Download Genetic analysis of a Chinese Han family with multiple endocrine

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Public health genomics wikipedia, lookup

Genetic engineering wikipedia, lookup

Vectors in gene therapy wikipedia, lookup

Multiple sclerosis research wikipedia, lookup

Gene therapy wikipedia, lookup

Gene therapy of the human retina wikipedia, lookup

Androgen insensitivity syndrome wikipedia, lookup

Transcript
Indian Journal of Biochemistry & Biophysics
Vol. 50, February 2013, pp. 26-31
Genetic analysis of a Chinese Han family with multiple endocrine neoplasia type 2A
Yi Guoa,b,c, Hongbo Xua, Zuhai Rend, Yongjia Yange, Wei Xiongf, Kai Gaoa, Xiaorong Lid, Ziqiang Luob and Hao Denga,*
a
Center for Experimental Medicine, The Third Xiangya Hospital, Central South University, bDepartment of Physiology, Xiangya School
of Medicine, Central South University, cDepartment of Medical Information, Xiangya School of Medicine, Central South University,
d
Department of Surgery, The Third Xiangya Hospital of Central South University, eThe Laboratory of Genetics and Metabolism, Hunan
Children’s Hospital, fCancer Research Institute, Xiangya School of Medicine, Central South University, Changsha, Hunan 410013, China
Received 19 April 2012; revised 04 January 2013
Multiple endocrine neoplasia type 2 (MEN2) is an autosomal dominant disorder that can be distinguished as three
different syndromes: multiple endocrine neoplasia type 2A (MEN2A), MEN2B and familial medullary thyroid carcinoma
(FMTC). This disorder is usually caused by the mutations of the rearranged during transfection protooncogene gene (RET)
or the neurotrophic tyrosine kinase receptor type 1 gene (NTRK1). To investigate the genetic cause in a Chinese Han family
with MEN2A and the genotype-phenotype correlations, nine members belonging to 3 generations of MEN2A family with 5
affected subjects underwent genetic analysis. Standard GTG-banded karyotype analysis and sequencing of the RET and
NTRK1 genes were performed to identify the genetic cause of this family. A heterozygous mutation p.Cys634Arg in the RET
gene was identified in 5 patients with MEN2A and one asymptomatic family member. The phenotype of patients was that of
classic MEN2A, characterized by medullary thyroid carcinoma and phaeochromocytoma. The clinical features of all cases
with RET mutations varied greatly, including onset age of clinical manifestations, severity and comorbidities. Thus, this
study not only identified the hereditary nature of the MEN2A in the cases, but also discovered a family member harboring
the same p.Cys634Arg mutation, who was unaware of his condition. These finding may provide new insights into the cause
and diagnosis of MEN2A and have implications for genetic counseling.
Keywords: Multiple endocrine neoplasia type 2 (MEN2A), RET, p.Cys634Arg, Mutation
Multiple endocrine neoplasia type 2 (MEN2) is an
autosomal dominant disorder with a penetrance of
almost 100% for medullary thyroid carcinoma (MTC,
MIM 155240)1, a rare tumor that accounts for 3-5% of
all thyroid cancers arising from parafollicular thyroid
C cells. It can be distinguished as three different
syndromes — MEN2A, MEN2B and familial MTC
(FMTC). Previous study has shown that FMTC
accounts for 62.5%, MEN2A presents 30.5%, and
MEN2B is responsible for only 7% of MEN22.
Clinical classification of MEN2 has been established
based on the spectrum of clinical manifestations in the
proband and in other affected members of the family.
