
LNCaP
C4-2
~
Co
0
eseasem
0
0
:LO
W)
Y
D
q
-
O
VC
0
0
phos mTOR
a-tubulin
'
ASCT2
P-actin
phos p70 S6 kinase
phos EIF4E
a-tubulin
DMSO
Resveratrol
C4-2
D
N
0.70.6-
*C
0.5-
00
Z
z
0.4-
Z
z
0.3o
S
E
0.20.1.
oN
0.
DMSO
25 pM Res 25 pM Res
+ GlcNAc
G cNAc
AM Wee**-
E
'
Cleaved PARP
.*woo @-actin
Figure 5-5: Glucose Uptake Inhibition Hypothesis. (a)C4-2 cells were serum starved for
12 hours and treated with resveratrol for 1 hour prior to cell lysis. Phosphorylation of mTOR
(S2448), p70S6K (T389), and EIF4E (S209) was assayed by western blotting and
phosphorylation decreased following resveratrol treatment in both cell lines. (b)LNCaP and
C4-2 cells in serum free conditions have differential expression of ASCT2 by western blot. (c)
Immunofluorescence images of C4-2 cells and visualizing ASCT2 with a cy3- anti rabbit
secondary under DMSO and 25uM resveratrol treatment at 12 hours. (d)Manual scoring of
ASCT2 internalization following resveratrol treatment at 12 hours, p = 0.07. (e) Reduced
PARP cleavage in cells pretreated with 15mM N-acetyl-D-glucosamine (GlcNAC) for 1 hour
prior to resveratrol treatment for 12 hours.
00
1h
i
LI
VAI
ILJI.4#I
IfI
19.4%j
a-K
Nu l u
/
R AG
lutathione
---+Biosynthesis
0
Amino acids
\B4/ASCT2 geeNucleotides
Nitrogen Source
Glutamine Addiction
Figure 5-6: Proposed Model of Resveratrol in Cancer Metabolism. Based on the data presented, resveratrol may inhibit glucose
uptake leading to a cascade of downstream effectors. Glutamine metabolism may be adversely targeted by down-regulation of
ASCT2 from the surface of the cell, depleting glutamine levels in the cell, which, in cancer, may induce apoptosis. (a-KG = alpha
ketoglutarate)
--------------------------
expression should be validated with genetic knockdown. Validation of the overall glutamine
"addiction" status of the LNCaP and C4-2 cell lines should be documented through glutamine
withdrawal toxicity experiments at long time points.
The link between resveratrol, growth factor signaling, and metabolism implies inhibiting
or down regulating growth factor signaling networks may suppress resveratrol-induced death.
This explicitly contradicts the established "rescue" of resveratrol-induced death in the DU145
cells (1), but seems conceptually valid. EGFR inhibition may simultaneously down regulate
oncogenic signaling, ASCT2 levels and metabolic processes, thereby shifting cells to a metabolic
state that resveratrol may not target.
5.5 References
1. Shih A, Zhang S, Cao HJ, Boswell S, Wu YH, Tang HY, Lennartz MR, Davis FB, Davis PJ,
Lin HY. Inhibitory effect of epidermal growth factor on resveratrol-induced apoptosis in prostate
cancer cells is mediated by protein kinase C-alpha. Mol Cancer Ther. 2004 Nov;3(11):1355-64.
2. Ratan HL, Steward WP, Gescher AJ, Mellon JK. Resveratrol-a prostate cancer
chemopreventive agent? Urol Oncol. 2002 Nov-Dec;7(6):223-7.
3. Lagouge M, Argmann C, Gerhart-Hines Z, Meziane H, Lerin C, Daussin F, Messadeq N,
Milne J, Lambert P, Elliott P, Geny B, Laakso M, Puigserver P, Auwerx J. Resveratrol improves
mitochondrial function and protects against metabolic disease by activating SIRTI and PGClalpha. Cell. 2006 Dec 15;127(6):1109-22.
4. Ajmo JM, Liang X, Rogers CQ, Pennock B, You M. Resveratrol alleviates alcoholic fatty
liver in mice. Am J Physiol Gastrointest Liver Physiol. 2008 Oct;295(4):G833-42.
5. Porstmann T, Griffiths B, Chung YL, Delpuech 0, Griffiths JR, Downward J, Schulze A.
PKB/Akt induces transcription of enzymes involved in cholesterol and fatty acid biosynthesis via
activation of SREBP. Oncogene. 2005 Sep 29;24(43):6465-81.
6. Wise DR, DeBerardinis RJ, Mancuso A, Sayed N, Zhang XY, Pfeiffer HK, Nissim I, Daikhin
E, Yudkoff M, McMahon SB, Thompson CB. Myc regulates a transcriptional program that
stimulates mitochondrial glutaminolysis and leads to glutamine addiction. Proc Natl Acad Sci U
S A. 2008 Dec 2;105(48):18782-7.
7. Palmada M, Speil A, Jeyaraj S, Bohmer C, Lang F. The serine/threonine kinases SGK1, 3 and
PKB stimulate the amino acid transporter ASCT2. Biochem Biophys Res Commun. 2005 May
27;331(l):272-7.
8. Heemers H, Vanderhoydonc F, Roskams T, Shechter I, Heyns W, Verhoeven G, Swinnen JV.
Androgens stimulate coordinated lipogenic gene expression in normal target tissues in vivo. Mol
Cell Endocrinol. 2003 Jul 31;205(1-2):21-31.
