Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Edited by David A. Phoenix, Frederick Harris, and Sarah R. Dennison Novel Antimicrobial Agents and Strategies Related Titles Gualerzi, C.O., Brandi, L., Fabbretti, A., Pon, C.L. (eds.) Antibiotics Skold, O. Antibiotics and Antibiotic Resistance Targets, Mechanisms and Resistance 2011 2013 Print ISBN: 978-3-527-33305-9, also available in digital formats Print ISBN: 978-0-470-43850-3, also available in digital formats Chen, L., Petersen, J., Schlagenhauf, P. (eds.) Phoenix, D. A., Dennison, S. R., Harris, F. Antimicrobial Peptides Infectious Diseases - A Geographic Guide 2013 2011 Print ISBN: 978-3-527-33263-2, also available in digital formats Anderson, R.R., Groundwater, P.P., Todd, A.A., Worsley, A.A. Antibacterial Agents Chemistry, Mode of Action, Mechanisms of Resistance and Clinical Applications 2012 Print ISBN: 978-0-470-97244-1, also available in digital formats Print ISBN: 978-0-470-65529-0, also available in digital formats De Clercq, E. (ed.) Antiviral Drug Strategies 2011 Print ISBN: 978-3-527-32696-9, also available in digital formats Edited by David A. Phoenix, Frederick Harris, and Sarah R. Dennison Novel Antimicrobial Agents and Strategies The Editors Prof. David A. Phoenix London South Bank University Borough Road 103 London SE1 0AA United Kingdom All books published by Wiley-VCH are carefully produced. Nevertheless, authors, editors, and publisher do not warrant the information contained in these books, including this book, to be free of errors. Readers are advised to keep in mind that statements, data, illustrations, procedural details or other items may inadvertently be inaccurate. Dr. Frederick Harris University of Central Lancashire Forensic & Investigative Science Preston, Lancashire PR1 2HE United Kingdom Library of Congress Card No.: applied for British Library Cataloguing-in-Publication Data A catalogue record for this book is available from the British Library. Dr. Sarah R. Dennison University of Central Lancashire Pharmacy and Biomedical Science Preston, Lancashire PR1 2HE United Kingdom Bibliographic information published by the Deutsche Nationalbibliothek The Deutsche Nationalbibliothek lists this publication in the Deutsche Nationalbibliografie; detailed bibliographic data are available on the Internet at <http://dnb.d-nb.de>. Cover design The cover shows beta-lactamase, an enzyme produced by some bacteria, which provide bacterial resistance to beta-lactam antibiotics in the presence of a lipid bilayer. The image was created by Dr. Manuela Mura, University of Central Lancashire, UK. © 2015 Wiley-VCH Verlag Gmbh & Co. KGaA, Boschstr. 12, 69469 Weinheim, Germany All rights reserved (including those of translation into other languages). No part of this book may be reproduced in any form – by photoprinting, microfilm, or any other means – nor transmitted or translated into a machine language without written permission from the publishers. Registered names, trademarks, etc. used in this book, even when not specifically marked as such, are not to be considered unprotected by law. Print ISBN: 978-3-527-33638-8 ePDF ISBN: 978-3-527-67614-9 ePub ISBN: 978-3-527-67615-6 Mobi ISBN: 978-3-527-67616-3 oBook ISBN: 978-3-527-67613-2 Cover-Design Adam-Design, Weinheim, Germany Typesetting Laserwords Private Limited, Chennai, India Printing and Binding Markono Print Media Pte Ltd, Singapore Printed on acid-free paper V Contents List of Contributors XI Preface XVII 1 1 The Problem of Microbial Drug Resistance Iza Radecka, Claire Martin, and David Hill 1.1 1.2 Introduction 1 History of the Origins, Development, and Use of Conventional Antibiotics 1 Problems of Antibiotic Resistance 4 Multiple Drug-Resistant (MDR), Extensively Drug-Resistant (XDR), and Pan-Drug-Resistant (PDR) Organisms 5 MDR Mechanisms of Major Pathogens 5 Antimicrobial Stewardship Programs 11 Discussion 12 Acknowledgment 13 References 13 1.3 1.4 1.5 1.6 1.7 2 Conventional Antibiotics – Revitalized by New Agents 17 Anthony Coates and Yanmin Hu 2.1 2.2 2.3 2.4 Introduction 17 Conventional Antibiotics 18 The Principles of Combination Antibiotic Therapy 20 Antibiotic Resistance Breakers: Revitalize Conventional Antibiotics 21 β-Lactamase Inhibitors 21 Aminoglycoside-Modifying Enzyme Inhibitors 23 Antibiotic Efflux Pumps Inhibitors 23 Synergy Associated with Bacterial Membrane Permeators 23 Discussion 25 Acknowledgments 26 References 26 2.4.1 2.4.2 2.4.3 2.4.4 2.5 VI Contents 3 Developing Novel Bacterial Targets: Carbonic Anhydrases as Antibacterial Drug Targets 31 Clemente Capasso and Claudiu T. Supuran 3.1 3.2 3.3 3.4 3.5 3.6 3.7 3.8 3.9 Introduction 31 Carbonic Anhydrases 31 CA Inhibitors 32 Classes of CAs Present in Bacteria 33 Pathogenic Bacterial CAs 35 α-CAs in Pathogenic Bacteria 35 β-CAs in Pathogenic Bacteria 37 γ-CAs from Pathogenic Bacteria 39 Conclusions 40 References 41 4 Magainins – A Model for Development of Eukaryotic Antimicrobial Peptides (AMPs) 47 Sarah R. Dennison, Frederick Harris, and David A. Phoenix 4.1 4.2 4.3 4.4 4.5 Introduction 47 Magainins and Their Antimicrobial Action 49 Magainins as Antibiotics 51 Other Antimicrobial Uses of Magainins 55 Future Prospects for Magainins 57 References 58 5 Antimicrobial Peptides from Prokaryotes 71 Maryam Hassan, Morten Kjos, Ingolf F. Nes, Dzung B. Diep, and Farzaneh Lotfipour 5.1 5.2 5.2.1 5.2.2 Introduction 71 Bacteriocins 73 Microcins – Peptide Bacteriocins from Gram-Negative Bacteria Lanthibiotics – Post-translationally Modified Peptides from Gram-Positive Bacteria 76 Non-modified Peptides from Gram-Positive Bacteria 77 Applications of Prokaryotic AMPs 79 Food Biopreservation 79 Bacteriocinogenic Probiotics 80 Clinical Application 81 Applications in Dental Care 82 Development and Discovery of Novel AMP 82 References 84 5.2.3 5.3 5.3.1 5.3.2 5.3.3 5.3.4 5.4 6 Peptidomimetics as Antimicrobial Agents Peng Teng, Haifan Wu, and Jianfeng Cai 6.1 6.2 Introduction 91 Antimicrobial Peptidomimetics 93 91 73 Contents 6.2.1 6.2.2 6.2.3 6.2.4 6.2.5 6.2.6 6.2.6.1 6.2.6.2 6.3 Peptoids 93 β-Peptides 94 Arylamides 96 β-Peptoid–Peptide Hybrid Oligomers 97 Oligourea and γ4 -Peptide-Based Oligomers 98 AApeptides 98 α-AApeptides 99 γ-AApeptides 101 Discussion 102 Acknowledgments 103 References 103 7 Synthetic Biology and Therapies for Infectious Diseases 109 Hiroki Ando, Robert Citorik, Sara Cleto, Sebastien Lemire, Mark Mimee, and Timothy Lu 7.1 7.2 7.3 7.3.1 7.3.2 7.4 7.4.1 7.4.2 7.4.3 7.4.4 7.5 7.5.1 7.5.2 7.5.3 7.6 7.7 7.7.1 7.7.2 7.7.2.1 7.7.2.2 7.7.2.3 7.7.2.4 7.7.2.5 Current Challenges in the Treatment of Infectious Diseases 109 Introduction to Synthetic Biology 112 Vaccinology 113 Genetic Engineering and Vaccine Development 114 Rational Antigen Design Through Reverse Vaccinology 119 Bacteriophages: A Re-emerging Solution? 122 A Brief History of Bacteriophages 122 Addressing the Problem of the Restricted Host Range of Phages 124 Phage Genome Engineering for Enhanced Therapeutics 129 Phages as Delivery Agents for Antibacterial Cargos 132 Isolated Phage Parts as Antimicrobials 133 Engineered Phage Lysins 133 Pyocins: Deadly Phage Tails 135 Untapped Reservoirs of Antibacterial Activity 136 Predatory Bacteria and Probiotic Bacterial Therapy 136 Natural Products Discovery and Engineering 139 In Silico and In Vitro Genome Mining for Natural Products 140 Strain Engineering for Natural Products 144 Production of the Antimalarial Artemisinin 145 Daptomycin (Cubicin) 147 Echinomycin 147 Clavulanic Acid 148 Production of the Antiparasitic Avermectin and Its Analogs Doramectin and Ivermectin 149 Production of Doxorubicin/Daunorubicin 149 Development of Hosts for the Expression of Nonribosomal Peptides and Polyketides 150 Generation of Novel Molecules by Rational Reprogramming 152 Engineering NRPS and PKS Domains 154 Activation of Cryptic Genes/Clusters 155 7.7.2.6 7.7.2.7 7.7.3 7.7.4 7.7.5 VII VIII Contents 7.7.6 7.8 Mutasynthesis as a Source of Novel Analogs 157 Summary 157 Acknowledgments 157 References 158 8 Nano-Antimicrobials Based on Metals 181 Maria Chiara Sportelli, Rosaria Anna Picca, and Nicola Cioffi 8.1 8.2 8.2.1 8.2.1.1 8.2.1.2 8.2.1.3 8.2.1.4 8.2.1.5 8.2.2 8.2.3 8.2.3.1 8.3 8.3.1 Introduction 181 Silver Nano-antimicrobials 182 Synthesis of Silver Nanostructures 182 Physical Approaches 183 Laser Ablation in Liquids 183 Chemical Approaches 183 Biological and Biotechnological Approaches 184 Electrochemical Approaches 184 Characterization of Silver Nanostructures 185 Applications of Silver Nanostructures 187 Silver-Based Nano-antimicrobials 187 Copper Nano-antimicrobials 190 Preparation and Applications of Antimicrobial Cu Nanostructures 190 Physical Methods 190 Wet-Chemical Methods 192 Electrochemical Syntheses 195 Laser Ablation in Liquids 196 Biological Syntheses 197 Zinc Oxide Nano-antimicrobials 197 Synthesis of Zinc Oxide Nanostructures 197 Physical Approaches 198 Chemical Approaches 198 Electrochemical Approaches 200 Conclusions 201 References 201 8.3.1.1 8.3.1.2 8.3.1.3 8.3.1.4 8.3.1.5 8.4 8.4.1 8.4.1.1 8.4.1.2 8.4.1.3 8.5 9 Natural Products as Antimicrobial Agents – an Update 219 Muhammad Saleem 9.1 9.2 9.2.1 9.2.2 9.2.3 9.3 9.4 9.5 9.6 Introduction 219 Antimicrobial Natural Products from Plants 220 Antimicrobial Alkaloids from Plants 220 Antimicrobial Alkaloids from Microbial Sources 223 Antimicrobial Alkaloids from Marine Sources 225 Antimicrobial Natural Products Bearing an Acetylene Function Antimicrobial Carbohydrates 228 Antimicrobial Natural Chromenes 228 Antimicrobial Natural Coumarins 229 226 Contents 9.6.1 9.6.1.1 9.7 9.7.1 9.8 9.8.1 9.9 9.9.1 9.10 9.10.1 9.10.2 9.10.3 9.11 9.12 9.12.1 9.12.2 9.12.2.1 9.12.2.2 9.12.2.3 9.12.3 9.13 9.13.1 9.13.2 9.14 9.14.1 9.14.2 9.14.3 9.15 9.15.1 9.15.2 9.15.3 9.16 Antimicrobial Coumarins from Plants 229 Antimicrobial Coumarins from Bacteria 232 Antimicrobial Flavonoids 232 Antimicrobial Flavonoids from Plants 233 Antimicrobial Iridoids 237 Antimicrobial Iridoids from Plants 237 Antimicrobial Lignans 238 Antimicrobial Lignans from Plants 238 Antimicrobial Phenolics Other Than Flavonoids and Lignans 240 Antimicrobial Phenolics from Plants 240 Antimicrobial Phenolics from Microbial Sources 244 Antimicrobial Phenolics from Marine Source 246 Antimicrobial Polypeptides 247 Antimicrobial Polyketides 249 Antimicrobial Polyketides as Macrolides 250 Antimicrobial Polyketides as Quinones and Xanthones 252 Antimicrobial Quinones and Xanthones from Plants 252 Antimicrobial Quinones from Bacteria 256 Antimicrobial Quinones and Xanthones from Fungi 257 Antimicrobial Fatty Acids and Other polyketides 261 Antimicrobial Steroids 263 Antimicrobial Steroids from Plants 264 Steroids from Fungi 266 Antimicrobial Terpenoids 267 Antimicrobial Terpenoids from Plants 267 Antimicrobial Terpenoids from Microbial Sources 273 Antimicrobial Terpenoids from Marine Sources 274 Miscellaneous Antimicrobial Compounds 275 Miscellaneous Antimicrobial Natural Products from Plants 275 Miscellaneous Antimicrobials from Bacteria 278 Miscellaneous Antimicrobials from Fungi 280 Platensimycin Family as Antibacterial Natural Products 282 References 284 10 Photodynamic Antimicrobial Chemotherapy 295 David A. Phoenix, Sarah R. Dennison, and Frederick Harris 10.1 10.2 10.3 10.4 10.4.1 10.4.2 10.5 Introduction 295 The Administration and Photoactivation of PS 296 Applications of PACT Based on MB 301 The Applications of PACT Based on ALA 303 Food Decontamination Using PACT Based on ALA 303 Dermatology Using PACT Based on ALA 305 Future Prospects 308 References 310 IX X Contents 11 The Antimicrobial Effects of Ultrasound 331 Frederick Harris, Sarah R. Dennison, and David A. Phoenix 11.1 11.2 11.3 11.3.1 11.3.2 11.4 Introduction 331 The Antimicrobial Activity of Ultrasound Alone 332 The Antimicrobial Activity of Assisted Ultrasound 335 Synergistic Effects 336 Sonosensitizers 338 Future Prospects 341 References 343 12 Antimicrobial Therapy Based on Antisense Agents 357 Glenda M. Beaman, Sarah R. Dennison, and David A. Phoenix 12.1 12.2 12.3 12.4 12.5 12.6 12.7 12.8 12.9 12.10 12.10.1 12.10.2 12.11 Introduction 357 Antisense Oligonucleotides 358 First-Generation ASOs 360 Second-Generation ASOs 361 Third-Generation ASOs 362 Antisense Antibacterials 364 Broad-Spectrum Antisense Antibacterials 365 Methicillin-Resistant Staphylococcus aureus (MRSA) 371 RNA Interference (RNAi) 371 Progress Using siRNA 374 Mycobacterium Tuberculosis 374 MRSA 375 Discussion 376 References 377 13 New Delivery Systems – Liposomes for Pulmonary Delivery of Antibacterial Drugs 387 Abdelbary M.A. Elhissi, Sarah R. Dennison, Waqar Ahmed, Kevin M.G. Taylor and David A. Phoenix 13.1 13.2 13.3 13.3.1 13.3.1.1 13.3.1.2 13.3.1.3 13.4 Introduction 387 Pulmonary Drug Delivery 389 Liposomes as Drug Carriers in Pulmonary Delivery 389 Liposomes for Pulmonary Delivery of Antibacterial Drugs 390 Delivery of Antibacterial Liposomes Using pMDIs 391 Delivery of Antibacterial Liposomes Using DPIs 392 Delivery of Antibacterial Liposomes Using Nebulizers 394 Present and Future Trends of Liposome Research in Pulmonary Drug Delivery 398 Conclusions 401 References 401 13.5 Index 407 XI List of Contributors Waqar Ahmed Glenda M. Beaman University of Central Lancashire Institute of Nanotechnology and Bioengineering School of Medicine and Dentistry Corporation street Preston PR1 2HE UK University of Central Lancashire School of Forensic and Investigative Sciences Corporation Street Preston PR1 2HE UK Hiroki Ando Department of Electrical Engineering and Computer Science and Department of Biological Engineering Massachusetts Institute of Technology 77 Massachusetts Avenue Cambridge, MA 02139 USA Jianfeng Cai University of South Florida Department of Chemistry 4202 E. Fowler Avenue Tampa, FL 33620 USA Clemente Capasso Istituto di Biochimica delle Proteine-CNR via Pietro Castellino 111 - 80131 Napoli Italy and and Massachusetts Institute of Technology MIT Synthetic Biology Center 500 Technology Square Cambridge, MA 02139 USA Istituto di Bioscienze e Biorisorse-CNR via Pietro Castellino 111 - 80131 Napoli Italy XII List of Contributors Nicola Cioffi Sara Cleto Università degli Studi di Bari Aldo Moro Dipartimento di Chimica via Orabona 4 70126 Bari Italy Department of Electrical Engineering and Computer Science and Department of Biological Engineering Massachusetts Institute of Technology 77 Massachusetts Avenue Cambridge, MA 02139 USA Robert Citorik Department of Electrical Engineering and Computer Science and Department of Biological Engineering Massachusetts Institute of Technology 77 Massachusetts Avenue Cambridge, MA 02139 USA and Massachusetts Institute of Technology MIT Synthetic Biology Center 500 Technology Square Cambridge, MA 02139 USA and Anthony Coates Massachusetts Institute of Technology MIT Synthetic Biology Center 500 Technology Square Cambridge, MA 02139 USA and Massachusetts Institute of Technology MIT Microbiology Program 77 Massachusetts Avenue Cambridge, MA 02139 USA St George’s University of London Medical Microbiology Institute of Infection and Immunity Cranmer Terrace London SW17 0RE UK Sarah R. Dennison University of Central Lancashire Institute of Nanotechnology and Bioengineering School of Pharmacy and Biomedical Sciences Corporation Street Preston PR1 2HE UK List of Contributors Dzung B. Diep David Hill Norwegian University of Life Sciences Laboratory of Microbial Gene Technology Department of Chemistry Biotechnology and Food Science P.O. Box 5003 1432 Ås Norway University of Wolverhampton School of Biology, Chemistry, and Forensic Science Faculty of Science and Engineering Wulfruna Street Wolverhampton WV1 1LY UK Abdelbary M.A. Elhissi Yanmin Hu University of Central Lancashire Institute of Nanotechnology and Bioengineering School of Pharmacy and Biomedical Sciences Corporation street Preston PR1 2HE UK St George’s University of London Medical Microbiology Institute of Infection and Immunity Cranmer Terrace London SW17 0RE UK Morten Kjos Frederick Harris University of Central Lancashire School of Forensic and Investigative Science Corporation street Preston PR1 2HE UK Norwegian University of Life Sciences Laboratory of Microbial Gene Technology Department of Chemistry Biotechnology and Food Science P.O. Box 5003 1432 Ås Norway Maryam Hassan Zanjan University of Medical Sciences Pharmaceutical Biotechnology Research Center Zanjan Iran and University of Groningen Molecular Genetics Group Groningen Biomolecular Sciences and Biotechnology Institute Centre for Synthetic Biology Nijenborgh 7 9747 AG Groningen The Netherlands XIII XIV List of Contributors Sebastien Lemire Timothy Lu Department of Electrical Engineering and Computer Science and Department of Biological Engineering Massachusetts Institute of Technology 77 Massachusetts Avenue Cambridge, MA 02139 USA Department of Electrical Engineering and Computer Science and Department of Biological Engineering Massachusetts Institute of Technology 77 Massachusetts Avenue Cambridge, MA 02139 USA and and Massachusetts Institute of Technology MIT Synthetic Biology Center 500 Technology Square Cambridge, MA 02139 USA Massachusetts Institute of Technology MIT Synthetic Biology Center 500 Technology Square Cambridge, MA 02139 USA Farzaneh Lotfipour and Tabriz University of Medical Sciences Hematology & Oncology Research Center and Faculty of Pharmacy Tabriz 51664 Iran Massachusetts Institute of Technology MIT Microbiology Program 77 Massachusetts Avenue Cambridge, MA 02139 USA Claire Martin University of Wolverhampton School of Pharmacy Faculty of Science and Engineering Wulfruna Street Wolverhampton WV1 1LY UK List of Contributors Mark Mimee David A. Phoenix Department of Electrical Engineering and Computer Science and Department of Biological Engineering Massachusetts Institute of Technology 77 Massachusetts Avenue Cambridge, MA 02139 USA London South Bank University Office of the Vice Chancellor 103 Borough Road London SE1 0AA UK and Massachusetts Institute of Technology MIT Synthetic Biology Center 500 Technology Square Cambridge, MA 02139 USA and Massachusetts Institute of Technology MIT Microbiology Program 77 Massachusetts Avenue Cambridge, MA 02139 USA Ingolf F. Nes Norwegian University of Life Sciences Laboratory of Microbial Gene Technology Department of Chemistry Biotechnology and Food Science P.O. Box 5003 1432 Ås Norway Rosaria Anna Picca Università degli Studi di Bari Aldo Moro Dipartimento di Chimica via Orabona 4 70126 Bari Italy Iza Radecka University of Wolverhampton School of Biology Chemistry and Forensic Science Faculty of Science and Engineering Wulfruna Street Wolverhampton WV1 1LY UK Muhammad Saleem The Islamia University of Bahawalpur Department of Chemistry Baghdad-ul-Jadeed Campus Bahawalpur, 63100 Pakistan XV XVI List of Contributors Maria Chiara Sportelli Kevin M.G. Taylor Università degli Studi di Bari Aldo Moro Dipartimento di Chimica via Orabona 4 70126 Bari Italy University College London Department of Pharmaceutics School of Pharmacy 29-39 Brunswick Square London WC1N 1AX UK Claudiu T. Supuran Università degli Studi di Firenze Dipartimento di Scienze Farmaceutiche Via della Lastruccia 3, Polo Scientifico 50019 Sesto Fiorentino (Florence) Italy and and Peng Teng Sezione di Scienze Farmaceutiche e Nutraceutiche, Neurofarba Department Università degli Studi di Firenze Via Ugo Schiff 6 50019 Sesto Fiorentino (Florence) Italy Department of Pharmaceutics UCL School of Pharmacy 29-39 Brunswick Square London WC1N 1AX UK University of South Florida Department of Chemistry 4202 E. Fowler Avenue Tampa, FL 33620 USA Haifan Wu University of South Florida Department of Chemistry 4202 E. Fowler Avenue Tampa, FL 33620 USA XVII Preface The “Golden age of antibiotics” was between 1929 and the 1970s when over 20 antibiotic classes were marketed [1, 2]. Since the 1960s, the rise in the emergence of microbial pathogens with multiple drug resistance (MDR) has led to the realization that the “Golden age” had ended. The pharmaceutical industry has been constantly battling with MDR because of the overprescription and misuse of antibiotics [3–5]. In Chapter 1, Radecka and coworkers give an insight into bacterial resistance being a major threat to public health. They also discuss the implications arising from the threat posed by MDR pathogens in relation to factors such as medical practice and economics, along with an overview of recent practices and measures proposed to contain this threat, such as the introduction of stewardship programs. Concern regarding our future ability to combat infection has been further intensified by the decreasing supply of new agents [3, 6–8], and in the remainder of the book we review approaches being taken to identity and develop the antimicrobials of the future. In response to the challenges outlined, in this book there has been increasing research into maximizing opportunities to develop and revitalize established classes of antibiotics. Coates and Hu consider this area in Chapter 2 where they look at opportunities to extend the life of old antibiotics such as β-lactams by the addition of agents that can overcome drug resistance factors, such as β-lactamase inhibitors. Identification of new, effective derivatives remains a challenge, and another approach in the search for new antibiotics has been to seek out new targets that would enable new classes of antibacterials to be developed. In Chapter 3, Capasso and Supuran review the cloning and characterization of carbonic anhydrases (CAs). In this chapter, they make reference to the impact of inhibitors that target the α-, β-, and γ-CAs from many pathogenic bacteria and suggest that this provides evidence that these proteins could provide novel antibacterial targets for the development of new antimicrobial compounds. There remain concerns, though, that only a small number of drugs are currently under research and development as antibacterial agents [9]. It has been suggested that a further approach could be to revisit naturally occurring compounds with antibacterial potential. Due to the arrival of antibiotics, there has been a rapid loss of interest in the therapeutic potential of natural host antibiotics such as XVIII Preface lysozyme [3, 4]. However, more recently, there has been an awakened interest in host defense molecules, such as antimicrobial peptides (AMPs) [10, 11]. Since the early 1990s, the potential of AMPs has been investigated using, for example, magainins isolated from the African clawed frog Xenopus laevis, to investigate the effect of the structural and physiochemical properties of these peptides on their antimicrobial action. These AMPs have the potency to target and kill a wide range of Gram-negative and Gram-positive bacteria, fungi, viruses, and some tumor cells [12]. Based on this ability, AMPs are attractive propositions for development as therapeutically useful antimicrobial and anticancer agents [13]. The first clinical trials of these AMPs as potential novel antibiotics have been for topical treatments [14], and Dennison et al. review this area in Chapter 4. AMPs are not only produced by eukaryotes but are also generated by prokaryotes, and Lotfipour and coworkers review this class of peptides, generally known as bacteriocins, in Chapter 5. These prokaryotic peptides are produced by geneencoded or ribosome-independent pathways [15]. Non-ribosomal prokaryotic AMPs generally include examples such as vancomycin and daptomycin, which are assembled by large multifunctional enzyme complexes. Gene-encoded AMPs from prokaryotes include microcins from Gram-negative bacteria, lantibiotics, and nonmodified bacteriocins from Gram-positive bacteria. The potential uses of these molecules are reviewed for their potential in food biopreservation and healthcare. However, both eukaryotic and prokaryotic AMPs have a range of challenges to overcome, such as the cost of production and design complexity of these molecules. For this reason, work has been under way to design mimics and peptidomimetics of these peptides, which is reviewed in Chapter 6 by Cai and coworkers. Major examples of these molecules include : peptoids [16], β-peptides [17], arylamide oligomers [18], AApeptides [19, 20], and other compounds [21–25], which may be considered second-generation AMPs. These molecules are designed to possess properties conducive to therapeutic application and retain key structural characteristics of naturally occurring AMPs, such as positive charge, hydrophobicity, and amphiphilicity, which facilitate their membranolytic and antimicrobial activity. Tuning these properties has led to superior levels of microbial selectivity and antimicrobial activity as compared to both natural AMPs and conventional antibiotics. This Chapter considers the recent development of these synthetic mimics of AMPs based on a variety of peptide backbones other than canonical peptides, including β-peptides, peptoids, and AApeptides. It is interesting to note that, in addition to direct action, AMPs are part of more complex innate immune systems and a further approach to developing treatments for the future has involved review of how aspects of such immune systems could be adapted to support treatment of infections. Prior to the discovery and widespread use of antibiotics, it was believed that bacterial infections could be treated by the administration of bacteriophages, which are viruses that infect and kill bacteria via lytic mechanisms but have no effect on humans. With the advent of penicillins and other antibiotics, clinical studies with bacteriophages were not vigorously pursued in the United States and Western Europe, but phage therapy was extensively used in Eastern European countries mainly in the former Soviet Union and Georgia. Preface However, with the current rise of antibiotic-resistant bacteria, there has been a revitalization of interest in phage therapy in Western countries. In Chapter 7, Lu and coworkers discuss the use of synthetic biology and whether bacteriophages are a re-emerging solution to the current problem of pathogenic microbes. Bacteriophage therapy has a number of potential advantages over the use of conventional antibiotics, such as high bacterial specificity and efficacy against bacteria with MDR, although there are concerns over its use, such as the possibility of inducing immunological responses. Nonetheless, phage therapy is generally regarded as one of the most promising strategies to provide antimicrobial alternatives for fighting antibiotic-resistant bacteria and could lead to the development of new and improved therapies and diagnostics to combat infectious threats of the present and the future. In addition to the above approaches, there is a wide range of additional natural compounds that have the potential in the treatment of infection. The antimicrobial properties of metals such as copper and silver have been known for centuries especially in use for the treatment of burns and chronic wounds [26]. Recently, the confluence of nanotechnology and the search for new agents in the fight against microbes with MDR has brought metals in the form of nanoparticles to the fore as potential antimicrobial agents. In Chapter 8, Sportelli and coworkers present several examples of nanomaterials based on three of the main inorganic materials with known antimicrobial action (i.e., silver, copper, and zinc oxide) along with the mechanisms underlying their antimicrobial action. The potential applications of these nanoparticles as antimicrobials in areas such as prophylaxis and therapeutics, medical devices, the food industry, and textile fabrics are discussed in more detail. In addition, there are numerous examples of naturally produced organic compounds with antibacterial properties. In the period 2000–2008, over 300 natural metabolites with antimicrobial activity were reported, and in Chapter 9, Saleem reviews these compounds and describes candidates with potentially useful antimicrobial activity with reference to a variety of molecules, including : alkaloids, acetylenes, coumarins, iridoids, terpenoids, and xanthones. A range of organic compounds with the potential to serve as anti-infectives are those that are known to sequester within bacterial cells and can be light-activated to induce antimicrobial activity. For example, phenothiazinium-based molecules [27, 28], whose antimicrobial properties were first noted in dyes that were used for the histological staining of cellular components, have been shown to be more efficacious than conventional antibiotics [28, 29]. These dyes photoinactivate bacteria, viruses, yeasts, fungi, and protozoa via the production of reactive oxygen species (ROS) such as such as hydroxyl radicals and hydrogen peroxide. Over the last few decades, photosensitizers (PS) have attracted increasing attention as antimicrobial agents with therapeutic potential, and, when applied in this context, the use of PS is known as photodynamic antimicrobial chemotherapy (PACT). Phoenix co-workers provide an overview of the photophysics and photochemistry involved in PACT, and illustrate the therapeutic uses of this action with reference to a variety of PACT agents such as methylene blue and 5-aminolevulinic acid. Whilst this area has clear potential, there are also challenges that need to XIX XX Preface be overcome if the use of such compounds is to become more widespread. One such limitation is the challenge of ensuring effective light penetration of tissue and in this respect, it has been suggested that ultrasound could be used as part of a new antimicrobial strategy that addresses this limitation based on its superior capacity for tissue penetration. Ultrasound has been shown to have an antibacterial effect comparable to some conventional antibiotics as recently reported in the case of rhinosinusitis. It has also been shown that the application of ultrasound in conjunction with conventional antibiotics such as gentamycin is able to synergize the effects of these drugs when applied to both planktonic and sessile bacteria. More recently, it has been shown that irradiation with ultrasound can activate some PS, which are generally termed sonosensitizers (SS) in this capacity, and based on these observations it was hypothesized that ultrasound and SS may be exploited for the treatment of infectious diseases. This system has been designated sonodynamic antimicrobial chemotherapy (SACT) and most recently has been shown to be able to eradicate both Gram-positive and Gram-negative bacteria. In Chapter 11, Harris coworkers provides an overview of the impact of SACT. In considering approaches to combat growing drug resistance and to identify new means of treatment, the potential of oligonucleotides as antibacterial agents has been investigated. Such molecules are able to act as antisense agents to prevent translation, or, alternatively, can be designed to bind DNA to prevent gene transcription: these approaches are reviewed in Chapter 12 by Beaman coworkers. In this area, a range of new and exciting approaches are being developed. For example, it may be that such agents can inhibit microbial resistance mechanisms by interrupting the expression of resistance genes and hence restore susceptibility to key antibiotics, which would be co-administered with the antisense compound. Such an approach will clearly have significant applications. Finally, it is worth considering whether antibiotic efficacy can be increased by enhancing the targeting of such molecules to their site of action. In the final chapter, Ehlissi coworkers review an example of such an approach by looking at targeting via the development of antimicrobial agent carrier systems such as the use of nanoparticle constructs. Here, the authors discuss the development of nanostructures for the entrapment and delivery of antimicrobials as an alternative to the direct application of these substances. Specific reference is made to structures formed from liposomes and the effects of the carrier on the activity of the compound are discussed. In conclusion, it is clear that new approaches are needed if we are to maintain our ability to deal with infection. These approaches have to be holistic and integrated and must involve consideration of stewardship programs as well as the development of new antibiotics and novel approaches to enhancing activity through improved targeting or combination therapies. The need for the development of new antibiotics and antibacterial design strategies has never been greater. March 2014 David A. Phoenix, Frederick Harris, and Sarah R. Dennison Preface Reference 1. Coates, A.R., Halls, G., and Hu, Y. (2011) 12. Zasloff, M. (1987) Magainins, a class of 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. Novel classes of antibiotics or more of the same? Br. J. Pharmacol., 163, 184–194. Powers, J. H. (2004). Antimicrobial drug development – the past, the present, and the future. Clin. Microbiol. Infect., 10 (Suppl 4), 23–31. Boucher, H.W., Talbot, G.H., Bradley, J.S., Edwards, J.E. Jr., Gilbert, D., Rice, L.B., Scheld, M., Spellberg, B., and Bartlett, J. (2009) Bad bugs, no drugs: no ESKAPE! An update from the Infectious Diseases Society of America. Clin. Infect. Dis., 48, 1–12. Berger, R.E. (2011) Emergence of a new antibiotic resistance mechanism in India, Pakistan, and the UK: a molecular, biological, and epidemiological study editorial comment. J. Urol., 185, 154. Costelloe, C., Metcalfe, C., Lovering, A., Mant, D., and Hay, A.D. (2010) Effect of antibiotic prescribing in primary care on antimicrobial resistance in individual patients: systematic review and meta-analysis. Br. Med. J., 340. Overbye, K.M. and Barrett, J.F. (2005) Antibiotics: where did we go wrong? Drug Discov. Today, 10, 45–52. Projan, S.J. and Shlaes, D.M. (2004) Antibacterial drug discovery: is it all downhill from here? Clin. Microbiol. Infect., 10, 18–22. Morel, C.M. and Mossialos, E. (2010) Stoking the antibiotic pipeline. BMJ (Clinical research ed.), 340, c2115. Alvan, G., Edlund, C., and Heddini, A. (2011) The global need for effective antibiotics – a summary of plenary presentations. Drug Resist. Updat., 14, 70–76. Davies, J. (2006) Where have all the antibiotics gone? Can. J Infect. Dis. Med. Microbiol. (Journal canadien des maladies infectieuses et de la microbiologie medicale/AMMI Canada), 17, 287–290. Katz, M.L., Mueller, L.V., Polyakov, M., and Weinstock, S.F. (2006) Where have all the antibiotic patents gone? Nat. Biotechnol., 24, 1529–1531. 