When a phaeochromocytoma (PHAEO) and/or a
primary
hyperparathyroidism
(hyperPTH)
are
____________
*Author for correspondence:
Tel: 011-86-731-88618372
Fax: 011-86-731-88618339
E-mail: hdeng008@yahoo.com
Abbreviations: CCH, C-cell hyperplasia; FMTC, familial
medullary thyroid carcinoma ; GTG, Giemsa-trypsin-Giemsa;
MEN2, multiple endocrine neoplasia type 2; MEN2A, multiple
endocrine neoplasia type 2A; MTC, medullary thyroid carcinoma;
NTRK1, neurotrophic tyrosine kinase receptor type 1 gene;
PHAEO, phaeochromocytoma.
evidenced in a patient with MTC or in some relatives,
MEN2A syndrome can be diagnosed. Other
non-endocrine clinical features (mucosal neurinomas,
megacolon, corneal nerve hypertrofia and habitus
marphanoid) with or without associated PHAEO in a
patient with MTC is suggestive of MEN2B syndrome1.
Finally, when at least four members of the same family
have a history of MTC with no evidence of
involvement of any other endocrine gland with no
PHAEO or hyperPTH in the familial history, a
diagnosis of FMTC can be advocated1,3.
MEN2 is usually caused by germline mutations of
the rearranged during transfection protooncogene
gene (RET) and only a few cases are caused by
mutations in the neurotrophic tyrosine kinase receptor
type 1 gene (NTRK1)3,4. MEN2 genetic screening
provides a major tool for the pre-clinical diagnosis
and early treatment of affected family members3.
We describe here a large family with MEN2A,
caused by a heterozygous p.Cys634Arg germline
mutation in the RET gene. This family draws attention
to the broad spectrum of phenotype, including
incomplete penetrance or phenotype express until
later in life for RET-related MEN2A.
GUO et al: GENETIC ANALYSIS OF A CHINESE HAN FAMILY WITH MEN2A
Materials and Methods
Pedigree and subjects
A 3-generation Chinese Han family with a total of
16 members and 6 affected members of MEN2A was
enrolled in this study (Fig. 1). Blood was collected
from 9 members of this family, including 5 patients
(II:3, II:5, III:3, III:4 and III:5, Table 1). They were
compared with 100 ethnically-matched normal
controls (male/female: 50/50, age 40.2 ± 8.2 yrs).
Clinical evaluation of MEN2A was performed
according to the published criteria5,6. The following
parameters were studied: clinical and diagnostic data
(age, gender and clinical features), biochemical
markers (carcinoembryonic antigen, parathyroid
hormone and catecholamines), a neck and an
abdomen ultrasound Doppler ultrasound and
computerized tomography scans.
MTC histological diagnosis was addressed by
typical histology (i.e. tumoural cells arranged in
trabecular, insular or sheet-like growth patterns and
showed atypia) and immunohistochemical findings2.
27
C-cell hyperplasia (CCH) was diagnosed when 2-5
C-cells with more than 50 cells per low power field
were found. Five affected patients underwent
total thyroidectomy and central neck dissection.
Pathology examination confirmed an intra-adrenal
pheochromocytoma. This study was approved by the
Ethics Committee of the Third Xiangya Hospital and
all participating individuals signed their informed
consents.
Conventional cytogenetics
Metaphase
chromosome
preparation
was
performed on a 72-h harvest of phytohemagglutinin
(PHA)-stimulated peripheral blood lymphocytes of
the proband and her sister. Standard karyotyping of
Giemsa-trypsin-Giemsa (GTG) banded chromosomes
from lymphocytes was performed according to
standard procedures. At least 20 metaphases per
sample were analyzed and karyotypes were described
according to the International System for Human
Cytogenetic Nomenclature (ISCN, 2009)7.
