Download View PDF

Original article
Mechanical loading induce expression of bone morphogenetic
protein-2, alkaline phosphatase activity and collagen synthesis in
osteoblastic MC3T3-E1 cells
Lu HF , Mai ZH , Xu Y, Wang W, Ai H
Department of Stomatology, Third Affiliated Hospital of Sun Yat-sen University,
Guangzhou, Guangdong 510630, China (Lu HF , Mai ZH , Wang W and Ai H)
Department of Stomatology, The 2nd hospital of Chao Yang District, Beijing, 100022,
China (Xu Y)
Correspondence to: Dr. Ai H, Department of Stomatology, Third Affiliated Hospital of
Sun
Yat-sen
University,
Guangzhou,
[email protected])
1
Guangdong
510630,
China
(E-mail:
Background Bone morphogenetic protein-2, alkaline phosphatase and collagen
type I were known to play a critical role in the process of bone remodeling. However,
the relationship between mechanical strain and the expression of Bone morphogenetic
protein-2, alkaline phosphatase and collagen type I in osteoblasts was still unknown.
The purpose of this study was to investigate the effects of different magnitudes of
mechanical strain on osteoblastic morphology and on the expression of Bone
morphogenetic protein-2, alkaline phosphatase and collagen type I.
Methods Osteoblastic-like cells were flexed at four deformation rates (0, 6, 12,
18% elongation). The expression of Bone morphogenetic protein-2 mRNA , alkaline
phosphatase and collagen type I in osteoblast-like cells were determined by real-time
quantitative reverse transcription polymerase chain reaction respectively. The results
were subjected to an analysis of variance (ANOVA) using SPSS 13.0 statistical
software.
Results The cells changed to fusiform and grew in the direction of the applied strain
after the mechanical strain was loaded. Expression level of the Bone morphogenetic
protein-2, alkaline phosphatase and collagen type I increased magnitude-dependently
with mechanical loading in the experimental groups, and the 12% elongation group had
the highest expression (p<0.05).
Conclusions Mechanical strain can induce morphological change and a
magnitude-dependent increase expression of Bone morphogenetic protein-2, alkaline
2
phosphatase and collagen type I mRNA in osteoblast-like cells, which might influence
bone remodeling in orthodontic treatment.
[Keywords] mechanical strain; osteoblasts; Bone Morphogenetic Protein-2; Alkaline
phosphatase; collagen type I
3
Understanding bone cellular biology was necessary to understand events such as
tooth movement in orthodontic treatment. To cope with orthodontic force, active
remodeling of alveolar bone must occur; under strain, alveolar bone continuously
alternates between resorption and formation during the physiological movement of teeth.
The study of differentiation of alveolar bone has recently been the subject of extensive
research.1-3
Among the factors controlling bone morphogenesis and the proliferation,
differentiation, and matrix secretion of bone cells, bone morphogenetic proteins
(BMPs), especially BMP-2, were known to play a critical role in aggregation and
induction of undifferentiated mesenchymal cells to differentiation into osteoblasts.4
These BMPs, which were mainly secreted from osteoblasts that found in abundance in
the alveolar bone, were sufficient to induce morphogenetic progenitor cell recruitment,
which ultimately promotes bone formation.5 Once bone matrix synthesis began in
osteoblast, the cells differentiate in accordance with the gene activation and protein
synthesis of osteoblast markers. Alkaline phosphatase (ALP) and collagen type I (COLI) were also two representative bone marker proteins for osteoblast differentiation.6
The relationship between mechanical strain and the expression of BMP-2, ALP
activity and collagen synthesis in osteoblasts has not fully clarified, particularly with
respect to increasing magnitudes of mechanical strain. In this study, we investigated the
effect of different magnitudes of mechanical strain on BMP-2, ALP activity and COLⅠexpression in osteoblasts. These data provide further evidence of strain-induced
4
osteoblasts remodeling at the cellular level, which is critical in orthodontic treatment.
METHODS
Cell culture
Mouse osteoblast-like cells, MC3T3-E1 (Tissue Engineering Laboratory of
Stomatological Hospital of The Fourth Military Medical University), were cultured in
DMEM/F12 culture solution (Hyclone, USA) and supplemented with 10% fetal bovine
serum (FBS) in a humidified atmosphere of 5% CO2 at 37℃.