13. 14. 15. 16. 17. 18. 19. 20. 21. antimicrobial peptides from Xenopus skin: isolation, characterization of two active forms, and partial cDNA sequence of a precursor. Proc. Natl. Acad. Sci. U.S.A., 84, 5449–5453. Izadpanah, A. and Gallo, R.L. (2005) Antimicrobial peptides. J. Am. Acad. Dermatol., 52, 381–390; quiz 391-2. Zasloff, M. (2000) Reconstructing one of nature’s designs. Trends Pharmacol. Sci., 21, 236–238. Cotter, P.D., Ross, R.P., and Hill, C. (2013) Bacteriocins - a viable alternative to antibiotics? Nat. Rev. Microbiol., 11, 95–105. Chongsiriwatana, N.P., Patch, J.A., Czyzewski, A.M., Dohm, M.T., Ivankin, A., Gidalevitz, D., Zuckermann, R.N., and Barron, A.E. (2008) Peptoids that mimic the structure, function, and mechanism of helical antimicrobial peptides. Proc. Natl. Acad. Sci. U.S.A., 105, 2794–2799. Epand, R.F., Raguse, T.L., Gellman, S.H., and Epand, R.M. (2004) Antimicrobial 14-helical beta-peptides: potent bilayer disrupting agents. Biochemistry, 43, 9527–9535. Choi, S., Isaacs, A., Clements, D., Liu, D., Kim, H., Scott, R.W., Winkler, J.D., and DeGrado, W.F. (2009) De novo design and in vivo activity of conformationally restrained antimicrobial arylamide foldamers. Proc. Natl. Acad. Sci. U.S.A., 106, 6968–6973. Niu, Y., Wu, H., Li, Y., Hu, Y., Padhee, S., Li, Q., Cao, C., and Cai, J. (2013) AApeptides as a new class of antimicrobial agents. Org. Biomol. Chem., 11, 4283–4290. Niu, Y., Wang, R.E., Wu, H., and Cai, J. (2012) Recent development of small antimicrobial peptidomimetics. Future Med. Chem., 4, 1853–1862. Goodman, C.M., Choi, S., Shandler, S., and DeGrado, W.F. (2007) Foldamers as versatile frameworks for the design and evolution of function. Nat. Chem. Biol., 3, 252–262. XXI XXII Preface of antimicrobials. Biotechnol. Adv., 27, 76–83. Hancock, R.E. (2006) Antibacterial peptides for therapeutic use: obstacles and 27. Harris, F. and Phoenix, D.A. (2006) Light realistic outlook. Curr. Opin. Pharmacol., activated compounds as antimicrobial 6, 468–472. agents – patently obvious? Recent Pat. Hancock, R.E. and Sahl, H.G. (2006) Antiinfect. Drug Discov., 1, 181–199. Antimicrobial and host-defense peptides 28. Phoenix, D.A., Sayed, Z., Hussain, S., as new anti-infective therapeutic strateHarris, F., and Wainwright, M. (2003) gies. Nat. Biotechnol., 24, 1551–1557. The phototoxicity of phenothiazinium Gellman, S. (2009) Structure and funcderivatives against Escherichia coli and tion in peptidic foldamers. Biopolymers, Staphylococcus aureus. FEMS Immunol. 92, 293. Med. Microbiol., 39, 17–22. Wu, Y.D. and Gellman, S. (2008) Pep29. Phoenix, D.A. and Harris, F. (2003) tidomimetics. Acc. Chem. Res., 41, Phenothiazinium-based photosensitizers: 1231–1232. antibacterials of the future? Trends Mol. Rai, M., Yadav, A., and Gade, A. (2009) Med., 9, 283–285. Silver nanoparticles as a new generation 22. Marr, A.K., Gooderham, W.J., and 23. 24. 25. 26. 1 1 The Problem of Microbial Drug Resistance Iza Radecka, Claire Martin, and David Hill 1.1 Introduction Microbial colonization, where it is not wanted, can lead to disease, disability, and death. Therefore, control and/or destruction of pathogenic microorganisms is crucial for the prevention and treatment of disease. Modern medicine is dependent on antimicrobial/chemotherapeutic agents such as antibiotics (Greek anti, against, bios life). Antibiotics can either destroy pathogens or inhibit their growth and avoid damage to the host. In the nineteenth century, infections such as diarrhea, pneumonia, or post-surgical infections were the main causes of death. Therefore, the discovery of antibiotics was of great importance to society and impacted on the prevention and treatment of disease. Antibiotics can be defined as compounds produced by microorganisms that are effective against other microorganisms but nowadays also include microbial compounds that have been synthetically altered. The classification of antibiotics is based not only on the cellular components or systems they affect but also on whether they inhibit cell growth (bacteriostatic drug) or kill the cells (bactericidal drug) [1]. Other chemotherapeutic synthetic drugs, not originating from microbes, such as sulfonamides, are also sometimes called antibiotics [2]. 1.2 History of the Origins, Development, and Use of Conventional Antibiotics The modern era of antimicrobial agents began with the work of the German scientist Paul Ehrlich (1854–1915), who, together with a Japanese scientist Sahachiro Hata (1873–1938), discovered in 1909 the first sulfa drug called arsphenamine – initially known as compound “606” (the 606th compound tested). This new drug was available for treatment in 1910 under the trade name Salvarsan. Arsphenamine, considered as a “magic bullet” with selective toxicity, was used in the treatment of syphilis and sleeping sickness. Despite the fact that Novel Antimicrobial Agents and Strategies, First Edition. Edited by David A. Phoenix, Frederick Harris and Sarah R. Dennison. © 2015 Wiley-VCH Verlag GmbH & Co. KGaA. Published 2015 by Wiley-VCH Verlag GmbH & Co. KGaA. 2 1 The Problem of Microbial Drug Resistance the mode of action of arsphenamine remained unclear, it was the most popular antimicrobial drug successfully used until the 1940s [2, 3]. After Ehrlich’s success, many more compounds were tested for their possible antimicrobial properties. In the 1930s, Gerard Domagk (1895–1964) tested a number of leather, nontoxic (for animals) dyes for their antimicrobial activity. His work led to the discovery of Prontosil Red (1932), the first sulfa antimicrobial agent effective against pathogenic streptococci and staphylococci. This discovery was so important that in 1939 he received the Nobel Prize for its discovery. However, it was the discovery of the first antibiotic called penicillin that revolutionized the treatment of infectious diseases and initiated the new antibiotic era. Although penicillin was first discovered by a French medical student Ernest Duchesne in 1896, it was Alexander Fleming (1881–1955) who first observed the lethal/antimicrobial activity of the substance, which he later named penicillin, against Staphylococcus aureus. He reported (1928) the inhibition of the growth of pathogenic bacteria contaminated with Penicillium notatum spores. Fleming published several papers about penicillin production and began efforts to characterize penicillin. Unfortunately, he stopped his research with penicillin at this stage as he was not able to demonstrate the stability of penicillin within the body. In 1930, Fleming’s paper about penicillin produced by P. notatum was again an object of great interest to Professor Howard Florey (1898–1968) and his coworker Ernest Chain (1906–1979) who were investigating the antimicrobial properties of many substances including Fleming’s penicillin. Crude penicillin produced by P. notatum (Fleming’s strain) was purified and successfully tested against staphylococci and streptococci. In March 1942, the first adult patient was successfully treated with penicillin, which led to both scientists receiving the Nobel Prize in 1945. In 1943, a new strain of Penicillium chrysogenum was isolated from a moldy cantaloupe by Mary Hount from the Horthen Regional Research Laboratory, Illinois, US, and the mass production of penicillin began [3]. In 1944, Selman Waksman, after screening about 10 000 strains of soil bacteria and fungi, discovered a new antibiotic produced by Streptomyces griseus called streptomycin. For his success, he received the Nobel Prize in 1952. By 1953, production of chloramphenicol, neomycin, tobramycin, and tetracycline was also possible [2]. Cephalosporins are the second class of antibiotics following penicillins. In 1945, Giuseppe Brotzu (1895–1955) isolated Cephalosporium acremonium from sewage water in Sardina, Italy. Brotzu observed great antimicrobial activity against some Gram-negative bacteria. Unable to proceed with his research, Brotzu sent his cultures to Edward Abraham (Oxford University) who, together with Guy Newton, isolated cephalosporin P, active only against Gram-positive bacteria. Shortly after, cephalosporin N and cephalosporin C were discovered (paper published in 1961). Cephalosporin N was later identified to be penicillin N – active against both Gram-negative and Gram-positive bacteria. Modern antibiotics used today are, or derive from, natural molecules isolated during the “golden age” of antibiotic era (1940–1970) mostly from Streptomyces species, a few from Gram-positive Bacillus species, and some from strains of 1.2 History of the Origins, Development, and Use of Conventional Antibiotics 3 Table 1.1 Examples of natural, semi-synthetic and synthetic antibiotics and their mode of action [1, 3, 4, 6]. Group of antibiotics Mode of action Primary target Derivation Organisms β-lactams Inhibition of cell wall synthesis Inhibition of cell wall synthesis Inhibition of RNA synthesis Penicillin binding protein Peptidoglycan units RNA polymerase Natural and semi-synthetic Natural and semi-synthetic Natural and semi synthetic Gram-positive and Gram-negative bacteria Gram-positive bacteria Inhibition of cell wall synthesis Inhibition of protein synthesis Cell membrane Natural and semi synthetic Natural and semi synthetic Tetracyclines Inhibition of protein synthesis 30S ribosome Natural and semi synthetic Macrolides Inhibition of protein synthesis 50S ribosome Natural and semi synthetic Streptogramins Inhibition of protein synthesis 50S ribosome Natural and semi synthetic Phenicols Inhibition of protein synthesis 50S ribosome Natural and semi synthetic Trimethoprimsulfamethoxazole Inhibition of DNA Inhibition of synthesis synthesis of tetrahydrofolic acid Inhibition of DNA Topoisomerase II synthesis and IV Glycopeptides and glycolipopeptides Rifamycins Lipopeptides Aminoglycosides Fluoroquinolones 30S ribosome Synthetic Synthetic Gram-positive and Gram-negative bacteria, M. tuberculosis Gram-positive and Gram-negative bacteria Aerobic Gram-positive and Gram-negative bacteria, M. tuberculosis Aerobic Gram-positive and Gram-negative bacteria Aerobic and anaerobic Gram-positive and Gram-negative bacteria Aerobic and anaerobic Gram-positive and Gram-negative bacteria Some Gram-positive and Gram-negative bacteria Gram-positive and Gram-negative bacteria Aerobic Gram-positive and Gram-negative bacteria; some anaerobic Gram-negative bacteria and M. tuberculosis Penicillium and Cephalosporium [4, 5]. Most bactericidal antibiotics kill the cell by interfering with the essential cellular processes (Table 1.1). They inhibit DNA, RNA, cell wall, or protein synthesis [1, 3, 4, 6]. Interestingly, it was also Fleming who, in his Nobel lecture, stated that bacteria can develop resistance to penicillin if exposed to low doses and that negligent use could encourage resistance. Sadly, he was right, and soon after penicillin G was introduced to hospitals (1940s) the problem of antibiotic-resistant bacteria 4 1 The Problem of Microbial Drug Resistance emerged [7]. Only 3 years after his warning, 38% of S. aureus strains in only one London hospital were penicillin resistant. Currently, around 90% of strains in the United Kingdom and nearly all in the United States show penicillin resistance [8]. Antibiotic resistance (AR) is driven by the misuse of antibiotics due to selective pressure. Moreover, unprecedented human air travel allows bacterial mobile resistance genes to be transported between continents. So the fact that bacteria and their resistance genes can travel faster and further than ever before creates serious risk to human health and development on a global scale [9, 10]. At the moment, in Europe at least 25 000 patients die every year because of bacterial infections, which cannot be treated with the available antibiotics [11]. Therefore, the development of new antimicrobial drugs with new modes of action and the preservation of the agents “in hand” are essential steps for the foreseeable future [7]. Great efforts have also been made to understand the mechanisms by which currently available antibiotics affect microbial cells. Antibiotic-facilitated cell death is very complex and involves many genetic and biochemical pathways. It is essential to understand the multilayered mechanisms by which currently available antibiotics kill bacteria, and also create new alternative antimicrobial therapies [1]. 1.3 Problems of Antibiotic Resistance Unquestionably, the discovery of antibiotics was one of the most important medical achievements in modern medicine and their introduction represents a remarkable success story for society. However, the widespread use and misuse of antibiotics for both clinical and nonclinical settings has resulted in the emergence (selection) of a number of multiresistant bacteria called superbugs such as methicillin-resistant Staphylococcus aureus (MRSA), vancomycin-intermediate Staphylococcus aureus (VISA) [12], vancomycin-resistant Enterococcus spp., [10] carbapenem-resistant Mycobacterium tuberculosis [5], extended spectrum β-lactamase-producing Escherichia coli, or the highly virulent antibiotic-resistant Clostridium difficile [11, 13]. The emergence of antibiotic resistance in bacteria, selected by negligent antibiotic usage, provides the most dramatic demonstration of Darwinian selection as a result of a specific evolutionary pressure to adapt to the presence of antimicrobials [14]. It has been reported that the consumption of antimicrobials by food-producing animals around the world is also a powerful driver of antibiotic multidrug resistance (AMR) in both humans and animals [8]. These activities also clearly create an ongoing explosion of antibiotic-resistant infections generating a significant risk to public health on a global scale, as there are very few or sometimes no effective antimicrobial agents available to treat infections caused by both Gram-positive and Gram-negative pathogenic bacteria [15, 16]. The problem of ever-increasing bacterial multiresistance is even more alarming when we consider the diminishing number of new antimicrobials entering clinical practice [17, 18]. There is clearly an urgent need for the development of new antibiotics or new alternatives to conventional antimicrobial 1.5 MDR Mechanisms of Major Pathogens agents with novel mechanisms of antimicrobial action as even some common infections are becoming increasingly difficult to treat. It is also very important to stress that antimicrobial resistance is not only found in bacteria – that there is a growing number of other pathogens such as viruses (that cause chronic hepatitis B (CHB) or influenza), parasites (cause malaria), and fungi (Candida infections) resistant to the antimicrobial agents [6, 19, 20]. Resistance to all classes of antimalarial drugs has been well documented including artemisinin derivatives and chloroquine. Moreover, resistance rates (10–20%) to anti-HIV drug regimens have been reported in the United States and Europe. Many people around the world suffer because of antimicrobial resistance. 1.4 Multiple Drug-Resistant (MDR), Extensively Drug-Resistant (XDR), and Pan-Drug-Resistant (PDR) Organisms There are many definitions in the medical literature used to characterize different patterns of bacterial multiresistance. International organizations such as the European Centre for Disease Prevention and Control (ECDC), the Clinical Laboratory Standards Institute (CLSI), the European Committee and Antimicrobial Susceptibility Testing (EUCAST), and the United States Food and Drug Administration (FDA) have made a combined effort to create standardized terminology that can be applied to all bacteria responsible for infections associated with multidrug resistance [18, 21]. Consequently, “antimicrobial categories” were created (for each specific organism or group), each category containing the related antimicrobial agents (Table 1.2). The term multiple drug resistance (MDR) refers to organisms non-susceptible to at least one agent in three or more antimicrobial categories. Extensively (extreme) drug resistant (XRD) means the organism shows non-susceptibility to at least one agent in all but two or fewer antimicrobial categories and pan-drug resistant (PDR) refers to an organism that shows non-susceptibility against all (or nearly all) of the antimicrobial agents within the antimicrobial categories. 1.5 MDR Mechanisms of Major Pathogens At present, the treatment of bacterial infections is severely affected by the emergence of antibiotic-resistant infections and epidemic increases of multidrug resistant (MDR), XRD, or increasingly PDR microorganisms [22] such as vancomycin-resistant Enterococcus faecium (VRE), Enterobacter cloacae, MRSA), XRD carbapenem-resistant Acinetobacter baumannii [8], third generation cephalosporin-resistant E. coli, third generation cephalosporin-resistant, extended spectrum β-lactamase producing Klebsiella pneumonia (ESBL-KP), carbapenem-resistant Klebsiella pneumoniae (CRKP) [8], carbapenem-resistant 5 6 1 The Problem of Microbial Drug Resistance Table 1.2 Examples of antimicrobial categories and antimicrobial agents used to define MDR, XDR and PDR [18]. Antimicrobial category Antimicrobial agent Carbapenems Imipenen Meropenem Doripenem Tetracycline Doxycycline Minocycline Gentamicin Tobramycin Amikacin Netilmicin Colistin Polymyxin B Cefotaxime Ceftriaxone Ceftazidime Vancomycin Teicoplanin Chloramphenicol Streptomycin Tetracyclines Aminoglycosides Polymyxins Extended spectrum cephalosporins third and fourth generation Glycopeptides Phenicols Streptomycin Pseudomonas aeruginosa, multidrug resistant Mycobacterium tuberculosis (MDR-TB) [23], and C. difficile [6, 13, 15, 24–29]. Drug resistance can be caused by mobile genes or, in the absence of mobile genetic elements, by sequential mutations in the microbial chromosome. Mobile genes can be transferred between different bacteria by mobile genetic elements such as plasmids, naked DNA, transposons, or bacteriophages. These genes code for information against a particular antibiotic. In some microbes, multiple genes can be present, resulting in MDR. Alternatively, resistance or MDR can also be caused by sequential mutation in chromosomal DNA, which can result in mutation in the antibiotic target enzymes (topoisomerases) or/and in the overexpression of efflux pumps that expel structurally unrelated drugs [6, 30]. Chromosomal genes can also be transferred. They can be acquired by one bacterium through the uptake of naked DNA released from another microorganism by the process called transformation (an introduction of an exogenous DNA into a cell, resulting in a new phenotype). For example, emergence of high-level resistant S. aureus to vancomycin, caused by a mobile element – transposon from enterococci – first appeared in response to an intermediate dose of vancomycin. Bacteria are also mobile and can easily travel from person to person, from continent to continent, spreading the problem of microbial resistance [10]. 1.5 MDR Mechanisms of Major Pathogens Bacterial mechanisms of resistance vary. Active resistance can be achieved by three major mechanisms: first, synthesis of specific enzymes that selectively target and inactivate the drug (e.g., β-lactamases, macrolide esterases, epoxidases, or several transferases); second, efflux of the antimicrobial agents from the cell via membrane-associated efflux pumps; third, modification of the antibiotic target sites (alteration of intracellular binding targets such as ribosomal RNA or DNA gyrase involved in DNA replication, or even enzymes involved in the synthesis of bacterial cell wall). The most important example of target change can be seen in MRSA, where the acquisition and expression of mecA genes results in resistance to methicillin and most of the β-lactam antibiotics [30–33]. All three mechanisms can make the drug incapable of inhibiting microbial metabolic pathways that are vital for microbial growth and survival [6, 31]. Antimicrobial resistance to a single antimicrobial agent is already problematic, but the emerging multidrug resistance of Gram-negative bacteria is of serious concern and it dramatically limits treatment options [25]. Gram-negative bacterial infections caused by MDR or PDR bacteria (such as E. coli, P. aeruginosa, Klebsiella pneumoniae, and/or A. baumannii) can result in death. In 2013, they were called the nightmare bacteria by the US Centres for Disease Control and Prevention (CDC) and a new coming “red plaque” by Looke et al. [34]. The predominant cause of resistance of Gram-negative bacteria is related to one or more β-lactamases, which can inactivate the β-lactam antibiotic by hydrolyzing the amide bond of the β-lactam ring, leaving β-lactam antibiotics harmless to bacteria [35–37]. In the 1980s, only cephalosporins (e.g., cefotaxime) were less susceptible to β-lactamases; unfortunately, their repetitive use selected resistant strains able to produce plasmid-mediated enzymes such as cefotaximasas (CTX-M) [35]. Research shows that ESBLs carried by E. coli and metallo-β-lactamases (SHV-1, sulfhydryl variable) carried by K. pneumoniae and Enterobacter spp can easily destroy the latest generation of penicillins or cephalosporins. They can even inactivate carbapenems, which are often called the last available resort for treatment of serious infections caused by Gram-negative bacteria [13, 35, 36]. Most of the species of E. coli, responsible for urinary tract infections and Gram-negative bacteremia, are antibiotic sensitive, apart from being resistant to ampicillin. However, research showed that up to 60% of E. coli isolates from hospital and non-hospital environments are resistant to ampicillin because of the production of plasmid-mediated TEM-1/2 (Temoniera from whom E. coli TEM was isolated in 1963) β-lactamases [13, 35]. TEM-2 enzyme differs from TEM-1 only by a single amino acid [13]. Microbes producing TEM-1 or TEM-2 are known to be resistant to ampicillin but still are susceptible to the third generation of cephalosporins. However, it has been reported that mutations in TEM-1 and TEM-2 can result in the production of new ESBLs (so far more than 100 of new TEM have been reported). Transferrable plasmids containing genes encoding ESBLs are often associated with aminoglycoside resistance and other resistances [13]. In 1990, the more virulent MDR CTX-M-producing E. coli has emerged, replacing opportunistic hospital outbreaks with SHV- and TEM-type ESBLs-KP. It was established that CTX-M enzymes are encoded in transferrable 7 8 1 The Problem of Microbial Drug Resistance plasmids and transposons. These mobile elements have originated from other bacteria such as Kluyvera spp. and have spread widely among enterobacteria [13]. Highly transmittable CTX-M-producing E. coli can also be resistant to the aminoglycosides and quinolones. As a result of this, MDR in E. coli is now increasingly common in the hospital environments and community. It is also known that phages can be involved in bacterial evolution and the creation of new “super bugs” such as the deadly E. coli O157 : H7 strain [38]. K. pneumoniae, one of the most common clinical pathogen causing sepsis, meningitis, pneumonia, and other diseases, is usually resistant to ampicillin by production of a metallo-β-lactamases (SHV-1), similar to TEM-1 or TEM-2. SHV-1 can be encoded by transferrable plasmid, integrons, or by chromosome mutations. Mutation of SHV-1 results in the production of one or more ESBLs. MDR K. pneumoniae is becoming a serious concern worldwide. Carbapenem-resistant organisms can produce several different carbapenemases. Plasmid-mediated Klebsiella pneumoniae carbapenemase (KPC) isolates were found to be responsible for many outbreaks worldwide and were associated with a significant mortality rate [36, 39, 40]. Gram-negative P. aeruginosa, another well-known opportunistic pathogen [30], is the third most common cause of hospital-acquired Gram-negative bacteremia after E. coli and K. pneumonia. Some isolates of P. aeruginosa are inherently resistant to most penicillins, cephalosporins, and even to carbapenems [13, 28, 36, 41]. This multidrug resistance was caused by the overexpression of the chromosomally encoded efflux system, which is very common in Gram-negative bacteria such as A. baumannii or P. aeruginosa [32]. In A. baumannii the efflux system is associated with the resistance-nodulation-cell division (RND) family of the transport proteins. These multidrug efflux pumps consist of an efflux membrane transporter (RND) that can interact with an outer membrane factor (OMF), which exports the drug through both membranes [33]. A. baumannii shows an extraordinary ability to develop multidrug resistance due to a high level of genomic plasticity and due to mutation of endogenous genes. Alteration of these genes exhibits overexpression of the chromosomally encoded β-lactamases, loss of expression of porins, mutation in gyrA and parC, and finally overexpression of efflux systems, which is associated with increased drug resistance. There are three types of efflux systems in A. baumannii: CraA (resistance to chloramphenicol); AbeM (extrudes several antimicrobials); and AmvA (resistance to several detergents, dyes, disinfectants, and erythromycin). There are also several tetracycline efflux pumps, for example, TetA and TetB. TetA is associated with resistance to tetracycline, while TetB shows resistance to tetracycline, doxycycline, and minocycline [30, 33, 42]. Gram-positive S. aureus has a great ability to develop multiple resistances [29]. Reports showed that it can be resistant to penicillin, tetracycline, erythromycin, chloramphenicol, gentamicin, and methicillin. The MRSA, called the superbug, emerged in 1961, only 2 years after methicillin was introduced and since then it has become the most common multiple-antibiotic-resistant pathogen in many parts of the world [27]. In 2011, it was estimated that MRSA was responsible for 171,200 healthcare-associated infections (HAIs) in Europe per year, 5400 1.5 MDR Mechanisms of Major Pathogens Table 1.3 Examples on antibiotics with activity against MRSA [15]. Antibiotic Mode of action Daptomycin Causes a calcium ion-dependent disruption of bacterial cell membrane, an efflux of potassium inhibits RNA, DNA, and translation Inhibits bacterial protein synthesis by binding to the domain V regions of 23S rRNA Bacteriostatic against most pathogens. Show broad spectrum of antimicrobial activity. Inhibits bacterial protein synthesis by binding to the 30S ribosomal sub-unit blocking binding of amino-acetyl transfer RNA into acceptor side Linezolid Tigecycline deaths, and more than a million extra days of hospitalization [29, 43]. Methicillin resistance developed because of the acquisition of the mecA gene located on a large genetic element called staphylococcal cassette chromosome mec (SCCmec) integrated into the MRSA chromosome [27]. SCCmec has been possibly assimilated by horizontal transfer from an animal coagulase-negative pathogen Staphylococcus sciuri. mecA gene encodes for the production of an abnormal penicillin-binding protein PBP-2a (also called PBP-2′ ). PBPs are transpeptidases necessary for cell wall peptidoglycan synthesis and are the target for penicillin. PBP-2a is a transpeptidase that does not bind to penicillin so inhibition of cell wall synthesis by penicillin does not occur [13, 31]. Many strains of MDR MRSA remain susceptible only to vancomycin and teicoplanin (glycopeptides). Unfortunately, in recent years some S. aureus isolates have also become glycopeptide tolerant, and even worse, several isolates now show glycopeptide and carbapenems resistance. New antibiotics against MRSA infections such as daptomycin (Cubicin®; Novartis), linezolid, and tigecycline (Tygacil®; Wyeth) have been investigated (Table 1.3). However, a number of novel agents such as a capsular polysaccharide-based vaccine, lipoglycopeptide ortivanacin, or the use of signal molecule-based drugs (quorum sensing inhibitor) or cell wall-anchored adhesions are in different stages of development [14, 29]. Hospital-acquired MRSA (HA-MRSA) have now been found outside the hospitals and spread to other healthcare facilities [27]. There is also massive spread of community-acquired MRSA (CA-MRSA) infections. Some CA-MRSA isolates can produce toxins called Panton-Valentine Leukocidin (PVL), which increases its virulence. Expression of this virulence is controlled by complex staphylococcal regulatory networks including the accessory gene regulator (agr) system. These genes can vary between different strains [29, 43]. PVL is responsible for acute skin infections and pneumonia. CA-MRSA can be easily transmitted from person to person. The development of antiviral drug resistance also represents serious complications. CHB virus is an example of antiviral drug resistance. The development of resistance in hepatitis B virus (HBV) is related to the lack of proofreading function in the DNA polymerase and its high replication rate [19], which, in the presence of 9 10 1 The Problem of Microbial Drug Resistance the antiviral drug, result in specific DNA mutations (during replication process). Clinically, antiviral drug resistance is first exhibited in higher levels of HBV DNA (virological breakthrough), followed by increased levels of alanine aminotransferase (biochemical breakthrough). Although the DNA mutations developed can affect the “fitness” of the viruses, they will also help the virus to survive the presence of the drug and develop a high level of antiviral drug resistance. In addition, compensatory additional DNA mutations help restore viral “fitness,” leading to viral rebound. HBV shows a high level of resistance to antiviral drugs such as lamivudine, telbivudine, and adefovir. Rapid development of antiviral drug resistance has also been seen for influenza viruses A and B. There are two classes of antiviral drugs approved in many countries: the adamantanes (active only against influenza virus A) and the neuraminidase inhibitors (NAIs). However, due to the rapid emergence of viral resistance, only NAIs are recommended by WHO (since 2010) for the treatment or prophylaxis of influenza A and B infections. At present, only two NAIs are licensed worldwide for therapeutic and prophylactic uses: oseltamivir, commercially available as Tamiflu® (F. Hoffmann-La Roche), and zanamivir, commercially available as Relenza® (GlaxoSmithKline). In 2009, influenza pandemic patients with suspected or known influenza A (H1N1)pdm09 were treated with a new drug peramvir (BioCryst). The mechanism of resistance is also linked to DNA mutations. Influenza viruses showing reduced sensitivity to NAIs contain mutations, which directly or indirectly change the shape of the influenza surface antigen–neuraminidase (NA) catalytic sites (made of 8 functional and 11 framework residues). The NA surface antigen exhibits two important functions: first, it releases progeny virions, and second, it facilitates viral spread. Any alterations to NA catalytic sites reduce the inhibitor binding of the drug and therefore lower the efficiency of Tamiflu. In 2007, H1N1 influenza strains in Europe and North America were reported resistant to NAI Tamiflu owing to the H274Y mutation [44]. Rapid evolution of influenza surface genes can create more worldwide dissemination of drug-resistant influenza infections caused by A(H1N1) variants; therefore, the development of new antiviral drugs and surveillance of viral infections is extremely important [45]. Pathogenic fungi such as MDR Candida spp. or MDR Candida krusei are known to be responsible for life-threatening infections. They are called hidden killers resulting in 46–75% mortality [46]. The multidrug resistance in Candida spp. is related to low accumulation of drugs caused by genes encoding drug transporters. ATP-binding cassette (ABC) transporters are encoded by Candida drug resistance (CDR1 and CDR2) and a major facilitator superfamily (MFS) transporter encoded by MDR1 genes. Overexpression of MDR1, which encodes the MDR efflux pump of the MFS often, increases resistance to azole antifungal drugs. Long-term therapies with fluconazole (antifungal drug) have led to the emergence of fluconazole-resistant Candida albicans and C. krusei strains, which can also be resistant to other drugs. C. krusei also showed decreased susceptibility to flucytosine and amphotericin [47]. Novel antimicrobial peptides that can target the mitochondria and DNA of MDR Candida spp. are being developed in order to fight microbial resistance [48]. 