Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Planning and Executing siRNA Experiments—Good Practices for Optimal Results Garre% Re(g, PhD Abstract Func%onal analysis by mRNA knockdown using siRNAs is now rou%ne in many molecular biology labs. However, many RNAi-‐related experiments fail due to diversion from simple, good prac%ces. This webinar will review the steps leading to successful siRNA experiments, including: • Understanding the target transcript • siRNA selec%on • Choosing the cell type • Valida%ng the assay • Including appropriate biological controls 2 DsiRNA—Intracellular Pathway 3 DsiRNA Processing 4 DsiRNA Processing 5 RNAi-Mediated Knockdown or Artifact? Amplification Plot qPCR – Gene of Interest (GOI) Expression in HeLa Cells ∆ Rn ∆ Cq > 3.3, 90% knockdown Untreated controls siRNA targeting gene of interest Cycle 6 Strategy Iden%fy target gene of interest DsiRNA selec%on Cell line selec%on Op%mize experimental condi%ons Controlled pilot experiment 7 Op%mized experiment: gene of interest knockdown Understanding the Transcript 2° Structure Iden%fy target gene of interest Transcript variants Remaining mRNA Levels (%) Species varia%on GOI Knockdown in HeLa Cells at 1 nM Normalized to Hs HPRT and SFRS9 vs NC1, NC5, and NC7 120 110 100 90 80 70 60 50 40 30 20 10 0 0 500 1000 1500 2000 2500 3000 3500 4000 4500 siRNA (Hs LocaFons) 8 Hs STAT3 574-‐720 (FAM) Hs STAT3 3904-‐4036 (MAX) INTEGRATED DNA TECHNOLOGIES 5' UTR CDS 3' UTR 5000 qPCR Assay Discordance 2° Structure Iden%fy target gene of interest Transcript variants Species varia%on 120 GOI Knockdown in HeLa Cells at 1 nM Normalized to Hs HPRT and SFRS9 vs NC1, NC5, and NC7 110 Assay discordance appears at the 3’-‐end of the transcript. Measured mRNA levels show significant divergence Retained mRNA fragments “Geographically” spaced qPCR assays mRNA Remaining (%) 100 90 80 70 60 50 40 30 20 10 0 0 9 500 Assay 1 1000 Assay 2 5' UTR CDS 1500 3' UTR Understanding the Transcript 2° Structure Iden%fy target gene of interest Transcript variants Species varia%on qPCR Assay Loc DsiRNA Loc Transcript variants (and rela%ve abundance) can affect results in a qPCR assay and DsiRNA loca%on-‐ dependent fashion. hZp://www.informaFcs.jax.org/genes.shtml 10 Understanding the Transcript 2° Structure Iden%fy target gene of interest Transcript variants Species varia%on Hs GOI Mm GOI Region of Mm/Hs sequence homology Interspecies alignment of mRNA sequence can affect future experimental direc%ons. 11 Selecting an Effective siRNA DsiRNA selec%on Design rules Design tools 12 Reynolds Nat Biotechnol (2004) 22(3):326-30 1. siRNA targeted sequence is usually 21 nt in length 2. Avoid regions within 50-100 bp of the start codon and the termination codon 3. Avoid intron regions 4. Avoid stretches of 4 or more bases (AAAA, CCCC) 5. Avoid regions with GC content <30% or >60% 6. Avoid repeats and low complexity sequence 7. Avoid SNP sites 8. Perform BLAST homology search to avoid off-target effects on other genes or sequences 9. Design negative controls as scrambled sequence of the target Selecting an Effective siRNA DsiRNA selec%on Tuschl Design rules Design tools 13 Methods (2002) 26(2):199-213 1. Select targeted region from a given cDNA sequence 50-100 nt downstream of start codon 2. First search for 21-nt sequence motif AAN19. If no suitable sequence found, then, 3. Search for 23-nt sequence motif NAN21 and convert the 3ʹ′ end of the sense siRNA to TT 4. Or search for NARN17YNN 5. Target sequence should have a GC content of around 50% Selecting an Effective siRNA DsiRNA selec%on Ui-Tei Design rules Design tools 14 Nucleic Acids Res (2004) 32(3):936-48 1. A/U at the 5' end of the antisense strand 2. G/C at the 5' end of the sense strand 3. At least five A/U residues in the 5' terminal one-third of the antisense strand 4. The absence of any GC stretch of more than 9 nt in length Selecting an Effective siRNA DsiRNA selec%on Design rules Design tools 15 Selecting an Effective siRNA DsiRNA selec%on Design rules Design tools 16 Selecting an Effective siRNA DsiRNA selec%on Design rules Design