Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Translation The 2nd step in Protein Synthesis Translation Vocabulary 18)Anticodon 19)‘AUG’ 20)Codon 21)Polypeptide 22)‘Stop’ Codon 23)Translation IV. Translation A. Proteins are long chains of amino acids. B. Codon: 3 consecutive nucleotides that “code” for a specific amino acid. • What is the universal “start” codon: • AUG • What are the three “stop” codons? • UGA, UAA, UAG The Genetic Code (mRNA to Protein) Translating an mRNA codon: Start from the center and move outward. The Genetic Code Start from the left side, the bottom, then right side. C. Use the genetic code below to translate the following mRNA sequences (into amino acids) 1. mRNA: AUGUAUCGGGCAUUUUAA 2. mRNA: UCCAUGGAAGUGAUUCCAUAA 3. mRNA: CCAUGUGUCCCCAAUGAAAA C. Use the genetic code below to translate the following mRNA sequences: 1. mRNA: AUGUAUCGGGCAUUUUAA Methionine (START), Tyrosine, Arginine, Alanine, Phenylalanine, STOP. 2. mRNA: UCCAUGGAAGUGAUUCCAUAA Serine, Methionine, Glutamic Acid, Valine, Isoleucine, Proline, STOP 3. mRNA: CCAUGUGUCCCCAAUGAAAA Methionine, Cysteine, Proline, Glutamine, STOP, Lysine D. Translation: The decoding of RNA into a polypeptide chain (protein) E. The Central Dogma of Biology is: DNA RNA protein Where does the first step take place? Nucleus Where does the second step take place? Cytoplasm F. What is the job of tRNA during translation? Bringing amino acids to ribosomes, match them with the correct base on mRNA. What is an anticodon? The three bases on tRNA that match with mRNA codons. G. What is the role of the ribosome during translation? It is the site of protein assembly The 4 steps of Translation H. 1) mRNA is transcribed in the nucleus then travels to the cytoplasm 2) Ribosome grabs mRNA. tRNA brings amino acids to the ribosome 3) tRNA matches with complimentary mRNA. Ribosome makes peptide bond between amino acids, and breaks the bond between tRNA and amino acid. 4) Peptide chain continues to grow until ribosome reaches a stop codon Protein is complete. Protein structure/folding •Primary •Amino acids holding hands •Secondary •Alpha helix •Beta pleated sheets •Tertiary •Quaternary