1.6 Antimicrobial Stewardship Programs 1.6 Antimicrobial Stewardship Programs Antimicrobial resistance has been recognized as a major global threat. Globalization of the world results in population movement, which favors the rapid spread of new MRD organisms and infectious diseases [16]. The dramatic increase in antibiotic-resistant infections leads to higher mortality, longer hospital stays, and unavoidably increased treatment costs [49]. It can be said that the gene pool for antimicrobial resistance has never been so big nor its selection pressure so strong [1]. There was a time when antimicrobial agents were highly successful in treating infections caused by pathogenic microbes; however, their unfettered use in human clinical therapy, aquaculture, and food animal production has triggered rapid development of antimicrobial resistance, especially in the developing world [34, 38]. In recent years, the scientific community has raised serious concerns about the fact that drug development will not be able to address the problem posed by drug or multidrug resistance. So what do we do next? How do we fight this multiresistance problem? Recognizing the serious global problem, several nations, international health agencies, and many other organizations worldwide have taken actions to counteract microbial resistance through the application of novel strategies/initiatives. For example, the ARTEMIS Antifungal Surveillance Program (2001–2005) was created to increase our understanding and to monitor the spread of the uncommon but MDR fungal pathogen C. krusei [47]. In 2001, a WHO global strategy was introduced in order to slow down and reduce the spread of antimicrobial-resistant organisms. The strategy included better access to appropriate antimicrobial agents, better use of antimicrobials, better surveillance of antimicrobial resistance by strengthening health systems, and enforcing of regulations and legislation. The strategy also included the development of new drugs and vaccines [24]. In 2008, to avoid the spread of resistance, virological monitoring of HIV patients was required. To facilitate this, the WHO developed a Global Strategy for Prevention of HIV Drug Resistance and established the HIVResNet network of experts and laboratories in order to reduce the spread of HIV infection due to resistance to anti-HIV drugs [18]. In 2011, during the World Health Day, the WHO urged the world for a political commitment and the creation of a comprehensive plan that may help fight antimicrobial resistance. Following advice, hospitals implemented novel initiatives such as antimicrobial stewardships. The antimicrobial stewardship is a combined set of strategies/guidelines created to reduce microbial resistance [50–52]. The mission of antimicrobial stewardship program is to reduce inappropriate use of antimicrobial agents (dose, duration, route of administration) and improve patient outcomes [53]. Antimicrobial stewardship also aims to reduce the spread of infections and the development of antimicrobial resistance [52]. Several studies showed that antibiotic resistance can be reduced by shortening the length of antibiotic courses [49, 54, 55]. An antimicrobial stewardship program is multidisciplinary, and brings together key healthcare professionals (nurses, general practitioners, pharmacists, clinical microbiologists, infectious 11 12 1 The Problem of Microbial Drug Resistance diseases physicians) and hospital management. The program cannot be just limited to large hospitals or academic centers only; it needs to include small regional facilities in both developed and developing healthcare systems around the world. Adopting novel stewardship strategies in the hospitals and community can provide a systematic approach to the growing threat of antibiotic resistance. 1.7 Discussion Multidrug resistance is a serious danger to the future of humans (and animals) and could result in the development of untreatable diseases and death. Immediate measures must be taken worldwide to safeguard the remaining antimicrobials and to facilitate the development of new antimicrobial agents. Numerous papers have been published about microbial multidrug-resistant pathogens created by intensive use of antibiotics in human and animal therapy, and food animal production. As a consequence, AR and MDR bacteria have been found in hospitals, healthcare centers, community, and various food products and even in the environments without a history of direct exposure to antibiotics [38]. Enteric bacteria such as E. coli or Enterococcus spp. have been extensively investigated and the impact of these commensal bacteria on the emergence of MDR gene pool has been recognized by the scientific community [38]. In addition, recent reports, released by the WHO, have raised concerns about MDR tuberculosis (MDR)-TB. In January 2010, 58 countries reported cases of XDR-TB [56]. It can be said that the problem of bacterial resistance or multidrug resistance in the ecosystem is a serious and complex issue. How should we manage and prevent multidrug resistance? First, detailed knowledge of the nature of AR and MDR pathogens is required in order to implement new successful strategies to control the transmission of multidrug resistance within hospital/healthcare environments and the community. Investigations of historic strain and events that have led to the origin of resistant strains such as mechanisms involved in the emergence and dissemination are essential. Secondly, the rate of MDR microbes can be reduced by the implementation of different intervention strategies relevant to the control of antibiotic use and control of hospital infections [18, 41, 57]. The control of antibiotic use focuses on factors such as choice of antibiotic or combination of antibiotics for treatment, duration of the therapy, monitoring and feedback on antimicrobial resistance, rational antibiotic usage, and regulations. ESBL-producing E. coli was reported in 79% of surgical wound infections in India, but only less than 5% in New Zealand [11, 57]. MRSA are highly dominant in the United States (34%) while in the Netherlands the prevalence is ≤2%. These massive differences could be associated to the local differences in antibiotic policies [57]. The second essential point is the control of hospital infection (to control cross-infections within hospitals and within community) through rapid detection/diagnostic tests, prevention, and control of antimicrobial resistance, and also References plans for patients (admitted, re-admitted, discharged, or transferred) colonized with resistant microbes. For example, to prevent further spread of MRSA the “Search-and-Destroy” policy was implemented in Denmark in 1983, when prevalence of MRSA was 30%; since then, the MRSA prevalence decreased to less than 1% [27]. Nemeth et al. [57] reported that a substantial proportion of the patients transferred to the hospital (Zurich University Hospital) from abroad are colonized with MDR organisms. They concluded that the rigors of infection control in the hospital are important and every patient admitted to the hospital should be screened for MDR colonization. Reducing the spread of MDR by using existing antibiotics and developing new antibiotics or novel alternative therapies should be seen as a collective responsibility [8]. Worldwide surveillance systems of resistance and reduction of transmission of resistant organisms are required to generate valuable data important for research and development. Managing the problem of bacterial resistance requires researchers, community, and politicians working together to promote research and implement global strategies. Acknowledgment We thank the University of Wolverhampton for the support given in the preparation of this chapter. References 1. Kohanski, M.A., Dwyer, D.J., and 2. 3. 4. 5. 6. Collins, J.J. (2010) How antibiotics kill bacteria: from targets to networks. Nat. Rev. Microbiol., 8, 423–435. Prescott, L.M., Harley, J.P., and Klein, D.A. (2002) Microbiology, 5th edn, Mc Grow-Hill Companies. Zaffiri, L., Gardner, J., and Toledo-Pereyea, L.H. (2012) History of antibiotics. From salvarsan to cephalosporins. J. Invest. Surg., 25, 67–77. Fernebro, J. (2011) Fighting bacterial infections – future treatment options. Drug Resist. Updat., 14, 125–139. Zucca, M., Scutera, S., and Savoia, D. (2011) in Drug Development – A Case Study Based Insight into Modern Strategies (ed. C. Rundfeldt), In Technologies, pp. 123–162. Levy, S.B. and Marshall, B. (2004) Antimicrobial resistance worldwide causes, challenges and responses. Nat. Med. Suppl., 10, 122–129. 7. Hiramatsu, K., Igarashi, M., Morimoto, Y., Baba, T., Umekita, M., and Akamatsu, Y. (2012) Curing bacteria of antibiotic resistance: reverse antibiotics, a novel class of antibiotics in nature. Int. J. Antimicrob. Agents, 39, 478–485. 8. Huttner, A., Harbarth, S., Carlet, J., Cosgrove, S., Goossens, H., Holmes, A., Jarlier, V., Voss, A., and Pittet, D. (2013) Antimicrobial resistance: a global view from the 2013 World Healthcareassociated Infections Forum. Antimicrob. Resistance Infect. Control, 2, 31. 9. Grundmann, H., Klugman, K.P., Walsh, T., Pardo, P.R., Sigauque, B., Khan, W., Laxminarayan, L., Heddini, A., and Stelling, J. (2011) A framework for global surveillance of antibiotic resistance. Drug Resist. Updat., 14, 79–87. 10. Kumarasamy, K.K., Toleman, M.A., Welsh, T.R., Bagaria, J., Butt, F., Bakakrishnan, R., Chaundhary, M.D., Giske, C.G., Irfan, S., Krishnan, P., Kumar, A.V., Maharjan, S., Mushtag, S., Noorie, T., Paterson, D.L., Pearson, 13 14 1 The Problem of Microbial Drug Resistance 11. 12. 13. 14. 15. 16. 17. 18. 19. A., Perry, C., Pike, R., Rao, B., Ray, U., Sarma, J.B., Sharma, M., Sheridan, E., Thirunarayan, A., Turton, J., Upadhyay, S., Warner, M., Welfere, W., Livermoer, D.M., and Woodford, N. (2010) Emergence of a new antibiotic resistance mechanism in India, Pakistan, and in the UK: a molecular, biological, and epidemiological study. Lancet Infect., 10, 597–602. Cars, O., Hedin, A., and Heddini, A. (2011) The global need for effective antibiotics – moving towards concerted action. Drug Resist. Updat., 14, 68–69. Vergidis, P.I. and Falagas, M.E. (2008) New antibiotics agents in bloodstream infections. Int. J. Antimicrob. Agents, 32, 60–65. Wright, G.D. (2005) Bacterial resistance to antibiotics: enzymatic degradation and modification. Adv. Drug Delivery Rev., 57, 1451–1470. French, G.L. (2010) The continuing crisis in antibiotic resistance. Int. J. Antimicrob. Agents, 36, 3–7. Ippolito, G., Leone, S., Lauria, F.N., Nicastri, E., and Wenzel, R.P. (2010) Methicillin – resistant Staphylococcus aureus: the superbug. Int. J. Infect. Dis., 14, 7–11. Livermore, D. (2007) Introduction: the challenge of multiresistance. Int. J. Antimicrob. Agents, 29, 1–7. Costelloe, C., Metcalfe, C., Lovering, A., Mant, D., and Hay, A.D. (2010) Effect of antibiotic prescribing in primary care on antimicrobial resistance in individual patients: systematic review and meta-analysis. Br. Med. J., 340, 1–11. Magiorakos, A.P., Srinivasan, A., Carey, R.B., Carmeli, Y., Falagas, M.E., Giske, C.G., Harbarth, S., Hindler, J.F., Kahlmeter, G., Olsson-Liljequist, B., Paterson, D.L., Rice, L.B., Stelling, M.J., Vatopoulos, A., Weber, J.T., and Monnet, D.L. (2012) Multidrug-resistant, extensively drug-resistant and pandrugresistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect., 18, 268–281. WHO Antimicrobial Resistance. Fact sheet N∘ 194, Updated May 2013, http://www.who.int/mediacentre/ 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. factsheets/fs194/en/ (accessed 3 February 2014). Tana, M.M. and Ghany, M.G. (2013) Hepatitis B virus treatment: management of antiviral drug resistance. Clin. Liver Dis., 2, 24–28. Freire-Moran, L., Aronsson, B., Manz, C., Gyssens, I.C., So, A.D., Monnet, D.L., and Cars, O. (2011) Critical shortage of new antibiotics in development against multidrug-resistant. Bacteria – Time to react is now. Drug Resist. Updat., 14, 118–124. Spellberg, B., Guidos, R., Gilbert, D., Bradley, J., Boucher, H.W., Scheld, W.M., Bartlett, J.G., and Edwards, J. (2008) The epidemic of antibiotic-resistant infections: a call to action for the medical community from the Infectious Diseases Society of America. Clin. Infect. Dis., 46, 155–164. Lynch, J.B. (2013) Multidrug-resistant tuberculosis. Med. Clin. North Am., 97, 553–579. World Health Organization (2012) The Evolving Threat of Antimicrobial Resistance: Options for Action, World Health Organization, Geneva, ISBN: 978 92 4 150318 1. www.who.int (accessed 9 April 2014). Andersen, S.E. and Knudsen, J.D. (2013) A managed multidisciplinary programme on multi-resistant Klebsiella pneumoniae in a Danish university hospital. BMJ Qual. Saf., 22, 907–915. Kallen, A.J., Hidron, A.I., Patel, J., and Srinvasan, A. (2010) Multidrug resistance among Gram-negative pathogens that caused healthcare – associated infections reported to the National Safety Network, 2006-2008. Infect. Control Hosp. Epidemiol., 31, 528–531. Deurenberg, R.H. and Stobberingh, E.E. (2008) The evolution of Staphylococcus aureus. Infect. Genet. Evol., 8, 747–763. Arias, C.A. and Murray, B.E. (2009) Antibiotic-resistant bugs in the 21st century – a clinical super-challenge. N. Engl. J. Med., 360, 439–443. Gould, I.M., David, M.Z., Esposito, S., Garau, J., Lina, G., Mazzei, T., and Peters, G. (2012) New insights into methicillin-resistant Staphylococcus aureus (MRSA) pathogenesis, treatment References 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. and resistance. Int. J. Antimicrob. Agents, 39, 96–104. Nikaido, H. and Pagès, J.M. (2012) Broad-specificity efflux pumps and their role in multidrug resistance of Gramnegative bacteria. FEMS Microbiol. Rev., 36, 340–363. Lambert, P.A. (2005) Bacterial resistance to antibiotics: modified target sites. Adv. Drug Delivery Rev., 57, 1471–1485. Kumar, A. and Schweizer, H.P. (2005) Bacterial resistance to antibiotics: active efflux and reduced uptake. Adv. Drug Delivery Rev., 57, 1486–1513. Coyne, S., Rosenfeld, N., Lambert, T., Courvalin, P., and Perichon, B. (2010) Overexpression of resistance-nodulationcell division pump AdeFGH cofers multidrug resistance in Acinetobacter baumannii. Antimicrob. Agents Chemother., 54, 4389–4393. Looke, D.F.M., Gottlieb, T., Jones, C.A., and Paterson, D.L. (2013) Gram-negative resistance: can we combat the coming of a new “Red Plague”? Med. J. Aust., 198, 243–244. Bonnet, R. (2004) Growing group of extended-spectrum β-lactamases: the CTX-M enzymes. Antimicrob. Agents Chemother., 48, 1–14. Lahiri, S.D., Mangani, S., Durand-Reville, T., Benvenuti, M., De Luca, F., Sanyal, G., and Docquier, J.D. (2013) Structural insight into potent broad-spectrum inhibition with reversible recyclization mechanism: avibactam in complex with CTX-M-15 and Pseudomonas aeruginosa AmpC β-Lactamases. Antimicrob. Agents Chemother., 57, 2496–2505. Munoz, P., Fernandez-Cruz, A., Rodriges- Creixems, M., and Bouza, E. (2008) Gram – negative bloodstream infections. Int. J. Antimicrob. Agents, 32, 10–14. Wang, H.H. and Schaffner, D.W. (2011) Antibiotic resistance: how much do we now and where do we go from here? Appl. Environ. Microbiol., 77, 7093–7095. Saidel-Odes, L. and Borer, A. (2014) Limiting and controlling carbapenemresistant Klebsiella pneumoniae. Infect. Drug Resist., 7, 9–14. 40. Sho, T., Muratani, T., Hamasuna, 41. 42. 43. 44. 45. 46. 47. R., Yakushiji, H., Fujimoto, N., and Matsumoto, T. (2013) The mechanism of high-level carbapenem resistance in Klebsiella pneumoniae: underlying Ompk36-deficient strains represent a threat of emerging high-level carbapenem-resistant K. pneumoniae with IMP-1 β-lactamase production in Japan. Microb. Drug Resist., 19, 274–281. French, G.L. (2005) Clinical impact and relevance of antibiotic resistance. Adv. Drug Delivery Rev., 57, 1514–1527. Rumbo, C., Gato, E., López, M., Ruiz de Alegría, C., Fernández-Cuenca, F., Martínez-Martínez, L., Vila, J., Pachón, J., Cisneros, J.M., Rodríguez-Baño, J., Pascual, A., Bou, G., and Tomás, M. (2013) Contribution of efflux pumps, porins, and {beta}lactamases to multidrug resistance in clinical isolates of Acinetobacter baumannii. Antimicrob. Agents Chemother., 57, 5247–5257. Gould, I.M., Cauda, R., Esposito, S., and Gudiol, F. (2011) Management of serious methicillin – resistant Staphylococcus aureus infections: what are the limits? Int. J. Antimicrob. Agents, 37, 202–209. Samson, M., Pizzorno, A., Abed, Y., and Boivin, G. (2013) Influenza virus resistance to neuraminidase inhibitors. Antiviral Res., 98, 174–185. Rahamat-Langendoen, J., Lokate, M., Friedrich, A., and Niesters, H. (2013) The value of realtime sequence based information in surveillance of nosocomial viral infections. Antimicrob. Resist. Infect. Control, 13, P180. Sun, N., Li, D., Fonzi, W., Li, X., Zhang, X., and Calderone, R. (2013) Multidrugresistant transporter mdr1p-mediated uptake of a novel antifungal compound. Antimicrob. Agents Chemother., 57, 5931–5939. Pfaller, M.A., Diekema, D.J., Gibbs, D.L., Newell, V.A., Nagy, E., Dobiasova, S., Rinaldi, M., Barton, R., Veselov, A., and the Global Antifungal Surveillance Group (2008) Candida krusei, a multidrug-resistant opportunistic fungal pathogen: geographic and temporal 15 16 1 The Problem of Microbial Drug Resistance 48. 49. 50. 51. 52. 53. 54. Short-course empiric antibiotic therapy trends from the ARTEMIS DISK antifor patients with pulmonary infiltrates fungal surveillance program. J. Clin. in the intensive care unit. A proposed Microbiol., 46, 515–521. solution for indiscriminate antibiotic Mishra, B., Leishangthem, G.D., Gill, K., prescription. Am. J. Respir. Crit. Care Singh, A.K., Das, S., Singh, K., Xess, I., Med., 162, 505–511. Dinda, A., Kapil, A., Patro, I.K., and Dey, D. (2013) A novel antimicrobial pep55. Deliberato, R.O., Marra, A.R., tide derived from modified N-terminal Rodrigues Sanches, P., Martino, M.D.V., domain of bovine lactoferrin: design, dos Santos Ferreira, E., Pasternak, J., synthesis, activity against multidrugTavares Paes, A., Pinto, L.M., dos Santos, resistant bacteria and Candida. Biochim. O.F.P., and Edmond, M.B. (2013) Clinical Biophys. Acta, 1828, 677–686. and economic impact of procalcitonin to Hohn, A., Schroeder, S., Gehrt, A., shorten antimicrobial therapy in septic Bernhardt, K., Bein, B., Wegscheider, K., patients with proven bacterial infecand Hochreiter, M. (2013) Procalcitonintion in an intensive care setting. Diagn. guided algorithm to reduce length of Microbiol. Infect. Dis., 76, 266–271. antibiotic therapy in patients with severe 56. Streicher, E.M., Muller, B., Chihoda, V., sepsis and septic shock. BMC Infect. Mlambo, C., Tait, M., Pillay, M., Torlipp, Dis., 13, 158. A., Hoek, K.G.P., Sirgel, F., van Pittius, N.C.G., van Helden, P.D., Victor, T.C., Daly, C.G. (2013) Dental note. Antimiand Warren, R.M. (2012) Emergence ot crobial stewardship. Aust. Prescriber, 36, treatment of multidrug resistant (MDR) 123. and extensively drug-resistant (XRD) Gould, I.M. (2009) Antibiotic resistance: tuberculosis in South Africa. Infect. the perfect storm. Int. J. Antimicrob. Genet. Evol., 12, 686–694. Agents, 34, 2–5. Charani, E. and Holmes, A.H. (2013) 57. Nemeth, J., Ledergerber, B., Preiswerk, Antimicrobial stewardship programmes: B., Nobile, A., Karrer, S., Ruef, C., and the need for wider engagement. BMJ Kuster, S.P. (2012) Multidrug-resistant Qual. Saf., 22, 885–887. bacteria in travellers hospitalized aboard: prevalence, characteristics, and influence Rawlins, M., McKenzie, D., and Mar, on clinical outcome. J. Hosp. Infect., 82, C. (2013) Antimicrobial stewardship: 254–259. what’s it all about? Aust. Prescriber, 36, 116–120. Singh, N., Rogers, P., Atwood, C.W., Wagener, M.M., and Yu, V.L. (2000) 17 2 Conventional Antibiotics – Revitalized by New Agents Anthony Coates and Yanmin Hu 2.1 Introduction Antibiotic resistance develops to all antibiotics [1–3]. Over several decades, this has led to the need to replace old antibiotics with new ones. Unfortunately, the world has not produced antibiotics fast enough to cope with the emergence of antibiotic resistance, particularly for Gram-negative bacteria [4]. Between the 1940s and 1970s, the “Golden era,” about 20 new classes of antibiotics were produced, which led to more than 200 analogs. Since then, there have only been three new classes marketed, none of which are for Gram-negatives [5]. Can we recreate the golden era? In other words, can we make 20 new classes of antibiotics that are active against highly resistant bacteria? There is much debate about this. While new antibiotics against Gram-positive bacteria have been marketed in recent years, the main problem is that resistant Gram-negative bacteria are poorly served, with no new class being marketed for 40 years [5]. Furthermore, new antibiotics that are effective against the carbapenem-resistant bacteria [6], which express, for example, NDM-1 [7], are not being introduced into the market in good time, and we are playing “Catch-up.” Is there a way forward? On the one hand, if enough money was provided by governments, perhaps in a similar way to the Marshall plan [8, 9], or the Public Health Emergency Medical Countermeasures Enterprise, [10] which is a public–private partnership of multiple agencies of the US Federal Government, many more antibiotics might reach the market. This would need to be accompanied by global efforts by nonprofit organizations such as the Bill & Melinda Gates Foundation, the Drugs for Neglected Diseases Initiative (a research and development organization that develops new treatments for neglected diseases), and Medicines for Malaria Venture, which is a public–private partnership with the aim of providing affordable antimalarial drug discovery and development. In addition, there would need to be changes in regulation, and encouragements for industry, for example, the Generating Antibiotics Incentives Now (GAIN) Act and the proposed Antibiotic Development to Advance Patient Treatment Act, both in the United States (“ADAPT Act”) for a limited population antimicrobial Novel Antimicrobial Agents and Strategies, First Edition. Edited by David A. Phoenix, Frederick Harris and Sarah R. Dennison. © 2015 Wiley-VCH Verlag GmbH & Co. KGaA. Published 2015 by Wiley-VCH Verlag GmbH & Co. KGaA. 18 2 Conventional Antibiotics – Revitalized by New Agents drug pathway [8, 11]. On the other hand, in the long term, it may not be possible to market enough antibiotics to keep up with the relentless emergence of antibiotic resistance [12, 13]. While prevention will clearly play a greater role, this will not substitute for new antibiotics. The existing strategy is to discover and develop novel single antibiotic therapy [14]. Do we need to rethink this strategy? Considering costs alone, if we intend to discover and develop 200 new antibiotics, the cost will be somewhere in excess of $1 billion per compound [15]. So this route would be very expensive. Is it scientifically feasible to endlessly produce more and more antibiotics? The past 40 years have shown that it is becoming more difficult to bring new antibiotics to the market. The absence of new classes of antibiotics for Gram-negative infections during this period is an important example [5]. Now we have virtually untreatable carbapenem-resistant Gram-negative infections, exemplified by those bacteria that express metallo-beta-lactamase (MBL) [7], for which we are using, as a last resort, colistin [16], itself an old, relatively toxic antibiotic. Colistin resistance is now emerging in MBL Enterobacteriaceae [17]. Furthermore, the development of novel antibiotics against MBL-resistant bacteria is still in early clinical development [14, 18]. In addition, we know that antibiotic resistance arises to all antibiotics within a few years after entry into the marketplace [19]. Therefore, a continuous flow of new antibiotics into the market is needed. It seems unlikely that the world will be able to produce a limitless number of antibiotics far into the future. If the supply of effective antibiotics dries up, modern medicine is likely to suffer a devastating setback [13, 20]. We propose a new strategy. The world should revitalize conventional antibiotics by combining them with antibiotic resistance breakers (ARBs). This approach would mean that we could, potentially, continue to use conventional antibiotics. This has the advantage of being a cheaper option than developing hundreds of new antibiotics. For example, if each class of antibiotics could be resuscitated by a single ARB, theoretically, most of the 200 existing antibiotics could become useful again. Potentially, this could be achieved with fewer new compounds than would be required for the replacement of the existing 200 compounds. There would be substantial financial savings and this would transform the feasibility of prolonging the antibiotic era. This chapter looks at the origins of combination antibiotic therapy and examines whether it is possible to extend this concept, namely, the combination of conventional antibiotics (see Table 2.1) with resistance breakers, thereby revitalizing a wide range of different classes of antibiotics. 2.2 Conventional Antibiotics The main classes of antibiotics that have been marketed, and many of their analogs, are listed in Table 2.1. Resistance has occurred to all of them. The β-lactams are degraded by bacterial β-lactamases, which can be neutralized by combining the old antibiotic with a β-lactamase inhibitor such as clavulanic 2.2 Conventional Antibiotics Table 2.1 Main classes of antibiotics. Class Examples Aminoglycosides Streptomycin, neomycin, kanamycin, paromycin, gentamicin, tobramycin, amikacin, netilmicin, spectinomycin, sisomicin, dibekalin, isepamicin 𝛃-Lactams Penicillins Cephalosporins First generation Second generation Third generation Fourth generation Carbapenems Monobactams 𝛃-lactamase inhibitors Glycopeptides Macrolides Metronidazole Lincosamides Lipopeptides Oxazolidinones Polymyxin Quinolines Quinolones Rifamycins Streptogramins Sulfonamides Tetracyclines Trimethoprim Penicillin G, penicillin V, methicillin, oxacillin, cloxacillin, dicloxacillin, nafcillin, ampicillin, amoxicillin, carbenicillin, ticarcillin, mezlocillin, piperacillin, azlocillin, temocillin Cepalothin, cephapirin, cephradine, cephaloridine, cefazolin Cefamandole, cefuroxime, cephalexin, cefprozil, cefaclor, loracarbef, cefoxitin, cefmetazole Cefotaxime, ceftizoxime, ceftriaxone, cefoperazone, ceftazidime, cefixime, cefpodoxime, ceftibuten, cefdinir Cefpirome, cefepime Imipenem, meropenem Astreonam Clavulanate, sulbactam, tazobactam Vancomycin, teicoplanin Erythromycin, azithromycin, clarithromycin — Lincomycin, clindamycin Daptomycin Linezolid Polymyxin B, Polymyxin E (colistin) Bedaquiline Nalidixic acid, oxolinic acid, norfloxacin, pefloxacin, enoxacin, ofloxacin/levofloxacin, ciprofloxacin, temafloxacin, lomefloxacin, fleroxacin, grepafloxacin, sparfloxacin, trovafloxacin, clinafloxacin, gatifloxacin, moxifloxacin, sitafloxacin Rifampicin (also called rifampin), rifapentine, rifabutin, bezoxazinorifamycin, rifaximin Quinupristin, daflopristin Sulfanilamide, para-aminobenzoic acid, sulfadiazine, sulfisoxazole, sulfamethoxazole, sulfathalidine Tetracycline, chlortetracycline, demeclocycline, minocycline, oxytetracycline, methacycline, doxycycline, tigecycline — 19 20 2 Conventional Antibiotics – Revitalized by New Agents acid [21]. This is discussed in more detail in the next section, as are other combinations. Potential combinations only exist for a minority of classes. 2.3 The Principles of Combination Antibiotic Therapy In the clinic, combinations of antibiotics are often used. The main reasons for such combinations are as follows: 1) Combinations break resistance and rejuvenate old antibiotics. The best example of this approach is the combination of clavulanic acid and amoxicillin [21]. Clavulanic acid inhibits bacterial β-lactamase, which neutralizes amoxicillin, thus allowing the latter to kill β-lactamase-producing bacteria. Clavulanic acid alone has no antibacterial activity. This chapter primarily deals with breaking resistance. 2) Combinations prevent the emergence of resistance during chemotherapy. It is important to appreciate the limitations of this approach. While combinations of antibiotics do prevent the emergence of resistance during tuberculosis chemotherapy [22], it is unlikely that this will be effective in multispecies environments such as the large intestine. In the case of Mycobacterium tuberculosis, combinations are effective because mutations only arise in the chromosome, and do not occur because of plasmid transfer from other species of bacteria [23]. M. tuberculosis lives on its own in a relatively sterile environment, for example, inside macrophages in the lung. So, there is little opportunity for plasmid transfer. Resistance due to transfer of plasmids does not occur in M. tuberculosis. In contrast, other bacteria, such as Escherichia coli, live in the large intestine in a multispecies environment where resistance is often transferred via plasmids [24]. Combinations such as sulfonamide and trimethoprim (co-trimoxazole) already have high levels of resistance – for example, over 95% of Gram-negative bacteria from babies in rural India [25] in spite of early hopes that such a combination would prevent the emergence of resistance [26]. A meta-analysis (including data from eight randomized controlled trials) that compared aminoglycoside/β-lactam combination therapy with β-lactam monotherapy to observe the emergence of antimicrobial resistance found that aminoglycoside/β-lactam combination therapy was not associated with a reduced development of resistance when compared with β-lactam therapy alone [27]. Nevertheless, for certain infections where chromosomal resistance is thought to be important, combinations of different antibiotics may have the potential to prevent the emergence of resistance. 3) Combinations in which one antibiotic boosts the effect of a second antibiotic and vice versa. This is called synergy. For instance, penicillin and gentamicin are synergistic [28], and are used to treat bacterial endocarditis. 4) A combination of antibiotics is used by clinicians to broaden the number of species of bacteria that are targeted. For example, if a seriously ill patient has 2.4 Antibiotic Resistance Breakers: Revitalize Conventional Antibiotics suspected intra-abdominal infection with an unknown bacterium, an aminoglycoside and anti-anerobe agents can be used [29]. 5) Sometimes, the clinician may be faced with an infection that harbors dormant bacteria as well as fast multiplying ones. Tuberculosis is well known as an infection that persists owing to the presence of dormant bacteria that are relatively tolerant to antibiotics. Combinations of antibiotics, typically containing four separate compounds (rifampicin, pyrazinamide, isoniazid, and ethambutol), are used in the initial stages of tuberculosis therapy. Rifampicin and pyrazinamide kill dormant bacteria and so are responsible for the shortening of the duration of chemotherapy from 12 to 6 months [22]. 