Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Original article Mechanical loading induce expression of bone morphogenetic protein-2, alkaline phosphatase activity and collagen synthesis in osteoblastic MC3T3-E1 cells Lu HF , Mai ZH , Xu Y, Wang W, Ai H Department of Stomatology, Third Affiliated Hospital of Sun Yat-sen University, Guangzhou, Guangdong 510630, China (Lu HF , Mai ZH , Wang W and Ai H) Department of Stomatology, The 2nd hospital of Chao Yang District, Beijing, 100022, China (Xu Y) Correspondence to: Dr. Ai H, Department of Stomatology, Third Affiliated Hospital of Sun Yat-sen University, Guangzhou, [email protected]) 1 Guangdong 510630, China (E-mail: Background Bone morphogenetic protein-2, alkaline phosphatase and collagen type I were known to play a critical role in the process of bone remodeling. However, the relationship between mechanical strain and the expression of Bone morphogenetic protein-2, alkaline phosphatase and collagen type I in osteoblasts was still unknown. The purpose of this study was to investigate the effects of different magnitudes of mechanical strain on osteoblastic morphology and on the expression of Bone morphogenetic protein-2, alkaline phosphatase and collagen type I. Methods Osteoblastic-like cells were flexed at four deformation rates (0, 6, 12, 18% elongation). The expression of Bone morphogenetic protein-2 mRNA , alkaline phosphatase and collagen type I in osteoblast-like cells were determined by real-time quantitative reverse transcription polymerase chain reaction respectively. The results were subjected to an analysis of variance (ANOVA) using SPSS 13.0 statistical software. Results The cells changed to fusiform and grew in the direction of the applied strain after the mechanical strain was loaded. Expression level of the Bone morphogenetic protein-2, alkaline phosphatase and collagen type I increased magnitude-dependently with mechanical loading in the experimental groups, and the 12% elongation group had the highest expression (p<0.05). Conclusions Mechanical strain can induce morphological change and a magnitude-dependent increase expression of Bone morphogenetic protein-2, alkaline 2 phosphatase and collagen type I mRNA in osteoblast-like cells, which might influence bone remodeling in orthodontic treatment. [Keywords] mechanical strain; osteoblasts; Bone Morphogenetic Protein-2; Alkaline phosphatase; collagen type I 3 Understanding bone cellular biology was necessary to understand events such as tooth movement in orthodontic treatment. To cope with orthodontic force, active remodeling of alveolar bone must occur; under strain, alveolar bone continuously alternates between resorption and formation during the physiological movement of teeth. The study of differentiation of alveolar bone has recently been the subject of extensive research.1-3 Among the factors controlling bone morphogenesis and the proliferation, differentiation, and matrix secretion of bone cells, bone morphogenetic proteins (BMPs), especially BMP-2, were known to play a critical role in aggregation and induction of undifferentiated mesenchymal cells to differentiation into osteoblasts.4 These BMPs, which were mainly secreted from osteoblasts that found in abundance in the alveolar bone, were sufficient to induce morphogenetic progenitor cell recruitment, which ultimately promotes bone formation.5 Once bone matrix synthesis began in osteoblast, the cells differentiate in accordance with the gene activation and protein synthesis of osteoblast markers. Alkaline phosphatase (ALP) and collagen type I (COLI) were also two representative bone marker proteins for osteoblast differentiation.6 The relationship between mechanical strain and the expression of BMP-2, ALP activity and collagen synthesis in osteoblasts has not fully clarified, particularly with respect to increasing magnitudes of mechanical strain. In this study, we investigated the effect of different magnitudes of mechanical strain on BMP-2, ALP activity and COLⅠexpression in osteoblasts. These data provide further evidence of strain-induced 4 osteoblasts remodeling at the cellular level, which is critical in orthodontic treatment. METHODS Cell culture Mouse osteoblast-like