9. Wieman HL, Wofford JA, Rathmell JC. Cytokine stimulation promotes glucose uptake via
phosphatidylinositol-3 kinase/Akt regulation of Glut1 activity and trafficking. Mol Biol Cell.
2007 Apr; 18(4):1437-46.
10. Gao P, Tchernyshyov I, Chang TC, Lee YS, Kita K, Ochi T, Zeller KI, De Marzo AM, Van
Eyk JE, Mendell JT, Dang CV. c-myc suppression of miR-23a/b enhances mitochondrial
glutaminase expression and glutamine metabolism. Nature. 2009 Apr 9;458(7239):762-5.
11. Clegg NJ, Couto SS, Wongvipat J, Hieronymus H, Carver BS, Taylor BS, Ellwood-Yen K,
Gerald WL, Sander C, Sawyers CL. MYC cooperates with AKT in prostate tumorigenesis and
alters sensitivity to mTOR inhibitors. PLoS One. 2011 Mar 4;6(3):e17449.
12. Wellen KE, Lu C, Mancuso A, Lemons JM, Ryczko M, Dennis JW, Rabinowitz JD, Coller
HA, Thompson CB. The hexosamine biosynthetic pathway couples growth factor-induced
glutamine uptake to glucose metabolism. Genes Dev. 2010 Dec 15;24(24):2784-99.
13. Nicklin P, Bergman P, Zhang B, Triantafellow E, Wang H, Nyfeler B, Yang H, Hild M,
Kung C, Wilson C, Myer VE, MacKeigan JP, Porter JA, Wang YK, Cantley LC, Finan PM,
Murphy LO. Bidirectional transport of amino acids regulates mTOR and autophagy. Cell. 2009
Feb 6;136(3):521-34.
14. Fuchs BC, Perez JC, Suetterlin JE, Chaudhry SB, Bode BP. Inducible antisense RNA
targeting amino acid transporter ATBO/ASCT2 elicits apoptosis in human hepatoma cells. Am J
Physiol Gastrointest Liver Physiol. 2004 Mar;286(3):G467-78.
15. Bode BP, Fuchs BC, Hurley BP, Conroy JL, Suetterlin JE, Tanabe KK, Rhoads DB,
Abcouwer SF, Souba WW. Molecular and functional analysis of glutamine uptake in human
hepatoma and liver-derived cells. Am J Physiol Gastrointest Liver Physiol. 2002
Nov;283(5):G1062-73.
16. Witte D, Ali N, Carlson N, Younes M. Overexpression of the neutral amino acid transporter
ASCT2 in human colorectal adenocarcinoma. Anticancer Res. 2002 Sep-Oct;22(5):2555-7.
17. Wise DR, Thompson CB. Glutamine addiction: A new therapeutic target in cancer. Trends
Biochem Sci. 2010 Aug;35(8):427-33.
18. Feeney CJ, Pennefather PS, Gyulkhandanyan AV. A cuvette-based fluorometric analysis of
mitochondrial membrane potential measured in cultured astrocyte monolayers. J Neurosci
Methods. 2003 May 30;125(1-2):13-25.
19. DeBerardinis RJ, Mancuso A, Daikhin E, Nissim I, Yudkoff M, Wehrli S, Thompson CB.
Beyond aerobic glycolysis: Transformed cells can engage in glutamine metabolism that exceeds
the requirement for protein and nucleotide synthesis. Proc Natl Acad Sci U S A. 2007 Dec
4;104(49):19345-50.
20. Ellinger JJ, Lewis IA, Markley JL. Role of aminotransferases in glutamate metabolism of
human erythrocytes. J Biomol NMR. 2011 Mar 6
21. Wong DT, Fuller RW, Molloy BB. Inhibition of amino acid transaminases by L-cycloserine.
Adv Enzyme Regul. 1973;11:139-54.
22. Thornburg JM, Nelson KK, Clem BF, Lane AN, Arumugam S, Simmons A, Eaton JW,
Telang S, Chesney J. Targeting aspartate aminotransferase in breast cancer. Breast Cancer Res.
2008; 10(5):R84.
23. Meng M, Chen S, Lao T, Liang D, Sang N. Nitrogen anabolism underlies the importance of
glutaminolysis in proliferating cells. Cell Cycle. 2010 Oct 1;9(19):3921-32.
24. Kueck A, Opipari AW,Jr, Griffith KA, Tan L, Choi M, Huang J, Wahl H, Liu JR.
Resveratrol inhibits glucose metabolism in human ovarian cancer cells. Gynecol Oncol. 2007
Dec;107(3):450-7.
25. Faber AC, Dufort FJ, Blair D, Wagner D, Roberts MF, Chiles TC. Inhibition of
phosphatidylinositol 3-kinase-mediated glucose metabolism coincides with resveratrol-induced
cell cycle arrest in human diffuse large B-cell lymphomas. Biochem Pharmacol. 2006 Nov
15;72(10):1246-56.
26. Chan AY, Dolinsky VW, Soltys CL, Viollet B, Baksh S, Light PE, Dyck JR. Resveratrol
inhibits cardiac hypertrophy via AMP-activated protein kinase and akt. J Biol Chem. 2008 Aug
29;283(35):24194-201.
