Download c. Chemiosmosis (electron transport)

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Vectors in gene therapy wikipedia , lookup

Biology wikipedia , lookup

Organ-on-a-chip wikipedia , lookup

Life wikipedia , lookup

Living things in culture wikipedia , lookup

List of types of proteins wikipedia , lookup

Triclocarban wikipedia , lookup

Cell theory wikipedia , lookup

Drosophila melanogaster wikipedia , lookup

State switching wikipedia , lookup

Evolution of metal ions in biological systems wikipedia , lookup

Symbiogenesis wikipedia , lookup

Developmental biology wikipedia , lookup

Sexual reproduction wikipedia , lookup

Introduction to genetics wikipedia , lookup

Evolutionary history of life wikipedia , lookup

Photosynthesis wikipedia , lookup

Transcript
BIOL 1114
EXAM 4 (No Star Form)
May 9, 2002
Use a # 2 pencil to fill in the information portion of your NCS answer sheet including the appropriate circles
(bubbles). Write “No Star Form” – above your name in the margin of your NCS answer sheet. Read all questions
and answers carefully before choosing the single BEST response for each question. Feel free to ask the
instructor for clarification. Don’t be shy.
----------------------------------------------------------------------------------------------------------------------------------------Use the following information to answer the next 7 questions:
A farmer starts a field of alfalfa from seeds. The seeds will germinate and develop into mature plants that will be
used to feed chickens that in turn are eaten by humans. In order to increase the crop the farmer takes two actions:
1. addition of fertilizers to the soil (the fertilizer contains nitrogen and phosphorus), 2. spraying the plants with a
pesticide (long lasting, non-biodegradable) that kills insects that eat the alfalfa leaves.
1. During growth, new cells are produced in alfalfa by_________, in insects by_________ and in chickens
by__________.
a. mitosis, mitosis, mitosis
b. meiosis, meiosis, meiosis
c. mitosis, meiosis , meiosis
d. meiosis, mitosis, mitosis
e. mitosis, meiosis, mitosis
2. Which one or more of the following statements is INCORRECT?
a. Alfalfa plants conduct cellular respiration only in the dark and photosynthesis only in the light.
b. Alfalfa plants conduct cellular respiration in the dark and in the light.
c. Alfalfa plants conduct cellular respiration only in the light and photosynthesis in the light and dark.
d. Chickens conduct cellular respiration in dark and in light.
e. Both (a) and (c) are incorrect.
3. In the trophic (food) pyramid on this farm, alfalfa plants are__________ , chickens are__________ and humans
are __________.
a. primary consumers, secondary consumers, tertiary consumers
b. primary producers, secondary producers, tertiary producers
c. primary producers, primary consumers, secondary consumers
d. primary producers, secondary consumers, secondary consumers
e. primary consumers, primary consumers, secondary consumers
4. After a few seasons of spraying this non-biodergadable pesticide, in which organism’s tissues will you expect to
find the highest levels of the pesticide?
a. Alfalfa
b. Insects
c. Chickens
d. Humans
e. All organisms will have about the same level of the pesticide.
5. _________ produced by alfalfa plants in photosynthesis is used by chickens to produce _________ in cellular
respiration.
a. proteins, fats
b. RNA, DNA
c. ATP, NADPH
d. oxygen, ADP
e. glucose, ATP
6. The phosphorus and nitrogen used in the fertilizer may run off into a lake. This may result in which one or more
of the following:
a. eutrophication
b. increase in algae biomass
c. anoxia leading to fish death
d. increase in species diversity
e. (a), (b) and (c) are correct
7. The farmer discovered that after many years of use, the non-biodegradable pesticide stopped killing all the
insects. The most likely explanation is that_________ .
a. because of genetic variability, some insects are more resistant to the pesticide than the others
b. the incompetent farmer did not spray some patches in the field
c. some smart insects waited and did not eat the leaves until the insecticide was biodegraded
d. the surviving insects are nocturnal and the insecticide is sprayed during the day.
8. In BIOL 1114 you learned that N (nitrogen) and P (phosphorus) can act as limiting factors for photosynthetic
organisms in aquatic ecosystems. Which one of the following would be the best hypothesis concerning why
