Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Genetic Considerations in Broodstock Selection for Oyster Restoration, Aquaculture Development, and Non-native Species Introductions Kimberly S. Reece Virginia Oyster Landings 1880 - 2005 Chesapeake Bay Market Oyster Landings 1931-2005 7 7 Morta lity from H. n elsoni (MSX) Virginia be gins Maryland 5 6 Millions of Bushels Millions of Bushels 6 5 Total 4 4 P. marin us (Derm o) 3 3 in tens ifie s 2 2 1 1 0 1930 0 1940 1950 1960 1970 1980 1990 2000 Year What is the best approach to restoration, protection and preservation of the oyster resource? Preferred Approach May Depend on Motivations and Perspectives What is the goal of oyster restoration? Industry Restorationobjective to become profitable and self-sustaining Ecological Restoration To restore habitat and populations of native oysters To rebuild a sustainable harvest fishery Native oyster Develop a new oyster industryaquaculture Non-native oyster Not necessary exclusive approaches, but emphasis and measures of success may differ Possible Solutions 1. 2. 3. Oyster reef restoration- build/restore habitat (reefs) and establish sanctuaries. 1. Reefs provide substrate for natural spatfall, sanctuaries protect from fishing pressure. 2. Stock reefs with oysters from hatcheries-goal self-sustaining 1. wild broodstock 2. selected / domesticated strains? Aquaculture development through improved selective breeding practices: 1. Enhanced disease tolerance 2. Enhanced growth rate Consideration of alternative Crassostrea species for Chesapeake Bay aquaculture and maybe restoration of the fishery (or ecological restoration). 1. Asian oysters are significantly more resistant (tolerant) to MSX and Dermo. 2. Crassostrea ariakensis tested in Chesapeake Bay has shown: 1. rapid growth 2. taste that is acceptable to market 3. disease tolerance in field trials Genetic Considerations Stocking reefs with hatchery oysters Does it work? Is it a good idea from the genetics point of view? Which oysters to use? Wild or Selected? What is the genetic impact on extant natural Aquaculture Development populations? oyster stocks to use? but Diploids Ultimate goal =Which self-sustaining populations, of or triploids? Special genetic lines might be selected for particular what genetic make-up. traits of interest. Maintain genetically healthy lines. Is there any genetic impact on extant natural populations? Introduction of a Non-native Oyster Aquaculture or on bottom fishery? Which species? Genetic identification needed. Which stock? Broodstock source? Oregon strain too genetically bottlenecked? Genetic Considerations (Restoration) Stocking reefs with hatchery oysters Does it work? Is it a good idea from the genetics point of view? Which oysters to use? Wild or Selected? What is the genetic impact on extant natural populations? Ultimate goal = self-sustaining populations, but of what genetic make-up? Should Reefs be Stocked? •Supportive breeding - adding hatchery broodstock to reefs to supplement natural populations. •If we do stock, what is the best broodstock? • Hatchery oysters from wild broodstock too wimpy? ie. Subject to high disease mortality? •Any selected line? • Different lines (or wild broodstock) be used for different systems/environments? wild I like a pale ale- 10 ppt Make mine a stout-30 ppt VIMS selected Genetic variation High Natural spatfall- natural populations Hatchery oysters from wild broodstock Selected lines Low Highly inbred lines The answer to the questions of whether to stock and with what, depends on: 1. The genetic structure of the historical and the extant populations. 2. The phenotypic relevance of any detected genetic variation. Is there local adaptation? 