Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Hospital-acquired infection wikipedia , lookup
Plasmodium falciparum wikipedia , lookup
Sexually transmitted infection wikipedia , lookup
Diagnosis of HIV/AIDS wikipedia , lookup
Schistosomiasis wikipedia , lookup
Hepatitis B wikipedia , lookup
African trypanosomiasis wikipedia , lookup
Herpes simplex wikipedia , lookup
Neonatal infection wikipedia , lookup
Oesophagostomum wikipedia , lookup
Toxoplasmosis wikipedia , lookup
Schizophrenia and Other Human Psychiatric Diseases Challenges for 21st Century Researchers Robert H Yolken, MD Director, Stanley Neurovirology Laboratory Ted and Vada Stanley Distinguished Professor of Pediatrics, Johns Hopkins School of Medicine, Baltimore Md. E Fuller Torrey, MD Medical Director, Stanley Medical Research Institute, Bethesda Md Faith Dickerson, PhD Director of Psychology, Sheppard Pratt Health System, Baltimore Md. Schizophrenia Clinical and Epidemiological Features Positive Symptoms Hallucinations, Delusions, Disordered Thinking Negative Symptoms Withdrawal, Amotivation, Restricted Expressiveness Impairment in Cognitive and Social Functioning Structural and Functional Brain Abnormalities Lifetime prevalence approximately 1% Peak onset of Symptoms in Young Adulthood Massive societal Consequences Worldwide Currently Available Medications Symptomatic improvement High rate of side effects Do not affect overall disease process Genetics Of Schizophrenia • Increased Incidence in Biological First Degree Relatives • General Population 1% • First Degree Relatives 7-9% • Monozygotic Twins 30% • Most individuals with schizophrenia do not have a first • • degree relative with this disease. Genetic factors have a large relative risk but a small risk in the overall population (5%) Intensive search for genes using molecular methods • Multiple (>30) chromosomal regions of linkage • Genetic polymorphisms of minor effect (OR~2) • No genes of major effect in different populations Microbial Agents and Schizophrenia Epidemiological Findings Specific Infectious Agent Perinatal Rubella (Brown et al, 2001; OR~3.5) Neonatal Enterovirus (Jones et al, 1998 OR~4) Maternal Herpesvirus (Buka 2001; OR~4) Possible Infectious Exposure Seasonality of Birth (Torrey at al, 1998; OR~2) Urban Birth (Mortenson et at, 1999, OR~2.5) Exposures in Pregnancy (Brown et al, 2000; Torrey et al, OR~3) Case Reports HIV Herpes Simplex Virus Borrelia bergdorferii Human Infectious Diseases Known Genetic Associations Agent Gene Function HIV EBV Hepatitis B Mycobacteria Salmonella H pylori S mansoni L donovani CCR5 XLP Man BP Il12; IFN R Il12; IFN R HLA-DQ GMCSF Cytokines Co-Receptor T-Cell Activity Viral binding Phagocytosis Phagocytosis Immune Response Phagocytosis Immune Function P falciparum HgS,G6PD Oxygenation Psychiatric Disorders Association with Viral Encephalitis HSV-1 HIV Influenza Measles EBV oxsackie Mumps Other Unknown 0 10 20 30 40 Percentage (108 total cases) Caroff et al, Psych Ann 31:193, 2001 50 Infections and Psychosis Bacteria and Parasites Bacteria Streptococcus pyogenes Borrelia burgdorferi Treponema pallidum Ehrlichiae Mycoplasma pneumoniae Bartonella henselae Salmonella typhii Parasites Toxoplasma gondii Plasmodium falciparum Babesiae Taenia solium Leishmania donovani Antecedents of Schizophrenia 264 Cases/528 Controls Fever in Pregnancy Pregnancy Complications Delivery Complications Urban Birth Developmental Delay Family Cat Family Dog 1 Scz Research 46:17-23, 2000 2 3 Odds Ratio (95% Conf) 4 Schizophrenia Working Hypotheses Most cases of schizophrenia are the result of infections and other environmental insults occurring in genetically susceptible individuals before the onset of clinically apparent symptoms. Distinct gene-environmental interactions may be operant in different populations. The role of specific infectious agents can be defined by clinical trials of anti-microbial chemotherapy. Identification of Infections in Schizophrenia Methods-Old and New Analytic Methods Differential Display PCR Library screening Microarrays Two-dimensional electrophoresis Enzyme immunoassays Samples for Analysis Brains collected by the Stanley Neuropathology Consortium Cerebrospinal fluid and blood samples from individuals with recent onset schizophrenia Blood samples from mothers of infants who developed schizophrenia in adult life Differential Display PCR Brain from Individual with Schizophrenia (S) and Unaffected Control(U) M S U S U S U M HIV Human Endogenous Retrovirus HERV-W Endogenous Retroviruses Borderland Between Viruses and Genes II Dynamic Effects on Gene Function Promoter control of adjacent genes- PLA2; Placental Genes Functionality of viral proteins-Syncytin; ASCT1 Glutamate transporter Interaction with infectious agents- Herpesviruses; Toxoplasma Interaction with soluble mediators-Hormones; Cytokines Role in Human Disease Diabetes- Superantigen activation Multiple Sclerosis- Glial cell function Autoimmune Arthritis- T cell activity Endogenous Retroviruses Activation and Transcription Microbe DNA Hormone Mediator 5’LTR Viral Proteins 3’LTR Human Retroviruses Activation by Herpesviruses Retrovirus Herpesvirus Reverse Transcriptase Activity