27. Brito PM, Devillard R, Negre-Salvayre A, Almeida LM, Dinis TC, Salvayre R, Auge N.
Resveratrol inhibits the mTOR mitogenic signaling evoked by oxidized LDL in smooth muscle
cells. Atherosclerosis. 2009 Jul;205(l):126-34.
28. Fuchs BC, Finger RE, Onan MC, Bode BP. ASCT2 silencing regulates mammalian target-ofrapamycin growth and survival signaling in human hepatoma cells. Am J Physiol Cell Physiol.
2007 Jul;293(1):C55-63.
29. Avissar NE, Sax HC, Toia L. In human entrocytes, GLN transport and ASCT2 surface
expression induced by short-term EGF are MAPK, P13K, and rho-dependent. Dig Dis Sci. 2008
Aug;53(8):2113-25.
30. Marin M, Lavillette D, Kelly SM, Kabat D. N-linked glycosylation and sequence changes in
a critical negative control region of the ASCT1 and ASCT2 neutral amino acid transporters
determine their retroviral receptor functions. J Virol. 2003 Mar;77(5):2936-45.
31. Park JB. Inhibition of glucose and dehydroascorbic acid uptakes by resveratrol in human
transformed myelocytic cells. J Nat Prod. 2001 Mar;64(3):381-4.
32. Haider UG, Sorescu D, Griendling KK, Vollmar AM, Dirsch VM. Resveratrol suppresses
angiotensin II-induced Akt/protein kinase B and p7 0 S6 kinase phosphorylation and subsequent
hypertrophy in rat aortic smooth muscle cells. Mol Pharmacol. 2002 Oct;62(4):772-7.
33. Sidoryk M, Matyja E, Dybel A, Zielinska M, Bogucki J, Jaskolski DJ, Liberski PP,
Kowalczyk P, Albrecht J. Increased expression of a glutamine transporter SNAT3 is a marker of
malignant gliomas. Neuroreport. 2004 Mar 22;15(4):575-8.
34. Hwang SO, Lee GM. Nutrient deprivation induces autophagy as well as apoptosis in chinese
hamster ovary cell culture. Biotechnol Bioeng. 2008 Feb 15;99(3):678-85.
35. Lee MH, Choi BY, Kundu JK, Shin YK, Na HK, Surh YJ. Resveratrol suppresses growth of
human ovarian cancer cells in culture and in a murine xenograft model: Eukaryotic elongation
factor 1A2 as a potential target. Cancer Res. 2009 Sep 15;69(18):7449-58.
36. Wasa M, Bode BP, Abcouwer SF, Collins CL, Tanabe KK, Souba WW. Glutamine as a
regulator of DNA and protein biosynthesis in human solid tumor cell lines. Ann Surg. 1996
Aug;224(2):189-97.
37. Kallinowski F, Runkel S, Fortmeyer HP, Forster H, Vaupel P. L-glutamine: A major
substrate for tumor cells in vivo? J Cancer Res Clin Oncol. 1987; 113(3):209-15.
38. Lefauconnier JM, Portemer C, Chatagner F. Free amino acids and related substances in
human glial tumours and in fetal brain: Comparison with normal adult brain. Brain Res. 1976
Nov 19;117(1):105-13.
39. de Almeida LM, Pineiro CC, Leite MC, Brolese G, Tramontina F, Feoli AM, Gottfried C,
Goncalves CA. Resveratrol increases glutamate uptake, glutathione content, and S1 OOB secretion
in cortical astrocyte cultures. Cell Mol Neurobiol. 2007 Aug;27(5):661-8.
40. Rayalam S, Yang JY, Ambati S, Della-Fera MA, Baile CA. Resveratrol induces apoptosis
and inhibits adipogenesis in 3T3-L1 adipocytes. Phytother Res. 2008 Oct;22(10):1367-71.
41. Ballard FJ, Hanson RW. The citrate cleavage pathway and lipogenesis in rat adipose tissue:
Replenishment of oxaloacetate. J Lipid Res. 1967 Mar;8(2):73-9.
Chapter 6: Concluding Remarks
The work in this thesis followed the implications of the data along a single path to
determine a critical difference between cell lines representing prostate cancer disease progression.
While this approach produced an interesting story, traversing multiple disciplines, many
questions still remain about the mechanisms of action of the two drugs: U0126 and resveratrol.
In an attempt to conclude this work, the following section hypothesizes a number of conceivable
molecular mechanisms based on the literature and the data presented in the proceeding chapters.
Specific emphasis is placed on where resveratrol and U0126 may converge to antagonizing one
another.
In vitro disease progression model of prostate cancer
The in vitro cell line models, C4-2 and LNCaP, are perhaps the best cell line pair
available for studying disease progression, because of their overwhelming number of similarities
and yet divergent growth characteristics in vivo. These aspects of the cell line models make
pertinent differences challenging to find, but may decrease the probability of discovering false
positives. Previous delineation between the cell lines have focused on microarray analysis, but
the resulting network of expression changes provided few clues to the castration resistance of the
C4-2 cells. If changes at the gene expression level are minimal, perhaps the point of divergence
lies in the dynamic regulation of protein levels or post translational modifications.