3. The genetic impact of hatchery (planted) oysters on the wild populations and overall genetic variance (Ne). Do the disease-tolerant oysters, selected lines have a better chance of survival in the face of disease challenges? Maybe yes, in the short term, but what about longer term? Risks of inbreeding? Environmental change New stress/challenge: Selected stock may not be able to survive different challenges-may really be “wimpy” under a different set of conditions. Inbreeding may lead to increasing deleterious allele frequencies = line crash Genetic diversity (higher effective population size) can be important for survival of a species Environmental change = new stress/challenge and can results in elimination of some genetic types : Others may survive: Some “natural” populations are demonstrating disease tolerance. Maybe these are a better source for supportive breeding broodstock Shell Bar Reef, Great Wicomico River June-September 2006: biweekly analysis of P. marinus in samples (each n = 25) of deployed DEBYs and naturally recruited C. virginica P. marinus Weighted Prevalence 3 2.5 Natural DEBY 2 1.5 1 0.5 0 6/8/06 6/22/06 Carnegie and Burreson 7/6/06 7/20/06 8/3/06 8/17/06 8/31/06 9/14/06 York River-Disease Data •Cumulative mortality higher in Ross Rocks -- approaching 100% by September -- than in DEBYs (63% in October) •Cumulative mortality in Aberdeen Rocks (58% by October) similar to DEBYs; Wreck Shoals slightly higher (72%; MSX disease?) Mortality, York River, 2006 100 Cumulative Mortality (%) 90 80 DEBYs, Resistant Ross Rock, Susceptible Aberdeen Natives Wreck Natives 70 60 50 40 30 20 10 0 Carnegie and Burreson 1 June 2 July 3 Aug 4 5 Sept Oct Motivations for, and the risks of, supportive breedingusing selected/hatchery stocks for restoration efforts. Motivations •Increase the chances of survival/reproduction in the face of disease. •Genetic rehabilitation-introgression of “disease resistance” alleles into natural populations. •Ability to genetically track the success and dispersal patterns at restored sites-experiments to help design/improve restoration strategies. However, (the risks) •Calculations and analyses indicate population bottlenecking possible by deploying highly inbred selected lines (Hare and Rose) •Little evidence to date that the selected lines are doing well and reproducing. Are we wasting $? (Carlsson et al.--stay tuned) •Evidence of resistance (tolerance) in natural populations (Carnegie and Burreson), which are genetically more diverse and therefore risk can be reduced by using wild broodstock. Need Basic Genetic Data Chesapeake Bay What is the Crassostrea virginica population genetic structure? Ongoing studies-published and preliminary results What is the effective population size in CB and how would selectively bred stock impact this? Matt Hare’s presentation on Thursday:high risk with current selected highly inbred lines with low Ne. What are the larval dispersal patterns around restored reefs? Ongoing studies-published and preliminary results What is the genetic structure of the extant native oyster populations? What historically was the genetic structure of the native oyster populations? The BAYLOR SURVEY of OYSTER GROUNDS 1892 survey of most productive oyster grounds in Virginia (8 million bushels/year) Chesapeake Bay Oysters One panmictic population OR Isolated, genetically distinct populations? One population, which over time declined to an extent that there are now individual populations that have become genetically isolated? Retentive/trap-like estuaries with low gene flow among systems? Microsatellites +High power of discrimination for populations genetics and restoration monitoring +Highly variable +High throughput +Nuclear marker-biparentally inherited Microsatellite- simple sequence repeats often varying lengths among copies (alleles) ATCTATATATATATATATATATATCGTGG Chromosome (allele) from TCGATATATATATATATATATATAGCACC ♀ (TA)10 ATCTATATATATATATATATCGTGG Chromosome (allele) from (TA)8 TCGATATATATATATATATAGCACC ♂ Evidence of Genetic Structure in the Bay using Microsatellite Markers But Weak Structure Buroker et al. 1983. Evidence of differentiation using allozyme markers Rose, Paynter and Hare. 2006. J Hered. 