Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Indian Journal of Biochemistry & Biophysics Vol. 50, February 2013, pp. 26-31 Genetic analysis of a Chinese Han family with multiple endocrine neoplasia type 2A Yi Guoa,b,c, Hongbo Xua, Zuhai Rend, Yongjia Yange, Wei Xiongf, Kai Gaoa, Xiaorong Lid, Ziqiang Luob and Hao Denga,* a Center for Experimental Medicine, The Third Xiangya Hospital, Central South University, bDepartment of Physiology, Xiangya School of Medicine, Central South University, cDepartment of Medical Information, Xiangya School of Medicine, Central South University, d Department of Surgery, The Third Xiangya Hospital of Central South University, eThe Laboratory of Genetics and Metabolism, Hunan Children’s Hospital, fCancer Research Institute, Xiangya School of Medicine, Central South University, Changsha, Hunan 410013, China Received 19 April 2012; revised 04 January 2013 Multiple endocrine neoplasia type 2 (MEN2) is an autosomal dominant disorder that can be distinguished as three different syndromes: multiple endocrine neoplasia type 2A (MEN2A), MEN2B and familial medullary thyroid carcinoma (FMTC). This disorder is usually caused by the mutations of the rearranged during transfection protooncogene gene (RET) or the neurotrophic tyrosine kinase receptor type 1 gene (NTRK1). To investigate the genetic cause in a Chinese Han family with MEN2A and the genotype-phenotype correlations, nine members belonging to 3 generations of MEN2A family with 5 affected subjects underwent genetic analysis. Standard GTG-banded karyotype analysis and sequencing of the RET and NTRK1 genes were performed to identify the genetic cause of this family. A heterozygous mutation p.Cys634Arg in the RET gene was identified in 5 patients with MEN2A and one asymptomatic family member. The phenotype of patients was that of classic MEN2A, characterized by medullary thyroid carcinoma and phaeochromocytoma. The clinical features of all cases with RET mutations varied greatly, including onset age of clinical manifestations, severity and comorbidities. Thus, this study not only identified the hereditary nature of the MEN2A in the cases, but also discovered a family member harboring the same p.Cys634Arg mutation, who was unaware of his condition. These finding may provide new insights into the cause and diagnosis of MEN2A and have implications for genetic counseling. Keywords: Multiple endocrine neoplasia type 2 (MEN2A), RET, p.Cys634Arg, Mutation Multiple endocrine neoplasia type 2 (MEN2) is an autosomal dominant disorder with a penetrance of almost 100% for medullary thyroid carcinoma (MTC, MIM 155240)1, a rare tumor that accounts for 3-5% of all thyroid cancers arising from parafollicular thyroid C cells. It can be distinguished as three different syndromes — MEN2A, MEN2B and familial MTC (FMTC). Previous study has shown that FMTC accounts for 62.5%, MEN2A presents 30.5%, and MEN2B is responsible for only 7% of MEN22. Clinical classification of MEN2 has been established based on the spectrum of clinical manifestations in the proband and in other affected members of the family. When a phaeochromocytoma (PHAEO) and/or a primary hyperparathyroidism (hyperPTH) are ____________ *Author for correspondence: Tel: 011-86-731-88618372 Fax: 011-86-731-88618339 E-mail: [email protected] Abbreviations: CCH, C-cell hyperplasia; FMTC, familial medullary thyroid carcinoma ; GTG, Giemsa-trypsin-Giemsa; MEN2, multiple endocrine neoplasia type 2; MEN2A, multiple endocrine neoplasia type 2A; MTC, medullary thyroid carcinoma; NTRK1, neurotrophic tyrosine kinase receptor type 1 gene; PHAEO, phaeochromocytoma. evidenced in a patient with MTC or in some relatives, MEN2A syndrome can be