cells, MC3T3-E1 (Tissue Engineering Laboratory of Stomatological Hospital of The Fourth Military Medical University), were cultured in DMEM/F12 culture solution (Hyclone, USA) and supplemented with 10% fetal bovine serum (FBS) in a humidified atmosphere of 5% CO2 at 37℃. Mechanical strain application MC3T3-E1 osteoblast-like cells (2x105/ml) were subcultured into six-well, flexible-bottomed Uniflex culture plates (Medical Electronic Engineering Department of The Fourth Military Medical University, China) to provide mechanical strain.7 They were then subjected to an intermittent deformation of 6% (group B), 12% (group C) or 18% (group D) of maximum stretch for five seconds followed by five seconds of relaxation (six cycle/min) with computer control technology. Relative quantitative reverse transcription polymerase chain reaction (RT-PCR) For BMP-2 mRNA gene expression analysis, samples were collected after cycled stretching for 24 h. The unstretched control group (A) consisted of cells cultured under similar conditions and collected at the same time points as the stretched experimental groups (B, C and D). During the entire strain regimen, cell monolayers were kept in an incubator at 37℃ under an atmosphere of 5% CO2. Experiments were performed in sextuplicate using cells from the same passage. Following the strain regimen, cells were 5 lysed in TRIzol reagent (Invitrogen Corp, Carlsbad, CA, USA) and kept at -70℃ until extraction of total RNA and quantitative reverse transcription–polymerase chain reaction (RT-PCR) analysis. After applying the mechanical strain, total RNA was isolated from the cells using the Trizol reagent (Invitrogen Life Technologies, Carlsbad, CA) according to the manufacturer’s instructions. The levels of BMP-2 mRNA were evaluated by relative quantitative RT-PCR assay and ratios of BMP-2 mRNA were normalized against Glyceraldehyde -3-Phosphate Dehydrogenase (GAPDH). Quantitative real-time reverse transcription polymerase chain reaction (QRT-PCR) For ALP activity and COL-ⅠmRNA gene expression analysis, samples were collected after cycled stretching for 24 h. The unstretched control group (A) consisted of cells cultured under similar conditions and collected at the same time points as the stretched experimental groups (B, C and D).Total RNA was extracted and purified by using Trizol 1 ml (lml/10cm2). For reverse transcription with polymerase chain reaction, 1 μg of total RNA was reverse-transcribed (RT) into cDNA with a mixture of oligo (dT). RT-PCR was performed by using 1 μl of the 20-μl total RT product, PCR buffer, dNTPs, and Premix Taq DNA polymerase under the manufacturer’s recommended conditions (Takara, Shiga, Japan). Quantification was performed by comparing levels obtained with standardized sample and ratios of ALP and COL-ⅠmRNA were normalized against Glucose 6-Phosphate Dehydrogenase (G6PDH). The PCR conditions and primer sequences used for BMP-2, ALP, COL-I, GAPDH and G6PDH were listed in Table 1. 6 Statistical analysis Experimental data were expressed as mean±standard deviation (SD). The statistical analyses of the data were performed by an analysis of variance (ANOVA) with the use of the SPSS 13.0 program. Statistical significance was determined at P < 0.05. 7 RESULTS Morphology Observation Before/After Cell Loading A morphological change in cells was observed using an inverted phase contrast microscope 24 h after strain loading. MC3T3-E1 cells were polygonal and arranged irregularly before strain loading. However, the morphology and arrangement of cells clearly changed after strain loading; the cells became spindle-shaped and orderly arranged in the direction of the loaded strain (Figure 1). Evaluation of mRNA Expression of BMP-2 by Relative quantitative RT-PCR The Ct values of BMP-2 and GAPDH showed how different magnitudes of strain affect the BMP-2 mRNA in the MC3T3-E1 cells (Figure 2). Mechanical strain at 6% or 12% elongation caused a significant magnitude-dependent increase in BMP-2 mRNA compared to that in control (0% elongation) group and when the strain was greater than 18%, the mRNA expression of BMP-2 decreased. Evaluation of mRNA Expression of ALP and COL- I by QRT-PCR ALP and COL- I were also two signals involved in osteoblast differentiation. Interestingly, exposing cells to12% or 18% mechanical loading increased ALP and COL- I gene expression significantly (p < 0.05). However, there was no significant difference between cells exposed to 6% elongation (Figure 3, 4). 