2.4 Antibiotic Resistance Breakers: Revitalize Conventional Antibiotics The main threat to the effectiveness of a marketed antibiotic is the emergence of widespread resistance among its bacterial targets. While prevention of resistance is clearly the ultimate answer to this problem, the world is a long way from reversing this trend. Since resistance to an antibiotic is an inevitable consequence of entry into the market, the main subject of this chapter is to examine the feasibility of revitalizing conventional antibiotics by the addition of an ARB . The combination is active against resistant bacteria. In the large pyogenic bacterial field, combination therapy has not been developed to the extent that it has in tuberculosis, although HIV and cancer therapy do use well-characterized combinations of drugs. There are a number of ways that conventional antibiotics can be revitalized by combining them with another agent. 2.4.1 𝛃-Lactamase Inhibitors Bacteria can produce β-lactamases, which are enzymes that destroy the β-lactam ring of β-lactam antibiotics, thereby reducing their effectiveness [30]. There are over 1300 known β-lactamases. The concept of combining a β-lactam antibiotic with a β-lactamase inhibitor in order to revitalize the antibiotic and to render it active against β-lactamase-expressing bacteria, was first introduced into the market by a combination of the β-lactamase inhibitor clavulanic acid, derived from Streptomyces clavuligerus, with amoxicillin [31]. This combination is called Augmentin (GlaxoSmithKline, Brentford, UK). In a clinical trial [32], patients with non-bullous impetigo were treated with either amoxicillin alone or Augmentin. The causative organism of impetigo, Staphylococcus aureus, was shown to be present in lesions from all the patients. When tested for sensitivity to amoxicillin, all the bacterial isolates were resistant, but were sensitive to Augmentin. Clinically, the Augmentin group of patients responded better than the amoxicillin group. These data indicated that neutralization of bacterial β-lactamase can revitalize amoxicillin. 21 22 2 Conventional Antibiotics – Revitalized by New Agents Unfortunately, bacteria produce many β-lactamases that are not inhibited by clavulanic acid. There has been a 100-fold increase in the number of known β-lactamase inhibitors in the past 40 years [30]. The classification of bacterial β-lactamases is complicated. We have used the Bush [30] system in this chapter, bearing in mind that extended spectrum beta-lactamases (ESBLs, which include TEM and SHV) and carbapenemases (such as NDM and KPC) in Gram-negatives are thought to be of the greatest clinical importance because they are difficult to treat and are relatively common in many countries [33, 34]. β-lactamases can be divided into Ser- and MBLs, by their active sites. They are subdivided into molecular classes A–D, which have functional groups and major functional subgroups. For example, the serine β-lactamases of molecular class C 1(1, 1e), which degrade early cephalosporins, and expanded spectrum cephalosporins in the case of 1e, Class A 2 (2a, 2b, 2be, 2br, 2f ), which degrade penicillins and others, and in the case of 2f, penicillins, early and expanded spectrum cephalosporins, carbapenems and monobactams, and Class D 2d (2de, 2df ), which destroy penicillins and in the case of 2df, carbapenems. The MBLs B 3 (3a and 3b) target carbapenems, and in the case of 3a, penicillins and early and expanded spectrum cephalosporins. Enzymes that are expressed are C 1 (AmpC, CMY) and 1e (GC1), A 2a (PC1), 2b (TEM-1, SHV-1), 2be (CTX-M, ESBLs (TEM, SHV)), 2br (IRT, SHV-10), 2f (KPC,SME), 2de (OXA-11, OXA-15), 2df (OXA-23, OXA-48), and B 3a (IMP, VIM, NDM), 3b (CphA). Clavulanic acid only neutralizes the serine β-lactamases A (2a, 2b, and 2be) and has a partial effect on A (2f ), and D (2d). Clavulanic acid has also been combined with ticarcillin (Timentin; GlaxoSmithKline, Brentford, UK). Other inhibitor combinations include tazobactam with piperacillin (Zosyn; Pfizer, Philadelphia, PA, USA), and sulbactam with ampicillin (Unasyn; Pfizer, Philadelphia, PA, USA). Unfortunately, the current β-lactamase inhibitor combinations are not active against bacteria that express AmpC or ESBLs. Even worse is that, so far, it is proving difficult to develop MBL inhibitors that are effective against NDM [35]. Since the current marketed inhibitors are only active against class A enzymes but lack effectiveness against class A KPC carbapenemases, new inhibitors are under development, which broaden the β-lactamases that can be neutralized. For example, avibactam, which is a bridged 1,6-diazabicyclo[3.2.1]ocatan-7-one (DBO), is in clinical development. This compound is active against a wide range of Class A and C serine β-lactamases [36], including ESBLs and class A carbapenemases. Although it neutralizes Class D OXA-48, it is inactive against other D carbapenemases. This molecule also inhibits selected class D β-lactamases including OXA-48, but not other class D carbapenemases or B MBLs. Avibactam combinations with ceftaroline (Cereza-Forest) and cefdazidime (AstraZeneca and Forest) are in clinical trials [35]. Another combination under development (Cubist) is tazobactam and ceftolozane [37]. Tazobactam increases the activity of the combination against ESBL-producing Enterobacteriaceae, and can partially neutralize AmpC and KPC carbapenemases. A new DBO (MK-7655 Merck) has been combined with imipenem and is in clinical trials [38]. This combination is active against KPC-2-producing Klebsiella pneumoniae and 2.4 Antibiotic Resistance Breakers: Revitalize Conventional Antibiotics AmpC-overexpressing isolates of Pseudomonas aeruginosa but not against those that express metallo-carbapenemases [39]. 2.4.2 Aminoglycoside-Modifying Enzyme Inhibitors While these types of inhibitors have not yet reached the clinical trials phase of development, some interesting in vitro experience has been achieved. In general, inhibitors of aminoglycoside-modifying enzymes [40, 41] have struggled with numerous different targets because bacteria may express multiple enzymes. However, inhibition of aminoglycoside phosphotransferases and acetyl transferases has been shown by cationic antimicrobial peptides (AMPs) [40]. Indolicidin is a bovine AMP. This peptide and its synthetic analogs inhibited both aminoglycoside phosphotransferase and aminoglycoside acetyltransferase classes. This is the first description of broad-spectrum inhibitors of aminoglycoside resistance enzymes. Crystallographic studies have shed light on the molecular structure of aminoglycosidephosphotransferases or kinases (APHs). A review of APH structures and inhibitors is covered by Shi and colleagues [42]. These data suggest that the commercial development of a universal APH inhibitor may not be feasible. 2.4.3 Antibiotic Efflux Pumps Inhibitors Although there are numerous examples of antibiotic efflux pump inhibitors, none are in clinical trials as yet. The main families of bacterial efflux pumps that are chromosomally expressed and that are associated with multidrug resistance [43] are the resistance nodulation division (RND) family (encodes AcrA/B-TolC), the major facilitator superfamily (MFS) (encodes QacA), the staphylococcal multiresistance (SMR) (encodes QacC), the multidrug and toxic compound extrusion (MATE) family (NorM), and the ATP binding cassette (ABC) (LmrA). Efflux pump inhibitors include reserpine [44], which is too neurotoxic to be used at effective concentrations in humans [45], berberine and palmatine [46], and other compounds (reviewed in [43]) including plant extracts, synthetic molecules, thioxanthenes, phenothiazenes, and arylpiperazines. While some inhibitors perform well in vitro, problems with toxicity have not resulted in extensive clinical trials. In addition, particularly in some Gram-negative bacteria, treatment with an inhibitor may lead to compensatory upregulation of other efflux pumps. For example, [47], RamA expression is induced by inhibition of efflux or inactivation of acrAB in Salmonella typhimurium. 2.4.4 Synergy Associated with Bacterial Membrane Permeators Synergy between non-antibiotics and antibiotics and between antibiotics themselves is well known. In some cases, this synergy is associated with one of the 23 24 2 Conventional Antibiotics – Revitalized by New Agents pair in the combination being a bacterial membrane permeabilizer. Whether this is responsible for the synergy is unknown in many cases, but it has been suggested [48] that permeabilization of the membrane may increase the intracellular concentration of the antibiotic in the combination, and this, in turn may increase the antibacterial potency of the antibiotic. Some of these associations are described here. Gram-negative bacteria have two membranes. In the case of fluoroquinolones, outer membrane proteins play a key part in helping these molecules to cross the membrane [49, 50]. In contrast, passive diffusion is thought to be important for translocation of the inner membrane of Gram-negatives and the single membrane of Gram-positives [51–54]. In the 1960s [55, 56], improved penetration of fluoroquinolones was achieved by the addition of a 7-piperazine side chain and this is thought to initiate translocation across the membrane [57]. This suggests that adding side groups such as piperazine or membrane permeabilization compounds in combinations could be a way of increasing the activity of current antibiotics. One of the most serious problems in clinical practice in the world is the emergence of carbapenem-resistant Gram-negative bacteria. Carbapenems are often used as the antibiotics of last resort. Combinations of antibiotics are used to treat patients with carbapenem-resistant MBL producing Gram-negative infections such as K. pneumoniae [58], and these combinations often contain colistin. This antibiotic, which is a polypeptide of the polymyxin group, increases the permeability of Gram-negative membranes [59]. The polycationic regions of colistin displace the bacterial counter ions in the lipopolysaccharide of the outer membrane. The inner membrane is solubilized by the hydrophobic/hydrophilic regions of colistin. While clinical data regarding the efficacy of different antibiotic combinations is sparse, in vitro data [58] suggests that a combination of colistin, rifampicin, and meropenem is effective against MBL-producing K. pneumoniae (VIM; NDM-1). AMPs can also increase the permeability of bacterial membranes, and can synergize with conventional antibiotics. For example, [60] AMPs have been created, which synergize with conventional antibiotics such as cefotaxime, ciprofloxacin, or erythromycin against highly resistant strains of the Gram-negative bacterium Acinetobacter baumannii. There are three models of AMP membrane interaction (reviewed in [61]): Barrel-stave pores, toroidal pores, and carpet mechanism, in which peptides form a layer on the surface and dissolve the membrane [62]. AMPs have numerous other effects on bacterial cells, and so synergy may not necessarily be the most important as far as a bactericidal effect is concerned. A recent development has been the observation of enhancement or synergy between a compound that was developed against dormant S. aureus [63] and three different classes of antimicrobials [64]. The compound (HT61; Helperby Therapeutics Ltd., London) depolarizes the bacterial cell membrane and is in clinical trials. Another example is loperamide (Immodium; McNeil Consumer Healthcare, Fort Washington, PA, USA) [65], an opioid receptor agonist, which enhances the activity of minocycline against E. coli, S. aureus, and P. aeruginosa. Loperamide 2.5 Discussion interferes with the electrical component of the proton motive force of the bacterial membrane. This leads to an increase in the pH gradient, which enhances the entry of tetracycline into the cell. 2.5 Discussion Revitalizing old antibiotics by combination with a second compound means that resistance to the old antibiotic is broken by the second compound, either directly or indirectly. There is only one clear, clinically proven example of rejuvenation of old antibiotics in this way, namely, the addition of β-lactamase inhibitors to β-lactams. Arguably, the addition of the 7-piperazine ring to quinolones in order to enhance the initiation of translocation could be regarded as another example. Antibiotic–antibiotic combinations that are frequently used in clinical practice, for example, in tuberculosis chemotherapy, do not break resistance as such. Such antibiotic–antibiotic combinations (with the exception of those that include colistin, and perhaps other membrane permeators) have other functions such as preventing the emergence of resistance (tuberculosis chemotherapy) or synergy (increasing efficacy). If resistance exists to the primary antibiotic, a second antibiotic is added to which the organism is sensitive and this renders the combination effective. Combinations can also broaden the spectrum of species that are targeted. For example, in abdominal sepsis patients, two antibiotics such as an aminoglycoside and anti-anaerobe agents are used together to cover as many aerobic and anaerobic species of bacteria as possible before the results of microbiological tests are available. Some combinations contain drugs that kill dormant organisms (for instance, pyrazinamide and rifampicin in tuberculosis chemotherapy), thus shortening the duration of therapy. The advantages of revitalizing old antibiotics, such as β-lactams with a β-lactamase inhibitor, is that the existing antibiotic can be used once again to effectively treat a resistant bacterial infection that was previously untreatable by that antibiotic. A further advantage of this approach is that it is relatively low cost because one ARB can be used to rejuvenate several old antibiotics. In addition, the risk that is associated with this approach is lower than that with developing a novel antimicrobial because once the ARB has been shown to be safe in clinical trials in combination with one compound it can be used to rejuvenate other old antibiotics. Furthermore, instead of reproducing the golden era of antibiotic discovery by creating 200 novel antibiotics, the world could, potentially, rejuvenate existing antibiotics with 20 or less ARBs in combination with 200 existing antibiotics. Could ARBs prevent the emergence of resistance? While combinations of drugs are used in tuberculosis, HIV, and cancer chemotherapy to reduce the emergence of resistance, there are certain fundamental differences between these combinations and ARBs for the treatment of pyogenic bacterial infections such as urinary tract disease due to Gram-negative bacteria. The first difference is that M. tuberculosis resistance is not transmitted by plasmids. It is chromosomally 25 26 2 Conventional Antibiotics – Revitalized by New Agents mediated. This contrasts with resistance in pyogenic bacteria that is transmitted by plasmids in some cases, is chromosomally mediated in others, and through both mechanisms in some. It is unlikely that ARBs could reduce the emergence of plasmid-mediated resistance, but they might be able to impact on chromosomal resistance. A second important difference is that some ARBs, such as some β-lactamase inhibitors, have no antibacterial activity by themselves. These ARBs are unlikely to be able to prevent even chromosomal resistance because resistance emergence is effectively appearing to the one old antibiotic alone. If, however, the ARB has some antibacterial activity in its own right, such as HT61 [63], mutants that arise to the old antibiotic can be killed by the ARB, and thus the combination may be able to prevent the emergence of chromosomally mediated resistance. Could ARBs be used to reduce the dose of old antibiotics against sensitive bacterial strains, and so decrease the incidence of toxic side effects? If the ARB can boost the effect of the old antibiotic against sensitive strains, it may be possible to use a lower dose of the old antibiotic to achieve cure. Would ARBs enhance activity against dormant bacteria? This depends on the ARB. β-lactamase inhibitors have no action against dormant bacteria and so would not increase a β-lactam’s activity against dormant bacteria. In contrast, other ARBs such as HT61, which was selected for anti-dormancy activity [63, 64], boost the activity of the combinations against dormant bacteria. Historically, resistance has eventually emerged to every antibiotic after entry into the market. Clearly, resistance will appear to ARB combinations. Experience with β-lactamase inhibitors suggests that mutant bacteria emerge over time that express β-lactamases, such as the B3a MBL NDM, that are resistant to, for example, clavulanic acid [7]. Since bacteria produce over 1000 β-lactamases, it seems likely that, when challenged with a new β-lactamase inhibitor, mutants will emerge that can neutralize the inhibitor with a novel β-lactamase. Ways need to be found to slow down the emergence of resistance. One possible route could be to use ARBs that target the cell membrane, on the grounds that it may take bacteria longer to develop resistance against combinations that act on the bacterial membrane [66]. ARBs that can rescue old antibiotics from a wide range of resistance challenges are needed, and those that can counteract MBLs are urgently needed. Acknowledgments We would like to acknowledge financial support from the Burton Trustees and Helperby Therapeutics Ltd. References 1. Wellington, E.M., Boxall, A.B., Cross, P., Feil, E.J., Gaze, W.H., Hawkey, P.M., Johnson-Rollings, A.S., Jones, D.L., Lee, N.M., Otten, W., Thomas, C.M., and Williams, A.P. (2013) The role of the natural environment in the emergence of antibiotic resistance in Gram-negative bacteria. Lancet Infect. Dis., 13 (2), 155–165. References 2. Arias, C.A. and Murray, B.E. (2009) 3. 4. 5. 6. 7. 8. 9. 10. Antibiotic-resistant bugs in the 21st century–a clinical super-challenge. N. Engl. J. Med., 360, 439–443. Livermore, D.M. (2009) Has the era of untreatable infections arrived? J. Antimicrob. Chemother., 64, 29–36. Cantón, R., Akóva, M., Carmeli, Y., Giske, C.G., Glupczynski, Y., Gniadkowski, M., Livermore, D.M., Miriagou, V., Naas, T., Rossolini, G.M., Samuelsen, Ø., Seifert, H., Woodford, N., Nordmann, P., and European Network on Carbapenemases (2012) Rapid evolution and spread of carbapenemases among Enterobacteriaceae in Europe. Clin. Microbiol. Infect., 18 (5), 413–431. Coates, A.R., Halls, G., and Hu, Y. (2011) Novel classes of antibiotics or more of the same? Br. J. Pharmacol., 163 (1), 184–194. Nordmann, P. (2013) Carbapenemaseproducing Enterobacteriaceae: overview of a major public health challenge. Med. Mal. Infect., pii, S0399-077X(13)00336-3, doi: 10.1016/j.medmal.2013.11.007. Bushnell, G., Mitrani-Gold, F., and Mundy, L.M. (2013) Emergence of New Delhi metallo-β-lactamase type 1-producing enterobacteriaceae and nonenterobacteriaceae: global case detection and bacterial surveillance. Int. J. Infect. Dis., 17 (5), e325–e333. Laxminarayan, R., Duse, A., Wattal, C., Zaidi, A.K., Wertheim, H.F., Sumpradit, N., Vlieghe, E., Hara, G.L., Gould, I.M., Goossens, H., Greko, C., So, A.D., Bigdeli, M., Tomson, G., Woodhouse, W., Ombaka, E., Peralta, A.Q., Qamar, F.N., Mir, F., Kariuki, S., Bhutta, Z.A., Coates, A., Bergstrom, R., Wright, G.D., Brown, E.D., and Cars, O. (2013) Antibiotic resistance-the need for global solutions. Lancet Infect. Dis., 13 (12), 1057–1098. The Marshall Plan (1948) http://www.marshallfoundation.org/ TheMarshallPlan.htm (accessed 2 March 2014). U.S. Department of Health and Human Services (2010) The Public Health Emergency Medical Countermeasures Enterprise 2010, https://www.medicalcountermeasures.gov/ 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. media/1138/mcmreviewfinalcover-508.pdf (accessed 2 March 2014). Antibiotic Development to Advance Patient Treatment Act (2013) http://usamobiledrugtesting.com/adaptact-would-create-a-new-limitedpopulation-approval-pathway-forantibiotics-and-antifungals (accessed 3 March 2014). Grossi, P.A., Tebini, A., and Dalla Gasperina, D. (2014) Novel multi-drug resistant microorganisms in critically ill: a potential threat. Minerva Anestesiol. [Epub ahead of print]. Davies, S. (2013) The Drugs Don’t Work (Penguin Special), Penguin. Coates, A.R. and Halls, G. (2012) Antibiotics in phase II and III clinical trials. Handb. Exp. Pharmacol., 211, 167–183. Huttner, A., Harbarth, S., Carlet, J., Cosgrove, S., Goossens, H., Holmes, A., Jarlier, V., Voss, A., and Pittet, D. (2013) Antimicrobial resistance: a global view from the 2013 World Healthcare-Associated Infections Forum. Antimicrob. Resist. Infect. Control, 2 (1), 31. Tzouvelekis, L.S., Markogiannakis, A., Psichogiou, M., Tassios, P.T., and Daikos, G.L. (2012) Carbapenemases in Klebsiella pneumoniae and other Enterobacteriaceae: an evolving crisis of global dimensions. Clin. Microbiol. Rev., 25 (4), 682–707. Tascini, C., Tagliaferri, E., Giani, T., Leonildi, A., Flammini, S., Casini, B., Lewis, R., Ferranti, S., Rossolini, G.M., and Menichetti, F. (2013) Synergistic activity of colistin plus rifampin against colistin-resistant KPC-producing Klebsiella pneumoniae. Antimicrob. Agents Chemother., 57 (8), 3990–3993. Chen, J., Shang, X., Hu, F., Lao, X., Gao, X., Zheng, H., and Yao, W. (2013) βLactamase inhibitors: an update. Mini Rev. Med. Chem., 13 (13), 1846–1861. (1998) House of Lords inquiry into antimicrobial resistance. Commun. Dis. Rep. CDR Wkly., 8 (17), 147, 150. So, A.D., Gupta, N., and Cars, O. (2010) Tackling antibiotic resistance. Br. Med. J., 340, c2071 (Editorial). Watkins, R.R., Papp-Wallace, K.M., Drawz, S.M., and Bonomo, R.A. (2013) 27 28 2 Conventional Antibiotics – Revitalized by New Agents 22. 23. 24. 25. 26. 27. 28. 29. 30. Novel β-lactamase inhibitors: a therapeutic hope against the scourge of multidrug resistance. Front. Microbiol., 4, 392. Mitchison, D. and Davies, G. (2012) The chemotherapy of tuberculosis: past, present and future. Int. J. Tuberc. Lung Dis., 16 (6), 724–732. Mitchison, D.A. (2012) Prevention of drug resistance by combined drug treatment of tuberculosis. Handb. Exp. Pharmacol., 211, 87–98. Dalhoff, A. (2012) Resistance surveillance studies: a multifaceted problem–the fluoroquinolone example. Infection, 40 (3), 239–262. Viswanathan, R., Singh, A.K., Ghosh, C., Dasgupta, S., Mukherjee, S., and Basu, S. (2012) Profile of neonatal septicaemia at a district-level sick newborn care unit. J. Health Popul. Nutr., 30 (1), 41–48. Grüneberg, R.N. (1979) The microbiological rationale for the combination of sulphonamides with trimethoprim. J. Antimicrob. Chemother., 5 (Suppl. B), 27–36. Bliziotis, I.A., Samonis, G., Vardakas, K.Z., Chrysanthopoulou, S., and Falagas, M.E. (2005) Effect of aminoglycoside and beta-lactam combination therapy versus beta-lactam monotherapy on the emergence of antimicrobial resistance: a meta-analysis of randomized, controlled trials. Clin. Infect. Dis., 41 (2), 149–158. Indrelie, J.A., Wilson, W.R., Matsumoto, J.Y., Geraci, J.E., and Washington, J.A. II, (1984) Synergy of imipenem or penicillin G and aminoglycosides against enterococci isolated from patients with infective endocarditis. Antimicrob. Agents Chemother., 26 (6), 909–912. Investigators of the Piperacillin/Tazobactam Intra-abdominal Infection Study Group (1994) Results of the North American trial of piperacillin/tazobactam compared with clindamycin and gentamicin in the treatment of severe intra-abdominal infections. Eur. J. Surg. Suppl., 573, 61–66. Bush, K. (2013) Proliferation and significance of clinically relevant β-lactamases. Ann. N. Y. Acad. Sci., 1277, 84–90. 31. Brogden, R.N., Carmine, A., Heel, R.C., 32. 33. 34. 35. 36. 37. 38. 39. 40. Morley, P.A., Speight, T.M., and Avery, G.S. (1981) Amoxycillin/clavulanic acid: a review of its antibacterial activity, pharmacokinetics and therapeutic use. Drugs, 22 (5), 337–362. Review. Dagan, R. and Bar-David, Y. (1989) Comparison of amoxicillin and clavulanic acid (augmentin) for the treatment of nonbullous impetigo. Am. J. Dis. Child., 143 (8), 916–918. Savard, P. and Perl, T.M. (2012) A call for action: managing the emergence of multidrug-resistant Enterobacteriaceae in the acute care settings. Curr. Opin. Infect. Dis., 25, 371–377. Lascols, C., Hackel, M., Hujer, A.M., Marshall, S.H., Bouchillon, S.K., Hoban, D.J., Hawser, S.P., Badal, R.E., and Bonomo, R.A. (2012) Using nucleic acid microarraysto perform molecular epidemiology and detect novel beta-lactamases: a snapshot of extendedspectrum betalactamases throughout the world. J. Clin. Microbiol., 50, 1632–1639. Buynak, J.D. (2013) Beta-Lactamase inhibitors: a review of the patent literature 2010–2013. Expert Opin. Ther. Pat., 23 (11), 1–13. Drawz, S.M., Papp-Wallace, K.M., and Bonomo, R.A. (2013) New β-lactamase inhibitors: a therapeutic renaissance in an “MDR world”. Antimicrob. Agents Chemother., [Epub ahead of print]. Hong, M.C., Hsu, D.I., and Bounthavong, M. (2013) Ceftolozane/tazobactam: a novel antipseudomonal cephalosporin and β-lactamase-inhibitor combination. Infect. Drug Resist., 6, 215–223. (eCollection 2013. Review). Shlaes, D.M. (2013) New β-lactam-βlactamase inhibitor combinations in clinical development. Ann. N. Y. Acad. Sci., 1277, 105–114. Livermore, D.M., Warner, M., and Mushtaq, S. (2013) Activity of MK7655 combined with imipenem against Enterobacteriaceae and Pseudomonas aeruginosa. J. Antimicrob. Chemother., 68 (10), 2286–2290. Boehr, D.D., Draker, K.A., Koteva, K., Bains, M., Hancock, R.E., and Wright, G.D. (2003) Broad spectrum peptide inhibitors of aminoglycoside antibiotic References 41. 42. 43. 44. 45. 46. 47. 48. 49. resistance enzymes. Chem. Biol., 10 (2), 189–196. Singh, H., Thangaraj, P., and Chakrabarti, A. (2013) Acinetobacter baumannii: a brief account of mechanisms of multidrug resistance and current and future therapeutic management. J. Clin. Diagn. Res., 7 (11), 2602–2605. Shi, K., Caldwell, S.J., Fong, D.H., and Berghuis, A.M. (2013) Prospects for circumventing aminoglycoside kinase mediated antibiotic resistance. Front. Cell. Infect. Microbiol., 3, 22. Piddock, L.J. (2006) Clinically relevant chromosomally encoded multidrug resistance efflux pumps in bacteria. Clin. Microbiol. Rev., 19 (2), 382–402. Neyfakh, A.A., Bidnenko, V.E., and Bo Chen, L. (1991) Efflux-mediated multidrug resistance in Bacillus subtilis: similarities and dissimilarities with the mammalian system. Proc. Natl. Acad. Sci. U.S.A., 88, 4781–4785. Markham, P.N. and Neyfakh, A. (1996) Inhibition of the multi-drug transporter norA prevents emergence of norfloxacin resistance in Staphylococcus aureus. Antimicrob. Agents Chemother., 40, 2673–2674. Hsieh, P.-C., Siegel, S.A., Rogers, B., Davis, D., and Lewis, K. (1998) Bacteria lacking a multidrug pump: a sensitive tool for drug discovery. Proc. Natl. Acad. Sci. U.S.A., 95, 6602–6606. Lawler, A.J., Ricci, V., Busby, S.J., and Piddock, L.J. (2013) Genetic inactivation of acrAB or inhibition of efflux induces expression of ramA. J. Antimicrob. Chemother., 68 (7), 1551–1557. Buyck, J.M., Plésiat, P., Traore, H., Vanderbist, F., Tulkens, P.M., and Van Bambeke, F. (2012) Increased susceptibility of Pseudomonas aeruginosa to macrolides and ketolides in eukaryotic cell culture media and biological fluids due to decreased expression of oprM and increased outer-membrane permeability. Clin. Infect. Dis., 55 (4), 534–542. Masi, M. and Pagès, J.M. (2013) Structure, function and regulation of outer membrane proteins involved in drug transport in Enterobactericeae: the 50. 51. 52. 53. 54. 55. 56. 57. 58. OmpF/C - TolC case. Open Microbiol. J., 7, 22–33. Tran, Q.T., Williams, S., Farid, R., Erdemli, G., and Pearlstein, R. (2013) The translocation kinetics of antibiotics through porin OmpC: insights from structure-based solvation mapping using WaterMap. Proteins, 81 (2), 291–299. Bayer, A.S., Schneider, T., and Sahl, H.G. (2013) Mechanisms of daptomycin resistance in Staphylococcus aureus: role of the cell membrane and cell wall. Ann. N. Y. Acad. Sci., 1277, 139–158. Weingart, H., Petrescu, M., and Winterhalter, M. (2008) Biophysical characterization of in- and efflux in Gram-negative bacteria. Curr. Drug Targets, 9 (9), 789–796. Nikaido, H. and Thanassi, D.G. (1993) Penetration of lipophilic agents with multiple protonation sites into bacterial cells: tetracyclines and fluoroquinolones as examples. Antimicrob. Agents Chemother., 37, 1393–1399. Vázquez, J.L., Merino, S., Domenech, O., Berlanga, M., Viñas, M., Montero, M.T., and Hernández-Borrell, J. (2001) Determination of the partition coefficients of a homologous series of ciprofloxacin: influence of the n − 4 piperazinyl alkylation on the antimicrobial activity. Int. J. Pharm., 220, 53–62. Domagala, J.M. (1994) Structure-activity and structure-side-effect relationships for the quinolone antibacterials. J. Antimicrob. Chemother., 33 (4), 685–706. Sanchez, J.P., Domagala, J.M., Hagen, S.E., Heifetz, C.L., Hutt, M.P., Nichols, J.B. et al. (1988) Quinolone antibacterial agents. Synthesis and structure-activity relationships of 8-substituted quinolone3-carboxylic acids. J. Med. Chem., 31, 983–991. Cramariuc, O., Rog, T., Javanainen, M., Monticelli, L., Polishchuk, A.V., and Vattulainen, I. (2012) Mechanism for translocation of fluoroquinolones across lipid membranes. Biochim. Biophys. Acta, 1818 (11), 2563–2571. Tängdén, T., Hickman, R.A., Forsberg, P., Lagerbäck, P., Giske, C.G., and Cars, O. (2014) Evaluation of double and triple antibiotic combinations for VIM- and 29 30 2 Conventional Antibiotics – Revitalized by New Agents 59. 60. 61. 62. NDM-producing Klebsiella pneumoniae by in vitro time-kill experiments. Antimicrob. Agents Chemother., 58 (3), 1757–1762. Dhariwal, A.K. and Tullu, M.S. (2013) Colistin: re-emergence of the ‘forgotten’ antimicrobial agent. J. Postgrad. Med., 59 (3), 208–215. Gopal, R., Kim, Y.G., Lee, J.H., Lee, S.K., Chae, J.D., Son, B.K., Seo, C.H., and Park, Y. (2013) Synergistic effects and anti-biofilm properties of chimeric peptides against MDR Acinetobacter baumannii strains. Antimicrob. Agents Chemother., [Epub ahead of print]. Tavares, L.S., Silva, C.S., de Souza, V.C., da Silva, V.L., Diniz, C.G., and Santos, M.O. (2013) Strategies and molecular tools to fight antimicrobial resistance: resistome, transcriptome, and antimicrobial peptides. Front. Microbiol., 4, 412. eCollection 2013. Pietiäinen, M., François, P., Hyyryläinen, H.L., Tangomo, M., Sass, V., Sahl, H.G., Schrenzel, J., and Kontinen, V.P. (2009) Transcriptome analysis of the responses of Staphylococcus aureus to antimicrobial peptides and characterization of 63. 64. 65. 66. the roles of vraDE and vraSR in antimicrobial resistance. BMC Genomics, 10, 429. Hu, Y., Shamaei-Tousi, A., Liu, Y., and Coates, A. (2010) A new approach for the discovery of antibiotics by targeting non-multiplying bacteria: a novel topical antibiotic for staphylococcal infections. PLoS One, 5 (7), e11818. Hu, Y. and Coates, A.R. (2013) Enhancement by novel anti-methicillin-resistant Staphylococcus aureus compound HT61 of the activity of neomycin, gentamicin, mupirocin and chlorhexidine: in vitro and in vivo studies. J. Antimicrob. Chemother., 68 (2), 374–384. Ejim, L., Farha, M.A., Falconer, S.B., Wildenhain, J., Coombes, B.K., Tyers, M., Brown, E.D., and Wright, G.D. (2011) Combinations of antibiotics and nonantibiotic drugs enhance antimicrobial efficacy. Nat. Chem. Biol., 7, 348–350. Hurdle, J.G., O’Neill, A.J., Chopra, I., and Lee, R.E. (2011) Targeting bacterial membrane function: an underexploited mechanism for treating persistent infections. Nat. Rev. Microbiol., 9 (1), 62–75. 31 3 Developing Novel Bacterial Targets: Carbonic Anhydrases as Antibacterial Drug Targets Clemente Capasso and Claudiu T. Supuran 3.1 Introduction Metals play roles in approximately one-third of the known enzymes. Proteins having metals incorporated into their molecule are known as metalloenzymes [1, 2]. Many enzymes incorporate electrophilic or nucleophilic moieties, whose reactivity is enhanced by the presence of cations, explaining why metal ions are frequently present in enzymes. In most metalloenzymes, the role of the cation is one of the following three: 1) Within the active site of the protein, participating in the catalytic mechanism of the enzyme 2) Into noncatalytic sites, stabilizing the structure of the enzyme and contributing to its tridimensional folding 3) Into the heme, within a prosthetic group as for hemoglobins and cytochromes [1–4]. Metal removal from the molecule leads to the unfolding of the tridimensional structure and frequently to the inactivation of the enzyme [3, 4]. Intriguingly, metalloenzymes are incredibly different between them, regarding the nature of the catalytic/structural cation present within the active site, the number of cations within the active site/the whole protein, the oligomeric state of the enzyme, and so on, being involved in a multitude of important physiological processes [5]. Carbonic anhydrases (CAs), carboxypeptidases, hemoglobins, cytochromes, phosphotransferases, alcohol dehydrogenase, arginase, ferredoxin, and cytochrome oxidase are several examples of the most common metalloenzymes known to date [3, 4]. 