diagnosed. Other non-endocrine clinical features (mucosal neurinomas, megacolon, corneal nerve hypertrofia and habitus marphanoid) with or without associated PHAEO in a patient with MTC is suggestive of MEN2B syndrome1. Finally, when at least four members of the same family have a history of MTC with no evidence of involvement of any other endocrine gland with no PHAEO or hyperPTH in the familial history, a diagnosis of FMTC can be advocated1,3. MEN2 is usually caused by germline mutations of the rearranged during transfection protooncogene gene (RET) and only a few cases are caused by mutations in the neurotrophic tyrosine kinase receptor type 1 gene (NTRK1)3,4. MEN2 genetic screening provides a major tool for the pre-clinical diagnosis and early treatment of affected family members3. We describe here a large family with MEN2A, caused by a heterozygous p.Cys634Arg germline mutation in the RET gene. This family draws attention to the broad spectrum of phenotype, including incomplete penetrance or phenotype express until later in life for RET-related MEN2A. GUO et al: GENETIC ANALYSIS OF A CHINESE HAN FAMILY WITH MEN2A Materials and Methods Pedigree and subjects A 3-generation Chinese Han family with a total of 16 members and 6 affected members of MEN2A was enrolled in this study (Fig. 1). Blood was collected from 9 members of this family, including 5 patients (II:3, II:5, III:3, III:4 and III:5, Table 1). They were compared with 100 ethnically-matched normal controls (male/female: 50/50, age 40.2 ± 8.2 yrs). Clinical evaluation of MEN2A was performed according to the published criteria5,6. The following parameters were studied: clinical and diagnostic data (age, gender and clinical features), biochemical markers (carcinoembryonic antigen, parathyroid hormone and catecholamines), a neck and an abdomen ultrasound Doppler ultrasound and computerized tomography scans. MTC histological diagnosis was addressed by typical histology (i.e. tumoural cells arranged in trabecular, insular or sheet-like growth patterns and showed atypia) and immunohistochemical findings2. 27 C-cell hyperplasia (CCH) was diagnosed when 2-5 C-cells with more than 50 cells per low power field were found. Five affected patients underwent total thyroidectomy and central neck dissection. Pathology examination confirmed an intra-adrenal pheochromocytoma. This study was approved by the Ethics Committee of the Third Xiangya Hospital and all participating individuals signed their informed consents. Conventional cytogenetics Metaphase chromosome preparation was performed on a 72-h harvest of phytohemagglutinin (PHA)-stimulated peripheral blood lymphocytes of the proband and her sister. Standard karyotyping of Giemsa-trypsin-Giemsa (GTG) banded chromosomes from lymphocytes was performed according to standard procedures. At least 20 metaphases per sample were analyzed and karyotypes were described according to the International System for Human Cytogenetic Nomenclature (ISCN, 2009)7. Mutation analysis Fig. 1—Pedigree of the family with MEN2A showing affected cases [Thyroid cancer and pheochromocytoma, fully-shaded; thyroid cancer only, half-shaded and pre-symptomatic gene carriers (dot)] Table 1—Epidemiological clinical and pathological features of 6 RET p.Cys634Arg mutation carriers Subjects Sex II:3 II:5 II:7 III:3 III:4 III:5 F M M F F M Age Age at Neck US or Histology (Yrs) diagnosis CT (Yrs) 45 40 36 24 19 18 24 16 N 20 14 16 SN SN N Bilateral SN SN MTC MTC, PHEO NA MTC MTC MTC M, male; F, female; N, no; US, ultrasound; CT, computerized tomography; SN, single nodule, any size; PHEO, pheochromocytoma; MTC, medullary thyroid carcinoma; NA, not applicable; RET, the rearranged during transfection protooncogene gene. Genomic DNA was isolated from lymphocytes using standard method. PCR amplified the RET and NTRK1 gene by using an 9700 Thermal cycler System (Applied Biosystems Inc.) for 35 cycles at 95°C for 45 s, 56-58°C for 45 s, and 72°C for 45 s. The primers used for PCR amplification covered all coding regions and intron/exon boundaries of the RET and NTRK1 gene (Table 2). 