8 DISCUSSION Effects of Mechanical Strain on Osteoblastic Morphology A recent study8 suggests that mechanically induced remodeling is mediated by a complex feedback mechanism involving the synthesis of cytokines. This process takes place downstream from the initial mechanotransduction event at focal adhesions linking the extracellular matrix to the cytoskeleton. These in turn act in an autocrine/paracrine fashion to regulate the expression of cytokines involved in the differentiation, proliferation and function of mesenchymal and other cell types. By loading strain on osteoblasts for 2 hours, some researchers9 found that mechanical stretch caused extensive response on osteoblasts which led to the rearrangement of F-actin filament. Meazzin10 found that mechanical strain leads to a coordinated change both in the cytoskeleton and in the extracellular matrix proteins that facilitate tighter adhesion of an osteoblast to its extracellular matrix. These results indicated that mechanical strain induced the rearrangement and morphological change of cytoskeleton. The study results of this experiment showed that the cells were polygonal and arranged irregularly before strain loading; however, after strain loading, obvious changes in morphology and arrangement of the cells occurred, and cells were arranged in a more orderly fashion consistent with mechanical loaded strain. The results indicated that the cytoskeleton was rearranged and morphologically changed under the strain, and the mechanical signal was transferred into cells inducing a series of biological reactions that included BMP-2, ALP and COL- I expression in cells. 9 Effects of Mechanical Strain Magnitude on BMP-2 Expression of Osteoblast-like cells It is well known that mechanical stress is a fundamental physiological factor for regulating structure and function in bones. Mechanical strain also plays a crucial role in orthodontic tooth movement.11 It was generally accepted that osteoblasts were located on the surface of cancellous and cortical bone on the yet unmineralized cell matrix.12 Therefore, deformation of the substrate to which these cells adhere would be an appropriate signal for stimulating them. Other experimental results found that the application of different magnitudes of cyclic tensile strain (0%, 6%, 12% or 18%) induced a magnitude-dependent increase in MMP-13 and TIMP-1 expression in cultured osteoblasts.13 However, different studies show that due to different magnitudes, frequencies and action times of mechanical strain as well as different using devices, the effects on osteoblasts were different.14,15,16,17 We used an in vitro cell strain system that allowed mechanical stimulus to be quantified at different magnitudes of stress, using cyclic strains of 6%, 12% or 18% elongation in this study. According to some studies,18,19,20 the formation of bone tissue was regulated by total growth factors and local growth factors, and BMP-2 mainly plays the role of aggregating and differentiating undifferentiated mesenchymal cells and bone-family cells and can also reverse and differentiate myoblasts, fibroblasts and bone marrow stromal cells into bone-family cells. Therefore, BMP-2 was considered the most crucial regulatory factor in the formation of bone tissue. In this study, we found that the increase in BMP-2 mRNA expression was magnitude-dependent after strain loading in 10 MC3T3-E1 osteoblast-like cell for 24 hours. Furthermore, mechanical strain corresponding to 6%, 12%, or 18% elongation led to a magnitude-dependent increase in BMP-2 mRNA expression. A maximal and significant increase in expression of BMP-2 mRNA was observed at 12% elongation, which decreased at elongations greater than 18%. This may possibly have resulted due to the fact that too large a strain can cause adverse effects on osteoblasts and affect BMP-2 expression. Other study21 reported that physiological loading of osteoblast-like cells enhances the regenerative capacity of bone, whereas