Mechanical strain application
MC3T3-E1 osteoblast-like cells (2x105/ml) were subcultured into six-well,
flexible-bottomed Uniflex culture plates (Medical Electronic Engineering Department
of The Fourth Military Medical University, China) to provide mechanical strain.7 They
were then subjected to an intermittent deformation of 6% (group B), 12% (group C) or
18% (group D) of maximum stretch for five seconds followed by five seconds of
relaxation (six cycle/min) with computer control technology.
Relative quantitative reverse transcription polymerase chain reaction (RT-PCR)
For BMP-2 mRNA gene expression analysis, samples were collected after cycled
stretching for 24 h. The unstretched control group (A) consisted of cells cultured under
similar conditions and collected at the same time points as the stretched experimental
groups (B, C and D). During the entire strain regimen, cell monolayers were kept in an
incubator at 37℃ under an atmosphere of 5% CO2. Experiments were performed in
sextuplicate using cells from the same passage. Following the strain regimen, cells were
5
lysed in TRIzol reagent (Invitrogen Corp, Carlsbad, CA, USA) and kept at -70℃ until
extraction of total RNA and quantitative reverse transcription–polymerase chain
reaction (RT-PCR) analysis. After applying the mechanical strain, total RNA was
isolated from the cells using the Trizol reagent (Invitrogen Life Technologies, Carlsbad,
CA) according to the manufacturer’s instructions. The levels of BMP-2 mRNA were
evaluated by relative quantitative RT-PCR assay and ratios of BMP-2 mRNA were
normalized against Glyceraldehyde -3-Phosphate Dehydrogenase (GAPDH).
Quantitative real-time reverse transcription polymerase chain reaction
(QRT-PCR)
For ALP activity and COL-ⅠmRNA gene expression analysis, samples were
collected after cycled stretching for 24 h. The unstretched control group (A) consisted
of cells cultured under similar conditions and collected at the same time points as the
stretched experimental groups (B, C and D).Total RNA was extracted and purified by
using Trizol 1 ml (lml/10cm2). For reverse transcription with polymerase chain reaction,
1 μg of total RNA was reverse-transcribed (RT) into cDNA with a mixture of oligo
(dT). RT-PCR was performed by using 1 μl of the 20-μl total RT product, PCR buffer,
dNTPs, and Premix Taq DNA polymerase under the manufacturer’s recommended
conditions (Takara, Shiga, Japan). Quantification was performed by comparing levels
obtained with standardized sample and ratios of ALP and COL-ⅠmRNA were
normalized against Glucose 6-Phosphate Dehydrogenase (G6PDH).
The PCR conditions and primer sequences used for BMP-2, ALP, COL-I, GAPDH
and G6PDH were listed in Table 1.
6
Statistical analysis
Experimental data were expressed as mean±standard deviation (SD). The
statistical analyses of the data were performed by an analysis of variance (ANOVA)
with the use of the SPSS 13.0 program. Statistical significance was determined at P <
0.05.
7
RESULTS
Morphology Observation Before/After Cell Loading
A morphological change in cells was observed using an inverted phase contrast
microscope 24 h after strain loading. MC3T3-E1 cells were polygonal and arranged
irregularly before strain loading. However, the morphology and arrangement of cells
clearly changed after strain loading; the cells became spindle-shaped and orderly
arranged in the direction of the loaded strain (Figure 1).
Evaluation of mRNA Expression of BMP-2 by Relative quantitative RT-PCR
The Ct values of BMP-2 and GAPDH showed how different magnitudes of strain
affect the BMP-2 mRNA in the MC3T3-E1 cells (Figure 2). Mechanical strain at 6% or
12% elongation caused a significant magnitude-dependent increase in BMP-2 mRNA
compared to that in control (0% elongation) group and when the strain was greater than
18%, the mRNA expression of BMP-2 decreased.
Evaluation of mRNA Expression of ALP and COL- I by QRT-PCR
ALP and COL- I were also two signals involved in osteoblast differentiation.
Interestingly, exposing cells to12% or 18% mechanical loading increased ALP and
COL- I gene expression significantly (p < 0.05). However, there was no significant
difference between cells exposed to 6% elongation (Figure 3, 4).
8
DISCUSSION
Effects of Mechanical Strain on Osteoblastic Morphology
A recent study8 suggests that mechanically induced remodeling is mediated by a
complex feedback mechanism involving the synthesis of cytokines. This process takes
place downstream from the initial mechanotransduction event at focal adhesions linking
the extracellular matrix to the cytoskeleton. These in turn act in an autocrine/paracrine
fashion to regulate the expression of cytokines involved in the differentiation,
proliferation and function of mesenchymal and other cell types. By loading strain on
osteoblasts for 2 hours, some researchers9 found that mechanical stretch caused
extensive response on osteoblasts which led to the rearrangement of F-actin filament.