8.5 µl PCR products were digested by 0.8 U shrimp alkaline phosphatase and 8 U exonuclease I in a 10 µl reaction volume and sequenced using an 8-capillary 3500 genetic analyzer (Applied Biosystems Inc.)8. Results GTG-banded chromosome analysis revealed normal female karyotypes (46, XX) in two cases (III:3, III:4, Fig. 1) and sequence analysis of the RET and NTRK1 genes showed nine nucleotide variants, including 4 novel variants (Table 3)9-12. RET mutation p.Cys634Arg was found in these two patients. Extended analysis of the family members revealed that p.Cys634Arg mutation co-segregated with MEN2A in this family and it was absent in 100 ethnically-matched normal controls. Five carriers were clinically affected and all of them (II:3, II:5, III:3, III:4 and III:5) underwent surgery. Bilateral neck nodule and lymph node metastasis were detected in a 24-yrs female (III:3, Fig. 1). The youngest patient INDIAN J. BIOCHEM. BIOPHYS., VOL. 50, FEBRUARY 2013 28 Table 2—Primers for the RET and NTRK1 genes Gene Exon RET NTRK1 Reverse primer (5'→3') 1 1 2 3 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 CAGACTGAGCGCCGTACC TAGCCGCAGTCCCTCCAG AAGAAGCCTTATTCTCACCATCC GTCTGAGCCTTGTGGACCTT GGTCTTCCTGTCACCCACAT CCTTCCCGAGGAAAGCGGCT ATCTCGCCTGCACTGACC AACCGGAACCTCTCCATCTC TACCCTCAGGCCATTACAGG CCTTGGGCACTAGCTGGAC GATCTGCCTAGGAGGTGGTG ACACTGCCCTGGAAATATGG ATACGCAGCCTGTACCCAGT CCCCTGTCATCCTCACACTT TGACCTGGTATGGTCATGGA AAGACCCAAGCTGCCTGAC CTGGTCACACCAGGCTGAG TCTCCTTTACCCCTCCTTCC CTCTGTGAGGGCCAGGTG GGCTGTCCTTCTGAGACCTG TGGCTTGTTGTATACTGAGTTGTATC TTGCCAAGGCCTTACTGTCT GCTGCTCGGCGCCAACTTC ACAGAAAGGCGCTTCTGAAC CAGCCTCACTTAACCCCTGA CAGGCTGGAAAGGAGGTGT GAGCAAGACCAGCAGTAGCA CGAACTGTGGCCGGAGACAG AAGAGCGAGCACCTCATTTC CCAGTCTACTCTGTGCTGGTTG CTTTTCTCAAAGGGCAGGAG AGACCTGGAGCAGGGAGAC ACTCTGGCTGAAGTGCCTGT TGCTGTTGAGACCTCTGTGG CACAGGATGGCCTCTGTCTC CTCTTCAGGGTCCCATGCT GGAGAACAGGGCTGTATGGA GTGGTGGGTCAGGGTGTG TCTTTCCTAGGCTTCCCAAG TGTAACCTCCACCCCAAGAG CACAGATGTCCCCTCCCTT CAAGCCACTTTCAGCTTGT AAAAAGCATCACAGAGAGGAAG TCTTCCCCTTGTGAGTCCAT 214 205 456 260 310 369 294 300 401 299 268 255 419 300 250 328 286 176 244 204 299 272 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 CTGGTCATCTGCGGACTCA ACTTGCCAAGGGTCTCACAG GCGGCTGGGTCTTTAACA AACTCAAGTGTGGGCCTGAG GGCCCAGAGTAGCTGAGACC GGTCACTCAAGGGGTCTGTC TATCCCCTGTGATCCCTCAG GCCACTCCCAGCTCTAACAC CCAAGCTGGCTAAAGCTCCT GTGGACTTGTCGGGTGTGT AGGGGACTCACTGCTTTCCT AGTGTGTGTCAAGGCTCACC AGGAGGCTCTGAGAGTACAGGA CAAGGTGGGGGTGACCAG CCCAAGACTGGGGCTACC CCCCAACTCAGTCCTGTCC GGCTCCTGGGAGTTCTATCC GGGTAGGCTGTGCCTTGAC GGACTGGCCTCACTCTCTTG ACAAAGGCCACTCCAAGAGA CAGCATTGGGGGAAATGAT CATCGCAGTCCCGAGGAG GAGCCCTCCCTGACCTTCT GGACAGCCAAGCCCATTAG AACAGACCCAAGTGCACACA CAGGCAGGTAGGTCTCTTCC CATCTTTGTCCCCTGTGCTC CCCCACCCTACATCCTCTTT GCAGGAAGTTGGCTGTAACC CAGTTCAGCTGTACCCTCTGC CTCCCGGTCCCAAAGTCT CCCCAGAGACAGAGTCAGGA ACACACACACACACACACTCGT CCCACTCTGTCCTGATGTGA TGTCTATAGGGAAGGGAAGACG CTTGGGATCCAGGGTGTCTA TCCCTGAAAAAGGAACCTGA CCAGTATTCCGGCTAACCAC 171 253 258 198 199 180 265 255 258 470 176 143 247 290 249 280 360 299 294 RET, rearranged during transfection protooncogene; NTRK1, neurotrophic tyrosine kinase receptor type 1 Table 3—Variants detected in MEN2 chromosomes Gene Nucleotide change Exon/Intron Amino acid change Type SNP ID RET NTRK1 Product size ( bp ) Forward primer (5'→3') c1296G>A c.1900T>C