carbon is NOT a limiting factor for photosynthetic organisms?
a. Carbon is easily released by the weathering of rock.
b. Plants synthesize their own carbon atoms during photosynthesis.
c. Carbon, in the form of carbon dioxide, is constantly available in the environment.
d. Carbon is released the by the Calvin Cycle and immediately used by plants.
9. Tina and Raider are golden retrievers. Raider is a male and has a larger body size than Tina, but otherwise is
similar in shape. When Tina and Raider practice their retrieving skills during the summer months they pant
quite a bit. Which of the following would be the best hypothesis for why the dogs are panting?
a. Their body temperature has dropped below the upper critical limit for their species.
b. Their body temperature has increased beyond the upper critical limit for their species.
c. Their body temperature has dropped below the lower critical for their species.
d. Their body temperature is within the thermal neutral zone for their species.
10. Tina sometimes wears a purple collar and Raider wears a blue collar. Our ability to distinguish these two
collars is based on all of the following EXCEPT _______.
a. The colors of the wavelengths of light that each collar reflects.
b. The blue wavelengths of light that the blue collar absorbs.
c. The purple wavelengths that are reflected by the purple collar.
d. Action potentials from cone cells (color vision) in the retina of our eye to our brain.
11. Tina has _________ surface area to volume ratio when compared to Raider.
a. a greater
b. a smaller
c. the same
12. Raider will lose and gain heat __________ Tina
a. faster than
b. slower than
c. at the same rate as
13. Some snakes, such as the green mamba, produce venom that contains a type of toxin called fasiculin. This
toxin results in paralysis of the cardio-respiratory system (heart and diaphragm). A victim can die within minutes
of being bitten if the venom is delivered directly into a vein. Which one of the following is consistent with
paralysis?
a. mimicking acetylcholine
b. enhancing acetylcholinesterase activity
c. increasing the number of acetylcholine receptors
d. inhibiting acetylcholinesterase
14. The sandstone hills of Borneo are considered nutrient poor, yet the area contains several thriving species of
plants, such as the fern Dischidia. If you slice open one of the large fern leaves you will find an ant (Philidris)
nursery. Because of the fern roots’ unique location in the leaf base, the roots can draw nourishment from the
nutrient-rich debris that the ants drag into the hollow leaf. The fern feeds its ant colony with edible masses of
oily orange spores. This is an example of:
a. the importance of surface area to volume ratio
b. coevolution
c. adaptive radiation
d. sexual selection
15. In the fern plants, the primary function of the Calvin Cycle (light independent reactions) is to
a. convert glucose into carbon dioxide and water
b. use ATP to split glucose
c. fix carbon from carbon dioxide into glucose
d. produce NADPH that is used latter in photosynthesis
e. convert pyruvate into carbon dioxide
16. Which of the following is NOT required for photosynthesis in the fern plant?
a. oxygen
b. ADP
c. sunlight
d. NADP+
e. water
17. Which of the following is NOT required for cellular respiration in the fern plant?
a. oxygen
b. ADP
c. NAD+
d. CO2
e. None of the above is required because plants do not perform cellular respiration.
Use the following information to answer the next 4 questions:
The spotted salamander (an amphibian) can be found laying its eggs in small pools during the springtime in many
areas of the United States. Prior to laying her eggs the female fertilizes them by selecting packets of sperm left
behind by males. She retains the fertilized eggs for about a week before she deposits them on a sturdy twig
beneath the water’s surface where the eggs hang together in a gelatinous mass. If the pool gets enough sunlight,
algae will form on the egg mass. The gelatinous substance surrounding the eggs provides an excellent medium for
the single-celled plants to attach and grow. In turn the algae transmit oxygen to the salamander embryos, ensuring
robust development and increased chances of survival. Once the eggs hatch, the young search for food and
remain in the ponds until they complete metamorphoses and leave the pool.
18. Given the above information you would correctly predict that the spotted salamander has a _______ mating