Mutation analysis
Fig. 1—Pedigree of the family with MEN2A showing affected
cases [Thyroid cancer and pheochromocytoma, fully-shaded;
thyroid cancer only, half-shaded and pre-symptomatic gene
carriers (dot)]
Table 1—Epidemiological clinical and pathological features of
6 RET p.Cys634Arg mutation carriers
Subjects
Sex
II:3
II:5
II:7
III:3
III:4
III:5
F
M
M
F
F
M
Age
Age at Neck US or Histology
(Yrs) diagnosis
CT
(Yrs)
45
40
36
24
19
18
24
16
N
20
14
16
SN
SN
N
Bilateral
SN
SN
MTC
MTC, PHEO
NA
MTC
MTC
MTC
M, male; F, female; N, no; US, ultrasound; CT, computerized
tomography; SN, single nodule, any size; PHEO, pheochromocytoma;
MTC, medullary thyroid carcinoma; NA, not applicable; RET, the
rearranged during transfection protooncogene gene.
Genomic DNA was isolated from lymphocytes
using standard method. PCR amplified the RET and
NTRK1 gene by using an 9700 Thermal cycler System
(Applied Biosystems Inc.) for 35 cycles at 95°C for
45 s, 56-58°C for 45 s, and 72°C for 45 s. The primers
used for PCR amplification covered all coding regions
and intron/exon boundaries of the RET and NTRK1
gene (Table 2). 8.5 µl PCR products were digested by
0.8 U shrimp alkaline phosphatase and 8 U
exonuclease I in a 10 µl reaction volume and
sequenced using an 8-capillary 3500 genetic analyzer
(Applied Biosystems Inc.)8.
Results
GTG-banded chromosome analysis revealed
normal female karyotypes (46, XX) in two cases
(III:3, III:4, Fig. 1) and sequence analysis of the RET
and NTRK1 genes showed nine nucleotide variants,
including 4 novel variants (Table 3)9-12. RET mutation
p.Cys634Arg was found in these two patients.
Extended analysis of the family members revealed
that p.Cys634Arg mutation co-segregated with
MEN2A in this family and it was absent in 100
ethnically-matched normal controls. Five carriers
were clinically affected and all of them (II:3, II:5,
III:3, III:4 and III:5) underwent surgery. Bilateral
neck nodule and lymph node metastasis were detected
in a 24-yrs female (III:3, Fig. 1). The youngest patient
INDIAN J. BIOCHEM. BIOPHYS., VOL. 50, FEBRUARY 2013
28
Table 2—Primers for the RET and NTRK1 genes
Gene
Exon
RET
NTRK1
Reverse primer (5'→3')
1
1
2
3
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
CAGACTGAGCGCCGTACC
TAGCCGCAGTCCCTCCAG
AAGAAGCCTTATTCTCACCATCC
GTCTGAGCCTTGTGGACCTT
GGTCTTCCTGTCACCCACAT
CCTTCCCGAGGAAAGCGGCT
ATCTCGCCTGCACTGACC
AACCGGAACCTCTCCATCTC
TACCCTCAGGCCATTACAGG
CCTTGGGCACTAGCTGGAC
GATCTGCCTAGGAGGTGGTG
ACACTGCCCTGGAAATATGG
ATACGCAGCCTGTACCCAGT
CCCCTGTCATCCTCACACTT
TGACCTGGTATGGTCATGGA