c2071G>A IVS12+47C>T c.2712C>G -5G>A c.1187C>T IVS16-4delA IVS18+6C>T Exon 7 Exon 11 Exon 11 Intron 12 Exon 15 5’-UTR Exon 11 Intron 16 Intron 18 p.Ala432Ala p.Cys634Arg p.Gly691Ser p.Ser904Ser p.Ser396Leu Polymorphism Mutation Polymorphism Polymorphism Polymorphism Polymorphism Polymorphism Polymorphism Polymorphism rs75076352 rs1799939 rs760466 rs1800601 rs1799770 Reference Novel Marsh et al 9 Lemos et al10 NCBI Database Novel Tsui et al11 Novel Cozza et al12 Novel Novel polymorphisms are bold-faced. RET, the rearranged during transfection protooncogene gene; NTRK1, the neurotrophic tyrosine kinase receptor type 1 gene. GUO et al: GENETIC ANALYSIS OF A CHINESE HAN FAMILY WITH MEN2A to present with MTC and lymph node metastasis was 14-yrs old (III:4, Fig. 1). The mean age at surgery was 18 yrs. Only one asymptomatic 36-yrs-old man (II:7, Fig. 1) was found to be carrying Cys634Arg mutation and had no evidence of disease by Doppler ultrasound and he refused further biochemical investigation (Table 1). Prophylactic thyroidectomy was also recommended, however, he refused the procedure. Discussion Given that MEN2 could be caused by chromosomal rearrangements in the RET or NTRK1 gene, cytogenetic analysis and mutation screening were conducted in our family with MEN2A. Normal karyotypes were observed for proband and her affected sister. p.Cys634Arg variant, previously reported in MEN2A patients9, was found to be co-segregated with the disorder in our family. This variant was absent in 100 normal controls, suggesting p.Cys634Arg variant was a pathogenic mutation. Five p.Cys634Arg carriers had MTC and only one of them developed bilateral and asynchronous pheochromocytomas. At the time of investigation, a p.Cys634Arg carrier (II:7) presented no clinical symptoms, suggestive of MEN2 or MTC, which is a malignant tumor of the calcitonin-secreting parafollicular C-cells of the thyroid and occurs sporadically or as a component of the MEN2 syndromes13. The human RET gene, mapped to chromosome 10q11.2 contains 21 exons spanning about 55 kb. The cDNA encodes a deduced 1114-amino acid protein with 2 potential transmembrane domains that separate the protein into 3 domains: extra-cellular domain, transmembrane domain and intracellular tyrosine kinase domain. The RET protooncogene is one of the receptor tyrosine kinases, cell-surface molecules that transduce signals for cell growth and differentiation14. The RET can undergo oncogenic activation in vivo and in vitro by cytogenetic rearrangement14. The RET gene is expressed in a variety of neuronal cell lineages, including thyroid C cells and adrenal medulla15. In MEN2, the most frequent RET amino acid substitution is p.Val804Met (19.6%), followed by p.Cys634Arg (13.6%)4. Whereas in MEN2A, codon 634 is most frequently affected (85% of cases), with the p.Cys634Arg substitution being the most frequent change16. These “gain of function” mutations result in receptor dimerization and constitutive activation, 29 ultimately giving rise to MEN2A16. Identification of p.Cys634Arg mutation in the studied family further supported the clinical diagnosis of MEN2A, since this change has never been found in FMTC, in which the mutations are more evenly distributed among the various codons17. Codon 634 is located on the extra-cellular domain of the RET gene and this codon is highly liable to produce mutations, including p.Cys634Arg, p.Cys634Tyr and p.Cys634Trp18. It appears that RET p.Cys634Arg is a hot spot of mutation, since it occurs independently in different families from widely separated geographic areas and shows different haplotype associations1. A strong genotype-phenotype correlation has been reported in the MEN2 syndromes with Cys634 