system.
a. monogamous
b. polygamous
19. The oxygen that the algae provide to the salamanders is ______.
a. produced by cellular respiration
b. released from the splitting of water by photosystem II
c. released from the Krebs Cycle
d. released from the Calvin Cycle (light independent reactions)
22
20
18
16
14
12
PM
PM
5:
00
AM
PM
3:
00
1:
00
AM
11
:0
0
AM
9:
00
7:
00
AM
10
5:
00
21. The pools containing the baby salamanders are
shallow and the water temperature fluctuates during
the day. On warm spring days, which of the following
would you correctly predict to happen between dawn
and noon in this ectotherm?
a. Metabolic rates of the salamanders stay
constant.
b. Body temperatures of the salamanders stay
constant.
c. Metabolic rates of the salamanders decrease.
d. Body temperatures of the salamanders
decrease.
e. Metabolic rates of the salamanders increase.
Water Temperature (degrees
C)
20. The salamanders directly use the oxygen _________.
a. in glycolysis to generate ATP and NAD+
b. in Krebs to generate ATP and FAD+
c. in chemiosmosis as the final electron acceptor
d. in translation to build ribosomes
TIme of day
22. Suppose you set up 2 identical experimental chambers
containing mitochondria. One chamber is kept at 20C (cool room temperature) and the other is kept at 37C
(human body temperature). Which one or more of the following would you correctly predict to occur?
a. Glycolysis and the Krebs Cycle would be inhibited in the mitochondria held at 37C.
b. More ATP would be made by the mitochondria held at 37C than those held at 20C.
c. Less CO2 would be released by the mitochondria held at 20C than those
held at 37C.
d. All of the above would be correct predictions.
e. Both (b) and (c) would be correct predictions.
Use the following information to answer the next 2 questions:
Dr. I. M. Kutov, a prominent anatomist and physiologist, is renowned for his ability to identify organs from numerous
animal species. Upon a visit to his college’s anatomy lab, Prof. Kutov immediately identified the remains of an
Australian Outback rat, a desert dweller that drinks no water.
23. What anatomical feature of the desert rat would Dr. Kutov use to distinguish the desert rat remains from that of
animals from more temperate climates?
a. A relatively large urinary bladder
b. Relatively small ears
c. A much longer nephron loop in the kidney
d. A much shorter nephron loop in the kidney
e. Short, thick legs
24. The Australian Outback rat drinks no water and gets only 10% of its water requirement from its seed diet. How
does it obtain the rest of its water?
a. Glycolysis
b. Krebs Cycle
c. Chemiosmosis (electron transport)
d. Fermentation
e. Na+/K+ pump
25. Which statement below is NOT correct?
a. Mutations can be natural.
b. A mutation can exist before there is any use for it.
c. A few mutations are beneficial, although most are detrimental or neutral.
d. New traits appear in organisms because they need them.
e. Having many mutations in a population is evolutionarily advantageous.
Use the following information to answer the next 4 questions:
On a recent episode of “Third Watch” on NBC, paramedics rescued an elderly woman who had become trapped
and frozen solid after a fall into a flooded basement of an old building.
26. Which of the following would NOT have helped the woman survive being frozen?
a. counter-current heat exchange
b. vasoconstriction
c. sacrifice
d. shivering
e. evaporative cooling
27. While the firemen were working to free the woman from the ice, the paramedics started an IV of warmed saline
(NaCl + H2O) to begin the process of slowly warming the woman. To prevent further complications (maintain
homeostasis), the paramedics should be sure that the saline solution has ____________.
a. a higher NaCl concentration than that of the woman’s blood
b. the same NaCl concentration as that of the woman’s blood
c. a lower NaCl concentration than that of the woman’s blood
d. a drug to decrease vasodilation of the woman’s blood vessels
e. a temperature close to boiling
28. In the ambulance, one of the paramedics took off his outer clothing and put his body in contact with the woman
to help warm her. Which one or more of the following is (are) involved in warming the woman?
a. Conduction
b. A heat gradient
c. Increasing surface area in contact
d. Evaporation
e. (a), (b), and (c) are involved
29. The woman’s 4-year-old grandchild had been left alone upstairs while the woman was in the basement. If the