3.2 Carbonic Anhydrases In this chapter, the reader’s attention is focused on the role of one of the crucial metalloenzymes in all life kingdoms, carbonic anhydrase (CA, EC 4.2.1.1). Developing CA inhibitor-based antibiotics by inhibiting bacterial CAs present Novel Antimicrobial Agents and Strategies, First Edition. Edited by David A. Phoenix, Frederick Harris and Sarah R. Dennison. © 2015 Wiley-VCH Verlag GmbH & Co. KGaA. Published 2015 by Wiley-VCH Verlag GmbH & Co. KGaA. 32 3 Developing Novel Bacterial Targets: Carbonic Anhydrases as Antibacterial Drug Targets in pathogenic species started to be investigated relatively recently as a new drug design strategy for obtaining antibacterial agents [5–9]. CAs are ubiquitous metalloenzymes present in prokaryotes and eukaryotes. The five genetically distinct classes known to date, the α-, β-, γ-, δ-, and ζ-CAs, are all metalloenzymes, using Zn(II), Cd(II), or Fe(II) at their active sites [9–15]. The α-CAs are present in vertebrates, bacteria, algae, and cytoplasm of green plants; the β-CAs are predominantly found in bacteria, algae, and chloroplasts of both mono and dicotyledons; the γ-CAs are present in Archaea, bacteria, and plants, whereas the δ- and ζ CAs are present in marine diatoms and other eukaryotes composing the plankton [16, 17]. These enzymes catalyze a very simple physiological reaction, the interconversion between carbon dioxide and the bicarbonate ion when a proton is also formed, being involved in crucial physiological processes connected with respiration and transport of CO2 /bicarbonate between metabolizing tissues and lungs (in vertebrates), pH and CO2 homeostasis, electrolyte secretion in a variety of tissues/organs, biosynthetic reactions (such as gluconeogenesis, lipogenesis, and ureagenesis – again in vertebrates), bone resorption, calcification, and tumorigenicity [7, 12, 16, 18]. In prokaryotes, the existence of genes encoding for CAs from at least three classes (α-, β-, and γ-class) suggests that these enzymes play an important role in prokaryotic physiology. CAs, in fact, are involved in the transport of CO2 or HCO3 − , in supplying CO2 or HCO3 − for the biosynthetic reactions (and thus metabolisms); in pH regulation and also in xenobiotic degradation (for example, cyanate, by Escherichia coli), as well as in the survival of intracellular pathogens within their host [7, 12, 16, 18]. At present, infectious diseases are the second leading cause of death in the world and the emergence of antibiotic-resistant bacteria is an inevitable and dangerous phenomenon, inherent to most new drugs [19, 20]. The possibility of developing new antibacterial agents raised much interest recently. The main classes of antibiotics clinically used nowadays act toward the inhibition of four classical targets: (i) cell wall biosynthesis; (ii) protein biosynthesis; (iii) DNA and RNA biosynthesis; and (iv) folate biosynthesis [21]. CAs started to be investigated in detail recently in pathogenic bacteria, in the search for antibiotics with a novel mechanism of action, as it has been demonstrated that in many bacteria CAs are essential for the life cycle of the organism and that their inhibition leads to growth impairment or growth defects of the pathogen [22–26]. 3.3 CA Inhibitors Several classes of CA inhibitors (CAIs) are known to date: the metal complexing anions, and the unsubstituted sulfonamides, which bind to the Zn(II) ion of the enzyme either by substituting the non-protein zinc ligand or by adding to the metal coordination sphere, generating trigonal-bipyramidal species are the classical, most frequently investigated ones [26–29]. The primary sulfonamides were the first antimicrobial drugs, discovered in 1935 by Domagk, and they paved 3.4 Classes of CAs Present in Bacteria the way for the antibiotic revolution in medicine [30]. The first sulfonamide showing effective antibacterial activity, prontosil, was a prodrug, with the real antibacterial agent being sulfanilamide, a compound isosteric/isostructural with 4-aminobenzoic acid (pABA). Sulfanilamide is generated by the in vivo reduction of prontosil. In the years following the discovery of sulfanilamide as a bacteriostatic agent, a range of analogs have entered into clinical use (constituting the so-called sulfa drug class of antibacterials), and many of these compounds are still widely used [7]. Sulfonamides, such as the clinically used derivatives acetazolamide (AAZ), methazolamide (MZA), ethoxzolamide (EZA), dichlorophenamide, dorzolamide (DZA), and brinzolamide (BRZ), bind in a tetrahedral geometry to the Zn(II) ion in a deprotonated state, with the nitrogen atom of the sulfonamide moiety coordinated to Zn(II) and an extended network of hydrogen bonds, involving amino acid residues Thr199 and Glu106 (numbering system used for the human CA, isoform I), also participating in the anchoring of the inhibitor molecule to the metal ion [7]. The aromatic/heterocyclic part of the inhibitor interacts with the hydrophilic and hydrophobic residues of the cavity. Anions, such as the inorganic metal-complexing ones, or more complicated species such as the carboxylates, are also known to bind to the CAs, but generally with less efficiency compared to the sulfonamides [8, 24, 27]. Anions may bind either with the tetrahedral geometry of the metal ion or as trigonal-bipyramidal adducts. Enzymes found in vertebrates, arthropods, corals, fungi, bacteria, diatoms, and Archaea have been investigated for their inhibition with simple inorganic anions. Anion inhibitors are important both for understanding the inhibition/catalytic mechanisms of these enzymes fundamental for many physiologic processes, and for designing novel types of inhibitors that may have clinical applications for the management of a variety of disorders in which CAs are involved [9–14, 17, 26]. 3.4 Classes of CAs Present in Bacteria The bacterial genomes encode CAs belonging to at least three classes (the α-, β-, and γ-CA class). The metal coordination pattern in the α and γ-CAs involves three histidine residues and a water molecule, while the amino acid residues involved in the catalytic cycle of β-CAs are two cysteines and one histidine, the fourth metal ion ligand being again a water molecule/hydroxide ion. The existence of five CA classes (α, β, γ, δ, and ζ) that have evolved independently has been well documented in the literature, these enzymes being an excellent example of convergent evolution at the molecular level [13, 31–36]. Hence, we present here the most parsimonious phylogenetic tree of the CAs, in order to elucidate the phylogenetic relationships existing among the three classes found in bacteria, the α, β, and γ-CAs. Phylogenetic analysis was carried out using α-, β-, and γ-CAs from different prokaryotic and eukaryotic species (Figure 3.1). From the dendrogram shown in Figure 3.1, the α-CAs (bacterial and non-bacterial) appear closely 33 34 3 Developing Novel Bacterial Targets: Carbonic Anhydrases as Antibacterial Drug Targets HumCAII_alpha HumCAI_alpha HpyICA_alpha 0.115 SspCA_alpha 0.158 VchCA_alpha 0.723 SsalCA_alpha 0.856 NgonCA_alpha 0.925 PseCA_gamma 0.996 BglCA_gamma 0.253 CAM_gamma 0.468 CreCA_gamma AthCA_gamma PgiCA_gamma PgiCA_beta 0.877 0.875 MinCA_beta AbaCA_beta 0.936 0.99 0.889 0.885 CA class Organism Alpha Helicobacter pylori J99 Homo sapiens, isoform II Homo sapiens, isoform I Sulfurihydrogenibium yellowstonense YO3AOP1 Streptococcus salivarius PS4 Vibrio cholerae Neisseria gonorrhoeae NP_223829.1 AAH11949.1 NP_001158302.1 ACD66216.1 EIC81445.1 AFC59768.1 CAA72038.1 HpyICA_alpha HumCAII_alpha humCAI_alpha SspCA_alpha SsalCA_alpha VchCA_alpha NgonCA_alpha Beta Schizosaccharomyces pombe Brucella suis 1330 Burkholderia thailandensis Bt4 Coccomyxa sp. Chlamydomonas reinhardtii Acinetobacter baumannii Porphyromonas gingivalis Myroides injenensis Zea mays Vigna radiata Flaveria bidentis, isoform I Arabidopsis thaliana Helicobacter pylori Legionella pneumophila 2300/99 Escherichia coli Methanobacterium thermoautotrophicum Saccharomyces cerevisiae Dekkera bruxellensis AWRI1499 CAA21790 NP_699962.1 ZP_02386321 AAC33484.1 XP_001699151.1 YP_002326524 YP_001929649.1 ZP_10784819 NP_001147846.1 AAD27876 AAA86939.2 AAA50156 BAF34127.1 YP_003619232 ACI70660 GI:13786688 GAA26059 EIF49256 SpoCA_beta BsuCA_beta BthCA_beta CspCA_beta CreCA_beta AbaCA_beta PgiCA_beta MinCA_beta ZmaCA_beta VraCA_beta FbiCA_beta AthCA_beta HpyCA_beta LpnCA_beta EcoCa_beta Cab_beta SceCA_beta DbrCA_beta Gamma Pseudomonas sp. PAMC 25886 Burkholderia gladioli BSR3 Methanosarcina thermophila Chlamydomonas reinhardtii Arabidopsis thaliana Porphyromonas gingivalis ZP_10427314.1 YP_004359911.1 ACQ57353.1 XP_001703237.1 NP_564091.1 YP_001929649.1 PseCA_gamma BgICA_gamma CAM_gamma CreCA_gamma AthCA_gamma PgiCA_gamma Cab_beta 0.889 ZmaCA_beta VraCA_beta FbiCA_beta AthCA_beta HpyCA_beta LpnCA_beta EcoCA_beta SpoCA_beta BsuCA_beta 0.965 BthCA_beta 0.858 CspCA_beta 0.968 CreCA_beta SceCA_beta DbrCA_beta 0.997 0.968 0.507 0.248 0.861 0.496 0 0.963 0.955 0.133 Accession number Cryptonym Figure 3.1 Phylogenetic analysis carried out on the α, β, and γ-CAs identified in the genome of different prokaryotic and eukaryotic organisms. All the CA classes, microorganisms, accession numbers, and cryptonyms have been indicated in the table included in this figure. 3.6 α-CAs in Pathogenic Bacteria related to the γ-CAs clustering in a branch distinct from that of the β-CAs. These results probably indicate that there was a gene duplication event occurring in the ancestral lineage of CAs separating the α- and γ-class enzymes from the β-CAs. 3.5 Pathogenic Bacterial CAs Microbes express their pathogenicity by means of their virulence, which determines the ability of pathogens to enter a host, evade host defenses, grow in the host environment, counteract its immune responses, assimilate iron or other nutrients from the host, or sense environmental changes [37–39]. Numerous enzymes are responsible for the virulence, acting against host components and contributing to the damage of host tissues. Cloning of the genomes of many pathogenic microorganisms offered the possibility of exploring alternative pathways for inhibiting virulence factors or proteins essential for their life cycle, and such an approach was applied systematically for CAs from pathogenic bacteria in the last decade. As described above, bacterial genomes are characterized by the presence of genes encoding for α-, β-, and γ-CAs. Hence, the investigations of these three classes of CAs may reveal novel aspects of microbial virulence. CAs started to be investigated in detail recently in pathogenic bacteria, in the search for antibiotics with a novel mechanism of action, as it has been demonstrated that in many of them, these enzymes are essential for the life cycle of the pathogen [7, 16]. 3.6 𝛂-CAs in Pathogenic Bacteria The α-CAs are present in vertebrates, protozoa, algae, and cytoplasm of green plants and in bacteria [7, 16]. The first bacterial α-CA was characterized from the pathogen Neisseria gonorrhoeae [40], a Gram-negative coffee-bean-shaped diplococcic bacteria responsible for the sexually transmitted infection gonorrhea. The α-CA identified in N. gonorrhoeae (NgCA) However, the three-dimensional structures of these two contains 252 amino acid residues, has a molecular mass of 28 kDa and, presumably, is localized in the periplasm of the bacterial cell. Its amino acid sequence is only about 35% identical with that of human (h) hCA II. enzymes are quite similar, although several surface loops are considerably shorter in the bacterial enzyme than in the hCA II [40]. One important difference between these two α-CAs is the presence of a disulfide bond in bacterial enzyme, while the cytoplasmic hCA II contains only one Cys residue. The bacterial enzyme showed a high CO2 hydrase activity, with a k cat of 1.1 × 106 s−1 and K m of 20 mM (at pH 9 and 25 ∘ C). The enzyme also showed esterase activity for the hydrolysis of 4-nitrophenyl acetate, similarly to the mammalian isoforms hCA I and II. NgCA crystallized as a dimer. Recently, our groups resolved the three-dimensional 35 36 3 Developing Novel Bacterial Targets: Carbonic Anhydrases as Antibacterial Drug Targets structure of the first thermostable α-CA identified in the thermophilic bacteria Sulfurihydrogenibium yellowstonense. The extremo-α-CA was named SspCA and, intriguingly, this molecule had an asymmetric crystallographic unit formed by a dimer with two independent moieties. This is a very interesting result considering that α-CAs were long considered to be monomeric enzymes [9, 11, 36, 41]. The best studied bacterial α-CA is that from the gastric pathogen provoking ulcer and gastric cancer, Helicobacter pylori, named hpαCA. This CA has a periplasmic localization and was shown to be catalytically efficient with almost identical activity to that of the human isoform hCA I, for the CO2 hydration reaction, and highly inhibited by many sulfonamides/sulfamates, including AAZ, EZA, topiramate (TPM), and sulpiride (SLP), all clinically used drugs [42–44]. Furthermore, some CAIs, such as AAZ and MZA, were shown to inhibit the bacterial growth in cell cultures. Since the genome of H. pylori encodes also for a cytoplasmic β-CA and the efficacy of H. pylori eradication therapies currently employed has been decreasing because of drug resistance and side effects of the commonly used drugs, the dual inhibition of α- and/or β-CAs of H. pylori could be applied as an alternative therapy in patients with H. pylori infection or for the prevention of gastroduodenal diseases due to this widespread pathogen [42–46]. In 2005, in fact, Shahidzadeh and coworkers [47] showed the efficacy of AAZ in the treatment of gastric ulcer. This compound (as well as EZA) was in fact widely used as an antiulcer agent in the 1970s and 1980s [47]. Recently, our group cloned, purified, and characterized an α-CA from the human pathogenic bacterium Vibrio cholerae, VchCA [31, 48, 49]. This enzyme showed significant catalytic activity for CO2 hydration reaction. VchCA has kinetic parameters quite similar to those of the human isoform hCA I, with a k cat of 8.23 × 105 s−1 and a K m of 11.7 mM, which leads to a k cat /K m of 7.0 × 107 M−1 s−1 (compared to 5.0 × 107 M−1 s−1 for hCA I) [31]. VchCA is thus slightly more active than hCA I but also four times more active compared to the bacterial enzyme, hpαCA. VchCA was about half as active as hCA II, one of the best catalysts known in nature (which has a k cat /K m of 1.5 × 108 M−1 s−1 ) [31]. The inhibition study with sulfonamides and sulfamates led to the detection of a large number of low nanomolar inhibitors, among which are MZA, AAZ, EZA, DZA, BRZ, benzolamide (BZA), and indisulam (IND) (K I values in the range 0.69–8.1 nM). For example, VchCA was strongly inhibited by AAZ, a sulfonamide in clinical use, with a K I of 6.8 nM, and was almost twice more sensitive to this inhibitor than hCA II and three times more sensitive than the H. pylori enzyme. Since bicarbonate was demonstrated to be a virulence factor of this bacterium and since EZA was shown to inhibit the in vivo virulence, we proposed that VchCA may be a target for antibiotic development, exploiting a mechanism of action rarely considered until now [31]. Many inorganic anions and several small molecules were also investigated as VchCA inhibitors [49]. Inorganic anions such as cyanate, cyanide, hydrogen sulfide, hydrogen sulfite, and trithiocarbonate were effective VchCA inhibitors with inhibition constants in the range of 33–88 μM. Other effective inhibitors were diethyldithiocarbamate, sulfamide, sulfamate, phenylboronic acid, and phenylarsonic acid, with K I s of 3.7 β-CAs in Pathogenic Bacteria 7–43 μM. Halides (bromide, iodide), bicarbonate, and carbonate were much less effective VchCA inhibitors, with K Is in the range of 4.64–28.0 mM. The resistance of VchCA to bicarbonate inhibition may represent an evolutionary adaptation of this enzyme to living in an environment rich in this ion, such as the gastrointestinal tract, as bicarbonate is a virulence enhancer of this bacterium, as mentioned above. These findings are thus of extreme importance because they may help in engineering highly active α-CAs such as hCA II in order to obtain mutated enzymes with enhanced thermostability for use under the harsh conditions of the biotechnological processes. For example, the temperature of combustion gases or liquids into which the CO2 are dissolved may easily exceed the optimal temperature for the enzyme used in CO2 capture process. 3.7 𝛃-CAs in Pathogenic Bacteria β-CAs are found in bacteria, algae, and chloroplasts of both mono- and dicotyledons, and also in many fungi and some Archaea. CAs belonging to the β-class were cloned, purified, and characterized in many pathogenic bacteria, such as E. coli, Mycobacterium tuberculosis, Salmonella enterica, H. pylori, Haemophilus influenzae, and Streptococcus pneumoniae [16, 29]. A list of the β-CAs isolated from pathogens is presented in Table 3.1. The main difference between these enzymes and the α-CAs discussed above consists in the fact that usually the β-CAs are oligomers, generally formed of two to six monomers of molecular weight (of the monomer) of 25–30 kDa [35, 45, 50, 51]. The tridimensional structures of these enzymes are similar to that of the S. enterica isoform stCA 1, characterized by a long channel at the bottom of which the catalytic zinc ion is found, tetrahedrally coordinated by Cys42, Asp44, His98, and Cys101 (numbering system of stCA1). This is called closed active site as these enzymes are not catalytically active (at pH Table 3.1 β-CAs from bacteria cloned and characterized so far. Pathogen Helicobacter pylori Escherichia coli Haemophilus influenzae Mycobacterium tuberculosis Brucella suis Streptococcus pneumoniae Salmonella enterica Enzyme abbreviation hp𝛃CA EcoCA HICA mtCA1 mtCA2 mtCA3 mtCA4 bsCA1 bsCA2 PCA stCA1 stCA2 37 38 3 Developing Novel Bacterial Targets: Carbonic Anhydrases as Antibacterial Drug Targets values <8.3). At pH values >8.3, the “closed active site” is converted to the “open active site,” associated with a movement of the Asp residue from the catalytic Zn(II) ion, with the concomitant coordination of an incoming water molecule approaching the metal ion [35, 45, 50, 51]. This water molecule (as hydroxide ion) is in fact responsible for the catalytic activity, as for the α-CAs investigated in much greater detail. Many of these CAs reported in Table 3.1 displayed excellent activity for the CO2 hydration but lacked esterase activity, similar to the β-class enzymes isolated from other organisms (plants, arthropods, etc.). For some of these CAs in vitro and in vivo inhibition studies with various classes of inhibitors, such as anions, sulfonamides, and sulfamates, have been reported and are discussed in the following paragraphs. As mentioned above, the genome of H. pylori encodes for two different classes of CAs, with different subcellular localization: a periplasmic α-class CA (hpαCA) and a cytoplasmic β-class CA (hpβCA). These two CAs were shown to be catalytically efficient with almost identical activity to that of the human isoform hCA I, for the CO2 hydration reaction, and highly inhibited by many sulfonamides/sulfamates, including clinically used drugs [42, 43, 45]. In vivo, it was possible to observe inhibition of the bacterial growth for H. pylori, S. pneumoniae, Brucella suis, and M. tuberculosis. In fact, most of the sulfonamides possess a rather polar nature and may have problems passing through the cell membranes of many pathogenic bacteria. This was the case for M. tuberculosis possessing four β-CAs, which have good catalytic activity and are inhibited in the low nanomolar range by many sulfonamides [52, 53]. All in vivo inhibition studies with such CAIs only gave negative results (fort the inhibition of growth of the pathogen), but recently, Colina’s group showed that a class of phenol inhibitors possesses antimycobacterial activity in vitro and in vivo [52]. Unlike the sulfonamides, these derivatives were more lipophilic and probably are able to better penetrate through the bacterial cell walls. Thus, many of these β-CAs are in fact validated drug targets. Our group obtained in vitro inhibition data for several of these enzymes with sulfonamide/sulfamates, which represent one of the main classes of CAIs. These compounds are clinically used drugs, for example, AAZ, MZA, EZA, dichorophenamide DCP, DZA, BRZ, BZA, TPM, zonisamide ZNS, SLP, IND, celecoxib CLX, valdecoxib VLX, as diuretics, antiepileptics, antiglaucoma, and anti-inflammatory agents. It was observed that most CAs from bacterial pathogenic organisms are inhibited in the micro-nanomolar range by many such sulfonamide/sulfamate drugs [6, 35, 50, 54]. It is interesting to note that the research in this area may lead to highly effective and bacterial CA-selective compounds, which may validate these enzymes as antibacterial drug targets. Recently, Ferry and coworkers [55, 56] purified and characterized kinetically a β-CA in the pathogen Clostridium perfringens (named CpeCA). C. perfringens is the most common bacterial agent for gas gangrene, which is necrosis, putrefaction of tissues, and gas production. The gas gangrene is caused primarily by C. perfringens alpha toxin. Besides, C. perfringens is also the third most common cause of food poisoning in the United Kingdom and the United States though it can sometimes be ingested and cause no harm. The study of CAs in C. perfringens 3.8 γ-CAs from Pathogenic Bacteria provides the basis for developing better clostridial enzyme inhibitors with potential as anti-infectives with a new mechanism of action. Vullo et al. [55] described the first inhibition study of this β-CA. CpeCA was poorly inhibited by iodide and bromide, and was inhibited with KIs in the range of 1–10 mM by a range of anions such as (thio)cyanate, azide, bicarbonate, nitrate, nitrite, hydrogensulfite, hydrogensulfide, stannate, tellurate, pyrophosphate, divanadate, tetraborate, peroxydisulfate, sulfate, iminodisulfonate, and fluorosulfonate. Better inhibition, with K Is of 0.36–1.0 mM, was observed for cyanide, carbonate, selenate, selenocyanide, trithiocarbonate, and diethyldithiocarbamate, whereas the best CpeCA inhibitors were sulfamate, sulfamide, phenylboronic acid, and phenylarsonic acid, which had K Is in the range of 7–75 μM. 3.8 𝛄-CAs from Pathogenic Bacteria The γ-CAs were found in Archaea, bacteria, and plants. The prototype of the γ-class CAs, “Cam,” has been isolated from the methanogenic archaeon Methanosarcina thermophila [57–59]. The crystal structures of zinc-containing and cobalt-substituted Cam were reported in the unbound form and cocrystallized with sulfate or bicarbonate. Cam has several features that differentiate it from the α- and β-CAs. Thus, the protein fold is composed of a left-handed β-helix motif interrupted by three protruding loops and followed by short and long α-helices. Cam monomer self-associates in a homotrimer with the approximate molecular weight of 70 kDa. The Zn(II) ion within the active site is coordinated by three histidine residues, as in α-CAs, but relative to the tetrahedral coordination geometry seen at the active site of α-CAs; the active site of this γ-CA contains additional metal-bound water ligands, so that the overall coordination geometry is trigonal-bipyramidal for the zinc-containing Cam and octahedral for the cobalt-substituted enzyme [60, 61]. Two of the His residues coordinating the metal ion belong to one monomer (monomer A), whereas the third one is from the adjacent monomer (monomer B). Thus, the three active sites are located at the interface between pairs of monomers. The catalytic mechanism of γ-CAs was proposed to be similar to the one presented for the α-class enzymes. Still, the finding that Zn(II) is not tetracoordinated as originally reported but pentacoordinated, with two water molecules bound to the metal ion, demonstrates that much is still to be understood regarding these enzymes. At this moment, the zinc hydroxide mechanism is accepted as being valid for γ-CAs, as it is probable that an equilibrium exists between the trigonal-bipyramidal and the tetrahedral species of the metal ion from the active site of the enzyme [60, 61]. Our groups identified a γ-CA (denominated PgiCA) in the genome of the pathogenic bacterium Porphyromonas gingivalis, which is a Gram-negative oral anaerobe involved in the pathogenesis of periodontitis and arthritis [62, 63]. 39 40 3 Developing Novel Bacterial Targets: Carbonic Anhydrases as Antibacterial Drug Targets These are inflammatory diseases, which destroy the tissues supporting the tooth/bone, eventually leading to tooth loss as well as other serious conditions. More than 700 bacterial species colonize the oral cavity, but P. gingivalis is the species mainly associated with the chronic form of periodontitis. The open reading frame of the P. gingivalis gene encodes a 192 amino acid polypeptide chain, which displays 33 and 30% identity when compared with the prototypical γ-CAs CAM and CAMH, respectively. CAM and CAMH both belong to the γ-CA class and were isolated from the archaeon M. thermophila; they have been thoroughly characterized by Ferry’s group, as discussed above. PgiCA was shown to possess a significant catalytic activity for the reaction that converts the CO2 to bicarbonate and protons, with a k cat of 4.1 × 105 s−1 and a k cat /K m of 5.4 × 107 M−1 s−1 , thus being 62 times more effective as a catalyst compared to CAM (k cat /K m of 8.7 × 105 M−1 s−1 ) [62, 63]. Like most enzymes belonging to the CA superfamily, PgiCA was also inhibited by AAZ with inhibition constants of 324 nM whereas CAM was inhibited in the low nanomolar range (K I s of 63 nM). We have also investigated the inhibition profile of the new enzyme with a range of inorganic anions such as thiocyanate, cyanide, azide, hydrogen sulfide, sulfamate, and trithiocarbonate. These anions were effective PgiCA inhibitors with inhibition constants in the range of 41–97 μM [62, 63]. Other effective inhibitors were diethyldithiocarbamate, sulfamide, and phenylboronic acid, with K Is of 4.0–9.8 μM [62, 63]. The role of this enzyme as a possible virulence factor of P. gingivalis is poorly understood at the moment but its good catalytic activity and the possibility to be inhibited by a large number of compounds may lead to interesting developments in the field. 3.9 Conclusions The extensive use of antibiotics has led to serious public health problems due to the emergence of multiresistant bacterial pathogens worldwide. The recent cloning and characterization of many CAs in pathogenic bacteria and the proof of concept studies showing that these are potential drug targets and can lead to growth inhibition in these bacteria offer interesting new alternatives that were not yet fully exploited clinically. In many pathogenic bacteria, α-, β-, and γ-CAs have been cloned and characterized in detail in the last years. For some of these enzymes, the X-ray crystal structures were determined at high resolution, allowing a good understanding of the catalytic/inhibition mechanisms. Here, we have highlighted the existence of a great number of low nanomolar/micromolar CAIs targeting some of them, and belonging to various chemical classes (sulfonamides, sulfamates, sulfamides, carboxylates, phenols, etc.). The inhibitors targeting the α-, β-, and γ-CAs from many pathogenic bacteria may provide opportunities to identify novel antibacterial targets for the development of alternative classes of antibiotics and to design more potent antimicrobial compounds derived from the existing References antibiotics in clinical use for decades. This represents a fascinating research field that can lead to interesting developments in the antibacterial drug research. References 1. McCall, K.A., Huang, C., and Fierke, 2. 3. 4. 5. 6. 7. 8. 9. C.A. (2000) Function and mechanism of zinc metalloenzymes. J. Nutr., 130, 1437S–1446S. Reetz, M.T. (2012) Artificial metalloenzymes as catalysts in stereoselective Diels-Alder reactions. Chem. Rec., 12, 391–406. Vallee, B.L. and Auld, D.S. (1992) Active zinc binding sites of zinc metalloenzymes. Matrix, 1, 5–19. Feinberg, H., Greenblatt, H.M., and Shoham, G. (1993) Structural studies of the role of the active site metal in metalloenzymes. J. Chem. Inf. Comput. Sci., 33, 501–516. Lopez, M., Kohler, S., and Winum, J.Y. (2012) Zinc metalloenzymes as new targets against the bacterial pathogen Brucella. J. Inorg. Biochem., 111, 138–145. Nishimori, I., Minakuchi, T., Vullo, D., Scozzafava, A., and Supuran, C.T. (2011) Inhibition studies of the betacarbonic anhydrases from the bacterial pathogen Salmonella enterica serovar Typhimurium with sulfonamides and sulfamates. Bioorg. Med. Chem., 19, 5023–5030. Supuran, C.T. (2011) Bacterial carbonic anhydrases as drug targets: toward novel antibiotics? Front. Pharmacol., 2, 34. Vullo, D., Nishimori, I., Minakuchi, T., Scozzafava, A., and Supuran, C.T. (2011) Inhibition studies with anions and small molecules of two novel betacarbonic anhydrases from the bacterial pathogen Salmonella enterica serovar Typhimurium. Bioorg. Med. Chem. Lett., 21, 3591–3595. Vullo, D., De Luca, V., Scozzafava, A., Carginale, V., Rossi, M., Supuran, C.T., and Capasso, C. (2012) The first activation study of a bacterial carbonic anhydrase (CA). The thermostable alpha-CA from Sulfurihydrogenibium yellowstonense YO3AOP1 is highly activated by 10. 11. 12. 13. 14. 15. amino acids and amines. Bioorg. Med. Chem. Lett., 22, 6324–6327. Akdemir, A., Vullo, D., Luca, V.D., Scozzafava, A., Carginale, V., Rossi, M., Supuran, C.T., and Capasso, C. (2013) The extremo-alpha-carbonic anhydrase (CA) from Sulfurihydrogenibium azorense, the fastest CA known, is highly activated by amino acids and amines. Bioorg. Med. Chem. Lett., 23, 1087–1090. De Luca, V., Vullo, D., Scozzafava, A., Carginale, V., Rossi, M., Supuran, C.T., and Capasso, C. (2012) Anion inhibition studies of an alpha-carbonic anhydrase from the thermophilic bacterium Sulfurihydrogenibium yellowstonense YO3AOP1. Bioorg. Med. Chem. Lett., 22, 5630–5634. Luca, V.D., Vullo, D., Scozzafava, A., Carginale, V., Rossi, M., Supuran, C.T., and Capasso, C. (2013) An alpha-carbonic anhydrase from the thermophilic bacterium Sulphurihydrogenibium azorense is the fastest enzyme known for the CO(2) hydration reaction. Bioorg. Med. Chem., 21, 1534–1538. Vullo, D., De Luca, V., Scozzafava, A., Carginale, V., Rossi, M., Supuran, C.T., and Capasso, C. (2012) Anion inhibition studies of the fastest carbonic anhydrase (CA) known, the extremo-CA from the bacterium Sulfurihydrogenibium azorense. Bioorg. Med. Chem. Lett., 22, 7142–7145. Vullo, D., Luca, V.D., Scozzafava, A., Carginale, V., Rossi, M., Supuran, C.T., and Capasso, C. (2013) The alpha-carbonic anhydrase from the thermophilic bacterium Sulfurihydrogenibium yellowstonense YO3AOP1 is highly susceptible to inhibition by sulfonamides. Bioorg. Med. Chem., 21, 1465–14699. Nishimori, I., Vullo, D., Minakuchi, T., Scozzafava, A., Capasso, C., and Supuran, C.T. (2013) Restoring catalytic 41 42 3 Developing Novel Bacterial Targets: Carbonic Anhydrases as Antibacterial Drug Targets 16. 17. 18. 19. 20. 21. 22. 23. activity to the human carbonic anhydrase (CA) related proteins VIII, X and XI affords isoforms with high catalytic efficiency and susceptibility to anion inhibition. Bioorg. Med. Chem. Lett., 23, 256–260. Supuran, C.T. (2008) Carbonic anhydrases: novel therapeutic applications for inhibitors and activators. Nat. Rev. Drug Discovery, 7, 168–181. Del Prete, S., Vullo, D., Scozzafava, A., Capasso, C., and Supuran, C.T. (2014) Cloning, characterization and anion inhibition study of the delta-class carbonic anhydrase (TweCA) from the marine diatom Thalassiosira weissflogii. Bioorg. Med. Chem., 22, 531–536. Nishimori, I., Minakuchi, T., Onishi, S., Vullo, D., Scozzafava, A., and Supuran, C.T. (2007) Carbonic anhydrase inhibitors. DNA cloning, characterization, and inhibition studies of the human secretory isoform VI, a new target for sulfonamide and sulfamate inhibitors. J. Med. Chem., 50, 381–388. Sacarlal, J., Nhacolo, A.Q., Sigauque, B., Nhalungo, D.A., Abacassamo, F., Sacoor, C.N., Aide, P., Machevo, S., Nhampossa, T., Macete, E.V., Bassat, Q., David, C., Bardaji, A., Letang, E., Saute, F., Aponte, J.J., Thompson, R., and Alonso, P.L. (2009) A 10 year study of the cause of death in children under 15 years in Manhica, Mozambique. BMC Public Health, 9, 67. Nour, N.M. (2012) Premature delivery and the millennium development goal. Rev. Obstet. Gynecol., 5, 100–105. Gaynor, M. and Mankin, A.S. (2003) Macrolide antibiotics: binding site, mechanism of action, resistance. Curr. Top. Med. Chem., 3, 949–961. Rusconi, S., Scozzafava, A., Mastrolorenzo, A., and Supuran, C.T. (2004) New advances in HIV entry inhibitors development. Curr. Drug Targets Infect. Disord., 4, 339–355. Innocenti, A., Hall, R.A., Schlicker, C., Scozzafava, A., Steegborn, C., Muhlschlegel, F.A., and Supuran, C.T. (2009) Carbonic anhydrase inhibitors. Inhibition and homology modeling studies of the fungal beta-carbonic anhydrase from Candida albicans with 24. 