tools 17 Guarantee: 2 of the top 3 ranked DsiRNAs will exhibit >70% knockdown at 10 nM transfecFon in a well-‐controlled experiment Tested 50 genes to confirm the frequency of achieving guaranteed knockdown. • 42/50 genes had 2 out of the first 3 ranked DsiRNAs pass at 10 nM. • 50/50 genes had at least 3 passing DsiRNAs out of the tested set of 10 at 10 nM. Cell Line Expression profile Cell line selec%on Literature search Assay valida%on Relative Abundance Hs GAPDH Tissue Prevalence 18 http://biogps.org/#goto=welcome INTEGRATED DNA TECHNOLOGIES Cell Line Expression profile Cell line selec%on Literature search Assay valida%on Biomaterials 33 (2012) 1154-1161 GAPDH NIH 3T3 murine fibroblasts 12,500 cells/cm2 6.25 – 50 nM qPCR 19 Cell Line Expression Profile Cell line selec%on Literature Search Assay valida%on § qPCR § Western § bDNA Northern § § Phenotype Amplification Plot ∆ Rn qPCR – Gene of Interest Expression in Candidate Cell Line Untreated controls 106 Cycle 20 INTEGRATED DNA TECHNOLOGIES 105 104 103 102 101 Cell Line Expression Profile Cell line selec%on Literature Search Assay valida%on 21 INTEGRATED DNA TECHNOLOGIES Cell Line Expression Profile Cell line selec%on Literature Search Assay valida%on HPRT mRNA and Protein Knockdown 10nM Transfection in HeLa Cells 22 INTEGRATED DNA TECHNOLOGIES Optimizing Conditions Transfec%on Controls Op%mize experimental condi%ons OpFmizing U87 Cell TransfecFons HPRT Knockdown Normalized to SFRS9 24hr Reverse TransfecFons 110% 100% Remaining mRNA Levels (%) 90% 80% 70% 6uL INTERFERin 60% 3uL TKO 50% 1uL siLentFect 40% 2uL RNAiMAX 30% 20% 10% 0% NC1 10nM 23 HPRT 10nM Optimizing Conditions Transfec%on Controls/Variables Op%mize experimental condi%ons Nega%ve Control DsiRNAs 5'3'5'3'5'3'- CGUUAAUCGCGUAUAAUACGCGUAT ||||||||||||||||||||||||| CAGCAAUUAGCGCAUAUUAUGCGCAUA CAUAUUGCGCGUAUAGUCGCGUUAG ||||||||||||||||||||||||| UGGUAUAACGCGCAUAUCAGCGCAAUC GGCGCGUAUAGUCGCGCGUAUAGTC ||||||||||||||||||||||||| CUCCGCGCAUAUCAGCGCGCAUAUCAG Addi%onal parameters to op%mize: TransfecGon reagent Dose-‐response -‐ reagent Cell seeding density Dose-‐response – DsiRNA Forward/reverse Time course Reagent:DsiRNA raGo Posi%ve Control DsiRNA – HPRT (Hypoxanthine-‐guanine phosphoribosyltransferase) 5'3'- 24 GCCAGACUUUGUUGGAUUUGAAATT ||||||||||||||||||||||||| UUCGGUCUGAAACAACCUAAACUUUAA Experimental Setup Cells Only HPRT Pos – 10 nM Reagent Only HPRT Pos – 1 nM Neg siRNA#1 – 10 nM HPRT Pos – 0.1 nM Neg siRNA#2 – 10 nM GOI siRNA – 10 nM • Nega%ve controls • Posi%ve controls • DsiRNA targe%ng gene of interest • Biological replicates • Technical replicates 25 Summary 2° Structure Iden%fy target gene of interest Transcript variants DsiRNA selec%on Species varia%on Design rules Design tools Transfec%on Controls Op%mize experimental condi%ons Expression profile Cell line selec%on Assay valida%on Controlled pilot experiment 26 Literature search Op%mized experiment: gene of interest knockdown Additional Resources EducaFonal Resources at www.IDTDNA.com Under Support & Educa0on Menu • DECODED Newsleeer (www.IDTDNA.com/ DECODED) • Video Library • Frequently Asked Ques%ons • More… Design Tools at www.IDTDNA.com/SciTools or Under the Tools Menu • Custom RNAi Design Tool • Predesigned DsiRNA Selec%on Tool • PrimeTime® qPCR Assays Tool • PrimerQuest® Tool for PCR and qPCR Design Customer Care and Technical Support for Design, Experimental Issues, and Ordering Help • [email protected] 27 INTEGRATED DNA TECHNOLOGIES Additional Resources AddiFonal Product InformaFon: • More informa%on on DsiRNA 27mer duplexes at www.idtdna.com , under Products &Services/DsiRNA • More informa%on on PrimeTime® qPCR Assays and products at www.IDTDNA.com/PrimeTime Related IDT PublicaFons Molecular Therapy (2012) 20(3):483-‐512. Gene Therapy (2011) 18:1111-‐1120. OligonucleoAdes (2008) 18:305-‐320. Curr Opin in Mol Ther (2007) 9(2):110-‐118. Nature Methods (2006) Online 23 August; DOI: 10.1038. • Nucleic Acids Research (2005) 33:4140-‐4156. • • • • • 28 INTEGRATED DNA TECHNOLOGIES Integrated DNA Technologies, Inc. 1710 Commercial Park Coralville, Iowa 52241 USA