hyperphysiological loads may impair bone regeneration, which was similar to the results of this experiment. Effects of Mechanical Strain Magnitude on ALP and COL- I Expression of Osteoblast-like cells ALP and collagen synthesis were early markers of osteoblast differentiation.22,23 It has been reported that 95% of the collagen recovered from MC3T3-E1 cells is type I. 24 Therefore, the high ALP activity and the COL- I in the cells are closely linked to differentiation into osteoblasts.25 In our study, mechanical loading to12% or 18%elongation increased ALP and COL- I mRNA expression in osteoblatic MC3T3E1 cells as time went by 24h, which is considered as stimulating osteoblast differentiation by bone marker protein synthesis by osteoblasts. Taken all together, the statistical analysis showed that the difference was significant (Figure 2-4). Therefore the significantly increased BMP-2, COL- I and ALP activity might play an important role in osteoblastic differentiation of MC3T3-E1 cells. These markers are considered highly predictive of the differentiated osteoblast 11 phenotype. But the transcriptional regulation of these genes is not well characterized. ACKNOWLEDGEMENTS The authors sincerely wish to thank PENG Zhu-li and staff members in the Tissue Engineering Research Center of Fourth Military Medical University for technical assistance. 12 REFERENCES 1. Cakir-Ozkan N, Eyibilen A, Ozkan F, Ozyurt B, Aslan H.. Stereologic analysis of bone produced by distraction osteogenesis or autogenous bone grafting in mandible. J Craniofac Surg 2010; 21: 735-740. 2. Zhang F, Wang CL, Koyama Y, Mitsui N, Shionome C, Sanuki R, et al. Compressive force stimulates the gene expression of IL-17s and their receptors in MC3T3-E1 cells. Connect Tissue Res 2010; 51:359-369. 3. Chang L, Zhe W, Sun HC. The Effect of Simvastatin on mRNA Expression of Transforming Growth Factor-β1, Bone Morphogenetic Protein-2 and Vascular Endothelial Growth Factor in Tooth Extraction Socket. Int J Oral Sci 2009 ; 1: 90–98. 4.. Barnouti ZP, Owtad P, Shen G, Petocz P, Darendeliler MA.The biological mechanisms of PCNA and BMP in TMJ adaptive remodeling.Angle Orthodontist 2011; 81:93-101 5. Schmitt JM, Hwang K, Winn SR, Hollinger JO. Bone morphogenetic proteins: an update on basic biology and clinical relevance. J Orthop Res 1999;17:269–278. 6. Franceschi RT, Iyer BS. Relationship between collagen synthesis and expression of the osteoblast phenotype in MC3T3-E1 cells. J Bone Miner Res 1992;7:235-46 7. Tang L, Lin Z, Li YM: Effects of different magnitudes of mechanical strain on osteoblasts in vitro. Biochem Biophys Res Commun 2006; 344:122-128. 8. Meikle MC. The tissue, cellular, and molecular regulation of orthodontic tooth movement: 100 years after Carl Sandstedt. Eur J Orthod, 2006, 28(3):221-240. 13 9. Qi MC, Hu J, Zou SJ, Han LC, Luo E. The changes of cytoskeleton F-actin in rat bone marrow mesenchymal stem cells and calvarial osteoblasts under mechanical strain [J]. Hua Xi Kou Qiang Yi Xue Za Zhi 2005; 23(2):110-2, 121. [Article in Chinese] 10. Meazzini MC, Toma CD, Schaffer JL, Gray ML, Gerstenfeld LC. Ostoeblast cytoskeletal modulation in response to mechanical strain in vitro. J Orthop Res 1998; 16 (2): 170-180. 11. Motokawa M, Kaku M, Tohma Y, Kawata T, Fujita T, Kohno S, et al. Effects of cyclic tensile forces on the expression of vascular endothelial growth factor (VEGF) and macrophage-colony-stimulating factor (M-CSF) in murine osteoblastic MC3T3-E1 cells, J. Dent. Res 2005; 84 (5):422–427. 12. Lin Tang, Zhu Lin, Yong-ming Li. Effects of different magnitudes of mechanical strain on Osteoblasts in vitro. Biochemical and Biophysical Research Communications 2006;344: 122–128 13. Li Y, Tang L, Duan Y, Ding Y. Upregulation of MMP-13 and TIMP-1 expression in response to mechanical strain in MC3T3-E1 osteoblastic cells. BMC Research Notes 2010; 3:309 14. Knoll BI, McCarthy TL, Centrella M, Shin J. Strain-dependent control of transforming growth factor-beta function in osteoblasts in an vitro model: biochemical events associated with distraction osteogenesis. Plast Reconstr surg 2005;116(1):224-233 15. Yang YQ, Li XT, Rabie AB, Fu MK, Zhang D. Human periodontal ligament cells 14 express osteoblastic