Meazzin10 found that mechanical strain leads to a coordinated change both in the
cytoskeleton and in the extracellular matrix proteins that facilitate tighter adhesion of
an osteoblast to its extracellular matrix. These results indicated that mechanical strain
induced the rearrangement and morphological change of cytoskeleton.
The study results of this experiment showed that the cells were polygonal and
arranged irregularly before strain loading; however, after strain loading, obvious
changes in morphology and arrangement of the cells occurred, and cells were arranged
in a more orderly fashion consistent with mechanical loaded strain. The results
indicated that the cytoskeleton was rearranged and morphologically changed under the
strain, and the mechanical signal was transferred into cells inducing a series of
biological reactions that included BMP-2, ALP and COL- I expression in cells.
9
Effects of Mechanical Strain Magnitude on BMP-2 Expression of Osteoblast-like
cells
It is well known that mechanical stress is a fundamental physiological factor for
regulating structure and function in bones. Mechanical strain also plays a crucial role in
orthodontic tooth movement.11 It was generally accepted that osteoblasts were located
on the surface of cancellous and cortical bone on the yet unmineralized cell matrix.12
Therefore, deformation of the substrate to which these cells adhere would be an
appropriate signal for stimulating them. Other experimental results found that the
application of different magnitudes of cyclic tensile strain (0%, 6%, 12% or 18%)
induced a magnitude-dependent increase in MMP-13 and TIMP-1 expression in
cultured osteoblasts.13 However, different studies show that due to different magnitudes,
frequencies and action times of mechanical strain as well as different using devices, the
effects on osteoblasts were different.14,15,16,17 We used an in vitro cell strain system that
allowed mechanical stimulus to be quantified at different magnitudes of stress, using
cyclic strains of 6%, 12% or 18% elongation in this study.
According to some studies,18,19,20 the formation of bone tissue was regulated by
total growth factors and local growth factors, and BMP-2 mainly plays the role of
aggregating and differentiating undifferentiated mesenchymal cells and bone-family
cells and can also reverse and differentiate myoblasts, fibroblasts and bone marrow
stromal cells into bone-family cells. Therefore, BMP-2 was considered the most crucial
regulatory factor in the formation of bone tissue. In this study, we found that the
increase in BMP-2 mRNA expression was magnitude-dependent after strain loading in
10
MC3T3-E1 osteoblast-like cell for 24 hours. Furthermore, mechanical strain
corresponding to 6%, 12%, or 18% elongation led to a magnitude-dependent increase in
BMP-2 mRNA expression. A maximal and significant increase in expression of BMP-2 mRNA
was observed at 12% elongation, which decreased at elongations greater than 18%. This may
possibly have resulted due to the fact that too large a strain can cause adverse effects on
osteoblasts and affect BMP-2 expression. Other study21 reported that physiological
loading of osteoblast-like cells enhances the regenerative capacity of bone, whereas
hyperphysiological loads may impair bone regeneration, which was similar to the
results of this experiment.
Effects of Mechanical Strain Magnitude on ALP and COL- I Expression of
Osteoblast-like cells
ALP and collagen synthesis were early markers of osteoblast differentiation.22,23
It has been reported that 95% of the collagen recovered from MC3T3-E1 cells is type I.
24
Therefore, the high ALP activity and the COL- I in the cells are closely linked to
differentiation into osteoblasts.25 In our study, mechanical loading to12% or
18%elongation increased ALP and COL- I mRNA expression in osteoblatic MC3T3E1 cells as time went by 24h, which is considered as stimulating osteoblast
differentiation by bone marker protein synthesis by osteoblasts.
Taken all together, the statistical analysis showed that the difference was
significant (Figure 2-4). Therefore the significantly increased BMP-2, COL- I and ALP
activity might play an important role in osteoblastic differentiation of MC3T3-E1 cells.
These markers are considered highly predictive of the differentiated osteoblast
11
phenotype. But the transcriptional regulation of these genes is not well characterized.
ACKNOWLEDGEMENTS
The authors sincerely wish to thank PENG Zhu-li and staff members in the Tissue
Engineering Research Center of Fourth Military Medical University for technical
assistance.
12
REFERENCES
1. Cakir-Ozkan N, Eyibilen A, Ozkan F, Ozyurt B, Aslan H.. Stereologic analysis of
bone produced by distraction osteogenesis or autogenous bone grafting in mandible.
J Craniofac Surg 2010; 21: 735-740.