child had been trapped and frozen with her grandmother she would have been LESS LIKELY to survive
because ____________.
a. she has a smaller surface to volume ratio and thus would have frozen more quickly
b. she has a smaller surface to volume ratio and thus would have frozen more slowly
c. she has a larger surface to volume ratio and thus would have frozen more quickly
d. she has a larger surface to volume ratio and thus would have frozen more slowly
e. she has the same surface to volume ratio and would have frozen more quickly
30. Ichthyophthirius is a one-celled parasite that lives in the skin of freshwater fishes (those that live in ponds, lakes
and streams). When it lives in the fish, the concentration of salts in the parasite is the same as that in the fish
tissue. When the parasite leaves the fish to swim and look for another fish, it lives in fresh water, which has a
lower concentration of salts than the parasite or the fish. When the parasite moves into the fresh water, water
will immediately move _____.
a. mostly into the parasite cell
b. mostly out of the parasite cell
c. at the same rate into and out of the parasite cell
d. to make the cell shrink
Use the following information to answer the next 3 questions:
Dr. Saltspray is interested in determining which of 4 types of algae (yellow, red, brown, and green) have been eaten
by crabs. She states that the hypothesis she is testing is “members of the same species will eat the same type of
algae”. After conducting her experiment, Dr. Saltspray finds that out of 10 crabs she sampled, 8 of the crabs had
eaten the yellow, red, and brown algae, while the other 2 had only eaten green algae. Dr. Saltspray sends a copy
of her report to you to review. In her report, she states “I have proven that the 2 green algae eating crabs are
evolving into a new species”.
31. Dr. Saltspray has ____________.
a. written a theory that she is incorrectly calling a hypothesis
b. written a hypothesis that would be correct if she added the word “because” to the beginning
c. written a prediction that she is incorrectly calling a hypothesis
d. written an observation that she is incorrectly calling a hypothesis
e. written a good testable hypothesis
32. In your review, you would correctly disagree with Dr. Saltspray’s statement that “I have proven that the....”
because:
a. in any experiment you cannot control all the possible variables, therefore some doubt always remains
about the truth or falsity of any hypothesis.
b. her sample size is inadequate to prove her hypothesis.
c. she did not compare her results to a control.
d. only theories are proven, not hypotheses.
e. Both (a) and (d) are correct.
33. Dr. Saltspray determined which algae the crabs preferred by presenting crabs with the four algae types (i.e. her
independent/manipulated variable) and watching them eat. Which of the following could she have used as her
dependent/response variable?
a. Number of crabs surviving
b. Amount of each type of algae eaten
c. Size of crabs
d. Time of day
e. Total amount of algae available
34. In the cell membrane of a neuron (nerve cell) which one or more of the following structures/molecules would
you expect to find?
a. proteins embedded in the cell membrane
b. NADP+ and CO2 channels embedded in the membrane
c. mitochondria
d. antibodies
e. All of the above
35. Which of the following parts of the neuron require the use of ATP to function?
a. phospholipids that comprise most of the cell membrane
b. Na+ and K+ channels embedded in the membrane
c. Na+/K+ pump
d. All of the above
36. Many of the neurotoxins we discussed in class are produced by plants. Plants produce these toxins because of
which one or more of the following.
a. they are effective insecticides
b. they increase the fitness of those plants that produce them
c. the plants that produce them always do better than the plants that don’t
d. Both (a) and (b) are correct.
e. Both (a) and (c) are correct.
37. If endosymbiosis had never occurred, which of the following organelles would be missing from eukaryotic
photosynthetic cells?
a. ribosomes
b. Golgi
c. vesicles
d. mitochondria
e. smooth endoplasmic reticulum
Use the following information to answer the next 5 questions:
The early voyages to the New World took months. In the first ship, upon first leaving England, there were 20 rats
on board. Life on board the ship was good for the rats. There were no cats or dogs on this particular ship and the