phenotypes under intermittent force loading in vitro. Front Biosci 2006 ; 1(11):776-781 16. Di Palma F, Douet M, Boachon C, Guignandon A, Peyroche S, Forest B, et al. Physiological strains induce differentiation in human osteoblasts cultured on orthopaedic biomaterial. Biomaterials 2003; 24(18): 3139-3151 17. Winter LC, Walboomers XF, Bumgardner JD. Intermittent versus continuous stretching effects on osteoblast-like cells in vitro.J Biomed Mater Res 2003; 67(4):1269-1275 18. Kato S, Sangadala S, Tomita K, Titus L, Boden SD. A synthetic compound that potentiates bone morphogenetic protein-2-induced transdifferentiation of myoblasts into the osteoblastic phenotype. Mol Cell Biochem 2011;349:97-106. 19. Varkey M, Kucharski C, Haque T, Sebald W, Uludağ H. In vitro osteogenic response of rat bone marrow cells to bFGF and BMP-2 treatments. Clin Orthop Relat Res 2006;443: l13-123. 20. Luo QF, Wang X, Yi B, Li ZL, Wang XX, Liang C. The transformation of fibroblast-like cells origenating from different tissue into osteoblasts. Chinese Journal of Stomatology 2005;40: 327-330. [Article in Chinese] 21. Meyer U, Terodde M, Joos U, Wiesmann HP. Mechanical stimulation of osteoblasts in cell culture. Mund Kiefer Gesichtschir 2001;5(3):166-72. [Article in German] 22. Seo HJ, Cho YE, Kim T, Shin HI, Kwun IS. Zinc may increase bone formation through stimulating cell proliferation, alkaline phosphatase activity and collagen 15 synthesis in osteoblastic MC3T3-E1 cells. Nutrition Research and Practice 2010;4(5):356-361 23. Han P, Ji WP, Zhao CL, Zhang XN, Jiang Y. Improved osteoblast proliferation, differentiation and mineralization on nanophase Ti6Al4V. Chinese Medical Journal 2011;124(2):273-279 24. Hata R, Hori H, Nagai Y, Tanaka S, Kondo M, Hiramatsu M, et al. Selective inhibition of type I collagen synthesis in osteoblastic cells by epidermal growth factor. Endocrinology 1984; 115: 867-876. 25. Horiguchi Y, Nakai T, Kume K. Effects of Bordetella bronchiseptica Dermonecrotic Toxin on the Structure and Function of Osteoblastic Clone MC3T3-E1 Cells. Infect Immun. 1991; 59(3): 1112-1116 16 Table. Primer sequence (5’–3’) Gene BMP-2 Primers and Conditions Used for RT-PCR Fw: 5’- TGACTGGATCGTGGCACCTC-3’ PCR conditions Product size (bp) 40 cycles 112 Rv: 5’- CAGAGTCTGCACTATGGCATGGTTA -3’ 95℃ 40 sec, 60℃ 45 sec, 72℃ 45 sec ALP Fw: Rv: Col-Ⅰ GAPDH G6PDH 5’- CCAACTCTTTTGTGCCAGAGA -3’ 110 5’- GGCTACATTGGTGTTGAGCTTTT -3’ 94℃ 15 sec, 60℃ 15 sec, 72℃ 15 sec Fw: 5’- GCTCCTCTTAGGGGCCACT -3’ Rv: 5’- CCACGTCTCACCATTGGGG -3’ Fw: 5’-TGTGTCCGTCGTGGATCTGA-3’ Rv: 5’- TTGCTGTTGAAGTCGCAGGAG -3’ Fw: 5’-AGGTCGGTGTGAACGGATTTG -3’ Rv: 40 cycles 40 cycles 94℃ 15 sec, 60℃ 15 sec, 72℃ 15 sec 40 cycles 17 150 95℃ 40 sec, 60℃ 45 sec, 72℃ 45 sec 40 cycles 5’- TGTAGACCATGTAGTTGAGGTCA -3’ 94℃ 15 sec, 60℃ 15 sec, 72℃ 15 sec bp, base pairs; Fw, forward; Rv, reverse. 103 123 Figure 1 Phase contrast images showing the morphological change in osteoblast-like cells The osteoblast-like cells appeared polygonal and were arranged irregularly before application of mechanical strain, but became spindle-shaped and orderly arranged in the direction of the strain loaded (A) before application of mechanical strain (B) 0% elongation (C) 6% elongation (D) 12% elongation (E) 18% elongation. Magnification: 400X. Figure 2 Expression of BMP-2 mRNA 24 hours after strain loading Expression of BMP-2 mRNA in rat osteoblast-like cells subjected to 0%, 6%, 12% or 18% stretching loads at a frequency of 6 cycle/min for 24 hours. A maximal and significant increase in 18 expression of BMP-2 mRNA was observed at 12% elongation. (*p<0.05) Figure 3 Expression of ALP mRNA 24 hours after strain loading Expression of ALP mRNA in rat osteoblast-like cells subjected to 0%, 6%, 12% or 18%stretching loads at a frequency of 6 cycle/min for 24 hours. A significant increase in expression of ALP mRNA was observed at 12% or 18%elongation.(*p<0.05) Figure 4 Expression of COL- I mRNA 24 hours after strain loading Expression of COL- I mRNA in rat osteoblast-like cells subjected to 0%, 6%, 12% or 18%stretching loads at a frequency of 6 cycle/min for 24 hours. A significant increase in expression of COL- I mRNA was observed at 12% or 18%elongation.(*p<0.05) 19