25. 26. 27. 28. 29. 30. 31. 32. sulfonamides. Bioorg. Med. Chem., 17, 4503–4509. Maresca, A., Scozzafava, A., Kohler, S., Winum, J.Y., and Supuran, C.T. (2012) Inhibition of beta-carbonic anhydrases from the bacterial pathogen Brucella suis with inorganic anions. J. Inorg. Biochem., 110, 36–39. Supuran, C.T. (2012) Inhibition of bacterial carbonic anhydrases and zinc proteases: from orphan targets to innovative new antibiotic drugs. Curr. Med. Chem., 19, 831–844. Capasso, C. and Supuran, C.T. (2013) Anti-infective carbonic anhydrase inhibitors: a patent and literature review. Expert Opin. Ther. Pat., 23, 693–704. Bertucci, A., Innocenti, A., Scozzafava, A., Tambutte, S., Zoccola, D., and Supuran, C.T. (2011) Carbonic anhydrase inhibitors. Inhibition studies with anions and sulfonamides of a new cytosolic enzyme from the scleractinian coral Stylophora pistillata. Bioorg. Med. Chem. Lett., 21, 710–714. Temperini, C., Scozzafava, A., and Supuran, C.T. (2010) Carbonic anhydrase inhibitors. X-ray crystal studies of the carbonic anhydrase II-trithiocarbonate adduct--an inhibitor mimicking the sulfonamide and urea binding to the enzyme. Bioorg. Med. Chem. Lett., 20, 474–478. Supuran, C.T. (2010) Carbonic anhydrase inhibitors. Bioorg. Med. Chem. Lett., 20, 3467–3474. Sulek, K. (1968) Nobel prize for Gerhard Domagk in 1939 for discovery of the antibacterial activity of prontosil. Wiad. Lek., 21, 1089. Del Prete, S., Isik, S., Vullo, D., De Luca, V., Carginale, V., Scozzafava, A., Supuran, C.T., and Capasso, C. (2012) DNA cloning, characterization, and inhibition studies of an alpha-carbonic anhydrase from the pathogenic bacterium Vibrio cholerae. J. Med. Chem., 55, 10742–10748. Luca, V.D., Vullo, D., Scozzafava, A., Carginale, V., Rossi, M., Supuran, C.T., and Capasso, C. (2013) An alpha-carbonic anhydrase from the thermophilic bacterium Sulphurihydrogenibium azorense is the fastest enzyme References 33. 34. 35. 36. 37. 38. 39. known for the CO2 hydration reaction. Bioorg. Med. Chem., 21, 1465–1469. Monti, S.M., De Simone, G., Dathan, N.A., Ludwig, M., Vullo, D., Scozzafava, A., Capasso, C., and Supuran, C.T. (2013) Kinetic and anion inhibition studies of a beta-carbonic anhydrase (FbiCA 1) from the C4 plant Flaveria bidentis. Bioorg. Med. Chem. Lett., 23, 1626–1630. Pan, P., Vermelho, A.B., Capaci Rodrigues, G., Scozzafava, A., Tolvanen, M.E., Parkkila, S., Capasso, C., and Supuran, C.T. (2013) Cloning, characterization, and sulfonamide and thiol inhibition studies of an alpha-carbonic anhydrase from Trypanosoma cruzi, the causative agent of Chagas disease. J. Med. Chem., 56, 1761–1771. Vullo, D., Leewattanapasuk, W., Muhlschlegel, F.A., Mastrolorenzo, A., Capasso, C., and Supuran, C.T. (2013) Carbonic anhydrase inhibitors: inhibition of the beta-class enzyme from the pathogenic yeast Candida glabrata with sulfonamides, sulfamates and sulfamides. Bioorg. Med. Chem. Lett., 23, 2647–2652. Vullo, D., Luca, V.D., Scozzafava, A., Carginale, V., Rossi, M., Supuran, C.T., and Capasso, C. (2013) The alpha-carbonic anhydrase from the thermophilic bacterium Sulfurihydrogenibium yellowstonense YO3AOP1 is highly susceptible to inhibition by sulfonamides. Bioorg. Med. Chem., 21, 1534–1538. Cardoso, T., Ribeiro, O., Aragao, I.C., Costa-Pereira, A., and Sarmento, A.E. (2012) Additional risk factors for infection by multidrug-resistant pathogens in healthcare-associated infection: a large cohort study. BMC Infect. Dis., 12, 375. Cox, G.M., McDade, H.C., Chen, S.C., Tucker, S.C., Gottfredsson, M., Wright, L.C., Sorrell, T.C., Leidich, S.D., Casadevall, A., Ghannoum, M.A., and Perfect, J.R. (2001) Extracellular phospholipase activity is a virulence factor for Cryptococcus neoformans. Mol. Microbiol., 39, 166–175. Cox, G.M., Mukherjee, J., Cole, G.T., Casadevall, A., and Perfect, J.R. (2000) 40. 41. 42. 43. 44. 45. 46. Urease as a virulence factor in experimental cryptococcosis. Infect. Immun., 68, 443–448. Chirica, L.C., Elleby, B., Jonsson, B.H., and Lindskog, S. (1997) The complete sequence, expression in Escherichia coli, purification and some properties of carbonic anhydrase from Neisseria gonorrhoeae. Eur. J. Biochem./FEBS, 244, 755–760. Di Fiore, A., Capasso, C., De Luca, V., Monti, S.M., Carginale, V., Supuran, C.T., Scozzafava, A., Pedone, C., Rossi, M., and De Simone, G. (2013) X-ray structure of the first ‘extremo-alpha-carbonic anhydrase’, a dimeric enzyme from the thermophilic bacterium Sulfurihydrogenibium yellowstonense YO3AOP1. Acta Crystallogr. D Biol. Crystallogr., 69, 1150–1159. Morishita, S., Nishimori, I., Minakuchi, T., Onishi, S., Takeuchi, H., Sugiura, T., Vullo, D., Scozzafava, A., and Supuran, C.T. (2008) Cloning, polymorphism, and inhibition of beta-carbonic anhydrase of Helicobacter pylori. J. Gastroenterol., 43, 849–857. Nishimori, I., Minakuchi, T., Kohsaki, T., Onishi, S., Takeuchi, H., Vullo, D., Scozzafava, A., and Supuran, C.T. (2007) Carbonic anhydrase inhibitors: the betacarbonic anhydrase from Helicobacter pylori is a new target for sulfonamide and sulfamate inhibitors. Bioorg. Med. Chem. Lett., 17, 3585–3594. Nishimori, I., Minakuchi, T., Morimoto, K., Sano, S., Onishi, S., Takeuchi, H., Vullo, D., Scozzafava, A., and Supuran, C.T. (2006) Carbonic anhydrase inhibitors: DNA cloning and inhibition studies of the alpha-carbonic anhydrase from Helicobacter pylori, a new target for developing sulfonamide and sulfamate gastric drugs. J. Med. Chem., 49, 2117–2126. Nishimori, I., Onishi, S., Takeuchi, H., and Supuran, C.T. (2008) The alpha and beta classes carbonic anhydrases from Helicobacter pylori as novel drug targets. Curr. Pharm. Des., 14, 622–630. Nishimori, I., Vullo, D., Minakuchi, T., Morimoto, K., Onishi, S., Scozzafava, A., and Supuran, C.T. (2006) Carbonic anhydrase inhibitors: cloning 43 44 3 Developing Novel Bacterial Targets: Carbonic Anhydrases as Antibacterial Drug Targets 47. 48. 49. 50. 51. 52. 53. and sulfonamide inhibition studies of a carboxyterminal truncated alphacarbonic anhydrase from Helicobacter pylori. Bioorg. Med. Chem. Lett., 16, 2182–2188. Shahidzadeh, R., Opekun, A., Shiotani, A., and Graham, D.Y. (2005) Effect of the carbonic anhydrase inhibitor, acetazolamide, on Helicobacter pylori infection in vivo: a pilot study. Helicobacter, 10, 136–138. Del Prete, S., De Luca, V., Scozzafava, A., Carginale, V., Supuran, C.T., and Capasso, C. (2014) Biochemical properties of a new alpha-carbonic anhydrase from the human pathogenic bacterium, Vibrio cholerae. J. Enzyme Inhib. Med. Chem., 29, 23–27. Vullo, D., Isik, S., Del Prete, S., De Luca, V., Carginale, V., Scozzafava, A., Supuran, C.T., and Capasso, C. (2013) Anion inhibition studies of the alphacarbonic anhydrase from the pathogenic bacterium Vibrio cholerae. Bioorg. Med. Chem. Lett., 23, 1636–1638. Joseph, P., Ouahrani-Bettache, S., Montero, J.L., Nishimori, I., Minakuchi, T., Vullo, D., Scozzafava, A., Winum, J.Y., Kohler, S., and Supuran, C.T. (2011) A new beta-carbonic anhydrase from Brucella suis, its cloning, characterization, and inhibition with sulfonamides and sulfamates, leading to impaired pathogen growth. Bioorg. Med. Chem., 19, 1172–1178. Vullo, D., Nishimori, I., Scozzafava, A., Kohler, S., Winum, J.Y., and Supuran, C.T. (2010) Inhibition studies of a betacarbonic anhydrase from Brucella suis with a series of water soluble glycosyl sulfanilamides. Bioorg. Med. Chem. Lett., 20, 2178–2182. Buchieri, M.V., Riafrecha, L.E., Rodriguez, O.M., Vullo, D., Morbidoni, H.R., Supuran, C.T., and Colinas, P.A. (2013) Inhibition of the beta-carbonic anhydrases from Mycobacterium tuberculosis with C-cinnamoyl glycosides: identification of the first inhibitor with anti-mycobacterial activity. Bioorg. Med. Chem. Lett., 23, 740–743. Maresca, A., Vullo, D., Scozzafava, A., Manole, G., and Supuran, C.T. (2013) Inhibition of the beta-class carbonic 54. 55. 56. 57. 58. 59. 60. 61. anhydrases from Mycobacterium tuberculosis with carboxylic acids. J. Enzyme Inhib. Med. Chem., 28, 392–396. Guzel, O., Maresca, A., Hall, R.A., Scozzafava, A., Mastrolorenzo, A., Muhlschlegel, F.A., and Supuran, C.T. (2010) Carbonic anhydrase inhibitors. The beta-carbonic anhydrases from the fungal pathogens Cryptococcus neoformans and Candida albicans are strongly inhibited by substituted-phenyl-1Hindole-5-sulfonamides. Bioorg. Med. Chem. Lett., 20, 2508–2511. Vullo, D., Sai Kumar, R.S., Scozzafava, A., Capasso, C., Ferry, J.G., and Supuran, C.T. (2013) Anion inhibition studies of a beta-carbonic anhydrase from Clostridium perfringens. Bioorg. Med. Chem. Lett., 23, 6706–6710. Kumar, R.S., Hendrick, W., Correll, J.B., Patterson, A.D., Melville, S.B., and Ferry, J.G. (2013) Biochemistry and physiology of the beta class carbonic anhydrase (Cpb) from Clostridium perfringens strain 13. J. Bacteriol., 195, 2262–2269. Innocenti, A., Zimmerman, S., Ferry, J.G., Scozzafava, A., and Supuran, C.T. (2004) Carbonic anhydrase inhibitors. Inhibition of the zinc and cobalt gamma-class enzyme from the archaeon Methanosarcina thermophila with anions. Bioorg. Med. Chem. Lett., 14, 3327–3331. Zimmerman, S., Domsic, J.F., Tu, C., Robbins, A.H., McKenna, R., Silverman, D.N., and Ferry, J.G. (2013) Role of Trp19 and Tyr200 in catalysis by the gamma-class carbonic anhydrase from Methanosarcina thermophila. Arch. Biochem. Biophys., 529, 11–17. Zimmerman, S.A., Tomb, J.F., and Ferry, J.G. (2010) Characterization of CamH from Methanosarcina thermophila, founding member of a subclass of the {gamma} class of carbonic anhydrases. J. Bacteriol., 192, 1353–1360. Ingram-Smith, C., Gorrell, A., Lawrence, S.H., Iyer, P., Smith, K., and Ferry, J.G. (2005) Characterization of the acetate binding pocket in the Methanosarcina thermophila acetate kinase. J. Bacteriol., 187, 2386–2394. Lawrence, S.H., Luther, K.B., Schindelin, H., and Ferry, J.G. (2006) Structural and References functional studies suggest a catalytic 63. Del Prete, S., Vullo, D., De Luca, V., mechanism for the phosphotransacetyCarginale, V., Scozzafava, A., Supuran, lase from Methanosarcina thermophila. C.T., and Capasso, C. (2013) A highly J. Bacteriol., 188, 1143–1154. catalytically active gamma-carbonic anhydrase from the pathogenic anaer62. Del Prete, S., De Luca, V., Vullo, D., obe Porphyromonas gingivalis and its Scozzafava, A., Carginale, V., Supuran, inhibition profile with anions and small C.T., and Capasso, C. (2013) Biochemical molecules. Bioorg. Med. Chem. Lett., 23, characterization of the gamma-carbonic 4067–4071. anhydrase from the oral pathogen Porphyromonas gingivalis, PgiCA. J. Enzyme Inhib. Med. Chem., in press. 45 47 4 Magainins – A Model for Development of Eukaryotic Antimicrobial Peptides (AMPs) Sarah R. Dennison, Frederick Harris, and David A. Phoenix 4.1 Introduction Microbial infection is a threat constantly faced by all living creatures and it has long been known that the adaptive immune system provides protection against this threat. However, it has also long been known that plants and insects, which lack an adaptive immune system, remain free from these infections for most of the time. The reasons for this immunity from infection were largely a mystery until the answer was provided, in part, by the discovery of host defense peptides (HDPs) in both plants [1] and insects [2]. It is now known that HDPs are produced by all eukaryotes [3] and are critical effectors of both adaptive and innate immunity. Indeed, they serve a wide range of functions, including direct antimicrobial activity [4, 5] and a host of immune-modulatory effects [6, 7]. There is some debate as to what the discovery of HDPs should be attributed but it is generally accepted that two landmark studies in the 1980s played a major role in focusing research on these peptides [8]. In 1980, two peptides with antimicrobial activity, P9A and P9B, were isolated from the pupae of the silk moth, Hyalophora cecropia [2] and were characterized and renamed as the now familiar HDPs, “cecropins” [9]. Around 6 years later, peptides with antimicrobial activity were independently identified in skin secretions of the African clawed frog, Xenopus laevis, by Williams and colleagues [10] in the United Kingdom and by Zasloff [11] in the United States. The latter reported two closely related peptides, which were derived from a common, larger protein and non-hemolytic while possessing potent activity against numerous protozoa, fungi, and bacteria [11, 12]. On the basis of these results, Zasloff [11] observed that “ … these peptides may be responsible for the extraordinary freedom from infection characteristic of wound healing in this animal and appear to constitute a previously unrecognized vertebrate antimicrobial host defence system.” To recognize their role as HDPs in the defense systems of X. laevis, these peptides were named magainins 1 and 2 after the Hebrew word for “Shield” [11]. Since this seminal study, it has become clear that the host defense role of magainins is not restricted to X. laevis with homologs of these peptides identified in the skin secretions of other Novel Antimicrobial Agents and Strategies, First Edition. Edited by David A. Phoenix, Frederick Harris and Sarah R. Dennison. © 2015 Wiley-VCH Verlag GmbH & Co. KGaA. Published 2015 by Wiley-VCH Verlag GmbH & Co. KGaA. 48 4 Magainins – A Model for Development of Eukaryotic Antimicrobial Peptides (AMPs) Table 4.1 Magainins from Xenopodinae. Host frog Magainins Sequence of magainins References X. laevis X. laevis X. borealis X. borealis X. clivii X. clivii X. muelleri X. muelleri X. muelleri West X. petersii X. petersii X. amieti X. amieti X. andrei X. andrei X. pygmaeus X. pygmaeus X. lenduensis X. lenduensis X. laevis × X. muelleri hybrid S. tropicalis S. epitropicalis Magainin-1 Magainin-2 Magainin-B1 Magainin-B2 Magainin-C1 Magainin-C2 Magainin-M1 Magainin-M2 Magainin-MW1 Magainin-P1 Magainin-P2 Magainin-AM1 Magainin-AM2 Magainin-AN1 Magainin-AN2 Magainin-PG1 Magainin-PG2 Magainin-L1 Magainin-L2 Magainin-LM1 GIGKFLHSAGKFGKAFVGEIMKS GIGKFLHSAKKFGKAFVGEIMNS GKFLHSAGKFGKAFLGEVMIG GIGKFLHSAGKFGKAFLGEVMKS GVGKFLHSAKKFGQALASEIMKS GVGKFLHSAKKFGQALVSEIMKS GIGKFLHSAGKFGKAFIGEIMKS GFKQFVHSLGKFGKAFVGEMIKPK GIGKFLHSAGKFGKAFLGEVMKS GIGKFLHSAGKFGKAFVGEIMKS GIGQFLHSAKKFGKAFVGEIMKS GIKEFAHSLGKFGKAFVGGILNQ GVSKILHSAGKFGKAFLGEIMKS GIKEFAHSLGKFGKAFVGGILNQ GVSKILHSAGKFGKAFLGEIMKS GVGKFLHAAGKFGKALMGEMMKS GVSQFLHSASKFGKALMGEIMKS GIGKFLHSAKKFGKAFVGEVMKS GISQFLHSAKKFGKAFAGEIMKS GIGKFLHSAKKFAKAFVGEIMNS [13] [13] [13] [13] [13] [13] [13] [13] [13] [22] [22] [13] [13] [13] [13] [22] [22] [22] [22] [23] Magainin-ST1 Magainin-SE1 GLKEVAHSAKKFAKGFISGLTGS GLKEVLHSTKKFAKGFITGLTGQ [24] [25] This table shows magainins identified in various species of Xenopodinae. These peptides show considerable levels of sequence homology and phylogenetic analyzes have suggested that they may have evolved from a common ancestral gene by a series of duplication events [13]. Table 4.2 Major analogs of magainins. Magainin analog Peptide sequence Magainin-2a F5W-magainin-2 Magainin-A Magainin-H1 Magainin-H2 MSI-78 (Pexiganan) MSI-594 MSI-99 MSI-843 GIGKFLHSAKKFGKAFVGEIMNS-NH2 GIGKWLHSAKKFGKAFVGEIMNS (βA)IGKFLHAAKKFAKAFVAEIMNS-NH2 GIKKFLHIIWKFIKAFVGEIMNS IIKKFLHSIWKFGKAFVGEIMNI GIGKFLKKAKKFGKAFVKILKK-NH2 GIGKFLKKAKKGIGAVLKVLTTGL-NH2 GIGKFLKSAKKFGKAFVKILNS-NH2 Oct–OOLLOOLOOL–NH2 References [26] [27] [19] [28] [28] [29] [30] [31] [32] 4.2 Magainins and Their Antimicrobial Action species belonging to the genera Xenopus and Silurana, which together comprise the Xenopodinae (Table 4.1) [13]. Not long after their discovery, the therapeutic potential of magainins was recognized [14, 15] and in response, numerous analogs of these peptides have been developed to maximize broad spectrum antimicrobial activity and minimize cytotoxicity (Table 4.2) [16–21]. Currently, magainins and their derivatives are under development for novel usage in a number of medical and biotechnological applications. In this chapter, we present an overview of recent progress in major examples of these applications. 4.2 Magainins and Their Antimicrobial Action As one of the first families of HDPs to be discovered, there has been intense investigation into the structure/function relationships underpinning the antimicrobial action of magainins and their analogs [33, 34]. On the basis of these studies, it has been established that the ability of magainins and most other HDPs to kill microbes is generally related to their direct interactions with the membranes of these organisms rather than through the use of specific, chiral receptors [8, 35–37], although a few exceptions are known [8, 38–41]. To initiate these interactions, magainins, along with the vast majority of HDPs, carry a net positive charge, thereby allowing them to show increased selectivity for the negatively charged target microbial membranes over mammalian membranes, which exhibit no overall charge [8, 35]. Once in the interfacial environment of the targeted microbial membrane, magainins, which are unstructured in aqueous solution, undergo a conformational change to adopt high levels of α-helical secondary structure. These structures exhibit the spatial segregation of hydrophobic and hydrophilic residues [42], which allows magainins to orientate parallel to the microbial membrane surface such that their hydrophilic residues associate with the bilayer lipid head-group region while their hydrophobic residues interact with its apolar lipid acyl chains [33, 34]. It is generally accepted that this mode of bilayer partitioning represents an early step in the mechanisms Table 4.3 Major membrane disruptive mechanisms for magainins and analogs. Mechanisms Magainins and analogs Toroidal pore Disordered toroidal pore Aggregate model Interfacial activity model Chaotic or non-stoichiometric model Carpet mechanism Membrane thinning/thickening Charged lipid clustering Magainin-2 Magainin-H2 Magainin-2 and analogs Magainin-2 Magainin-2 F5W-magainin-2 Magainin-2 MSI-78 and analogs References [48] [62] [49] [63] [64] [65] [66] [67] 49 50 4 Magainins – A Model for Development of Eukaryotic Antimicrobial Peptides (AMPs) used by magainins to disrupt microbial membranes, although a number of other models have been presented to describe these mechanisms (Table 4.3) [8, 43–47]. The most commonly cited model was first presented in the 1990s and proposes that these peptides induce the death of microbial cells through toroidal pore formation [48, 49]. Essentially, this model involves the association of magainins with membrane lipids to form a supramolecular arrangement of high curvature, thereby transiently forming pores that can induce cell death through membrane dysfunction and the leakage of essential cellular contents (Figure 4.1) [34, 44]. Variants of this model have been proposed by more recent studies (Table 4.3) [8, 50–53]. However, regardless of the specific antimicrobial Lys 11 Lys 14 Lys 10 Lys 4 N (a) C Phe 12 Phe 5 Phe 16 + + + + + + + (b) Figure 4.1 Magainins and membrane interaction. Figure (a) shows magainin-2, which is generally accepted as the prototype of α-helical HDPs [8]. The α-helical architecture of the peptide shows a segregation of polar and apolar amino acid residues, giving the molecule amphiphilic characteristics. For clarity, the polar face of the α-helix is indicated by the peptide’s lysine residues and its apolar face residues by phenylaniline residues. Figure (b) shows magainin-2 permeabilizing the membrane using a toroidal pore mechanism. Initially, the peptide is orientated parallel to the bilayer surface with its apolar residues buried in the hydrophobic membrane core and its polar residues associating with the lipid head-group region. + + + However, the aggregation of magainin-2 molecules on the membrane surface imposes a positive curvature strain by increasing the distance between membrane lipid head groups. When the aggregation of these peptide molecules reaches a critical concentration, they realign perpendicular to the bilayer, causing the membrane surface to cavitate inwards and ultimately form a pore. In this pore, magainin-2 molecules remain in close association with membrane lipid head groups such that these pores are lined by polar lipid head groups and hydrophilic surfaces of peptide molecules. These pores can then induce cell death through membrane dysfunction and the leakage of essential cellular contents [8]. 4.3 Magainins as Antibiotics mechanisms ascribed to magainins, these mechanisms are relatively nonspecific and generally involve attack on multiple hydrophobic/polyanionic targets as opposed to the limited number of targets used by conventional antibiotics [54]. On the basis of these observations, it is generally believed that it is difficult for microbes to acquire resistance to the action of magainins and other HDPs [5, 55, 56]. For example, using experimental evolution, multiple passages at sub-inhibitory concentrations of magainins were required to produce bacterial strains that were nonsusceptible to these peptides [57, 58]. These observations clearly give magainins and other HDPs a major advantage over conventional antibiotics and make them attractive propositions for development as potential next generation antimicrobials [54, 59–61]. 4.3 Magainins as Antibiotics Efforts to develop magainins as clinically relevant antibiotics stem from studies in the 1990s, which focused on the effect of changing a variety of structural and physiochemical properties on the antimicrobial action of these peptides [49, 68] including amino acid composition, sequence length, charge, and α-helicity [18, 19, 21, 69, 70]. The insight gained from these studies coupled with that gained from further structure/function studies by Zasloff and colleagues led to the development of MSI-78 or pexiganan [71], which is a more cationic analog of magainin 2 that contains five additional lysine residues and an α-amidated C-terminus (Table 4.2). Since these studies, MSI-78 has been extensively characterized and shown to possess activity against a broad range of Gram-positive and Gram-negative bacteria that involves membrane disruption via a toroidal pore-type mechanism, which appears to be generally the case for all magainins and their analogs so far tested [42, 72, 73]. The therapeutic potential of MSI-78 as an antibiotic for systemic administration was suggested by in vitro studies, which showed that the peptide was able to synergize the action of a number of β-lactams against bacteria responsible for bloodstream infections in neutropenic patients, including Staphylococci, which are currently the primary cause of nosocomial bacteremia [74]. A similar potential was suggested for magainin-2 when it was found that the peptide synergized the activity of a range of conventional antibiotics against both Gram-positive and Gram-negative organisms. In particular, the peptide was able to strongly enhance the action of β-lactams such as ceftriaxone and meropenem against strains of oxacillin-resistant Staphylococcus aureus, which were resistant to these antibiotics when acting alone [8, 75]. On the basis of these observations, it was suggested that magainins and their analogs may be able to synergize the systemic administration of conventional antibiotics to combat microbial pathogens [14]. Strongly supporting this suggestion, the administration of magainins was found to synergize various β-lactams such as cefepime in the treatment of Escherichia coli 51 52 4 Magainins – A Model for Development of Eukaryotic Antimicrobial Peptides (AMPs) infections in both mice and mice with induced neutropenia [14, 76, 77]. More recently, using a rat model of septic shock, several studies showed that the administration of magainin 1, magainin 2, magainin 2a, and MSI-78, either alone or in combination with β-lactams, strongly inhibited the growth of Gram-negative bacteria. The highest antibacterial efficacy obtained in these studies was observed following the co-administration of these peptides with piperacillin and iminipem. This was accompanied by strong reductions in the plasma endotoxin levels normally associated with β-lactam activity and attributed to the ability of magainins to bind lipopolysaccharide (LPS). On the basis of these observations, it was suggested that β-lactams and/or magainins and their analogs may act as lead compounds for the investigation of novel agents with activity against septic shock induced by Gram-negative pathogens [78, 79]. A recently developed strategy to synergize the activity of HDPs and conventional antibiotics has been to conjugate the two molecules [80]. For example, magainin 2 and a truncated analog were conjugated to vancomycin and it was found that the conjugated magainin analog showed increased antibacterial activity against vancomycin-resistant Enterococci as compared to vancomycin alone [81]. Currently, the major therapeutic potential shown by MSI-78 is for topical application as an antibacterial agent, which developed from studies on the peptide’s ability to treat a variety of conditions such as impetigo and its ability to support wound healing associated with various infections [71, 72]. These studies led to MSI-78 becoming the first of the HDPs to undergo commercial development [54, 82] when the peptide entered clinical trials for the topical treatment of diabetic foot ulcers [59, 71, 72] whose infections are the most common causes of hospitalizations and amputations in diabetic patients [83]. In phase III trials, MSI78 achieved clinical cure or improvement in about 90% of diabetic patients with infected foot ulcers and the peptide was well tolerated by these individuals. However, the US Food and Drug Administration (FDA) did not approve marketing of the peptide after concluding that it offered no improvement over the conventional treatment of foot ulcers with ofloxacin, a fluoroquinolone antibiotic [59, 72, 84]. However, this conclusion has been questioned [84, 85] and there is hope that MSI-78 may yet achieve commercial success with advances in areas such as peptide manufacturing and clinical trial design [59, 72, 84]. In response, there has been continuing research into mechanisms by which the peptide exerts its membrane interactions and antibacterial activity [47, 86–99]. In general, these studies support the toroidal pore mechanism proposed for microbial membrane disruption by MSI-78 and have provided further insight into the dynamics of the peptide–lipid interactions involved in the use of this mechanism [91, 96, 99]. These studies have also emphasized the importance of membrane composition to the selectivity of MSI-78 for bacterial cells over eukaryotic cells [95] and the ability of the peptide to inactivate bacteria, particularly the role of anionic lipid [67]. The presence of anionic lipid in bacterial membranes is key to the ability of MSI-78 to target and disrupt these membranes but the presence of high levels of this lipid in the bilayer was shown to inhibit this disruptive ability [86]. Consistent with these results, the binding of strongly cationic MSI-78 to LPS, which is the 4.3 Magainins as Antibiotics major anionic component of the outer membrane, was found to inhibit the ability of the peptide to traverse these membranes and thereby its potential to induce the death of some Gram-negative bacteria via disruption of the inner membrane [89]. A number of studies have shown that MSI-78 is able to induce the segregation of anionic lipids from zwitterionic lipids within the inner membranes of Gramnegative bacteria [47] and different anionic lipids from one another within the inner membranes of Gram-positive bacteria [97]. In both cases, it was proposed that this anionic lipid clustering effect could play an important role in the antibacterial mechanism of MSI-78 such as by contributing to membrane disruption and impairing the function of bilayer proteins [47, 97]. The insight provided by the continuing structure/function studies on MSI-78 has helped not only to provide a clearer picture of the antibacterial action used by the peptide but has also made an important contribution to efforts aimed at producing novel analogs and structural mimics of MSI-78 with improved stability and antimicrobial efficacy. A comprehensive review of these novel compounds is beyond the scope of this chapter, but a survey of the literature over the last decade showed that these compounds include de novo peptides [100], acylated analogs [32, 101, 102], fluorinated analogs [99, 103–106], polyethylene glycol (PEG) ylated analogs [107], β-peptides [108], peptoids [109, 110], oligourea polymers [111, 112], aryl-based compounds [113, 114], poly(amidoamine) dendrimers [115], polynorbornenes [116], meta-phenylene ethynylenes [117, 118], and other “MSI” compounds [16, 30, 32, 47, 87, 92–95, 97, 98, 119–135]. Many of these molecules are membrane interactive and show antibacterial activity, which is comparable or superior to that of MSI-78, but in general, they are not well studied with the best characterized belonging to the “MSI” group of compounds [16, 30, 32, 47, 87, 92–95, 97, 98, 119–135]. For example, MSI-843 is a 10 residue lipopeptide, which contains 6 ornithine residues and a conjugated C-terminal octanyl moiety (Table 4.2), and was originally developed as a potential treatment for Pseudomonas aeruginosa infection in cystic fibrosis patients [136]. More recent studies have shown that MSI-843 has activity against other Gram-negative organisms, including E. coli as well as Gram-positive bacteria such as S. aureus [32, 47, 67]. On the basis of this broad range antibacterial activity, the lipopeptide has recently been included in a patent, along with MSI-78 and MSI-594, for use in the treatment of infections associated with disorders of the skin [137] and sinonasal cavity [138]. In other studies, MSI-751 (N-amidino-phenylalanyl-dioctylamide) and MSI-774 (1,12-[Di-(N-amidino-arginine-phenylalanyl)]diaminododecane) were found to show potent and rapid antibacterial activity when directed against a range of oral pathogens such as Porphyromonas gingivalis, Fusobacterium nucleatum, and Prevotella spp., which led to the suggestion that these peptides may be suitable for development as agents in the prevention and treatment of periodontal diseases [119]. On the basis of the progress made in the development of magainins and their analogs from X. laevis, over the last few years a number of studies have investigated the antibacterial capabilities of magainins recently identified in other species of the Xenopodinae and hybrids of these species (Table 4.4) [139, 140]. 