Several data points from my work support a dynamic differential response between the
cell lines at the protein level including: differential temporal response of the EGFR network, a
unique node of activation downstream of the DNA damage response network, and the
differential protein level of ASCT2. Variation in the EGFR network may have been postulated
from a modest increase in EGFR mRNA in the C4-2 cells, but the different temporal profiles of
protein tyrosine phosphorylation between the two cells lines was not deducible and may have
profound implications in vivo. In contrast, the latter two observations are novel within the
literature and potentially important. The DNA damage response network is involved in cell
survival and death decisions, and alterations in this network may favor tumor growth and
survival. In addition, the level of ASCT2 protein implies an increased import rate of glutamine
into the cell which may help to fuel biosynthetic processes critical to cell proliferation.
Identifying other points of divergence between these cell lines may be possible with alternative
profiling techniques such as protein microarrays or relative protein level comparisons by mass
spectrometry.
Overall, the C4-2/ LNCaP comparison remains a challenging, but potentially very
rewarding system for prostate cancer research. Elucidating the small fraction of variations
between the cell lines may help to determine one path leading to castrate resistance.
Understanding the mechanism of progression may propagate into viable chemoprevention
strategies for low risk patients, to minimize any neoplastic growth to the organ.
Secondary mechanism of action of U0126
Investigating the mode of action of UO 126 was a divergence from the initial question of
how prostate cancer disease progresses to castration resistance. The interlude into the world of
small molecules inhibitors was a strategic decision based on the unique ability of U0126 to
repress resveratrol-induced programmed cell death. However, in the process of attempting to
understand how U0126 influenced resveratrol's mechanism of action, a broader picture of how
U0126 behaves in cells was proposed. The full characterization of UO126 was forgone in this
work due to technical limitations, and additional questions remain about its complete mechanism
of action.
In this work, U0126 was shown to inhibit mitochondrial function in cell culture, but this
phenomenon is not unique to UO 126 and linked to other drugs and their degradation products (1,
2). In biological systems, drugs degradation can be enhanced by a variety of enzymes and
potential catalyzing agents. While analyzing the structure of UO 126, I postulated U0126 might
cyclize and displace the nitrile groups on the backbone. While I was unable to propose a specific
chemical mechanism for the aforementioned reaction, the resulting structure was strikingly
similar to a known fluorescent compound. In addition, cyanide was detected in cells exposed to
U0126. These data support a mechanism for mitochondrial inhibition, but other assays and
experiments should be performed to confirm the overall hypothesis.
Beyond cyanide release, U0126 may inhibit mitochondrial function through the
accumulating fluorescence much like lipofuscins. Lipofuscins are described as residual protein/
lipid degradation products and metals which accumulate in cells and have a fluorescent emission
between 540 and 650nm. The accumulation of lipofuscins is associated with aging related
diseases such as macular degeneration [reviewed in(3)]. While the fluorescent characteristics of
lipofuscins do not match the fluorescence associated with U0126, the characteristic accumulation
and inhibition of normal cell function imply that the fluorescence may be more than a byproduct
of UO 126 degradation or reaction. The parallel between U0126 and lipofuscins supports further
elucidation of the structure and dynamic characteristic of the U0126 induced fluorescence.
Overall, U0126 appears to be a multifunctional molecule with its inherent MEK
inhibitory activity, mitochondrial suppression, and fluorescence generation. The characterization
of U0126 in cells also implies the dynamic and temporal function of U0126 over long term
incubation results in the integration of interactions with multiple targets. Attempting to
deconvolve these multitudes of interactions to provide a single mode of action may be difficult,
if not impossible. Further work is needed with a variety of chemical analogs to truly determine
how U0126 is behaving and modulating biological systems.
Understanding resveratrol in biological systems
Resveratrol is a very intriguing natural product linked to a large variety of biological
processes, but lacks a consensus about its mechanism of action. The ambiguity surrounding
resveratrol emphasizes the complexity of biological systems and the inherent noise, and
uncertainty of biological research. Stepping back from the possibilities and integrating across
divergent fields including: neuroscience, cancer, and metabolic disease, implies resveratrol shifts
metabolism through mitochondrial biogenesis. Within this scheme, understanding and taking
advantage of how resveratrol functions may help in preventing and treating a variety of diseases.
Resveratrol accentuates a larger problem in current biological research, the
overwhelming volume of conflicting, contradictory or repetitive papers published every year.
The intrinsic nature of science supports divergent publications and constantly challenging
assumptions, but the current publishing models don't support efficient assimilation of published
information by individuals outside of the specific field of investigation. This exclusionary
tendency of publication models diminishes the crosstalk between disciplines and possibly the
progression of science. I found minimal crosstalk particularly evident in papers about resveratrol
from different disciplines, even when the same core concepts are under investigation. More
efficient information reporting models or adaptive computational algorithms are needed to
compile and assimilate information across fields. If such technologies or strategies could be
developed, then we might be able to leverage our cumulative knowledge to converge on a subset
of possible modes of action for drugs like resveratrol. Efficiently directing biological research
efforts may help to push science forward and minimize repetitive work.
Convergence of U0126 and resveratrol
The suppression of resveratrol-induced death by U0126 implied an intriguing, and yet
perplexing paradox of how U0126 can inhibit mitochondrial function and a pro-survival kinase,
but simultaneously suppress programmed cell death. During the course of my thesis work, I
attempted to find an explicit point where resveratrol and U0126 converged to antagonize
programmed cell death, but node was discovered. This section attempts to explain what avenues
were discounted and where an answer might be found.