97:158-170 Populations may be genetically different. There is evidence that more distant populations are more distinct. Pairwise Comparisons of 10 Chesapeake Bay Populations FST 2 3 4 5 6 7 8 9 10 1 0.00023 0.00010 0.00102 0.00129 0.00051 0.00070 0.00101 0.00018 -0.00055 2 3 4 5 6 7 8 9 10 1 0.4268 0.5576 0.1162 0.0762 0.3262 0.2168 0.0488 0.5557 0.9102 P Carlsson et al. 2 3 4 5 6 7 8 9 0.00033 0.00167 0.00092 -0.00049 0.00050 0.00111 0.00005 -0.00057 0.00176 0.00033 -0.00010 0.00025 0.00121 0.00034 0.00027 0.00121 0.00124 0.00160 0.00062 0.00097 -0.00039 0.00223 0.00119 0.00171 0.00072 0.00089 -0.00012 0.00094 0.00052 -0.00050 -0.00061 0.00065 0.00075 0.00102 0.00121 0.00030 2 3 4 5 6 7 8 9 0.3916 0.0186 0.1846 0.8965 0.2793 0.0557 0.6826 0.8916 0.0586 0.4902 0.6260 0.4277 0.1162 0.5352 0.4482 0.2158 0.1621 0.0713 0.3574 0.3057 0.7666 0.0332 0.2022 0.0781 0.4453 0.2763 0.6641 0.1787 0.4854 0.8271 0.9326 0.3848 0.2382 0.2285 0.1445 0.5479 Is structure relevant? Are populations locally adapted? 4 microsatellite markers What happens to the oysters deployed on reefs? Molecular markers to track deployed oysters. •Do they reproduce? •Genotype (genetically fingerprint) the spatfall. •Are progeny purebred deployed or wild oysters? AND/OR •Hybrids? •Do the deployed oysters survive? How long? •Yearly genetic assessments of oysters at experimental deployment sites. •What impact do they have on surrounding populations? •Screening populations-follow through time. Wild stocks Planted hatchery stocks Spat population: Progeny from wild, hatchery or hybrids? Are they more or less fit than wild? Molecular markers can help us discriminate among stocks/lines and allow us to learn more about the reef recruitment shadow and the results of the inter-breeding of wild and hatchery stocks. Genetic analyses tracking the success of reef stocking Objective: Monitoring the breeding success, and longer-term relative survivability, of oysters planted on reefs 7 Experiment designed for the Great Wicomico River system using the genetically unique, disease tolerant aquaculture strains (DEBYs). 6 5 4 3 2 1 Spat collected at sample sites every 2 weeks from June -October for genetic typing in the years 2002-2006. GWR has been seeded multiple times over the years with several different stocks YearYear Number Number Stock Stock 19961996 750000 Sound 750000Tangier Tangier Sound 19971997 150000 Sound 150000Tangier Tangier Sound 19981998 150000 150000Deep Deep Rock Rock 19981998 2500 Sound 2500Tangier Tangier Sound 19991999 5000 Sound 5000Tangier Tangier Sound 20002000 24750 24750CROSBreed CROSBreed 20002000 210000 210000Deep Deep Creek Creek 20012001 10000 10000CROSBreed CROSBreed 20012001 300000 300000Deep Deep Creek Creek 20012001 200000 Creek 200000Lynnhaven/Plantation Lynnhaven/Plantation Creek 20022002 13500 13500CROSBreed CROSBreed 20022002 795700 795700DEBY DEBY 20032003 292060 292060DEBY DEBY 20042004 18000 18000CROSBreed CROSBreed 20042004 1400000 1400000DEBY DEBY 20052005-06 15000000 15000000DEBY DEBY Since 2002 primarily DEBY deployments as part of the experimental design to track success of planted oysters. Why did we choose DEBYs for the GWR experiment? DEBYs are genetically unique. Maternal signal-mtDNA. DEBYs Show High Frequency of Mitochondrial Haplotypes (DNA fingerprint patterns) that are Rare in Natural Chesapeake Bay Populations B A Hinf I digest of mt coIII in DEBY strain A Hinf I Digest of mt coIII in a Natural Population Frequency of the B alleles is relatively low in natural populations: <2%. Frequency of the B alleles is much higher in the DEBY stock, generally ranging from 25-50% depending on the spawn. Microsatellite markers allow clear discrimination between hatchery lines and natural populations Rappahannock wild – yellow Deployed spaton-shell - blue Example Rappahannock River, Drumming Ground Have the deployed DEBYs contributed significantly to spat production in GWR? Mt DNA Analyses PRIOR TO DEPLOYMENT DEPLOYED DEBY PRODUCED SPAT AA BB Rare Carlsson et al. Great Wicomico 2002-2006 Mt DNA and microsatellite analyses •1579 spat collected in the summer of 2002 •1 individual confidently assigned to DEBY •~10% DEBY/WILD hybrids Hare et al. 2006- form Great Wicomico River 2002 Overall, data to date suggest that the DEBY contribution has been low: predation, poor survival and reproduction? Recently there have been much larger deployments with efforts and protecting plants and genetic signal needs to be followed over several years. Genetic Considerations (Aquaculture) Aquaculture Development Which oyster