53 54 4 Magainins – A Model for Development of Eukaryotic Antimicrobial Peptides (AMPs) Table 4.4 The antimicrobial and hemolytic abilities of representative magainins. Magainin S. aureus Magainin-1 Magainin-2 Magainin-B1 Magainin-B2 Magainin-C1 Magainin-C2 Magainin-P1 Magainin-P2 Magainin-M1 Magainin-MW1 Magainin-AM1 Magainin-AM2 Magainin-AN2 Magainin-PG1 Magainin-PG2 Magainin-L1 Magainin-L2 Magainin-ST1 Magainin-SE1 < 40 < 40 > 100 50 > 100 > 100 > 50 > 50 50 > 200 > 200 50 > 100 > 50 > 50 > 50 > 50 > 256 > 160 E. coli Candida albicans < 40 < 30 > 100 > 100 100 50 > 50 > 50 12.5 50 > 200 > 200 100 > 50 > 50 > 50 > 50 64 > 160 — 35 — 100 — — — — 25 100 — — — — — — — — — EC50 430 430 — > 200 > 200 > 200 > 50 > 50 180 > 200 — — — > 50 > 50 > 50 > 50 > 256 > 160 References [58, 69, 75, 149] [11, 69, 75, 149, 150] [151] [151] [152] [152] [22] [22] [141] [141] [143] [143] [142] [22] [22] [22] [22] [24] [25] Interestingly, hybrids resulting from a cross between frogs from X. laevis and Xenopus muelleri expressed a novel peptide, magainin-LM1, which was absent from both parental species, although its antimicrobial activity has not yet been investigated [23]. These more recently described magainins are as yet not well characterized but showed similarities to their counterparts in X. laevis, including strong cationicity, significant levels of sequence homology and very low levels of hemolysis (Table 4.4) [13]. However, only magainin-M1 appeared to have broad spectrum antibacterial activity (Table 4.4) comparable to that of magainins 1 and 2 and may therefore be suitable for development as a clinically relevant antibacterial. The remaining recently described magainins showed only weak antibacterial activity with differing specificities (Table 4.4) and it was suggested that in vivo, these peptides may serve to synergize the activity of other HDPs and thereby offer better defense to the host frog against infections [23, 24, 139, 141, 142, 143] as has been demonstrated for magainins from X. laevis [42]. Indeed, it has been suggested that this antimicrobial synergism may play a role in defending Xenopus and other species against Batrachochytrium dendrobatidis [13, 144], whose lethal skin infections are currently responsible for a devastating global decline in amphibian populations [145]. Clearly, weak antibacterial activity may limit the potential of some individual magainins for development as useful anti-infectives. However, in cases such as magainin-AM1 (Table 4.4), it has been suggested that these weakly antibacterial peptides may serve some other primary biological activity, allowing the possibility of development for other therapeutic applications 4.4 Other Antimicrobial Uses of Magainins [143] or use in combination with conventional antibiotics. Consistent with this suggestion, a very recent study showed that both magainin-AM1 and magaininAM2 possessed a potent ability to stimulate secretion of glucagon-like peptide 1 and exert direct effects on insulin secretion [146]. Insulin-releasing actions have been demonstrated for HDPs from a number of frogs [147], including Xenopus and Silurana [148], and it was suggested that magainin-AM1 and magainin-AM2 may possess the potential to act as therapeutic agents for the treatment of type 2 diabetes [146]. 4.4 Other Antimicrobial Uses of Magainins In comparison with their antibacterial and antifungal activities, there have been relatively few studies on the antiviral capabilities of magainins. However, it has been shown that magainin-2, magainin-1, and some “MSI” compounds, such as MSI-594 (Table 4.2), are able to inhibit herpes simplex virus (HSV) [16, 122, 153–157], which causes chronic, recurrent genital infections and, globally, is the most frequent cause of genital ulceration [158]. In the case of each of these magainins, their antiviral activity appeared to involve disruption of the viral envelope and it was proposed that MSI-594 and several of its analogs may be suitable for development as therapeutically useful antiviral agents [16, 122, 153–157]. Moreover, taken with the fact that magainin-A inhibits the growth of bacterial pathogens such as Neisseria gonorrhoeae [159], which cause sexually transmitted infections (STIs) [160–162], these combined results led to the suggestion that magainins may also have the potential to act as broad spectrum agents in the prevention of these infections [16, 61, 163, 164]. Strongly supporting this suggestion, a number of “MSI” compounds, such as MSI-420 and MSI-591 [16, 122], have been patented for topical application in the treatment of STIs [165]. Magainins represent one of the few groups of HDPs that have been investigated for their potential to act as contraceptive agents [61, 163, 164, 166]. Earlier studies showed that magainin-2a, magainin-G, and magainin-A possessed spermicidal activity based on their ability to arrest sperm mobility in the case of hamsters [167] and humans [168–170]. This effect appeared to be related to the ability of these peptides to disrupt the outer plasma membrane of sperm cells and was enhanced by the removal of cholesterol from these membranes, which occurs during capacitation in vivo [168–170]. It is well established that this sterol is able to modulate the interaction of magainins with mammalian membranes and thereby plays a major role in the preference of these peptides for prokaryotic membranes [95, 171, 172]. Further studies on magainin-A showed that the intravaginal administration of the peptide immediately prior to insemination prevented conception through the spermicidal activity of the peptide in the cases of rats [169], rabbits [173], and the monkey, Macaca radiata [159]. However, the intravaginal administration of another magainin analog, (Ala8,13,18)-magainin-2a, after successful 55 56 4 Magainins – A Model for Development of Eukaryotic Antimicrobial Peptides (AMPs) insemination prevented conception in the monkey Macaca mulatta through the peptide’s ability to inhibit the pre-implantation of embryos [174]. Magainin-2a was also shown to exhibit toxicity to pre-implantation embryos in in vitro studies on mice [175, 176] and while the mechanisms underpinning the embryotoxic activities of this peptide and (Ala8,13,18)-magainin-2a remained unclear, it was suggested that they may involve the interaction of these cationic peptides with anionic surface components in the cytoplasmic membranes of early placental trophoblasts, thereby adversely affecting their growth, differentiation, and function [177, 178]. These various magainins and analogs were found to show low levels of hemolysis and cytotoxicity in vaginal cells, which led to the suggestion that they may be suitable for development as dual function microbicides, capable of reducing the risk of STIs as well as providing fertility control [61, 159, 169, 173–176]. A role in crop protection was suggested for magainins when in vitro studies showed that magainin-2, and MSI-99, which is a close analog of MSI-78 (Table 4.2) [179], exhibited activity against Gram-positive bacteria such as Clavibacter michiganensis, Gram-negative organisms such as Pseudomonas syringae, and fungi such as Penicillium digitatum [31], which are phytopathogens responsible for a variety of plant diseases [180–182]. These results led a very recent study to design de novo analogs of magainin-2, which showed potent activity against a broad range of phytopathogens, including C. michiganensis and P. syringae, but exhibited no toxicity toward human cells or plant protoplasts [100]. Similarly to naturally occurring magainins [42], these analogs appeared to utilize membrane disruptive mechanisms to facilitate their antimicrobial action, and it was suggested that they may serve in crop protection either as components in microbicidal sprays for external application or as transgene products to bolster plant immune defense systems [100]. The results of this latter study and other work [31, 100] led to the suggestion that MSI-99 could also be used as a transgene product to endow plants with resistance to microbial infections and diseases [183]. In response, the peptide was expressed via the chloroplast genome in transgenic tobacco plants to give high levels of production, which was found to provide protection against pathogenic microbes without harmful effects to either the host plants or their chloroplasts [125]. Since these studies, it has been shown that similar protection is provided by transgenic expression of MSI-99 in a variety of plants and crops, including other tobaccos [124, 126], soybeans [135], grapes [128, 130–133], bananas [124], tomatoes [123], potatoes [127, 134], and rape seed [184]. A number of investigations have suggested that magainins and analogs have the potential to act as biocides for the treatment of microbial biofilms [59, 117, 185, 186], which are becoming increasingly problematic in areas such as the food chain and the medical arena because of the development of resistance to established antimicrobial strategies [187–190]. To form biofilms, microbes attach to a surface and proliferate under favorable conditions, which leads to the formation of a polysaccharide matrix with embedded microbial cells that are up to a thousand times less susceptible to antibiotics and other biocides than their planktonic counterparts [186]. In response, the anti-biofilm potential of magainins immobilized on to surfaces was investigated, which was strongly supported 4.5 Future Prospects for Magainins when magainin-2 and several of its analogs were covalently bound to polymeric beads and found to retain their antimicrobial activity [191, 192]. Magainin-1 has also been shown to retain its antimicrobial activity when immobilized onto a number of other surfaces, including titanium oxide [193], stainless steel [194], and gold [195]. In a very recent study, the peptide was linked to polymer brushes [196], which are assemblies of macromolecules tethered at one end to a substrate [197]. This coating was used to immobilize magainin-1 onto a silica surface, which then showed antimicrobial activity, and it was suggested that these functionalized antimicrobial brushes possessed the potential for generic application to surfaces [196]. In each of these studies, magainin-1 was found to possess potent activity against a variety of bacterial pathogens, including Listeria ivanovii and Bacillus cereus, [191–196], which are Gram-positive bacteria involved in food-borne diseases that exhibit strong abilities to form biofilms [198, 199]. In combination, these studies clearly suggest that immobilized magainins and their analogs have the potential to inhibit or prevent microbial colonization and growth on surfaces and thereby endow substrates with antimicrobial functionality against biofilms [191–196]. Immobilized magainins have also been used as recognition molecules to capture target bacteria and thereby serve as selective probes for pathogenic organisms in a series of recently developed methodologies. In two cases, magainin-1 was immobilized onto glass slides and the target bacteria detected either by a labeled fluorescent dye [200] or by a target-specific antibody [201]. In another case, this peptide was immobilized onto gold microelectrodes to form part of an electronic biosensor, which facilitated the selective detection of pathogenic bacteria via impedance spectroscopy [202]. Most recently, magainin2 was immobilized onto a nitrocellulose membrane and used as a recognition molecule for bacteria in a lateral flow assay, which uses target-specific antibodies as a detection technique [203]. In each of these studies, it was found that immobilized magainins exhibited high sensitivity in the detection of bacterial pathogens such as E. coli O157:H7 and Salmonella typhimurium [200–203], two of the most prolific causes of food-borne illness worldwide [204, 205]. 4.5 Future Prospects for Magainins Magainins were one of the first families of HDPs to be discovered and are now universally taken as the prototypes of HDPs [8]. The impact of magainins on research into the development of HDPs is unquestionable, reflected in the fact that a database search on magainins shows that nearly 1500 manuscripts have been published on them over the last 25 years, with production increasing annually. The structure/function relationships gleaned from these peptides has led to the production of a multitude of analogs and structural mimics of magainins, many of which have antimicrobial activity and the potential for future therapeutic development and thereby, commercialization. Indeed, although generally beyond the scope of this chapter, it has become generally accepted that another property 57 58 4 Magainins – A Model for Development of Eukaryotic Antimicrobial Peptides (AMPs) of many HDPs is anticancer activity [206] and many magainin-derived molecules are being developed in this capacity [206, 207]. Studies on magainins have also led to the identification of a number of previously unknown magainins, which form a family of closely related, naturally occurring HDPs that can be used to relate structure to function and thereby lead to the design of more efficient antimicrobial agents. Interestingly, the majority of these newer magainins are far less potent than those from X. laevis and it is a tantalizing thought as to how the future of HDPs might have progressed if Michael Zasloff had studied a different frog from the Xenopodinae! Magainins also blazed the trail for the commercialization of HDPs in the form MSI-78 and there are now over a dozen of these peptides at various stages of clinical trials [54]. The refusal of the FDA to grant marketing approval was described by Zasloff as “a total miscarriage of the approval process” and it has since been observed that this verdict was based on, at least, questionable ethics [84]. However, under pressure from the pharmaceutical industry, there have been recent changes in FDA regulations governing the approval for marketing of new drugs and antibiotics for human use [208]. Since then, it has been observed that these changes could bring MSI-78 through to new clinical trials to achieve its full potential [209]. Indeed, it has recently been observed that HDPs are the new frontier in the therapy of infections [60] and as shown in this chapter, magainins are on the front line. References 1. Fernandez de Caleya, R., Gonzalez- 2. 3. 4. 5. Pascual, B., Garcia-Olmedo, F., and Carbonero, P. (1972) Susceptibility of phytopathogenic bacteria to wheat purothionins in vitro. Appl. Microbiol., 23, 998–1000. Hultmark, D., Steiner, H., Rasmuson, T., and Boman, H.G. (1980) Insect immunity – purification and properties of 3 inducible bactericidal proteins from hemolymph of immunized pupae of hyalophora-cecropia. Eur. J. Biochem., 106, 7–16. Wang, G., Li, X., and Wang, Z. (2009) APD2: the updated antimicrobial peptide database and its application in peptide design. Nucleic Acids Res., 37, D933–D937. Li, Y., Xiang, Q., Zhang, Q., Huang, Y., and Su, Z. (2012) Overview on the recent study of antimicrobial peptides: origins, functions, relative mechanisms and application. Peptides, 37, 207–215. Pasupuleti, M., Schmidtchen, A., and Malmsten, M. (2012) Antimicrobial 6. 7. 8. 9. 10. peptides: key components of the innate immune system. Crit. Rev. Biotechnol., 32, 143–171. Choi, K.-Y., Chow, L.N.Y., and Mookherjee, N. (2012) Cationic host defence peptides: multifaceted role in immune modulation and inflammation. J. Innate Immun., 4, 361–370. Steinstraesser, L., Kraneburg, U., Jacobsen, F., and Al-Benna, S. (2011) Host defense peptides and their antimicrobial-immunomodulatory duality. Immunobiology, 216, 322–333. Phoenix, D.A., Dennison, S.R., and Harris, F. (2013) Antimicrobial Peptides, Wiley-VCH Verlag GmbH, Weinheim. Steiner, H., Hultmark, D., Engstrom, A., Bennich, H., and Boman, H.G. (1981) Sequence and specificity of 2 antibacterial proteins involved in insect immunity. Nature, 292, 246–248. Giovannini, M.G., Poulter, L., Gibson, B.W., and Williams, D.H. (1987) Biosynthesis and degradation of peptides References 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. derived from Xenopus-laevis prohormones. Biochem. J., 243, 113–120. Zasloff, M. (1987) Magainins, a class of antimicrobial peptides from xenopus skin – isolation, characterization of 2 active forms, and partial cDNA sequence of a precursor. Proc. Natl. Acad. Sci. U.S.A., 84, 5449–5453. Terry, A.S., Poulter, L., Williams, D.H., Nutkins, J.C., Giovannini, M.G., Moore, C.H., and Gibson, B.W. (1988) The cDNA sequence coding for prepro-PGS (prepro-magainins) and aspects of the processing of this prepro-polypeptide. J. Biol. Chem., 263, 5745–5751. Conlon, J.M., Mechkarska, M., and King, J.D. (2012) Host-defense peptides in skin secretions of African clawed frogs (Xenopodinae, Pipidae). Gen. Comp. Endocrinol., 176, 513–518. Jacob, L. and Zasloff, M. (1994) in Antimicrobial Peptides (eds J. Marsh and J.A. Goode), John Wiley & Sons, Ltd, Chichester, pp. 197–216. Chopra, I. (1993) The magainins – antimicrobial peptides with potential for topical application. J. Antimicrob. Chemother., 32, 351–353. Zasloff, M. (2002) Amphibian antimicrobial peptides, in Peptide Antibiotics (eds C.J. Dutton, M.A. Haxell, H.A.I. McArthur, and R.G. Wax), Marcel Dekker Inc. Iwahori, A., Hirota, Y., Sampe, R., Miyano, S., Takahashi, N., Sasatsu, M., Kondo, I., and Numao, N. (1997) On the antibacterial activity of normal and reversed magainin 2 analogs against Helicobacter pylori. Biol. Pharm. Bull., 20, 805–808. Bessalle, R., Haas, H., Goria, A., Shalit, I., and Fridkin, M. (1992) Augmentation of the antibacterial activity of magainin by positive-charge chain extension. Antimicrob. Agents Chemother., 36, 313–317. Chen, H.C., Brown, J.H., Morell, J.L., and Huang, C.M. (1988) Synthetic magainin analogs with improved antimicrobial activity. FEBS Lett., 236, 462–466. Dathe, M., Nikolenko, H., Meyer, J., Beyermann, M., and Bienert, M. (2001) Optimization of the antimicrobial 21. 22. 23. 24. 25. 26. 27. activity of magainin peptides by modification of charge. FEBS Lett., 501, 146–150. Cuervo, J.H., Rodriguez, B., and Houghten, R.A. (1988) The magainins: sequence factors relevant to increased antimicrobial activity and decreased hemolytic activity. Pept. Res., 1, 81–86. King, J.D., Mechkarska, M., Coquet, L., Leprince, J., Jouenne, T., Vaudry, H., Takada, K., and Conlon, J.M. (2012) Host-defense peptides from skin secretions of the tetraploid frogs Xenopus petersii and Xenopus pygmaeus, and the octoploid frog Xenopus lenduensis (Pipidae). Peptides, 33, 35–43. Mechkarska, M., Meetani, M., Michalak, P., Vaksman, Z., Takada, K., and Conlon, J.M. (2012) Hybridization between the African clawed frogs Xenopus laevis and Xenopus muelleri (Pipidae) increases the multiplicity of antimicrobial peptides in skin secretions of female offspring. Comp. Biochem. Physiol. D: Genomics Proteomics, 7, 285–291. Roelants, K., Fry, B.G., Ye, L.M., Stijlemans, B., Brys, L., Kok, P., Clynen, E., Schoofs, L., Cornelis, P., and Bossuyt, F. (2013) Origin and functional diversification of an amphibian defense peptide arsenal. PLoS Genet., 9, e1003662. Conlon, J.M., Mechkarska, M., Prajeep, M., Sonnevend, A., Coquet, L., Leprince, J., Jouenne, T., Vaudry, H., and King, J.D. (2012) Host-defense peptides in skin secretions of the tetraploid frog Silurana epitropicalis with potent activity against methicillin-resistant Staphylococcus aureus (MRSA). Peptides, 37, 113–119. Soravia, E., Martini, G., and Zasloff, M. (1988) Antimicrobial properties of peptides from xenopus granular gland secretions. FEBS Lett., 228, 337–340. Matsuzaki, K., Murase, O., Tokuda, H., Funakoshi, S., Fujii, N., and Miyajima, K. (1994) Orientational and aggregational states of Magainin 2 in phospholipid bilayers. Biochemistry, 33, 3342–3349. 59 60 4 Magainins – A Model for Development of Eukaryotic Antimicrobial Peptides (AMPs) 28. Tachi, T., Epand, R.F., Epand, R.M., 29. 30. 31. 32. 33. 34. 35. 36. 37. and Matsuzaki, K. (2002) Positiondependent hydrophobicity of the antimicrobial magainin peptide affects the mode of peptide−lipid interactions and selective toxicity†. Biochemistry, 41, 10723–10731. Hallock, K.J., Lee, D.K., and Ramamoorthy, A. (2003) MSI-78, an analogue of the magainin antimicrobial peptides, disrupts lipid bilayer structure via positive curvature strain. Biophys. J., 84, 3052–3060. Domadia, P.N., Bhunia, A., Ramamoorthy, A., and Bhattacharjya, S. (2010) Structure, interactions, and antibacterial activities of MSI-594 derived mutant peptide MSI-594F5A in lipopolysaccharide micelles: role of the helical hairpin conformation in outermembrane permeabilization. J. Am. Chem. Soc., 132, 18417–18428. Alan, A.R. and Earle, E.D. (2002) Sensitivity of bacterial and fungal plant pathogens to the lytic peptides, MSI-99, magainin II, and cecropin B. Mol. Plant Microbe Interact., 15, 701–708. Thennarasu, S., Lee, D.K., Tan, A., Kari, U.P., and Ramamoorthy, A. (2005) Antimicrobial activity and membrane selective interactions of a synthetic lipopeptide MSI-843. Biochim. Biophys. Acta, Biomembr., 1711, 49–58. Bechinger, B. (2011) Insights into the mechanisms of action of host defence peptides from biophysical and structural investigations. J. Pept. Sci., 17, 306–314. Bechinger, B. and Aisenbrey, C. (2012) The polymorphic nature of membraneactive peptides from biophysical and structural investigations. Curr. Protein Pept. Sci., 13, 602–610. Dennison, S.R., Wallace, J., Harris, F., and Phoenix, D.A. (2005) Amphiphilic alpha-helical antimicrobial peptides and their structure/function relationships. Protein Pept. Lett., 12, 31–39. Soares, J.W. and Mello, C.M. (2004) Antimicrobial peptides: A review of how peptide structure impacts antimicrobial Proc. SPIE, 5271, 20–27. Chen, Y.X., Vasil, A.I., Rehaume, L., Mant, C.T., Burns, J.L., Vasil, M.L., 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. Hancock, R.E.W., and Hodges, R.S. (2006) Comparison of biophysical and biologic properties of alpha-helical enantiomeric antimicrobial peptides. Chem. Biol. Drug Des., 67, 162–173. Yount, N.Y. and Yeaman, M.R. (2013) Peptide antimicrobials: cell wall as a bacterial target. Ann. N. Y. Acad. Sci., 1277, 127–138. Wilmes, M., Cammue, B.P.A., Sahl, H.-G., and Thevissen, K. (2011) Antibiotic activities of host defense peptides: more to it than lipid bilayer perturbation. Nat. Prod. Rep., 28, 1350–1358. Chang, T.-W., Lin, Y.-M., Wang, C.-F., and Liao, Y.-D. (2012) Outer membrane lipoprotein Lpp is Gram-negative bacterial cell surface receptor for cationic antimicrobial peptides. J. Biol. Chem., 287, 418–428. Pushpanathan, M., Gunasekaran, P., and Rajendhran, J. (2013) Antimicrobial peptides: versatile biological properties. Int. J. Pept., 2013, 15. Haney, E.F., Hunter, H.N., Matsuzaki, K., and Vogel, H.J. (2009) Solution NMR studies of amphibian antimicrobial peptides: linking structure to function? Biochim. Biophys. Acta, Biomembr., 1788, 1639–1655. Brandenburg, L.-O., Merres, J., Albrecht, L.-J., Varoga, D., and Pufe, T. (2012) Antimicrobial peptides: multifunctional drugs for different applications. Polymers, 4, 539–560. Brogden, K.A. (2005) Antimicrobial peptides: pore formers or metabolic inhibitors in bacteria? Nat. Rev. Microbiol., 3, 238–250. Sengupta, D., Leontiadou, H., Mark, A.E., and Marrink, S.-J. (2008) Toroidal pores formed by antimicrobial peptides show significant disorder. Biochim. Biophys. Acta, Biomembr., 1778, 2308–2317. Harris, F., Dennison, S.R., and Phoenix, D.A. (2012) Aberrant action of amyloidogenic host defense peptides: a new paradigm to investigate neurodegenerative disorders? FASEB J., 26, 1776–1781. Epand, R.F., Maloy, W.L., Ramamoorthy, A., and Epand, R.M. (2010) Probing the “charge cluster References 48. 49. 50. 51. 52. 53. 54. 55. 56. 57. mechanism” in amphipathic helical cationic antimicrobial peptides. Biochemistry, 49, 4076–4084. Ludtke, S.J., He, K., Heller, W.T., Harroun, T.A., Yang, L., and Huang, H.W. (1996) Membrane pores induced by magainin. Biochemistry, 35, 13723–13728. Matsuzaki, K. (1998) Magainins as paradigm for the mode of action of pore forming polypeptides. Biochim. Biophys. Acta, Rev. Biomembr., 1376, 391–400. Mihajlovic, M. and Lazaridis, T. (2012) Charge distribution and imperfect amphipathicity affect pore formation by antimicrobial peptides. Biochim. Biophys. Acta, Biomembr., 1818, 1274–1283. He, Y. and Lazaridis, T. (2013) Activity determinants of helical antimicrobial peptides: a large-scale computational study. PLoS One, 8, e66440. He, Y., Prieto, L., and Lazaridis, T. (2013) Modeling peptide binding to anionic membrane pores. J. Comput. Chem., 34, 1463–1475. Woo, H.J. and Wallqvist, A. (2011) Spontaneous buckling of lipid bilayer and vesicle budding induced by antimicrobial peptide magainin 2: a coarse-grained simulation study. J. Phys. Chem. B, 115, 8122–8129. Fjell, C.D., Hiss, J.A., Hancock, R.E.W., and Schneider, G. (2012) Designing antimicrobial peptides: form follows function. Nat. Rev. Drug Discovery, 11, 37–51. Peschel, A. and Sahl, H.G. (2006) The co-evolution of host cationic antimicrobial peptides and microbial resistance. Nat. Rev. Microbiol., 4, 529–536. Anaya-Lopez, J.L., Lopez-Meza, J.E., and Ochoa-Zarzosa, A. (2013) Bacterial resistance to cationic antimicrobial peptides. Crit. Rev. Microbiol., 39, 180–195. Shireen, T., Singh, M., Das, T., and Mukhopadhyay, K. (2013) Differential adaptive responses of staphylococcus aureus to in vitro selection with different antimicrobial peptides. Antimicrob. Agents Chemother., 57, 5134–5137. 58. Maria-Neto, S., Candido, E.d.S., 59. 60. 61. 62. 63. 64. 65. 66. 67. Rodrigues, D.R., de Sousa, D.A., da Silva, E.M., Pepe de Moraes, L.M., de Jesus Otero-Gonzalez, A., Magalhaes, B.S., Dias, S.C., and Franco, O.L. (2012) Deciphering the magainin resistance process of escherichia coli strains in light of the cytosolic proteome. Antimicrob. Agents Chemother., 56, 1714–1724. Conlon, J.M. and Sonnevend, A. (2011) Clinical applications of amphibian antimicrobial peptides. J. Med. Sci., 4, 62–72. Zucca, M., Scutera, S., and Savoia, D. (2011) Antimicrobial peptides: new frontiers in the therapy of infections, in Drug Development – A Case Study Based Insight into Modern Strategies (ed. C. Rundfeldt), InTech. Zairi, A., Tangy, F., Bouassida, K., and Hani, K. (2009) Dermaseptins and magainins: antimicrobial peptides from frogs’ skin-new sources for a promising spermicides microbicides-a mini review. J. Biomed. Biotechnol., 2009, 452567. Leontiadou, H., Mark, A.E., and Marrink, S.J. (2006) Antimicrobial peptides in action. J. Am. Chem. Soc., 128, 12156–12161. Wimley, W.C. (2010) Describing the mechanism of antimicrobial peptide action with the interfacial activity model. ACS Chem. Biol., 5, 905–917. Gregory, S.M., Pokorny, A., and Almeida, P.F.F. (2009) Magainin 2 revisited: a test of the quantitative model for the all-or-none permeabilization of phospholipid vesicles. Biophys. J., 96, 116–131. Imura, Y., Choda, N., and Matsuzaki, K. (2008) Magainin 2 in action: distinct modes of membrane permeabilization in living bacterial and mammalian cells. Biophys. J., 95, 5757–5765. Ludtke, S., He, K., and Huang, H. (1995) Membrane thinning caused by magainin 2. Biochemistry, 34, 16764–16769. Epand, R.M. and Epand, R.F. (2011) Bacterial membrane lipids in the action of antimicrobial agents. J. Pept. Sci., 17, 298–305. 61 62 4 Magainins – A Model for Development of Eukaryotic Antimicrobial Peptides (AMPs) 68. Matsuzaki, K. (1999) Why and how 69. 70. 71. 72. 73. 74. 75. 76. are peptide–lipid interactions utilized for self-defense? Magainins and tachyplesins as archetypes. Biochim. Biophys. Acta, Biomembr., 1462, 1–10. Zasloff, M., Martin, B., and Chen, H.C. (1988) Antimicrobial activity of synthetic magainin peptides and several analogs. Proc. Natl. Acad. Sci. U.S.A., 85, 910–913. Matsuzaki, K., Sugishita, K., Harada, M., Fujii, N., and Miyajima, K. (1997) Interactions of an antimicrobial peptide, magainin 2, with outer and inner membranes of Gram-negative bacteria. Biochim. Biophys. Acta, Biomembr., 1327, 119–130. Islam, K. and Hawser, S.P. (1998) MSI78 magainin pharmaceuticals. IDrugs, 1, 605–609. Gottler, L.M. and Ramamoorthy, A. (2009) Structure, membrane orientation, mechanism, and function of pexiganan – A highly potent antimicrobial peptide designed from magainin. Biochim. Biophys. Acta, Biomembr., 1788, 1680–1686. Tamba, Y., Ariyama, H., Levadny, V., and Yamazaki, M. (2010) Kinetic pathway of antimicrobial peptide magainin 2-induced pore formation in lipid membranes. J. Phys. Chem. B, 114, 12018–12026. Giacometti, A., Cirioni, O., Kamysz, W., D’Amato, G., Silvestri, C., Licci, A., Nadolski, P., Riva, A., Łukasiak, J., and Scalise, G. (2005) In vitro activity of MSI-78 alone and in combination with antibiotics against bacteria responsible for bloodstream infections in neutropenic patients. Int. J. Antimicrob. Agents, 26, 235–240. Giacometti, A., Cirioni, O., Del Prete, M.S., Paggi, A.M., D’Errico, M.M., and Scalise, G. (2000) Combination studies between polycationic peptides and clinically used antibiotics against Grampositive and Gram-negative bacteria. Peptides, 21, 1155–1160. Jacob, L. and Zasloff, M. (2007) Ciba Foundation Symposium 186 – Antimicrobial Peptides, John Wiley & Sons, Ltd, pp. 197–223. 77. Darveau, R.P., Cunningham, M.D., 78. 79. 80. 81. 82. 83. 84. 85. 86. Seachord, C.L., Cassianoclough, L., Cosand, W.L., Blake, J., and Watkins, C.S. (1991) Beta-lactam antibiotics potentiate magainin-2 antimicrobial activity in vitro and in vivo. Antimicrob. Agents Chemother., 35, 1153–1159. Cirioni, O., Giacometti, A., Ghiselli, R., Mocchegiani, F., Fineo, A., Orlando, F., Del Prete, M.S., Rocchi, M., Saba, V., and Scalise, G. (2002) Single-dose intraperitoneal magainins improve survival in a Gram-negative-pathogen septic shock rat model. Antimicrob. Agents Chemother., 46, 101–104. Giacometti, A., Cirioni, O., Ghiselli, R., Orlando, F., Kamysz, W., Rocchi, M., D’Amato, G., Mocchegiani, F., Silvestri, C., Łukasiak, J., Saba, V., and Scalise, G. (2005) Effects of pexiganan alone and combined with betalactams in experimental endotoxic shock. Peptides, 26, 207–216. Devocelle, M. (2012) Targeted antimicrobial peptides. Front. Immunol., 3, 309. Arnusch, C.J., Pieters, R.J., and Breukink, E. (2012) Enhanced membrane pore formation through high-affinity targeted antimicrobial peptides. PLoS One, 7, e39768. Giuliani, A., Pirri, G., and Nicoletto, S.F. (2007) Antimicrobial peptides: an overview of a promising class of therapeutics. Cent. Eur. J. Biol., 2, 1–33. Hobizal, K.B. and Wukich, D.K. (2012) Diabetic foot infections: current concept review. Diabet. Foot Ankle., 3, 18409. Moore, A. (2003) The big and small of drug discovery – Biotech versus pharma: advantages and drawbacks in drug development. EMBO Rep., 4, 114–117. Nelson, E.A., O’Meara, S., Golder, S., Dalton, J., Craig, D., and Iglesias, C. on behalf of the, DSG (2006) Systematic review of antimicrobial treatments for diabetic foot ulcers. Diabet. Med., 23, 348–359. Lee, D.-K., Brender, J.R., Sciacca, M.F.M., Krishnamoorthy, J., Yu, C., and Ramamoorthy, A. (2013) Lipid References 87. 88. 89. 90. 91. 92. 93. 94. composition-dependent membrane membrane-disrupting mechanism of fragmentation and pore-forming mechantimicrobial peptides MSI-78 and anisms of membrane disruption by MSI-594 derived from magainin 2 and pexiganan (MSI-78). Biochemistry, 52, melittin. Biophys. J., 91, 206–216. 3254–3263. 95. McHenry, A.J., Sciacca, M.F.M., Porcelli, F., Buck-Koehntop, B.A., Brender, J.R., and Ramamoorthy, Thennarasu, S., Ramamoorthy, A., A. (2012) Does cholesterol suppress and Veglia, G. (2006) Structures of the antimicrobial peptide induced the dimeric and monomeric variants disruption of lipid raft containing of magainin antimicrobial peptides membranes? Biochim. Biophys. Acta, (MSI-78 and MSI-594) in micelles and Biomembr., 1818, 3019–3024. bilayers, determined by NMR spec96. Buer, B.C., Chugh, J., Al-Hashimi, troscopy. Biochemistry, 45, 5793–5799. H.M., and Marsh, E.N.G. (2010) Using Ramamoorthy, A. and Xu, J.D. (2013) fluorine nuclear magnetic resonance 2D H-1/H-1 RFDR and NOESY NMR to probe the interaction of membraneexperiments on a membrane-bound active peptides with the lipid bilayer. antimicrobial peptide under magic Biochemistry, 49, 5760–5765. angle spinning. J. Phys. Chem. B, 117, 97. Epand, R.F., Maloy, L., Ramamoorthy, 6693–6700. A., and Epand, R.M. (2010) AmphiPius, J., Morrow, M.R., and Booth, V. pathic helical cationic antimicrobial (2012) H-2 solid-state nuclear magpeptides promote rapid formation of netic resonance investigation of whole crystalline states in the presence of escherichia coli interacting with antimiphosphatidylglycerol: lipid clustering crobial peptide MSI-78. Biochemistry, in anionic membranes. Biophys. J., 98, 51, 118–125. 2564–2573. Yamamoto, K., Vivekanandan, S., and 98. Epand, R.M. and Epand, R.F. (2010) Ramamoorthy, A. (2011) Fast NMR Biophysical analysis of membranedata acquisition from bicelles containtargeting antimicrobial peptides: ing a membrane-associated peptide at membrane properties and the design natural-abundance. J. Phys. Chem. B, of peptides specifically targeting gram115, 12448–12455. negative bacteria, in Antimicrobial Yang, P., Ramamoorthy, A., and Chen, Peptides: Discovery, Design and Novel Z. (2011) Membrane orientation of Therapeutic Strategies, CABI. MSI-78 measured by sum frequency 99. Suzuki, Y., Buer, B.C., Al-Hashimi, generation vibrational spectroscopy. H.M., and Marsh, E.N.G. (2011) Using Langmuir, 27, 7760–7767. fluorine nuclear magnetic resonance Zimmerman, L.B., Worley, B.V., to probe changes in the structure and Palermo, E.F., Brender, J.R., Lee, K.D., dynamics of membrane-active pepKuroda, K., Ramamoorthy, A., and tides interacting with lipid bilayers. Meyerhoff, M.E. (2011) AbsorbanceBiochemistry, 50, 5979–5987. based assay for membrane disruption by antimicrobial peptides and synthetic 100. Zeitler, B., Diaz, A.H., Dangel, A., Thellmann, M., Meyer, H., Sattler, M., copolymers using pyrroloquinoline and Lindermayr, C. (2013) De-novo quinone-loaded liposomes. Anal. design of antimicrobial peptides for Biochem., 411, 194–199. plant protection. PLoS One, 8, e71687. Bhattacharjya, S. and Ramamoorthy, A. (2009) Multifunctional host defense 101. Maloy, W.L. and Kari, U.P. (1995) Structure-activity studies on magainpeptides: functional and mechanistic ins and other host-defense peptides. insights from NMR structures of potent Biopolymers, 37, 105–122. antimicrobial peptides. FEBS J., 276, 102. Radzishevsky, I.S., Rotem, S., Zaknoon, 6465–6473. F., Gaidukov, L., Dagan, A., and Mor, Ramamoorthy, A., Thennarasu, S., Lee, A. (2005) Effects of acyl versus aminoaD.K., Tan, A.M., and Maloy, L. (2006) Solid-state NMR investigation of the cyl conjugation on the properties of 63 64 4 Magainins – A Model for Development of Eukaryotic Antimicrobial Peptides (AMPs) 103. 