One of the first points of evaluation of the UO 126/ resveratrol interaction was the
production and suppression of reactive oxygen species (ROS). Resveratrol is characterized as an
antioxidant in multiple papers, but it can also induce ROS production when inducing cell death
(4). In contrast, I found U0126 suppressed ROS production and reduced the elevated level of
ROS resulting from resveratrol treatment. The intersection between the two drugs and ROS was
a fork in my research path. I chose to integrate ROS with U0126 and attempt to formulate a
mechanism for how fluorescence and mitochondrial inhibition might result. Following this path
led to the identification of cyanide as a mediator of mitochondrial inhibition, however, I did not
return to the original ROS observation. It remains to be seen if other antioxidants such as
ascorbic acid, N-acetyl cysteine, a-tocopherol, or EUK134 can suppress resveratrol-induced
apoptosis and this hypothesis should be tested. From a hypothetical perspective, I would not
expect antioxidants alone to rescue resveratrol-induced death because I've documented multiple
actions for U0126. U0126 is unique in its ability to inhibit ROS and mitochondrial function
simultaneously. These two phenomena typically do not occur in tandem and I am unaware of
another small molecule drug which is capable of both simultaneously. A single point of action
for U0126 to inhibit cell death may be too simplistic, but is still possible.
Another important variable in the convergence of UO 126 and resveratrol is the timing and
extent of death suppression. In the experimental setup, U0126 and resveratrol are dosed
simultaneously into the system at time zero. Programmed cell death by resveratrol is assayed
twelve hours later, and at this time point U0126 is able to suppress the cleavage of PARP as well
as DNA fragmentation repeatedly. However, cell viability at 24 hours was equally diminished
under all treatment conditions, implying the suppression by U0126 was only a short term effect.
The moderate death suppression at an early time point allows a variety of alternative
explanations to be proposed. Specifically, U0126 may shift cells from a PARP mediated cell
death to another form of death such as necrosis or autophagy, or limit cellular energy suppressing
the efficiency of death induction. Both of these possibilities contrast with the impression of a
rescue effect by U0126, but would produce the same experimental result: decreased PARP
cleavage and DNA fragmentation.
Moving beyond simple explanations, the literature implies U0126 and resveratrol may
interact through the aryl hydrocarbon receptor (AhR) or AMP activating protein kinase (AMPK).
The aryl hydrocarbon receptor was identified because resveratrol can inhibit it (5) while U0126
could activate it (6). The intriguing opposition of the two compounds plays into the potential of
the AhR to be a node of intersection. In addition, AhR induces expression of CYP lA1, a
member of the cytochrome P450 family which can activate environmental pollutants producing
highly reactive carcinogens. However, CYP1A1 can also activate a variety of natural products to
produce chemopreventives compounds (7). 1 investigated the reaction of resveratrol and another
AhR agonist, CAY10465, to determine if the second agonist recapitulated the U0126 effect.
Unfortunately, CAY 10465 did not suppress resveratrol-induced death. Given the initial negative
result and the limited tools and expertise available to investigate the AhR further, I choose to end
this line of investigation.
In contrast to the AhR approach, AMPK has been documented to be activated by both
resveratrol (8) and U0126 (9, 10). However, documentation of resveratrol activating AMPK is
predominantly cited in alleviating metabolic syndrome phenotypes in culture and in mice. In the
LNCaP/ C4-2 system, resveratrol minimally activated AMPK at early time points, while U0126
robustly activated it alone or in combination with resveratrol. When resveratrol was combined
with U0126, activation of AMPK increased, correlating with the suppression of resveratrolinduced cell death. Another AMPK activator, AICAR, was unable to consistently recapitulate
cell death suppression. The inconsistency of the AICAR antagonism of resveratrol may indicate
differential temporal activation of AMPK by AICAR and U0126. Given the slow, long term
mitochondrial suppression by U0126, AMPK may be constantly activated over the time course
or have an increasing activation as mitochondrial function tapers off. In contrast, AICAR is an
AMP mimetic and may degrade over the time course of the experiment, failing to provide a
constant or increasing activation of AMPK.
The role of AMPK in resveratrol-induced death and the possible agonistic effect of
UO 126 should be tested further, but with tools which can dynamically activate AMPK and
monitor its state temporally. AMPK is clearly an important node downstream of resveratrol as
demonstrated in recent mouse models of metabolic syndrome (11) and AMPK responsiveness in
cancer cells may be clinically relevant as well. The role of AMPK has explicit connotations in
prostate cancer where the AMPK activator metformin is correlated with disease suppression (12).
In my hands, metformin was unable to perturb resveratrol-induced apoptosis.
While activation of AMPK in the presence of resveratrol produced inconsistent results,
the same differential survival phenotype was found with the AMPK inhibitor, Compound C.
Specifically, Compound C was more cytotoxic to C4-2 cells compared to LNCaP cells, implying
the energetic state of C4-2 cells is shifted compared to LNCaP cells. This data further supports
investigating the energy states of the LNCaP and C4-2 cells, and how the AMPK signaling node
may be involved in prostate cancer progression.