AAGACCCAAGCTGCCTGAC
CTGGTCACACCAGGCTGAG
TCTCCTTTACCCCTCCTTCC
CTCTGTGAGGGCCAGGTG
GGCTGTCCTTCTGAGACCTG
TGGCTTGTTGTATACTGAGTTGTATC
TTGCCAAGGCCTTACTGTCT
GCTGCTCGGCGCCAACTTC
ACAGAAAGGCGCTTCTGAAC
CAGCCTCACTTAACCCCTGA
CAGGCTGGAAAGGAGGTGT
GAGCAAGACCAGCAGTAGCA
CGAACTGTGGCCGGAGACAG
AAGAGCGAGCACCTCATTTC
CCAGTCTACTCTGTGCTGGTTG
CTTTTCTCAAAGGGCAGGAG
AGACCTGGAGCAGGGAGAC
ACTCTGGCTGAAGTGCCTGT
TGCTGTTGAGACCTCTGTGG
CACAGGATGGCCTCTGTCTC
CTCTTCAGGGTCCCATGCT
GGAGAACAGGGCTGTATGGA
GTGGTGGGTCAGGGTGTG
TCTTTCCTAGGCTTCCCAAG
TGTAACCTCCACCCCAAGAG
CACAGATGTCCCCTCCCTT
CAAGCCACTTTCAGCTTGT
AAAAAGCATCACAGAGAGGAAG
TCTTCCCCTTGTGAGTCCAT
214
205
456
260
310
369
294
300
401
299
268
255
419
300
250
328
286
176
244
204
299
272
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
CTGGTCATCTGCGGACTCA
ACTTGCCAAGGGTCTCACAG
GCGGCTGGGTCTTTAACA
AACTCAAGTGTGGGCCTGAG
GGCCCAGAGTAGCTGAGACC
GGTCACTCAAGGGGTCTGTC
TATCCCCTGTGATCCCTCAG
GCCACTCCCAGCTCTAACAC
CCAAGCTGGCTAAAGCTCCT
GTGGACTTGTCGGGTGTGT
AGGGGACTCACTGCTTTCCT
AGTGTGTGTCAAGGCTCACC
AGGAGGCTCTGAGAGTACAGGA
CAAGGTGGGGGTGACCAG
CCCAAGACTGGGGCTACC
CCCCAACTCAGTCCTGTCC
GGCTCCTGGGAGTTCTATCC
GGGTAGGCTGTGCCTTGAC
GGACTGGCCTCACTCTCTTG
ACAAAGGCCACTCCAAGAGA
CAGCATTGGGGGAAATGAT
CATCGCAGTCCCGAGGAG
GAGCCCTCCCTGACCTTCT
GGACAGCCAAGCCCATTAG
AACAGACCCAAGTGCACACA
CAGGCAGGTAGGTCTCTTCC
CATCTTTGTCCCCTGTGCTC
CCCCACCCTACATCCTCTTT
GCAGGAAGTTGGCTGTAACC
CAGTTCAGCTGTACCCTCTGC
CTCCCGGTCCCAAAGTCT
CCCCAGAGACAGAGTCAGGA
ACACACACACACACACACTCGT
CCCACTCTGTCCTGATGTGA
TGTCTATAGGGAAGGGAAGACG
CTTGGGATCCAGGGTGTCTA
TCCCTGAAAAAGGAACCTGA
CCAGTATTCCGGCTAACCAC
171
253
258
198
199
180
265
255
258
470
176
143
247
290
249
280
360
299
294
RET, rearranged during transfection protooncogene; NTRK1, neurotrophic tyrosine kinase receptor type 1
Table 3—Variants detected in MEN2 chromosomes
Gene
Nucleotide change Exon/Intron
Amino acid change Type
SNP ID
RET
NTRK1
Product size ( bp )
Forward primer (5'→3')
c1296G>A
c.1900T>C
c2071G>A
IVS12+47C>T
c.2712C>G
-5G>A
c.1187C>T
IVS16-4delA
IVS18+6C>T
Exon 7
Exon 11
Exon 11
Intron 12
Exon 15
5’-UTR
Exon 11
Intron 16
Intron 18
p.Ala432Ala
p.Cys634Arg
p.Gly691Ser
p.Ser904Ser
p.Ser396Leu
Polymorphism
Mutation
Polymorphism
Polymorphism
Polymorphism
Polymorphism
Polymorphism
Polymorphism
Polymorphism
rs75076352
rs1799939
rs760466
rs1800601
rs1799770
Reference
Novel
Marsh et al 9
Lemos et al10
NCBI Database
Novel
Tsui et al11
Novel
Cozza et al12
Novel
Novel polymorphisms are bold-faced.
RET, the rearranged during transfection protooncogene gene; NTRK1, the neurotrophic tyrosine kinase receptor type 1 gene.