mutations, mainly relating to the MEN 2A19. RET mutations can be stratified into three groups (levels 1 to 3) based on the biological aggressiveness of MTC observed in patients with these mutations. Codon 634 mutations are considered high risk and it may develop MTC even starting from the age of one year. Lymph node metastasis from the first decade and distant metastases generally start from the third decade19. Current guidelines for the treatment of patients with level two, high-risk group mutations recommend prophylactic total thyroidectomy before the age of five years19. In our study, the proband and her sister showed neck metastases, which was consistent with p.Cys634Arg patients presenting significantly more distant metastases at diagnosis than those with the p.Cys634Tyr or p.Cys634Trp mutation, suggesting amino acid exchanges at codon 634 might have a direct impact on tumor aggressiveness in MEN2A syndrome20. A 36-yr male patient (II:7) of the studied family complied with bilateral pheochromocytoma. MEN2A represents a more aggressive form of MTC and has a corresponding younger age at onset compared to FMTC21. Our study not only identified the hereditary nature of the disease in the index cases of this MEN2A family, but also found a family member (II:7) harboring the p.Cys634Tyr mutation who was unaware of his condition. The establishment of a protocol for molecular analysis of this MEN2A family provided us the opportunity to carry out prophylactic thyroidectomy. MTC is usually a slow growing tumor with indolent clinical course, with the overall 10-yrs survival reported to be around 50%22,23. The relatively low aggressiveness of many 30 INDIAN J. BIOCHEM. BIOPHYS., VOL. 50, FEBRUARY 2013 of these MEN2A forms might explain the existence of asymptomatic carriers and the unaware members who were affected. Since the mid-1990s, genetic testing was employed on MEN2A and total thyroidectomy could completely avoid an otherwise lethal malignancy3,14. However, patients in our studied family were discovered much later when the MTC clinically manifested, thus impairing the possibility of successful treatment. In our study, the natural clinical manifestations and course of MEN2 were evident. As a result, the 5 patients with MEN2A had not undergone prophylactic thyroidectomy before the clinical features observed, a procedure strongly recommended by the international MEN2 consortium. The p.Cys634Arg carriers with clinical phenotype presented with cervical neck mass as the initial symptom in our study. However, the asymptomatic carrier (II:7) refused total thyroidectomy, which may reflect the conservative view in Chinese people and insufficient attention to the syndrome. No RET genetic variants appear to carry the same risk. However, the quantification of specific risk of RET-related genetic variants appears to be codonspecific. Codon 634 mutations have the highest transforming activity and correlate strongly with the onset of MEN220. In our studied family, the same p.Cys634Arg mutation from the same hereditary background had caused different clinical phenotypes, including clinical onset age, severity of disease and comorbidities, which was consistent with the previous study20. In conclusion, this study not only identified the hereditary nature of the MEN2A in the cases, but also discovered a family member harboring the same p.Cys634Arg mutation who was unaware of his condition. These findings may provide new insights into the cause and diagnosis of MEN2A and have implications for genetic counselling. Acknowledgements This work was supported by grants from the National Natural Science Foundation of China (81271921; 81101339); Research Foundation for the