grain to start the new colony was stored in the hold. When the ship arrived in New England 12 months later, there
were 60 rats that colonized the New World along with the pilgrims.
Some useful equations: G = rN
G = rN[(K-N)/K]
r=b–d
birth (death) rate = # born(died)/N
38. What was the growth increment (G) for this population during the year on the boat?
a. 20 rats
b. 40 rats
c. 60 rats
39. What is the intrinsic rate of growth (r) for this population?
a. 0.5 rats/rat/year
b. 1 rats/rat/year
c. 2 rats/rat/year
d. 20 rats/rat/year
e. 40 rats/rat/year
40. How many brown rats (N) would you expect to find in the colony if they had remained on the ship under the
same conditions for another year?
a. 100 rats.
b. 120 rats.
c. 180 rats.
d. 1000 rats.
e. 1200 rats.
When the first colony of brown rats (N = 60) arrived in New England, they did not find conditions in their new
surroundings as cushy as it had been on board the ship. There was still food around if one knew how to find it, but
there were also foxes and owls that began to reduce their numbers and they were exposed to diseases carried by
fleas and ticks on the local rodents. As a result, the colony’s numbers would be limited to 500.
41. What is the carrying capacity (K) for this population in its new habitat?
a. 40 rats
b. 60 rats
c. 120 rats
d. 500 rats
e. 620 rats.
42. Under these conditions, which of the following graphs would you predict to most accurately reflect the growth of
the brown rats over the next several generations?
a.
b.
c.
Use the following information to answer the next 10 questions:
Your lab’s new terrarium is inhabited by lush green ferns, bluebottle flies, several small frogs and a pair of large
king snakes. This reflects the order of the terrarium’s terrestrial food chain (i.e. ferns eaten by flies who are eaten
by frogs who are eaten by snakes). A miniature pond also exists within the terrarium that is inhabited by a large
variety of microorganisms, including photosynthetic green algae, Daphnia (water fleas) and many bacterial species.
43. If one fern leaf, containing 1000 calories of energy, is consumed entirely by the fly, how much energy from this
leaf reaches a king snake after progressing through the entire food chain?
a. 1 calorie
b. 10 calories
c. 100 calories
d. 500 calories
e. 1000 calories
44. Through which organism does atmospheric carbon return to the food chain?
a. Fern plants
b. Frogs
c. Bluebottle flies
d. Water fleas (Daphnia)
e. King snakes
45. Carbon (as carbon dioxide) can return to the atmosphere from ___________.
a. Fern plants
b. Algae
c. Bacteria
d. Frogs
e. All of the above
46. The terrarium’s miniature pond functions as a latrine (outhouse) for the frog population. After several weeks,
you notice that the pond becomes a rich green color as the algae population expands rapidly and the water flea
and aerobic bacterial populations decline. This reduction of the pond’s biodiversity is likely a consequence of
____________________.
a. Exponential algal growth
b. Eutrophication of the pond
c. Natural selection
d. Both (a) & (b) are correct.
e. (a), (b) & (c) are correct.
47. After several generations of frogs, you notice that a small portion of the frog population is no longer eaten by
the king snakes. A chemical analysis of several of these frogs reveals a secreted toxin that makes the frogs’
unpalatable (inedible) to the snakes. The presence of these inedible frogs in the population is most likely the
result of which one or more of the following?
a. Random mutation(s)
b. Mutations caused by frightened frogs
c. Natural selection
d. Lack of courage in older king snakes
e. Both (a) and (c) are correct.
48. A supply of phosphate is essential for synthesizing components of nucleic acids as well as cellular membranes.
The phosphate first entered the terrarium’s terrestrial food chain due to____________________.
a. synthesis of phosphate by the frogs from the pond water
b. absorption of phosphate by the fern plants from soil
c. absorption of atmospheric phosphate by flies during respiration
d. consumption of flies by the frogs
e. consumption of frogs by the snakes
49. The bluebottle fly population expands rapidly for several weeks until it levels off to a carrying capacity (K) of 200
flies in the terrarium. This is a result of ___________
a. Random mutations
b. Exponential growth (J-curve)
c. Logistic growth (S-curve)
d. The Bell Curve
e. Well-trained frogs
50. If fewer frogs are eaten by the snakes, you would predict that the fly population would _________.