GUO et al: GENETIC ANALYSIS OF A CHINESE HAN FAMILY WITH MEN2A
to present with MTC and lymph node metastasis was
14-yrs old (III:4, Fig. 1). The mean age at surgery was
18 yrs. Only one asymptomatic 36-yrs-old man (II:7,
Fig. 1) was found to be carrying Cys634Arg mutation
and had no evidence of disease by Doppler ultrasound
and he refused further biochemical investigation
(Table 1). Prophylactic thyroidectomy was also
recommended, however, he refused the procedure.
Discussion
Given that MEN2 could be caused by
chromosomal rearrangements in the RET or NTRK1
gene, cytogenetic analysis and mutation screening
were conducted in our family with MEN2A. Normal
karyotypes were observed for proband and her
affected sister. p.Cys634Arg variant, previously
reported in MEN2A patients9, was found to be
co-segregated with the disorder in our family. This
variant was absent in 100 normal controls, suggesting
p.Cys634Arg variant was a pathogenic mutation. Five
p.Cys634Arg carriers had MTC and only one of them
developed
bilateral
and
asynchronous
pheochromocytomas. At the time of investigation, a
p.Cys634Arg carrier (II:7) presented no clinical
symptoms, suggestive of MEN2 or MTC, which is a
malignant tumor of the calcitonin-secreting
parafollicular C-cells of the thyroid and occurs
sporadically or as a component of the MEN2
syndromes13.
The human RET gene, mapped to chromosome
10q11.2 contains 21 exons spanning about 55 kb. The
cDNA encodes a deduced 1114-amino acid protein
with 2 potential transmembrane domains that separate
the protein into 3 domains: extra-cellular domain,
transmembrane domain and intracellular tyrosine
kinase domain. The RET protooncogene is one of the
receptor tyrosine kinases, cell-surface molecules that
transduce signals for cell growth and differentiation14.
The RET can undergo oncogenic activation in vivo
and in vitro by cytogenetic rearrangement14. The RET
gene is expressed in a variety of neuronal cell
lineages, including thyroid C cells and adrenal
medulla15.
In MEN2, the most frequent RET amino acid
substitution is p.Val804Met (19.6%), followed by
p.Cys634Arg (13.6%)4. Whereas in MEN2A, codon
634 is most frequently affected (85% of cases), with
the p.Cys634Arg substitution being the most frequent
change16. These “gain of function” mutations result in
receptor dimerization and constitutive activation,
29
ultimately giving rise to MEN2A16. Identification of
p.Cys634Arg mutation in the studied family further
supported the clinical diagnosis of MEN2A, since this
change has never been found in FMTC, in which the
mutations are more evenly distributed among the
various codons17.
Codon 634 is located on the extra-cellular domain of
the RET gene and this codon is highly liable to produce
mutations, including p.Cys634Arg, p.Cys634Tyr and
p.Cys634Trp18. It appears that RET p.Cys634Arg is a
hot spot of mutation, since it occurs independently in
different families from widely separated geographic
areas and shows different haplotype associations1.
A strong genotype-phenotype correlation has been
reported in the MEN2 syndromes with Cys634
mutations, mainly relating to the MEN 2A19. RET
mutations can be stratified into three groups (levels 1 to
3) based on the biological aggressiveness of MTC
observed in patients with these mutations. Codon 634
mutations are considered high risk and it may develop
MTC even starting from the age of one year. Lymph
node metastasis from the first decade and distant
metastases generally start from the third decade19.
Current guidelines for the treatment of patients with
level two, high-risk group mutations recommend
prophylactic total thyroidectomy before the age of five
years19.
In our study, the proband and her sister showed
neck metastases, which was consistent with
p.Cys634Arg patients presenting significantly more
distant metastases at diagnosis than those with the
p.Cys634Tyr or p.Cys634Trp mutation, suggesting
amino acid exchanges at codon 634 might have a
direct impact on tumor aggressiveness in MEN2A
syndrome20. A 36-yr male patient (II:7) of the studied
family complied with bilateral pheochromocytoma.