2. Zhang F, Wang CL, Koyama Y, Mitsui N, Shionome C, Sanuki R, et al. Compressive
force stimulates the gene expression of IL-17s and their receptors in MC3T3-E1
cells. Connect Tissue Res 2010; 51:359-369.
3. Chang L, Zhe W, Sun HC. The Effect of Simvastatin on mRNA Expression of
Transforming Growth Factor-β1, Bone Morphogenetic Protein-2 and Vascular
Endothelial Growth Factor in Tooth Extraction Socket. Int J Oral Sci 2009 ; 1:
90–98.
4.. Barnouti ZP, Owtad P, Shen G, Petocz P, Darendeliler MA.The biological
mechanisms of PCNA and BMP in TMJ adaptive remodeling.Angle Orthodontist
2011; 81:93-101
5. Schmitt JM, Hwang K, Winn SR, Hollinger JO. Bone morphogenetic proteins: an
update on basic biology and clinical relevance. J Orthop Res 1999;17:269–278.
6. Franceschi RT, Iyer BS. Relationship between collagen synthesis and expression of
the osteoblast phenotype in MC3T3-E1 cells. J Bone Miner Res 1992;7:235-46
7. Tang L, Lin Z, Li YM: Effects of different magnitudes of mechanical strain on
osteoblasts in vitro. Biochem Biophys Res Commun 2006; 344:122-128.
8. Meikle MC. The tissue, cellular, and molecular regulation of orthodontic tooth
movement: 100 years after Carl Sandstedt. Eur J Orthod, 2006, 28（3）:221-240.
13
9. Qi MC, Hu J, Zou SJ, Han LC, Luo E. The changes of cytoskeleton F-actin in rat
bone marrow mesenchymal stem cells and calvarial osteoblasts under mechanical
strain [J]. Hua Xi Kou Qiang Yi Xue Za Zhi 2005; 23(2):110-2, 121. [Article in
Chinese]
10. Meazzini MC, Toma CD, Schaffer JL, Gray ML, Gerstenfeld LC. Ostoeblast
cytoskeletal modulation in response to mechanical strain in vitro. J Orthop Res
1998; 16 (2): 170-180.
11. Motokawa M, Kaku M, Tohma Y, Kawata T, Fujita T, Kohno S, et al. Effects of
cyclic tensile forces on the expression of vascular endothelial growth factor (VEGF)
and macrophage-colony-stimulating factor (M-CSF) in murine osteoblastic
MC3T3-E1 cells, J. Dent. Res 2005; 84 (5):422–427.
12. Lin Tang, Zhu Lin, Yong-ming Li. Effects of different magnitudes of mechanical
strain
on
Osteoblasts
in
vitro.
Biochemical
and
Biophysical
Research
Communications 2006;344: 122–128
13. Li Y, Tang L, Duan Y, Ding Y. Upregulation of MMP-13 and TIMP-1 expression in
response to mechanical strain in MC3T3-E1 osteoblastic cells. BMC Research
Notes 2010; 3:309
14. Knoll BI, McCarthy TL, Centrella M, Shin J. Strain-dependent control of
transforming growth factor-beta function in osteoblasts in an vitro model:
biochemical events associated with distraction osteogenesis. Plast Reconstr surg
2005;116(1):224-233
15. Yang YQ, Li XT, Rabie AB, Fu MK, Zhang D. Human periodontal ligament cells
14
express osteoblastic phenotypes under intermittent force loading in vitro. Front
Biosci 2006 ; 1(11):776-781
16. Di Palma F, Douet M, Boachon C, Guignandon A, Peyroche S, Forest B, et al.
Physiological strains induce differentiation in human osteoblasts cultured on
orthopaedic biomaterial. Biomaterials 2003; 24(18): 3139-3151
17. Winter LC, Walboomers XF, Bumgardner JD. Intermittent versus continuous
stretching effects on osteoblast-like cells in vitro.J Biomed Mater Res 2003;
67(4):1269-1275
18. Kato S, Sangadala S, Tomita K, Titus L, Boden SD. A synthetic compound that
potentiates bone morphogenetic protein-2-induced transdifferentiation of myoblasts
into the osteoblastic phenotype. Mol Cell Biochem 2011;349:97-106.
19. Varkey M, Kucharski C, Haque T, Sebald W, Uludağ H. In vitro osteogenic
response of rat bone marrow cells to bFGF and BMP-2 treatments. Clin Orthop
Relat Res 2006;443: l13-123.