a. grow exponentially (J-curve)
b. be controlled by density-independent factors
c. be limited by a reduced carrying capacity (K)
d. have an increased mutation rate
e. Both (a) and (b) are correct.
51. A biochemist isolates double-stranded DNA from each species within the terrarium: Of these, which species’
DNA would have much more cytosine (C) than guanine (G) among its nitrogenous bases?
a. Bacteria
b. Fern plants
c. King snakes
d. Both (a) and (b) are correct.
e. Each species’ DNA has equal percentages of these bases.
52. When frightened, the frogs often secrete a repellent skin toxin. Microscopic analysis of the secretory cells
reveals that they are not spherical, but elongated tongue-shaped cells. One might hypothesize that natural
selection favored these elongated cells as superior for secretion because
a. They can secrete more toxin from the cell per minute than from a spherical cell of equal volume.
b. They have the same surface area to volume ratio as spherical cells.
c. They have a lower surface area to volume ratio than spherical cells.
d. Their ribosomes synthesize proteins at a lower rate than spherical cells.
53. Some proposed fat reduction techniques by modern weight-loss advocates involve manipulation of blood
concentrations of natural fat metabolism agents, including the leptin hormone. Which of the following
statements is a correct consequence of the presence of INCREASED blood levels of leptin from fat cells?
a. Electron transport within the mitochondrial inner membrane slows down.
b. The cell decreases use of NADH.
c. The cell decreases production of water (H2O) from oxygen (O2).
d. The cell decreases production of ATP from ADP by uncoupling electron transport from ATP
synthesis.
e. Heat production by the cell decreases.
54. Leptin production is NOT constant. Which cells in the body would you predict are producing the leptin
hormone (a protein)?
a. Those with the lowest number of secretory vesicles.
b. Those with the gene for the leptin receptor.
c. Those with the most mRNAs coding for leptin hormone.
d. Those with the most mRNAs coding for leptin receptors.
e. Those with the gene for the leptin hormone.
Use the following information to answer the next 6 questions:
In the cichlid fish, Cyathopharynx furcifer, males form leks (areas of courting males) similar to prairie chickens by
building "bowers," large volcano-shaped structures composed of fine sand, over which the male courts potential
mates. Females visit the lek and examine potential mates. A scientist measures territory size and length of pelvic
fins (one fin is found on each side of the fish) in males.
Male Territory size
1 m2
5 m2
10 m2
# males that
successfully
attract mates
23
50
10
# males that
do not attract
mates
22
51
10
Difference in fin
lengths in pairs of
pelvic fins
0 mm
2 mm
4 mm
# males that
successfully
attract mates
50
8
1
# males that
do not attract
mates
1
23
16
55. Based on the information and data provided, females are probably using which cue to select mates?
a. Male size
b. Male pelvic fin symmetry
c. Size of males’ territory
d. Size of males’ pelvic fins
e. Size of bowers
56. Based on the information and data provided, you would correctly predict that the males most likely to have the
greatest fitness are those with __________
a. pelvic fins of the same length
b. larger pelvic fins
c. larger territories
d. smaller bowers
e. fewer matings
57. Which of the following data would provide the best evidence concerning fitness?
a. number of matings
b. number of eggs in nest
c. number of sperm produced
d. number of eggs that hatch
e. number of offspring that reproduce
58. While natural selection results in organisms better adapted to the environment, sexual selection results in
organisms that
a. are stronger
b. are longer lived
c. are more attractive to members of the opposite sex
d. produce fewer surviving young
e. are eaten more often
59. If the size of these cichlids’ tails was affected only by sexual selection, which of the following statements would
be correct?
a. As the tail size increased, the likelihood that the males would survive would increase
b. Females would mate more often with males with larger tails
c. Males with larger tails would swim slower
d. Males with larger tails would swim faster
e. Males with larger tails would live longer
60. Monogamy is more likely to occur than polygamy when
a. males and females are vastly different in size.