MEN2A represents a more aggressive form of MTC
and has a corresponding younger age at onset
compared to FMTC21.
Our study not only identified the hereditary nature
of the disease in the index cases of this MEN2A
family, but also found a family member (II:7)
harboring the p.Cys634Tyr mutation who was
unaware of his condition. The establishment of a
protocol for molecular analysis of this MEN2A
family provided us the opportunity to carry out
prophylactic thyroidectomy. MTC is usually a slow
growing tumor with indolent clinical course, with the
overall 10-yrs survival reported to be around
50%22,23. The relatively low aggressiveness of many
30
INDIAN J. BIOCHEM. BIOPHYS., VOL. 50, FEBRUARY 2013
of these MEN2A forms might explain the existence
of asymptomatic carriers and the unaware members
who were affected.
Since the mid-1990s, genetic testing was employed
on MEN2A and total thyroidectomy could completely
avoid an otherwise lethal malignancy3,14. However,
patients in our studied family were discovered much
later when the MTC clinically manifested, thus
impairing the possibility of successful treatment. In
our study, the natural clinical manifestations and
course of MEN2 were evident. As a result, the 5
patients with MEN2A had not undergone prophylactic
thyroidectomy before the clinical features observed, a
procedure strongly recommended by the international
MEN2 consortium. The p.Cys634Arg carriers with
clinical phenotype presented with cervical neck mass
as the initial symptom in our study. However, the
asymptomatic
carrier
(II:7)
refused
total
thyroidectomy, which may reflect the conservative
view in Chinese people and insufficient attention to
the syndrome.
No RET genetic variants appear to carry the same
risk. However, the quantification of specific risk of
RET-related genetic variants appears to be codonspecific. Codon 634 mutations have the highest
transforming activity and correlate strongly with the
onset of MEN220. In our studied family, the same
p.Cys634Arg mutation from the same hereditary
background had caused different clinical phenotypes,
including clinical onset age, severity of disease and
comorbidities, which was consistent with the previous
study20.
In conclusion, this study not only identified the
hereditary nature of the MEN2A in the cases, but also
discovered a family member harboring the same
p.Cys634Arg mutation who was unaware of his
condition. These findings may provide new insights
into the cause and diagnosis of MEN2A and have
implications for genetic counselling.
Acknowledgements
This work was supported by grants from the
National Natural Science Foundation of China
(81271921; 81101339); Research Foundation for the
Doctoral Program of Higher Education of China
(20110162110026);
Science
and
Technology
International cooperation Key project of Hunan
Province, China (2011WK2011); Sheng Hua Scholars
Program of Central South University, China (H.D.);
Construction Foundation for Key Subjects of
the Third Xiangya Hospital, Central South
University, China.