Ctr DNA Scz Endogenous Retroviral PCR CSFs:Schizophrenia and Controls Herv-W HERVw C1 A1 A2 A3 A4 A5 A6 GTTCAGGGATAGCCCCCATCTATTTGGCCAGGCATTAGCCCAAGACTTGAGTCAATTCTCATACCTGGACACTCTTGTCCTTCAG ---------------------------------------------------C--------------------------------------------------------------A---------------------------------------------------TG------------------------------A---------------------------------------------------TG----------------------------------C----------------C--G----------------------------G-----------A----------------------------T----------C--G---------------------------TG-----A------------------------------------------------------------------------------------------T------------CA---TA-------------------C--G---------------------------TG- 0 CSF Unaff Ctrs Acute Scz . Unaff Ctrs Neuro Ctrs Chronic Scz Acute Scz Percentage Reactive Reactivity to Retroviruses Schizophrenia and Controls 40 p<.001 30 20 10 Blood Collaborative Perinatal Study Study Design 65,000 healthy mothers enrolled from 1957-1964 from 11 geographically diverse sites. Mothers followed closely during pregnancy. Neurocognitive and developmental testing during first 7 years of life. Primary outcomes cerebral palsy and mental retardation. Serum samples obtained from mothers during pregnancy and infants at birth (cord). Offspring identified with psychiatric diseases in 1990’s and matched to maternal and cord blood serum specimens. Schizophrenia in Adult Life Inflammation During Fetal Development 9 8 Odds Ratio 7 6 5 * * * 4 3 2 1 0 IgG IgM IgA TNF IL1 *p<01 IL2 IL6 IL8 Schizophrenia in Adult Life Infection During Fetal Development 6.00 Odds Ratio 4.80 3.60 2.40 1.20 0.00 CMV CMV Rub IgG IgM IgG Rub Toxo Toxo HSV1 HSV2 Herv IgM IgG IgM IgG IgG W National Children’s Study Mandated by congress in 1999 Scheduled to start in 2004 Target enrollment of 100,000 births Follow-up of offspring for 30 years Specimen Collection and Storage Unanswered questions Target diseases Number of sites Consent requirements System of medical care Infection and Cognitive Functioning Individuals with Schizophrenia (N=229) Antibody Positive Antibody Negative Cognitive Score (RBANS Total) 80 ** * HSV-1 Toxo 75 70 65 60 **p<.00001 *p<.009 CMV HSV-2 EBV Infectious Agent (IgG Antibodies) HHV-6 Cognitive Functioning in Bipolar Disorder Effect of HSV-1 Infection HSV-1 Ne g HSV-1 Pos e dia te M e mory <.01 la y e d M e mory Vis Con La ngua ge Atte ntion Tota l 70 75 80 85 RBANS Sc ore 90 95 100 Cognitive Functioning Schizophrenia and Bipolar Disorder HSV-1 Infected HSV-1 Uninfected 100 Score 90 80 70 60 Memory Total Cognitive Memory Bipolar Disorder Total Cognitive Schizophrenia Acylovir-Mechanism of Action Valacyclovir Clinical Trial Individuals with Schizophrenia Enrollment of 66 patients with stable schizophrenia on standard medication all given Valacyclovir 2 gm/day for 16 weeks Evaluation by the positive and negative symptom score (PANSS) Change in score correlated with viral antibody status at start of study HSV1/2 CMV Other herpesviruses Response to Valacyclovir HSV-1 Antibody Status 20 P er centage Im pr ovem ent HSV-1 Seronegative Percent age Improvement HSV-1 Seropositive 10 0 -10 2 4 8 12 Week of V alacyclovir Positive Symptoms 16 20 15 10 5 0 -5 -10 2 4 8 12 W eek of Valacyclovir Total Symptoms 16 Percentage Improvement Response to Valacyclovir by CMV Status 20 P<.006 20 10 10 0 0 -10 Percentage Improvement Negative Scale Positive Scale 30 2 4 8 12 16 -10 2 4 General Scale 8 16 Total Score 20 20 P<.02 P<.0005 10 10 0 0 -10 12 2 4 8 12 16 CMV Seropositive -10 2 4 8 12 16 CMV Seronegative Prevalence of Cytomegalovirus Populations with Schizophrenia Cologne-Untreated Cologne-Recently Treated Cologne-Control Heidelberg-Recently Treated Heidelberg-Control Baltimore-Chronic 0 10 20 30 40 50 60 Prevalence (%) 70 80 90 New Therapies for Schizophrenia Ongoing/Proposed Clinical Trials Treatment Trials Valacyclovir Other medications for Cytomegalovirus Azithromycin trial for Toxoplasma gondii Antimicrobial aspects of Psychiatric Medications Epidemiological Studies Additional Perinatal Cohorts Cohorts of Healthy Young Adults Cohorts of High-Risk Adolescents Intervention strategies for disease prevention Infections and Schizophrenia Conclusions Recent onset schizophrenia is associated with: Increased transcription of HERV-W Increased levels of antibodies to CMV Past infection with HSV-1 and Toxoplasma gondii are associated with cognitive impairment in individuals with stable schizophrenia. Maternal exposure to infectious agents is associated with an increased rate of schizophrenia in the adult life of the offspring. The administration of Valacyclovir can reduce symptoms in some individuals with stable schizophrenia. Microbial Agents and Schizophrenia Acknowledgements Johns Hopkins University Harvard University Loraine Brando Vern Caruthers Inna Ruslanova Bogdana Krivogorsky Stanley Program Michael Knable John Bartko Sheppard Pratt Hospital Faith Dickerson John Boronow Catherine Stallings Steve Buka Ming Tsuang University of Heidelberg Silke Bachmann Johannes Schroeder Karolinska Institute Håkan Karlsson University of Cologne F Markus Leweke