b. it leads to fewer offspring.
c. animals live longer.
d. both parents must care for the young .
e. offspring develop into adults rapidly.
Not all color-blindness is X-linked. Tritanopia is a rare form of color-blindness in which the affected person cannot
distinguish shades of blue. The gene for this condition is found on Chromosome 7.
Tritanopia gene
sequence for each
allele
Blue visual pigment
production
Ability to distinguish
blue wavelengths
Number of this allele
needed to show effect
TTT TAA AAT
yes
yes
2
TTT CAA AAT
no
no
1 or 2
61. The mutation in the gene sequence above results in the production of....
a. Gly in the dominant allele instead of Arg in the recessive allele.
b. Val in the dominant allele instead of Ile in the recessive allele.
c. Pro in the dominant allele instead of Ser in the recessive allele.
d. an early stop in the dominant allele instead of Ile in the recessive allele.
e. an early stop in the recessive allele instead of Ile in the dominant allele.
62. Which of the following hypotheses is most consistent with the data provided and explains why those who are
heterozygous for this trait are unable to distinguish blue wavelengths, unlike those with normal vision?
a. They totally lack blue visual pigments.
b. They have higher than normal amounts of blue visual pigments than either of the two homozygotes.
c. They have lower than normal amounts of blue visual pigments than either of the two homozygotes.
d. They have higher than normal amounts of blue visual pigments than those with normal vision.
e. They have lower than normal amounts of blue visual pigments than those with normal vision.
63. A woman has Tritanopia, although her mother did not. She has children with a man who can see blue. You
would correctly predict that ____ of their children would be unable to distinguish shades of blue.
a. 0%
b. 25%
c. 50%
d. 75%
e. 100%
Use the following information to answer the nest 7 questions:
Neurons do not have receptors to detect bacteria or viruses, yet the presence of these microorganisms can cause
profound changes in behavior, that result in wasting away or anorexia. Because the immune system has receptors
capable of detecting bacteria and viruses, researchers have begun to examine how the immune system might
transmit messages to the brain. Recent work has shown that a chemical (TNFα) released by white blood cells
affects fat cells.
64. Which of the following predictions would be the most likely to be correct for those individuals exhibiting
anorexia?
a. TNFα stimulates increased leptin production
b. TNFα stimulates decreased leptin production
c. TNFα blocks leptin receptors
d. Leptin blocks TNFα receptors
e. Leptin blocks TNFα production
65. To trigger a response, there must be TNFα receptors. You would look for them on
a. leptin
b. TNF
c. pathogens
d. fat cells
e. white blood cells
66. If the Template DNA that codes for the receptor had the sequence CAT-CCG-ACG, then the amino acid
sequence found at that point in the receptor protein would be:
a. GTA-GGC-TGC
b. Pro-Glu-Arg
c. GUA-GGC-UGC
d. Val-Gly-Cys
e. Val-Asp-Ser
67. To examine the TNFα receptor gene, scientists cut it with a restriction enzyme that acts on the sequence
CTTTAC. How many cuts would it make in the sequence of linear DNA
TACACCCTTTACGCGCGGCTTTACTTTAAATATAACT ?
a. 1
b. 2
c. 3
d. 4
e. 5
68. If a heritable mutation arose leading to a phenotype that did not produce TNFα receptors and for it to be
expressed that allele had to be present on both homologous chromosomes, the trait “no-receptors” would be
labeled
a. antigenic
b. co-dominant
c. recessive
d. antibiotic
e. dominant
69. If producing TNFα was controlled by a single gene (autosomal) and the allele producing TNFα were dominant
to one for failing to produce TNFα then if a man who failed to produce TNFα married a woman who produced
TNFα but who had a child from a previous marriage that was a non-producer, what would you correctly predict
as the children of this marriage?
a. all producers
b. ¾ producers
c. ½ producers
d. ¼ producers
e. no producers
70. If it were discovered that failure to produce TNF was an X-linked recessive what would the predicted
offspring of the same marriage be?
a. All the sons would be producers
b. All the daughters would be non-producers
c. There would be more sons than daughters that would be producers
d. There would be more sons than daughters that would be non-producers
e. Half the sons and half the daughters would be producers.