References
1 Romei C, Cosci B, Renzini G, Bottici V, Molinaro E, Agate
L, Passannanti P, Viola D, Biagini A, Basolo F, Ugolini C,
Materazzi G, Pinchera A, Vitti P & Elisei R (2011) Clin
Endocrinol (Oxf) 74, 241-247
2 Elisei R, Romei C, Cosci B, Agate L, Bottici V, Molinaro E,
Sculli M, Miccoli P, Basolo F, Grasso L, Pacini F &
Pinchera A (2007) J Clin Endocrinol Metab 92, 4725-4729
3 Qi X P, Ma J M, Du Z F, Ying R B, Fei J, Jin H Y, Han J S,
Wang J Q, Chen X L, Chen C Y, Liu W T, Lu J J, Zhang J G
& Zhang X N (2011) PLoS One 6, e20353
4 Gimm O, Greco A, Hoang-Vu C, Dralle H, Pierotti M A &
Eng C (1999) J Clin Endocrinol Metab 84, 2784-2787
5 American Thyroid Association Guidelines Task Force, Kloos
R T, Eng C, Evans D B, Francis G L, Gagel R F, Gharib H,
Moley J F, Pacini F, Ringel M D, Schlumberger M & Wells
S A Jr (2009) Thyroid 19, 565-612
6 DeLellis R A, Lloyd R V & Heitz P U (2004) Pathology and
genetics of tumours of endocrine organs, IARC Press, Lyon
7 Shaffer L G, Slovak M L & Campbell L J (2009) An
International System for Human Cytogenetic Nomenclature:
Recommendations of the International Standing Committee
on Human Cytogenetic Nomenclature, Karger, Basel
8 Guo Y, Deng X, Zheng W, Xu H, Song Z, Liang H, Lei J,
Jiang X, Luo Z & Deng H (2011) Neurosci Lett 501, 185-187
9 Marsh D J, Robinson B G, Andrew S, Richardson A L, Pojer
R, Schnitzler M, Mulligan L M & Hyland V J (1994)
Genomics 23, 477-479
10 Lemos M C, Carrilho F, Rodrigues F J, Santos P, Carvalheiro
M, Ruas M A & Regateiro F J (2002) Endocr Pract 8, 19-22
11 Tsui C, Coleman L E, Griffith J L, Bennett E A, Goodson S
G, Scott J D, Pittard W S & Devine S E (2003) Nucleic Acids
Res 31, 4910-4916
12 Cozza A, Morandin F, Galfre S G, Mariotti V, Marangoni R
& Pellegrini S (2007) BMC Genomics 8, 10
13 Abu-Amero K K, Alzahrani A S, Zou M & Shi Y (2006)
Oncogene 25, 677-684
14 Grieco M, Santoro M, Berlingieri M T, Melillo R M, Donghi
R, Bongarzone I, Pierotti M A, Della Porta G, Fusco A &
Vecchio G (1990) Cell 60, 557-563
15 Romei C, Mariotti S, Fugazzola L, Taccaliti A, Pacini F,
Opocher G, Mian C, Castellano M, degli Uberti E,
Ceccherini I, Cremonini N, Seregni E, Orlandi F, Ferolla P,
Puxeddu E, Giorgino F, Colao A, Loli P, Bondi F, Cosci B,
Bottici V, Cappai A, Pinna G, Persani L, Verga U, Boscaro
M, Castagna M G, Cappelli C, Zatelli MC, Faggiano A &
Francia G, Brandi ML, Falchetti A, Pinchera A & Elisei R
(2010) Eur J Endocrinol 163, 301-308
16 Sakorafas G H, Friess H & Peros G (2008) Endocr Relat
Cancer 15, 871-884
17 Pazaitou-Panayiotou K, Giatzakis C, Koutsodontis G,
Vratimos A, Chrisoulidou A, Konstantinidis T & Kamakari S
(2010) Thyroid 20, 401-406
18 Patocs A, Klein I, Szilvasi A, Gergics P, Toth M, Valkusz Z,
Forizs E, Igaz P, Al-Farhat Y, Tordai A, Varadi A, Racz K &
Esik O (2006) Wien Klin Wochenschr 118, 417-421
GUO et al: GENETIC ANALYSIS OF A CHINESE HAN FAMILY WITH MEN2A
19 Jung J, Uchino S, Lee Y & Park H (2010) J Korean Med
Sci 25, 226-229
20 Puñales M K, Graf H, Gross J L & Maia A L (2003) J Clin
Endocrinol Metab 88, 2644-2649
21 Mulligan L M, Kwok J B, Healey C S, Elsdon M J, Eng C,
Gardner E, Love D R, Mole S E, Moore J K, Papi L,
31
Ponder M A, Telenius H, Tunnacliffe A & Ponder B A
(1993) Nature 363, 458-460
22 Bergholm U, Bergström R & Ekbom A (1997) Cancer 79,
132-138
23 Gülben K, Berberoğlu U & Boyabatli M (2006) World J
Surg 30, 84-90