Intersecting signaling nodes between U0126 and resveratrol didn't produce a conclusive
point of antagonism between the two compounds. However, one final point of convergence
deserves evaluation: mitochondrial function. Resveratrol is known to induce mitochondrial
biogenesis in cells, and I found U0126 to inhibit mitochondrial function. Convergence at the
mitochondria postulates the release of pro-death molecules from the mitochondria by resveratrol
and retention of these molecules by U0126. I evaluated this possibility by fractionating cells and
evaluating cytochrome c localization, but I did not detect cytochrome c release into the cytosol
under any of the experimental conditions (data not shown). While this data did not support a
mitochondrial death induction process several variables were uncontrolled including: the
sensitivity of the antibody, the optimal time point for detecting release, and accurate
quantification from western blotting. Given the importance of mitochondrial function in both
resveratrol and U0126 action, evaluating mitochondrial mechanisms in greater detail is
warranted and one conceivable point of intersection is hypothesized here9 .
To find a focal point within mitochondrial mediated death mechanisms, I examined what
I knew about early and late responses to resveratrol treatment. Resveratrol perturbs multiple
cellular processes, but only a few phenomena are quickly induced including: DNA damage
response, dephosphorylation of S6K, Sirtl, and calcium flux (13). In contrast, when cell death
begins, I've found induction of ER stress, mitochondrial involvement, and the cleavage of PARP,
a protein involved in the DNA damage response as well as a hallmark of cell death. From a
hypothetical perspective, I would expect the early signals to integrate to induce cell death.
Therefore, I integrating these observations within the context of the literature and propose
resveratrol induces parthanatos, a cell death process which samples both DNA damage and
mitochondrial function (14).
Parthanatos is a process initiated with excessive activation of PARP activity. PARP
produces the PAR polymer which is hypothesized to translocate from the nucleus to the
mitochondria releasing the apoptosis initiating factor (AIF). The exact mechanism of AIF
release by PAR is unknown, but in general AIF is cleaved by a protease and translocated through
the outer mitochondrial membrane when the permeability of the membrane is altered. Once in
the cytoplasm, AIF localizes to the nucleus to induce chromatin condensation and DNA
fragmentation resulting in cell death [reviewed in (15)]. Parthanatos induced cell death is
independent of caspase activity (14) and is consistent with the absence of caspase activation at
12 hours in LNCaP and C4-2 treated with resveratrol (data not shown). In addition, my data
supports resveratrol inducing PARP activity as a portion of the DNA damage response network.
Several studies have documented a role for parthanatos in resveratrol-induced death (16)(13)(17).
This mechanism of action is consistent with resveratrol, but antagonism by U0126 is not
explicitly evident.
U0126 may influence parthanatos by modulating the release of AIF in the mitochondria.
AIF is hypothesized to be regulated by NADH dependent reduction and recent crystal structure
data supports different conformations of the protein reflecting the redox state of the mitochondria
(18).
While the crystal structure data was based on a fragment of AIF, alternative conformations
may hypothetically block the cleavage site (18). Therefore, AIF cleavage may be influenced by
the redox state which is dependent on the functional state of the mitochondria and perturbed by
U0126.
In addition, AIF cleavage is dependent on the protease calpain which can be activated by
calcium ions. Given that resveratrol induces calcium flux at early time points and recent data
implies this release comes from the ER, then the calcium is expected to be taken up by the
mitochondria to maintain homeostasis. Prolonged or elevated levels of calcium in the
mitochondria are associated with induction of cell death (19). However, normally calcium levels
in the mitochondria are modulated by release through loss of mitochondrial membrane potential.
In my cell system, resveratrol may induce calcium uptake by the mitochondria which could
result in the induction of calpain and subsequent cleavage of AIF. UO 126 may antagonize AIF
cleavage by reducing mitochondrial membrane potential and subsequently decreasing uptake and
increasing export of calcium. One sign of calcium retention in the mitochondria is concomitant
induction of ER stress [reviewed in (20)]. In my cell system, induction of the gene CHOP, an
ER stress marker, precedes resveratrol-induced apoptosis. Although CHOP levels are not
mitigated with U0126 treatment implying U0126 is unable to completely redistribute calcium
and may only shift calcium levels.
Other support of U0126 influencing parthanatos is evident in the literature. Parthanatos
is a major mechanism of cell death in ischemia reperfusions models where U0126 has a
substantial rescue effect (21), though this rescue is classically attributed to MEK. Also, recent
work indicates increased lactic acid production may also suppress PARP activity (22). My work
explicitly demonstrated U0126 induces lactic acid production and this may provide another route
for U0126 to antagonize resveratrol-induced parthanatos.
To test the convergence of resveratrol and U0126 at the level of calcium flux, the release
of AIF, and the induction of parthanatos in the C4-2 cells several experiments need to be run.
Initially, the dynamic release and movement of calcium should be monitored in LNCaP and C4-2
cells following resveratrol treatment. Calcium has been previously hypothesized to be released
from the ER and picked up by the mitochondria. If this holds for the prostate cancer cell system,
then other tools to chelate calcium, open or close the mitochondrial permeability transition pore,
and shift the redox state of the cells should be used to see if they can modulate resveratrolinduced apoptosis. In addition, the important step of parthanatos is the translocation of AIF to
the nucleus at early time points. If parthanatos is engaged at 12 hours following resveratrolinduced death, then AIF should be detectable in the nucleus by cell fractionation or
immunofluorescence imaging.