Doctoral Program of Higher Education of China (20110162110026); Science and Technology International cooperation Key project of Hunan Province, China (2011WK2011); Sheng Hua Scholars Program of Central South University, China (H.D.); Construction Foundation for Key Subjects of the Third Xiangya Hospital, Central South University, China. References 1 Romei C, Cosci B, Renzini G, Bottici V, Molinaro E, Agate L, Passannanti P, Viola D, Biagini A, Basolo F, Ugolini C, Materazzi G, Pinchera A, Vitti P & Elisei R (2011) Clin Endocrinol (Oxf) 74, 241-247 2 Elisei R, Romei C, Cosci B, Agate L, Bottici V, Molinaro E, Sculli M, Miccoli P, Basolo F, Grasso L, Pacini F & Pinchera A (2007) J Clin Endocrinol Metab 92, 4725-4729 3 Qi X P, Ma J M, Du Z F, Ying R B, Fei J, Jin H Y, Han J S, Wang J Q, Chen X L, Chen C Y, Liu W T, Lu J J, Zhang J G & Zhang X N (2011) PLoS One 6, e20353 4 Gimm O, Greco A, Hoang-Vu C, Dralle H, Pierotti M A & Eng C (1999) J Clin Endocrinol Metab 84, 2784-2787 5 American Thyroid Association Guidelines Task Force, Kloos R T, Eng C, Evans D B, Francis G L, Gagel R F, Gharib H, Moley J F, Pacini F, Ringel M D, Schlumberger M & Wells S A Jr (2009) Thyroid 19, 565-612 6 DeLellis R A, Lloyd R V & Heitz P U (2004) Pathology and genetics of tumours of endocrine organs, IARC Press, Lyon 7 Shaffer L G, Slovak M L & Campbell L J (2009) An International System for Human Cytogenetic Nomenclature: Recommendations of the International Standing Committee on Human Cytogenetic Nomenclature, Karger, Basel 8 Guo Y, Deng X, Zheng W, Xu H, Song Z, Liang H, Lei J, Jiang X, Luo Z & Deng H (2011) Neurosci Lett 501, 185-187 9 Marsh D J, Robinson B G, Andrew S, Richardson A L, Pojer R, Schnitzler M, Mulligan L M & Hyland V J (1994) Genomics 23, 477-479 10 Lemos M C, Carrilho F, Rodrigues F J, Santos P, Carvalheiro M, Ruas M A & Regateiro F J (2002) Endocr Pract 8, 19-22 11 Tsui C, Coleman L E, Griffith J L, Bennett E A, Goodson S G, Scott J D, Pittard W S & Devine S E (2003) Nucleic Acids Res 31, 4910-4916 12 Cozza A, Morandin F, Galfre S G, Mariotti V, Marangoni R & Pellegrini S (2007) BMC Genomics 8, 10 13 Abu-Amero K K, Alzahrani A S, Zou M & Shi Y (2006) Oncogene 25, 677-684 14 Grieco M, Santoro M, Berlingieri M T, Melillo R M, Donghi R, Bongarzone I, Pierotti M A, Della Porta G, Fusco A & Vecchio G (1990) Cell 60, 557-563 15 Romei C, Mariotti S, Fugazzola L, Taccaliti A, Pacini F, Opocher G, Mian C, Castellano M, degli Uberti E, Ceccherini I, Cremonini N, Seregni E, Orlandi F, Ferolla P, Puxeddu E, Giorgino F, Colao A, Loli P, Bondi F, Cosci B, Bottici V, Cappai A, Pinna G, Persani L, Verga U, Boscaro M, Castagna M G, Cappelli C, Zatelli MC, Faggiano A & Francia G, Brandi ML, Falchetti A, Pinchera A & Elisei R (2010) Eur J Endocrinol 163, 301-308 16 Sakorafas G H, Friess H & Peros G (2008) Endocr Relat Cancer 15, 871-884 17 Pazaitou-Panayiotou K, Giatzakis C, Koutsodontis G, Vratimos A, Chrisoulidou A, Konstantinidis T & Kamakari S (2010) Thyroid 20, 401-406 18 Patocs A, Klein I, Szilvasi A, Gergics P, Toth M, Valkusz Z, Forizs E, Igaz P, Al-Farhat Y, Tordai A, Varadi A, Racz K & Esik O (2006) Wien Klin Wochenschr 118, 417-421 GUO et al: GENETIC ANALYSIS OF A CHINESE HAN FAMILY WITH MEN2A 19 Jung J, Uchino S, Lee Y & Park H (2010) J Korean Med Sci 25, 226-229 20 Puñales M K, Graf H, Gross J L & Maia A L (2003) J Clin Endocrinol Metab 88, 2644-2649 21 Mulligan L M, Kwok J B, Healey C S, Elsdon M J, Eng C, Gardner E, Love D R, Mole S E, Moore J K, Papi L, 31 Ponder M A, Telenius H, Tunnacliffe A & Ponder B A (1993) Nature 363, 458-460 22 Bergholm U, Bergström R & Ekbom A (1997) Cancer 79, 132-138 23 Gülben K, Berberoğlu U & Boyabatli M (2006) World J Surg 30, 84-90