20. Luo QF, Wang X, Yi B, Li ZL, Wang XX, Liang C. The transformation of
fibroblast-like cells origenating from different tissue into osteoblasts. Chinese
Journal of Stomatology 2005;40: 327-330. [Article in Chinese]
21. Meyer U, Terodde M, Joos U, Wiesmann HP. Mechanical stimulation of osteoblasts
in cell culture. Mund Kiefer Gesichtschir 2001;5(3):166-72. [Article in German]
22. Seo HJ, Cho YE, Kim T, Shin HI, Kwun IS. Zinc may increase bone formation
through stimulating cell proliferation, alkaline phosphatase activity and collagen
15
synthesis in osteoblastic MC3T3-E1 cells. Nutrition Research and Practice
2010;4(5):356-361
23. Han P, Ji WP, Zhao CL, Zhang XN, Jiang Y. Improved osteoblast proliferation,
differentiation and mineralization on nanophase Ti6Al4V. Chinese Medical Journal
2011;124(2):273-279
24. Hata R, Hori H, Nagai Y, Tanaka S, Kondo M, Hiramatsu M, et al. Selective
inhibition of type I collagen synthesis in osteoblastic cells by epidermal growth
factor. Endocrinology 1984; 115: 867-876.
25. Horiguchi Y, Nakai T, Kume K. Effects of Bordetella bronchiseptica Dermonecrotic
Toxin on the Structure and Function of Osteoblastic Clone MC3T3-E1 Cells. Infect
Immun. 1991; 59(3): 1112-1116
16
Table.
Primer sequence (5’–3’)
Gene
BMP-2
Primers and Conditions Used for RT-PCR
Fw:
5’- TGACTGGATCGTGGCACCTC-3’
PCR conditions
Product
size (bp)
40 cycles
112
Rv: 5’- CAGAGTCTGCACTATGGCATGGTTA -3’ 95℃ 40 sec, 60℃ 45 sec, 72℃ 45 sec
ALP
Fw:
Rv:
Col-Ⅰ
GAPDH
G6PDH
5’- CCAACTCTTTTGTGCCAGAGA -3’
110
5’- GGCTACATTGGTGTTGAGCTTTT -3’ 94℃ 15 sec, 60℃ 15 sec, 72℃ 15 sec
Fw:
5’- GCTCCTCTTAGGGGCCACT -3’
Rv:
5’- CCACGTCTCACCATTGGGG -3’
Fw:
5’-TGTGTCCGTCGTGGATCTGA-3’
Rv:
5’- TTGCTGTTGAAGTCGCAGGAG -3’
Fw:
5’-AGGTCGGTGTGAACGGATTTG -3’
Rv:
40 cycles
40 cycles
94℃ 15 sec, 60℃ 15 sec, 72℃ 15 sec
40 cycles
17
150
95℃ 40 sec, 60℃ 45 sec, 72℃ 45 sec
40 cycles
5’- TGTAGACCATGTAGTTGAGGTCA -3’ 94℃ 15 sec, 60℃ 15 sec, 72℃ 15 sec
bp, base pairs; Fw, forward; Rv, reverse.
103
123
Figure 1 Phase contrast images showing the morphological change in
osteoblast-like cells
The osteoblast-like cells appeared polygonal and were arranged irregularly before application of
mechanical strain, but became spindle-shaped and orderly arranged in the direction of the strain
loaded (A) before application of mechanical strain (B) 0% elongation (C) 6% elongation (D) 12%
elongation (E) 18% elongation. Magnification: 400X.
Figure 2
Expression of BMP-2 mRNA 24 hours after strain loading
Expression of BMP-2 mRNA in rat osteoblast-like cells subjected to 0%, 6%, 12% or 18%
stretching loads at a frequency of 6 cycle/min for 24 hours. A maximal and significant increase in
18
expression of BMP-2 mRNA was observed at 12% elongation. (*p<0.05)
Figure 3 Expression of ALP mRNA 24 hours after strain loading
Expression of ALP mRNA in rat osteoblast-like cells subjected to 0%, 6%, 12% or
18%stretching loads at a frequency of 6 cycle/min for 24 hours. A significant increase in expression
of ALP mRNA was observed at 12% or 18%elongation.(*p<0.05)
Figure 4 Expression of COL- I mRNA 24 hours after strain loading
Expression of COL- I mRNA in rat osteoblast-like cells subjected to 0%, 6%, 12% or
18%stretching loads at a frequency of 6 cycle/min for 24 hours. A significant increase in expression
of COL- I mRNA was observed at 12% or 18%elongation.(*p<0.05)
19