100
The proceeding theoretical convergence point for U0126 and resveratrol fits with the
current data and literature, but only an explicit experimental test of the hypothesis will prove if
the mechanism is true.
Cancer research and the need for shifting paradigms
Overall, this thesis focused on molecular mechanisms of action of small molecule drugs.
Targeted drugs are one approach to cancer therapy, because drugs can selectively target enzymes,
kinases, and other proteins to divert the aberrant programming and signaling of cancer cells.
However, in light of the complicated mechanisms of small molecule drugs illustrated here and
their failures in clinical trials (2), perhaps we should consider a parallel path for short term gains.
It seems improbable, that a single drug will cure cancer and multiple drug approaches may just
amplify adverse side effects, but long term chemopreventive strategies may be viable to decrease
incidence. Prostate cancer is perhaps the best example of a cancer with an established link to
dietary and lifestyle choices. Its elevated incidence in the western industrialized world implies
our current food consumption patterns need to be modified. Shifting dietary patterns is a
currently viable strategy which could be implemented now and may contain intrinsic
chemopreventive properties. While such a step will not "cure" cancer, it may reduce the
incidence rates and increase overall quality of life for the population. Instigating a dietary shift
would require extensive public education efforts to inform individuals of the risks and rewards of
changing their lifestyles.
References
1. Feng B, Xu JJ, Bi YA, Mireles R, Davidson R, Duignan DB, Campbell S, Kostrubsky VE,
Dunn MC, Smith AR, Wang HF. Role of hepatic transporters in the disposition and
hepatotoxicity of a HER2 tyrosine kinase inhibitor CP-724,714. Toxicol Sci. 2009
Apr;108(2):492-500.
2. Kerkela R, Woulfe KC, Durand JB, Vagnozzi R, Kramer D, Chu TF, Beahm C, Chen MH,
Force T. Sunitinib-induced cardiotoxicity is mediated by off-target inhibition of AMP-activated
protein kinase. Clin Transl Sci. 2009 Feb;2(l):15-25.
3. Gray DA, Woulfe J. Lipofuscin and aging: A matter of toxic waste. Sci Aging Knowledge
Environ. 2005 Feb 2;2005(5):rel.
101
4. Juan ME, Wenzel U, Daniel H, Planas JM. Resveratrol induces apoptosis through ROSdependent mitochondria pathway in HT-29 human colorectal carcinoma cells. J Agric Food
Chem. 2008 Jun 25;56(12):4813-8.
5. Ciolino HP, Daschner PJ, Yeh GC. Resveratrol inhibits transcription of CYP1A1 in vitro by
preventing activation of the aryl hydrocarbon receptor. Cancer Res. 1998 Dec 15;58(24):5707-12.
6. Bachleda P, Dvorak Z. Pharmacological inhibitors of JNK and ERK kinases SP600125 and
U0126 are not appropriate tools for studies of drug metabolism because they activate aryl
hydrocarbon receptor. Gen Physiol Biophys. 2008 Jun;27(2):143-5.
7. Androutsopoulos VP, Tsatsakis AM, Spandidos DA. Cytochrome P450 CYP1A1: Wider roles
in cancer progression and prevention. BMC Cancer. 2009 Jun 16;9:187.
8. Chan AY, Dolinsky VW, Soltys CL, Viollet B, Baksh S, Light PE, Dyck JR. Resveratrol
inhibits cardiac hypertrophy via AMP-activated protein kinase and akt. J Biol Chem. 2008 Aug
29;283(35):24194-201.
9. Dokladda K, Green KA, Pan DA, Hardie DG. PD98059 and U0126 activate AMP-activated
protein kinase by increasing the cellular AMP:ATP ratio and not via inhibition of the MAP
kinase pathway. FEBS Lett. 2005 Jan 3;579(1):236-40.
10. LaRosa C, Downs SM. MEK inhibitors block AICAR-induced maturation in mouse oocytes
by a MAPK-independent mechanism. Mol Reprod Dev. 2005 Feb;70(2):235-45.
11. Um JH, Park SJ, Kang H, Yang S, Foretz M, McBurney MW, Kim MK, Viollet B, Chung JH.
AMP-activated protein kinase-deficient mice are resistant to the metabolic effects of resveratrol.
Diabetes. 2010 Mar,59(3):554-63.
12. Monami M, Colombi C, Balzi D, Dicembrini I, Giannini S, Melani C, Vitale V, Romano D,
Barchielli A, Marchionni N, Rotella CM, Mannucci E. Metformin and cancer occurrence in
insulin-treated type 2 diabetic patients. Diabetes Care. 2011 Jan;34(1):129-31.
13. Sareen D, Darjatmoko SR, Albert DM, Polans AS. Mitochondria, calcium, and calpain are
key mediators of resveratrol-induced apoptosis in breast cancer. Mol Pharmacol. 2007
Dec;72(6):1466-75.
14. Andrabi SA, Dawson TM, Dawson VL. Mitochondrial and nuclear cross talk in cell death:
Parthanatos. Ann N Y Acad Sci. 2008 Dec;1 147:233-41.
15. Joza N, Pospisilik JA, Hangen E, Hanada T, Modjtahedi N, Penninger JM, Kroemer G. AIF:
Not just an apoptosis-inducing factor. Ann N Y Acad Sci. 2009 Aug; 1171:2-11.