stocks to use? Diploids or triploids? Special genetic lines might be selected for particular traits of interest. Maintain genetically healthy lines. Is there any genetic impact on extant natural populations? Genetic impact of aquaculture lines on natural populations is a concern in many aquatic systems. Eg. Salmonids But Is this a concern for aquaculture development in oysters? Little evidence of genetic impact to date Analysis of oysters collected near two farms growing DEBYs Site 1 4 microsatellites 2 mtDNA genes Over 85% significantly not assigned to DEBY 1 individual assigned to DEBY Site 2 4 microsatellites 2 mtDNA genes Over 90% significantly not assigned to DEBY No individuals assigned to DEBY 1 DEBY (natural collection) There is evidence of reduced genetic variation in hatchery lines of C. virginica Allelic diversity of microsatellites reduced in DEBYS compared to natural populations Natural population DEBY strain Genetic Considerations (Introduction) Introduction of a Non-native Oyster Aquaculture or on bottom fishery? Which species? Genetic identification needed. Which stock? Broodstock source? Oregon strain too genetically bottlenecked? 1995 Virginia House of Delegates Resolution no. 450 “Requesting the Virginia Institute of Marine Science to develop a strategic plan for molluscan shellfish research and begin the process of seeking the necessary approvals for in water testing of non-native oyster species.” ICES Protocols The International Council for the Exploration of the Seas (ICES) Code of Practice on Introductions and Transfers of Marine Organisms (ICES, 1994): “…prior to any introduction a detailed analysis should be conducted on the ecological, genetic and disease relationships of the species in its natural range and environment.” EIS Currently Being Drafted Genetic Analyses of Crassostrea ariakensis Objectives: • Inventory of germplasm resources in the species, Crassostrea ariakensis- Correct identification of the species became a large concern. • To examine genetic variation and differentiation (population structure), among natural populations of the C. ariakensis from China, Korea and Japan • To examine genetic variability. • In US hatchery stocks (Oregon Strain) • Compared to wild source populations Jan Cordes and Jie Xiao Ximing Guo’s group-Rutgers There is Genetic Variation among Wild C. ariakensis Populations linkage disequilibrium, and significant deviations from Hardy-Weinberg Equilibrium (HWE) Sample LD HW E IR 0 of 6 none KR 1 of 6 none YR 3 of 6 none DR 0 of 6 none IR KR YR DR IR - 0.022 0.014 0.026 KR <0.001 - 0.01* 0.014 YR <0.001 0.007* - 0.025 DR <0.001 <0.001 <0.001 - Population pairwise Fst (above) and P-values (below). * indicates Non-significant values. Genetic Variation among Wild Populations Factorial Correspondence Analysis (FCA) by Individuals KR YR DR IR US Hatchery Stocks “Oregon Strain” Japan F1 WC Pacific Northwest, USA WCA P1 TUI Yellow F1 NCA River China Beihai F1 SCA99 + SCA00 Genetic Variation in Hatchery Stocks vs. Wild Populations Factorial Correspondence Analysis (FCA) by Population KR IR YR DR TUI WCA SCA NCA •Hatchery Stocks show reduction in genetic diversity compared to wild populations •Oregon strain is relatively highly inbred Wild Populations Allelic richness for four hatchery strains and four wild populations of C. ariakensis. 25 Hatchery Strains Wild Stocks CarG110 CarG4-60 Car119-6a Car11-70 20 Sample LD HW E IR 0 of 6 none KR 1 of 6 none YR 3 of 6 none DR 0 of 6 none Hatchery Stocks 15 Sample LD HW E TUI 1 of 6 4 WCA 3 of 6 2 NCA 5 of 6 1 SCA 0 of 6 1 10 5 0 TUI WCA NCA SCA IR KR YR DR Acknowledgements Elizabeth Francis Stan Allen Francis O’Beirn Georgeta Constantin Roger Mann Tommy Leggett Jie Xiao Missy Southworth Ryan Carnegie Qian Zhang Juli Harding Mark Luckenbach Gail Scott Aimim Wang Ken Paynter Cheryl Morrison Dr. Wu Matt Hare Pat Gaffney Dr. Ahn Don Merritt Sharon Furriness Junya Higano Wendi Ribeiro US National Sea Grant-ODRP NOAA/NMFS Chesapeake Bay Program Office Virginia Sea Grant College Program Chesapeake Bay Foundation US Army Corps of Engineers JAC ARSs Jan F.A. Cordes Jens A. Carlsson Research Assistant Scientists