16. Zhang W, Wang X, Chen T. Resveratrol induces mitochondria-mediated AIF and to a lesser
extent caspase-9-dependent apoptosis in human lung adenocarcinoma ASTC-a-1 cells. Mol Cell
Biochem. 2011 Apr 20
17. Kolthur-Seetharam U, Dantzer F, McBurney MW, de Murcia G, Sassone-Corsi P. Control of
AIF-mediated cell death by the functional interplay of SIRTI and PARP-1 in response to DNA
damage. Cell Cycle. 2006 Apr;5(8):873-7.
102
18. Sevrioukova IF. Redox-linked conformational dynamics in apoptosis-inducing factor. J Mol
Biol. 2009 Jul 31;390(5):924-38.
19. Ichas F, Mazat JP. From calcium signaling to cell death: Two conformations for the
mitochondrial permeability transition pore. switching from low- to high-conductance state.
Biochim Biophys Acta. 1998 Aug 10;1366(1-2):33-50.
20. Berridge MJ, Bootman MD, Lipp P. Calcium--a life and death signal. Nature. 1998 Oct
15;395(6703):645-8.
21. Maddahi A, Edvinsson L. Cerebral ischemia induces microvascular pro-inflammatory
cytokine expression via the MEK/ERK pathway. J Neuroinflammation. 2010 Feb 26;7:14.
22. Wagner S, Hussain MZ, Beckert S, Ghani QP, Weinreich J, Hunt TK, Becker HD,
Konigsrainer A. Lactate down-regulates cellular poly(ADP-ribose) formation in cultured human
skin fibroblasts. Eur J Clin Invest. 2007 Feb;37(2):134-9.
103
104
Appendix
Extraneous Data: U0126 Fluorophore as a Fluorescent Mitochondrial Marker
While investigating the U0126 fluorophore, I postulated the fluorophore might be a
commercially viable mitochondrial marker due to its specific localization. Employing U0126
directly in cell culture experiments to label the mitochondria might be counterproductive to other
experimental objectives, therefore I tested the ability of the purified fluorophore to localize to the
mitochondria in fixed cells. I extracted and concentrated fluorophore generated from a 15cm
plate of C4-2 cells exposed to 1OpM U0126 for 12 hours. I plated a second set of C4-2 cells on
glass cover slip and allowed them to attach for 48 hours. The cells on cover-slips were fixed and
then incubate with or without the concentrated fluorophore for 1 hour. The slides were then
mounted and evaluated by immunofluorescence. The resulting images are in figure 3-6 and the
fluorophore explicitly stains a specific staining of the mitochondrial structure increased above
background compared to the unstained control cells. These results imply the fluorophore may be
a viable commercial product as a post fixation mitochondrial stain.
Fluorophore
Negative
Figure A-1: C4-2 cells fixed and then stained with U0126 induced fluorophore for 1 hour
in PBS-T of left untreated. U0126 induced fluorophore was purified from a 15cm plate of
C4-2 cells treated with U0126 for 24 hours.
105
Endnotes
1. UO 126 was tested with resveratrol because it arrived in tandem with a p38 inhibitor and I
hypothesized it would act as a good negative control. At the time, I ran the experiment expecting
to find death increased when U0126 was added to the system
2. In the process of attempting to determine what resveratrol was differentially targeting between
LNCaP and C4-2 cells, I evaluated a lot of different nodes including: NFKB, CEBPp, SCD1,
FASN, PPARy, androgen receptor, ATGL, and SIRTi. None of these endeavors altered the
differential response between the cell lines.
3. The U0126 induced fluorescence was discovered while performing immunofluorescence
staining on cells to determine the localization of the androgen receptor.
4. The assay for cyanide can give a false positive reaction from excess hydrogen peroxide and
the concentrations in the cells were close to the detection limit of the assay. These findings
should be explicitly validated by another mechanism.
5. The proposed use of UO 126 as a multi-targeted drug is probably questionable at best. The
relationship between cyanide and cancer is complicated due to the misrepresentation of B 17
(amygdalin) as a cure in the 1950s. If the concept of a U0126 drug is evaluated for independent
development, caution should be employed to ensure the association with cyanide is valid and
will not induce systemic toxicity.
6. The role of glutamine in resveratrol-induced death was accidental. In late December 2010, the
morphology and growth characteristics of my cells changed substantially and they stopped dying
in response to resveratrol. After extensive troubleshooting it became clear our medium stocks
were being exposed to excess light in the cold room and supplementation of media with extra
glutamine recovered resveratrol-induced death.
7. The transaminase inhibitors employed to perturb metabolism are well known to have multiple
significant off target effects. Both appeared to induce some level of toxicity at early time points
which may not have been detected after the 12 hour incubation with resveratrol. In general, a
knockdown approach should be implemented to perturb glutamine metabolism and verify the
involvement of these pathways.
8. Removing glutamine from the media is a bit extreme, and therefore the role of cytosolic
glutamine should be validated with transporter knockdown experiments.
9. The final hypothesis made in the concluding remarks section is supported by the data I've
collected, but like many other hypotheses I've made during my graduate career I would guess it
only has about a 1 in 30 chance of being true. In my experience, if you search the literature
enough, you can connect almost any phenomenon to another through references and the false
positive rate of such associations in very high.
106