104. 105. 106. 107. 108. 109. 110. 111. 112. antimicrobial peptides. Antimicrob. Agents Chemother., 49, 2412–2420. Meng, H. and Kumar, K. (2007) Antimicrobial activity and protease stability of peptides containing fluorinated amino acids. J. Am. Chem. Soc., 129, 15615–15622. Gottler, L.M., Lee, H.-Y., Shelburne, C.E., Ramamoorthy, A., and Marsh, E.N.G. (2008) Using fluorous amino acids to modulate the biological activity of an antimicrobial peptide. ChemBioChem, 9, 370–373. Buer, B.C. and Marsh, E.N.G. (2012) Fluorine: a new element in protein design. Protein Sci., 21, 453–462. Buer, B.C., Levin, B.J., and Marsh, E.N.G. (2013) Perfluoro-tert-butylhomoserine as a sensitive F-19 NMR reporter for peptide-membrane interactions in solution. J. Pept. Sci., 19, 308–314. Imura, Y., Nishida, M., and Matsuzaki, K. (2007) Action mechanism of PEGylated magainin 2 analogue peptide. Biochim. Biophys. Acta, Biomembr., 1768, 2578–2585. Porter, E.A., Weisblum, B., and Gellman, S.H. (2002) Mimicry of host-defense peptides by unnatural oligomers: antimicrobial beta-peptides. J. Am. Chem. Soc., 124, 7324–7330. Chongsiriwatana, N.P., Patch, J.A., Czyzewski, A.M., Dohm, M.T., Ivankin, A., Gidalevitz, D., Zuckermann, R.N., and Barron, A.E. (2008) Peptoids that mimic the structure, function, and mechanism of helical antimicrobial peptides. Proc. Natl. Acad. Sci. U.S.A., 105, 2794–2799. Dohm, M.T., Kapoor, R., and Barron, A.E. (2011) Peptoids: bio-inspired polymers as potential pharmaceuticals. Curr. Pharm. Des., 17, 2732–2747. Tang, H.Z., Doerksen, R.J., and Tew, G.N. (2005) Synthesis of urea oligomers and their antibacterial activity. Chem. Commun., 1537–1539. Violette, A., Fournel, S., Lamour, K., Chaloin, O., Frisch, B., Briand, J.P., Monteil, H., and Guichard, G. (2006) Mimicking helical antibacterial peptides with nonpeptidic folding oligomers. Chem. Biol., 13, 531–538. 113. Thaker, H.D., Som, A., Ayaz, F., Lui, 114. 115. 116. 117. 118. 119. 120. 121. D., Pan, W., Scott, R.W., Anguita, J., and Tew, G.N. (2012) Synthetic mimics of antimicrobial peptides with immunomodulatory responses. J. Am. Chem. Soc., 134, 11088–11091. Thaker, H.D., Sgolastra, F., Clements, D., Scott, R.W., and Tew, G.N. (2011) Synthetic mimics of antimicrobial peptides from triaryl scaffolds. J. Med. Chem., 54, 2241–2254. Majoros, I.J., Williams, C.R., Becker, A.C., and Baker, J.R. Jr., (2009) Surface interaction and behavior of poly(amidoamine) dendrimers: deformability and lipid bilayer disruption. J. Comput. Theor. Nanosci., 6, 1430–1436. Eren, T., Som, A., Rennie, J.R., Nelson, C.F., Urgina, Y., Nusslein, K., Coughlin, E.B., and Tew, G.N. (2008) Antibacterial and hemolytic activities of quaternary pyridinium functionalized polynorbornenes. Macromol. Chem. Phys., 209, 516–524. Beckloff, N., Laube, D., Castro, T., Furgang, D., Park, S., Perlin, D., Clements, D., Tang, H., Scott, R.W., Tew, G.N., and Diamond, G. (2007) Activity of an antimicrobial peptide mimetic against planktonic and biofilm cultures of oral pathogens. Antimicrob. Agents Chemother., 51, 4125–4132. Tew, G.N., Clements, D., Tang, H., Arnt, L., and Scott, R.W. (2006) Antimicrobial activity of an abiotic host defense peptide mimic. Biochim. Biophys. Acta, Biomembr., 1758, 1387–1392. Genco, C.A., Maloy, W.L., Kari, U.P., and Motley, M. (2003) Antimicrobial activity of magainin analogues against anaerobic oral pathogens. Int. J. Antimicrob. Agents, 21, 75–78. Bhunia, A., Ramamoorthy, A., and Bhattacharjya, S. (2009) Helical hairpin structure of a potent antimicrobial peptide MSI-594 in lipopolysaccharide micelles by NMR spectroscopy. Chem. Eur. J., 15, 2036–2040. Chen, X. and Chen, Z. (2006) SFG studies on interactions between antimicrobial peptides and supported lipid References 122. 123. 124. 125. 126. 127. 128. 129. bilayers. Biochim. Biophys. Acta, Biomembr., 1758, 1257–1273. Egal, M., Conrad, M., MacDonald, D.L., Maloy, W.L., Motley, M., and Genco, C.A. (1999) Antiviral effects of synthetic membrane-active peptides on herpes simplex virus, type 1. Int. J. Antimicrob. Agents, 13, 57–60. Alan, A.R., Blowers, A., and Earle, E.D. (2004) Expression of a magainin-type antimicrobial peptide gene (MSI-99) in tomato enhances resistance to bacterial speck disease. Plant Cell Rep., 22, 388–396. Chakrabarti, A., Ganapathi, T.R., Mukherjee, P.K., and Bapat, V.A. (2003) MSI-99, a magainin analogue, imparts enhanced disease resistance in transgenic tobacco and banana. Planta, 216, 587–596. DeGray, G., Rajasekaran, K., Smith, F., Sanford, J., and Daniell, H. (2001) Expression of an antimicrobial peptide via the chloroplast genome to control phytopathogenic bacteria and fungi. Plant Physiol., 127, 852–862. Ganapathi, T.R., Ghosh, S.B., Laxmi, N.H.S., and Bapat, V.A. (2007) Expression of an antimicrobial peptide (MSI-99) confers enhanced resistance to Aspergillus niger in transgenic potato. Indian J. Biotechnol., 6, 63–67. Hong, Y.-b., Liu, S.-p., Zhu, Y.-p., Xie, C., Jue, D.-w., Chen, M., Kaleri, H.A., and Yang, Q. (2013) Expression of the MSI-99m gene in transgenic potato plants confers resistance to phytophthora infestans and ralstonia solanacearum. Plant Mol. Biol. Rep., 31, 418–424. Kikkert, J.R., Vidal, J.R., Wallace, P.G., Reisch, B.I., Garcia-Zitter, S., Wilcox, W.F., Gadoury, D.M., Seem, R.C., and Burr, T.J. (2005) Disease resistance analyses of transgenic grapevines that contain endochitinase or antimicrobial peptide genes. Proceedings of the Seventh International Symposium on Grapevine Physiology and Biotechnology (ed. L.E. Williams), pp. 493–498. Thennarasu, S., Huang, R., Lee, D.K., Yang, P., Maloy, L., Chen, Z., and Ramamoorthy, A. (2010) Limiting an antimicrobial peptide to the 130. 131. 132. 133. 134. 135. 136. lipid−water interface enhances its bacterial membrane selectivity: a case study of MSI-367. Biochemistry, 49, 10595–10605. Reisch, B., Kikkert, J., Vidal, J., Ali, G.S., Gadoury, D., Seem, R., and Wallace, P. (2003) Genetic transformation of Vitis vinifera to improve disease resistance. Proceedings of the 8th International Conference on Grape Genetics and Breeding, vols. 1 and 2 (eds E. Hajdu and E. Borbas), pp. 303–308. Kikkert, J.R., Vidal, J.R., Wallace, P.G., Garcia-Zitter, S., Wilcox, W.F., Gadoury, D.M., Seem, R.C., Burr, T.J., Rosenfield, C.L., Samuelian, S., and Reisch, B.I. (2009) Disease resistance analyses of transgenic grapevines that contain endochitinase or antimicrobial peptide genes. IX International Conference on Grape Genetics and Breeding (eds E. Peterlunger, G. DiGaspero, and G. Cipriani), pp. 379-383. Rosenfield, C.-L., Samuelian, S., Vidal, J.R., and Reisch, B.I. (2010) Transgenic disease resistance in vitis vinifera: potential use and screening of antimicrobial peptides. Am. J. Enol. Vitic., 61, 348–357. Vidal, J.R., Kikkert, J.R., Malnoy, M.A., Wallace, P.G., Barnard, J., and Reisch, B.I. (2006) Evaluation of transgenic ‘Chardonnay’ (Vitis vinifera) containing magainin genes for resistance to crown gall and powdery mildew. Transgenic Res., 15, 69–82. O’Callaghan, M., Gerard, E.M., Waipara, N.W., Young, S.D., Glare, T.R., Barrell, P.J., and Conner, A.J. (2004) Microbial communities of Solanum tuberosum and magainin-producing transgenic lines. Plant Soil, 266, 47–56. Nanna, R. (2010) Expression of antimicrobial peptide gene (magainin) in soybean. In Vitro Cell. Dev. Biol.-Anim., 46, S50. McLane, M.P., McDonald, D.L., Zasloff, M.A., and Jacob, L.S. (1995) MSI-843, a magainin for the treatment of Pseudomonas aeruginosa infection in cystic fibrosis (CF) patients. Abstr. Intersci. Conf. Antimicrob. Agents Chemother., 35, 135. 65 66 4 Magainins – A Model for Development of Eukaryotic Antimicrobial Peptides (AMPs) 137. Trullas, C.C.R. and Krutmann, J. (2010) 138. 139. 140. 141. 142. 143. 144. Use of compositions comprising urea for treating microbial infections. EP 2241312 A1. Lichter, J., Lebel, C., Piu, F., and Harris, J.P. (2011) Compositions and methods for the treatment of sinonasal disorders. WO Patent 2011049960 A2. Mechkarska, M., Prajeep, M., Leprince, J., Vaudry, H., Meetani, M.A., Evans, B.J., and Conlon, J.M. (2013) A comparison of host-defense peptides in skin secretions of female Xenopus laevis × Xenopus borealis and X. borealis × X. laevis F1 hybrids. Peptides, 45, 1–8. King, J.D., Mechkarska, M., Meetani, M.A., and Conlon, J.M. (2013) Peptidomic analysis of skin secretions provides insight into the taxonomic status of the African clawed frogs Xenopus victorianus and Xenopus laevis sudanensis (Pipidae). Comp. Biochem. Physiol. D: Genomics Proteomics, 8, 250–254. Mechkarska, M., Ahmed, E., Coquet, L., Leprince, J., Jouenne, T., Vaudry, H., King, J.D., and Conlon, J.M. (2011) Peptidomic analysis of skin secretions demonstrates that the allopatric populations of Xenopus muelleri (Pipidae) are not conspecific. Peptides, 32, 1502–1508. Mechkarska, M., Ahmed, E., Coquet, L., Leprince, J., Jouenne, T., Vaudry, H., King, J.D., Takada, K., and Conlon, J.M. (2011) Genome duplications within the Xenopodinae do not increase the multiplicity of antimicrobial peptides in Silurana paratropicalis and Xenopus andrei skin secretions. Comp. Biochem. Physiol. D: Genomics Proteomics, 6, 206–212. Conlon, J.M., Al-Ghaferi, N., Ahmed, E., Meetani, M.A., Leprince, J., and Nielsen, P.F. (2010) Orthologs of magainin, PGLa, procaerulein-derived, and proxenopsin-derived peptides from skin secretions of the octoploid frog Xenopus amieti (Pipidae). Peptides, 31, 989–994. Rollins-Smith, L.A., Ramsey, J.P., Pask, J.D., Reinert, L.K., and Woodhams, D.C. (2011) Amphibian immune defenses 145. 146. 147. 148. 149. 150. 151. 152. against chytridiomycosis: impacts of changing environments. Integr. Comp. Biol., 51, 552–562. Voyles, J., Rosenblum, E.B., and Berger, L. (2011) Interactions between Batrachochytrium dendrobatidis and its amphibian hosts: a review of pathogenesis and immunity. Microbes Infect., 13, 25–32. Ojo, O.O., Conlon, J.M., Flatt, P.R., and Abdel-Wahab, Y.H.A. (2013) Frog skin peptides (tigerinin-1R, magainin-AM1,AM2, CPF-AM1, and PGla-AM1) stimulate secretion of glucagon-like peptide 1 (GLP-1) by GLUTag cells. Biochem. Biophys. Res. Commun., 431, 14–18. Ojo, O.O., Flatt, P.R., Abdel-Wahab, Y.H.A., and Conlon, J.M. (2013) in Handbook of Biologically Active Peptides (ed. A.J. Kastin), Elsevier, San Diego, CA, pp. 364–370. Srinivasan, D., Mechkarska, M., Abdel-Wahab, Y.H.A., Flatt, P.R., and Conlon, J.M. (2013) Caerulein precursor fragment (CPF) peptides from the skin secretions of Xenopus laevis and Silurana epitropicalis are potent insulin-releasing agents. Biochimie, 95, 429–435. Rackelmann-Silber, K. (2012) Development of therapeutic agents handbook. Edited by Shayne Cox Gad. ChemMedChem, 7, 1504–1505. Wieprecht, T., Dathe, M., Beyermann, M., Krause, E., Maloy, W.L., MacDonald, D.L., and Bienert, M. (1997) Peptide hydrophobicity controls the activity and selectivity of magainin 2 amide in interaction with membranes. Biochemistry, 36, 6124–6132. Mechkarska, M., Ahmed, E., Coquet, L., Leprince, J., Jouenne, T., Vaudry, H., King, J.D., and Conlon, J.M. (2010) Antimicrobial peptides with therapeutic potential from skin secretions of the Marsabit clawed frog Xenopus borealis (Pipidae). Comp. Biochem. Physiol. C: Toxicol. Pharmacol., 152, 467–472. Conlon, J.M., Mechkarska, M., Ahmed, E., Leprince, J., Vaudry, H., King, J.D., and Takada, K. (2011) Purification and properties of antimicrobial peptides from skin secretions of the Eritrea References 153. 154. 155. 156. 157. 158. 159. 160. 161. 162. clawed frog Xenopus clivii (Pipidae). Comp. Biochem. Physiol. C: Toxicol. Pharmacol., 153, 350–354. Albiol Matanic, V.C. and Castilla, V. (2004) Antiviral activity of antimicrobial cationic peptides against Junin virus and herpes simplex virus. Int. J. Antimicrob. Agents, 23, 382–389. Aboudy, Y., Mendelson, E., Shalit, I., Bessalle, R., and Fridkin, M. (1994) Activity of 2 synthetic amphiphilic peptides and magainin-2 against herpes-simplex virus type-1 and type-2. Int. J. Pept. Protein Res., 43, 573–582. Yasin, B., Pang, M., Turner, J.S., Cho, Y., Dinh, N.N., Waring, A.J., Lehrer, R.I., and Wagar, E.A. (2000) Evaluation of the inactivation of infectious herpes simplex virus by host-defense peptides. Eur. J. Clin. Microbiol. Infect. Dis., 19, 187–194. Jenssen, H. (2009) Therapeutic approaches using host defence peptides to tackle herpes virus infections. Viruses-Basel, 1, 939–964. Carriel-Gomes, M.C., Kratz, J.M., Barracco, M.A., Bachere, E., Barardi, C.R.M., and Simoes, C.M.O. (2007) In vitro antiviral activity of antimicrobial peptides against herpes simplex virus 1, adenovirus, and rotavirus. Mem. Inst. Oswaldo Cruz, 102, 469–472. Azwa, A. and Barton, S.E. (2009) Aspects of herpes simplex virus: a clinical review. J. Fam. Plann. Reprod. Health Care, 35, 237–242. Clara, A., Manjramkar, D.D., and Reddy, V.K. (2004) Preclinical evaluation of magainin-A as a contraceptive antimicrobial agent. Fertil. Steril., 81, 1357–1365. Miller, K.E. (2006) Diagnosis and treatment of Neisseria gonorrhoeae infections. Am. Fam. Physician, 73, 1779–1784. Whitlow, C.B. (2004) Bacterial sexually transmitted diseases. Clin. Colon Rectal Surg., 17, 209–214. Wasik, M. and Kachlic, M.D. (2009) A review of common sexually transmitted diseases. Formulary, 44, 78–85. 163. Reddy, K.V.R., Yedery, R.D., and 164. 165. 166. 167. 168. 169. 170. 171. 172. 173. Aranha, C. (2004) Antimicrobial peptides: premises and promises. Int. J. Antimicrob. Agents, 24, 536–547. Yedery, R.D. and Reddy, K.V.R. (2005) Antimicrobial peptides as microbicidal contraceptives: prophecies for prophylactics – a mini review. Eur. J. Contracept. Reprod. Health Care, 10, 32–42. Bedi, G., Jacob, J., Williams, T., and Zasloff, M. (1996) Method for inhibiting sexually transmitted diseases using magaining antimicrobials or squalamine compounds. WO 1996008270 A3. Shah, H.C., Tatke, P., and Singh, K.K. (2008) Spermicidal agents. Drug Discovery Ther., 2, 200–210. de Waal, A., Gomes, A.V., Mensink, A., Grootegoed, J.A., and Westerhoff, H.V. (1991) Magainins affect respiratory control, membrane potential and motility of hamster spermatozoa. FEBS Lett., 293, 219–223. Edelstein, M.C., Gretz, J.E., Bauer, T.J., Fulgham, D.L., Alexander, N.J., and Archer, D.F. (1991) Studies on the in vitro spermicidal activity of synthetic magainins. Fertil. Steril., 55, 647–649. Reddy, K.V.R., Shahani, S.K., and Meherji, P.K. (1996) Spermicidal activity of Magainins: in vitro and in vivo studies. Contraception, 53, 205–210. Wojcik, C., Sawicki, W., Marianowski, P., Benchaib, M., Czyba, J.C., and Guerin, J.F. (2000) Cyclodextrin enhances spermicidal effects of magainin-2-amide. Contraception, 62, 99–103. Brender, J.R., McHenry, A.J., and Ramamoorthy, A. (2012) Does cholesterol play a role in the bacterial selectivity of antimicrobial peptides? Front. Immunol., 3, 195. Matsuzaki, K., Sugishita, K., Fujii, N., and Miyajima, K. (1995) Molecularbasis for membrane selectivity of an antimicrobial peptide, magainin-2. Biochemistry, 34, 3423–3429. Reddy, V.R.K. and Manjramkar, D.D. (2000) Evaluation of the antifertility effect of magainin-A in rabbits: in vitro and in vivo studies. Fertil. Steril., 73, 353–358. 67 68 4 Magainins – A Model for Development of Eukaryotic Antimicrobial Peptides (AMPs) 174. Dhawan, L., Ghosh, D., Lalitkumar, 175. 176. 177. 178. 179. 180. 181. 182. P.G.L., Sharma, D.N., Lasley, B.L., Overstreet, J.W., and Sengupta, J. (2000) Anti-nidatory effect of vaginally administered (Ala8,13,18)-magainin II amide in the rhesus monkey. Contraception, 62, 39–43. Mystkowska, E.T., Niemierko, A., Komar, A., and Sawicki, W. (2001) Embryotoxicity of magainin-2-amide and its enhancement by cyclodextrin, albumin, hydrogen peroxide and acidification. Hum. Reprod., 16, 1457–1463. Sawicki, W. and Mystkowska, E.T. (1999) Contraceptive potential of peptide antibiotics. Lancet, 353, 464–465. Ghosh, D., Dhawan, L., Lalitkumar, P.G.L., Wong, V., Rosario, J.F., Hendrickx, A.G., Lasley, B.L., Overstreet, J.W., and Sengupta, J. (2001) Effect of vaginally administered (Ala8,13,18)-magainin II amide on the morphology of implantation stage endometrium in the rhesus monkey (Macaca mulatta). Contraception, 63, 335–342. Sengupta, J., Khan, M.A., Huppertz, B., and Ghosh, D. (2011) In-vitro effects of the antimicrobial peptide Ala8,13,18magainin II amide on isolated human first trimester villous trophoblast cells. Reprod. Biol. Endocrinol., 9, 49. Maloy, W. L., Macdonald, D., and Brasseur, M. (1991) Design of broadspectrum antibiotic and host defense peptides based on magainin and related peptides. Eichenlaub, R. and Gartemann, K.H. (2011) The Clavibacter michiganensis Subspecies: Molecular Investigation of Gram-Positive Bacterial Plant Pathogens. Annu. Rev. Phytopathol., 49, 445–464. Morris, C.E., Monteil, C.L., and Berge, O. (2013) The Life History of Pseudomonas syringae: Linking Agriculture to Earth System Processes. Annu. Rev. Phytopathol., 51, 85–104. Marcet-Houben, M., Ballester, A.-R., de la Fuente, B., Harries, E., Marcos, J.F., Gonzalez-Candelas, L., and Gabaldon, T. (2012) Genome sequence of the 183. 184. 185. 186. 187. 188. 189. 190. 191. 192. necrotrophic fungus Penicillium digitatum, the main postharvest pathogen of citrus. BMC Genomics, 13, 646. Keymanesh, K., Soltani, S., and Sardari, S. (2009) Application of antimicrobial peptides in agriculture and food industry. World J. Microbiol. Biotechnol., 25, 933–944. Sang, X., Jue, D., Yang, L., Bai, X., Chen, M., and Yang, Q. (2013) Genetic transformation of brassica napus with msi-99m gene increases resistance in transgenic plants to sclerotinia sclerotiorum in. Mol. Plant Breed., 4 (30), 247–253. Kapoor, R., Wadman, M.W., Dohm, M.T., Czyzewski, A.M., Spormann, A.M., and Barron, A.E. (2011) Antimicrobial peptoids are effective against pseudomonas aeruginosa biofilms. Antimicrob. Agents Chemother., 55, 3054–3057. Siedenbiedel, F. and Tiller, J.C. (2012) Antimicrobial polymers in solution and on surfaces: overview and functional principles. Polymers, 4, 46–71. Srey, S., Jahid, I.K., and Ha, S.-D. (2013) Biofilm formation in food industries: a food safety concern. Food Control, 31, 572–585. Lynch, A.S. and Robertson, G.T. (2008) Bacterial and fungal biofilm infections. Annu. Rev. Med., 59, 415–428. Bridier, A., Briandet, R., Thomas, V., and Dubois-Brissonnet, F. (2011) Resistance of bacterial biofilms to disinfectants: a review. Biofouling, 27, 1017–1032. Kostakioti, M., Hadjifrangiskou, M., and Hultgren, S.J. (2013) Bacterial biofilms: development, dispersal, and therapeutic strategies in the dawn of the postantibiotic era. Cold Spring Harbor Perspect. Med., 3, a010306. Haynie, S.L., Crum, G.A., and Doele, B.A. (1995) Antimicrobial activities of amphiphilic peptides covalently bonded to a water-insoluble resin. Antimicrob. Agents Chemother., 39, 301–307. Bagheri, M., Beyermann, M., and Dathe, M. (2009) Immobilization reduces the activity of surface-bound cationic antimicrobial peptides with no influence upon the activity spectrum. References 193. 194. 195. 196. 197. 198. 199. 200. Antimicrob. Agents Chemother., 53, 1132–1141. Peyre, J., Humblot, V., Methivier, C., Berjeaud, J.M., and Pradier, C.M. (2012) Co-grafting of amino poly(ethylene glycol) and Magainin I on a TiO2 surface: tests of antifouling and antibacterial activities. J. Phys. Chem. B, 116, 13839–13847. Hequet, A., Humblot, V., Berjeaud, J.M., and Pradier, C.M. (2011) Optimized grafting of antimicrobial peptides on stainless steel surface and biofilm resistance tests. Colloids Surf., B, 84, 301–309. Humblot, V., Yala, J.F., Thebault, P., Boukerma, K., Hequet, A., Berjeaud, J.M., and Pradier, C.M. (2009) The antibacterial activity of Magainin I immobilized onto mixed thiols SelfAssembled Monolayers. Biomaterials, 30, 3503–3512. Glinel, K., Jonas, A.M., Jouenne, T., Leprince, J., Galas, L., and Huck, W.T.S. (2009) Antibacterial and antifouling polymer brushes incorporating antimicrobial peptide. Bioconjugate Chem., 20, 71–77. Azzaroni, O. (2012) Polymer brushes here, there, and everywhere: recent advances in their practical applications and emerging opportunities in multiple research fields. J. Polym. Sci., Part A: Polym. Chem., 50, 3225–3258. Stenfors Arnesen, L.P., Fagerlund, A., and Granum, P.E. (2008) From soil to gut: bacillus cereus and its food poisoning toxins. FEMS Microbiol. Rev., 32, 579–606. Roberts, A.J. and Wiedmann, M. (2003) Pathogen, host and environmental factors contributing to the pathogenesis of listeriosis. Cell. Mol. Life Sci., 60, 904–918. Kulagina, N.V., Lassman, M.E., Ligler, F.S., and Taitt, C.R. (2005) Antimicrobial peptides for detection of bacteria 201. 202. 203. 204. 205. 206. 207. 208. 209. in biosensor assays. Anal. Chem., 77, 6504–6508. Kulagina, N.V., Shaffer, K.M., Anderson, G.P., Ligler, F.S., and Taitt, C.R. (2006) Antimicrobial peptide-based array for Escherichia coli and Salmonella screening. Anal. Chim. Acta, 575, 9–15. Mannoor, M.S., Zhang, S.Y., Link, A.J., and McAlpine, M.C. (2010) Electrical detection of pathogenic bacteria via immobilized antimicrobial peptides. Proc. Natl. Acad. Sci. U.S.A., 107, 19207–19212. Yonekita, T., Ohtsuki, R., Hojo, E., Morishita, N., Matsumoto, T., Aizawa, T., and Morimatsu, F. (2013) Development of a novel multiplex lateral flow assay using an antimicrobial peptide for the detection of Shiga toxin-producing Escherichia coli. J. Microbiol. Methods, 93, 251–256. Pexara, A., Angelidis, D., and Govaris, A. (2012) Shiga toxin-producing Escherichia coli (STEC) food-borne outbreaks. J. Hell. Vet. Med. Soc., 63, 45–53. Hur, J., Jawale, C., and Lee, J.H. (2012) Antimicrobial resistance of Salmonella isolated from food animals: a review. Food Res. Int., 45, 819–830. Gaspar, D., Veiga, A.S., and Castanho, M.A.R.B. (2013) From antimicrobial to anticancer peptides. A review. Front. Microbiol., 4, 294. Harris, F., Dennison, S.R., Singh, J., and Phoenix, D.A. (2013) On the selectivity and efficacy of defense peptides with respect to cancer cells. Med. Res. Rev., 33, 190–234. Ledford, H. (2012) FDA under pressure to relax drug rules. Nature, 492, 19. Fox, J.L. (2013) Antimicrobial peptides stage a comeback. Nat. Biotechnol., 31, 379–382. 69 71 5 Antimicrobial Peptides from Prokaryotes Maryam Hassan, Morten Kjos, Ingolf F. Nes, Dzung B. Diep, and Farzaneh Lotfipour 5.1 Introduction A significant part of the disease history of mankind concerns the never-ending fight against microbial pathogens. Invasion by microorganisms has killed millions of human beings, but with the discovery of antibiotics and vaccines the hope of eradicating bacteria-derived diseases developed. However, due to the recent alarming rise of antibiotic resistance among pathogens, there is an emerging need to develop new antimicrobial agents [1, 2]. From a clinical point of view, it is a desirable approach to develop narrowspectrum antibacterial agents that are active against the defined pathogens associated with microbial infections and the antimicrobial compounds should not affect the positive, commensal, and natural microflora of the patient [3]. Promising candidates for such treatment are found among the bacteriocins produced by bacteria and they may provide the key to solve some of the shortcomings of the classical antibiotics. Antimicrobial peptides (AMPs) from prokaryotic bacteria have long been seen as potential compounds for use as antimicrobials both in clinical treatments and in food applications, but with a few notable exceptions, their actual application has so far been very limited. Now, with the alarming increase of antibiotic resistance in pathogenic bacteria worldwide, AMPs from prokaryotes should no longer be ignored as an option to combat this problem [4, 5]. Bacteriocins are gene-encoded, ribosomally synthesized peptides with antimicrobial activity directed mostly against closely related bacteria [6]. Although bacteriocins are ribosomally produced, they may be subjected to post-translational modifications (PTMs) of various kinds and such modifications are often important for stabilization, translocation, and the antimicrobial activity of the peptides. Bacteriocins have several characteristics that make them excellent candidates for becoming a new generation of antimicrobials: (i) they are highly potent and inhibit target cells at nanomolar concentrations, (ii) some AMPs have a remarkably narrow spectrum of inhibition, which makes it possible to develop pathogen-specific drugs, (iii) yet other AMPs have broader activity spectra (targeting several different bacterial genera) and can be used in more general approaches, (iv) the AMPs Novel Antimicrobial Agents and Strategies, First Edition. Edited by David A. Phoenix, Frederick Harris and Sarah R. Dennison. © 2015 Wiley-VCH Verlag GmbH & Co. KGaA. Published 2015 by Wiley-VCH Verlag GmbH & Co. KGaA. 72 5 Antimicrobial Peptides from Prokaryotes are often highly stable and are resistant to many proteases, high temperature, and pH variation, and (iv) the AMPs are amenable to bioengineering, which makes it possible to create and develop novel variants of the antimicrobials by peptide synthesis or DNA recombinant technology. Bacteriocins display great diversity in amino acid sequence, structures, and targets. Owing to this enormous diversity, classification of bacteriocins is not straightforward and is still an unsettled issue as demonstrated by different classification schemes suggested over the years [6–8]. In general, bacteriocins from Gram-positive bacteria have been divided into two classes: Class I with peptides containing PTMs (lanthibiotics) and Class II containing non-modified bacteriocins. Gram-negative peptide bacteriocins are often referred to as microcins and these have been further subclassified according to their PTM. Recently, a comprehensive nomenclature and classification of peptides containing PTMs (RiPPs; ribosomally synthesized, post-translationally modified peptides) was proposed, where peptides from both Gram-positive and Gram-negative bacteria are combined in the same classification scheme. In this scheme, the modified peptides (Class I) are subdivided into 11 groups [8]. Biosynthesis of bacteriocins generally requires four types of genes, and these are often found in the same genetic locus: (i) The structural gene(s) encoding the bacteriocin itself – in most cases, the gene encodes a pre-form of the peptide, which consists of an N-terminal leader sequence and the mature peptide. The leader sequence, which renders the intracellular peptide inactive and is important for proper modification and transport across the cell membrane, is cleaved off when the peptide is exported. It should be mentioned that some Class II bacteriocins from Gram-positive bacteria are encoded without leader sequences [9, 10]. In the case of the so-called two-peptide bacteriocins, AMPs whose activity requires the combined action of both peptides, two structural genes are found in the same operon and both encode a bacteriocin with an N-terminal leader sequence. (ii) An immunity system – the AMP producer needs to encode an immunity mechanism to avoid being killed by its own AMP. The immunity protein(s) are often encoded by the same operon as the AMP structural gene to ensure co-regulation. The mechanism of immunity is highly different between AMPs and can include both multiple proteins (including ABC transporters) to obtain optimal resistance such as in nisin and other lantibiotics or by single, small proteins as often seen among many Class II bacteriocins. (iii) A transport system – in order to be active outside the cell, the AMPs need to be exported across the cell envelope. Some bacteriocins may utilize general secretory pathways for externalization, but often dedicated transport systems, known as ABC transporters, are encoded in the AMP locus. In many cases, cleavage of the leader peptide to produce the mature peptide occurs concomitantly with transport mediated by the ABC transporter. (iv) Genes responsible for PTMs – many bacteriocins, such as the lantibiotics and most of the microcins, contain PTMs. Such modifications are inferred by dedicated enzymes that act on the ribosomally synthesized peptide to produce different PTMs. The mode of action of bacteriocins varies greatly between peptides, and is often different from classical antibiotics. Generally, the bacteriocins can kill sensitive 5.2 Bacteriocins bacteria by two different methods: (i) they may target the cell envelope by forming pores or inhibiting cell wall biosynthesis or (ii) they may act intracellularly to inhibit essential enzymatic/metabolic processes that involve inhibition of processes such as DNA synthesis, transcription, and translation. Interestingly, the latter mechanisms are found only among Gram-negative bacteriocins so far. Conversely, both Gram-negative and Gram-positive bacteriocins are targeting the cell envelope and the majority of bacteriocins do this by permeabilizing the membrane or by affecting the cell wall. Such activities cause disruption of the integrity of the cell free flow of small molecules, dissipation of the proton motive force, and eventually cell death. In order to permeabilize the membrane by forming pores, disrupt the membrane integrity, or irreversibly open transport channels, most probably the bacteriocins need to interact with a target on the cell envelope. The initial attraction of bacteriocins to the cell membrane is probably partly governed by electrostatic interactions between the positively charged peptides and the anionic lipids in the bacterial membranes [11], but a number of membrane-targeted bacteriocins interact specifically with a receptor of the sensitive cell, and such specific interactions are necessary for potent activity of the bacteriocins. Different types of molecules, including the peptidoglycan precursor lipid II and membrane proteins involved in sugar transport have been shown to function as receptors for different types of bacteriocins [6]. In the following, we first describe some of the most important classes of prokaryotic AMPs, namely, the microcins of Gram-negative bacteria and the lanthibiotics (Class I) and the Class II bacteriocins of Gram-positive bacteria. Then we discuss the (potential) applications of these peptides in different fields. Finally, we present some approaches that are being used to discover and develop new AMPs. 5.2 Bacteriocins 5.2.1 Microcins – Peptide Bacteriocins from Gram-Negative Bacteria The small, peptide bacteriocins from Gram-negative Enterobacteria, such as Escherichia, Klebsiella, and Salmonella, are called microcins. These peptides are <10 kDa (typically under 100 amino acids (aa)) and generally have a narrow inhibitory spectrum; thus, they are active only against closely related species within the Enterobacteria. Microcins are generally hydrophobic and are highly stable to high temperatures, extreme pH, and proteases. One example of a highly stable peptide is microcin J25 (MccJ25), a 21 aa long peptide that forms a remarkably stable threaded lasso structure [12, 13], in which the C-terminal tail is threaded into a beta-lactam ring. Microcins constitute a heterogeneous class of peptides, and they are traditionally classified into two groups according to their size and PTMs [14] (Table 5.1). Class I consist of the smallest peptides 73 74 5 Antimicrobial Peptides from Prokaryotes Table 5.1 Classification of AMPs. Subgroup Microcins Lantibiotic-containing bacteriocins (Class I) I Examples Small (<5 kDa), extensive PTM Microcin C IIa Larger, no-PTM IIb Larger, C-terminal PTM I Modified by LanC- and LanD-like enzymes II III IV Non-modified bacteriocins (Class II) Description a b Modified by LanM-like enzymes Modified by LanKC-like enzymes Modified by LanL-like enzymes Pediocin-like one-peptide bacteriocins Two-peptide bacteriocins c Circular bacteriocins d Other one-peptide bacteriocins Microcin B17 Microcin J25 Microcin V Microcin L Microcin 24 Microcin E492 Microcin H47 Microcin M Nisin Subtilin Mersacidin Lacticin 481 Actagardine Nukacin ISK-1 Lacticin 3147 (two-peptide) Haloduracin (two-peptide) Labyrinthopeptin — Pediocin PA-1 Enterocin A Sakacin P Mesentericin Y105 Lactococcin G Abp-118 Lactacin F Enterocin A-48 Garvicin ML Lactococcin A Lactococcin B Enterocin B Lacticin Q 5.2 MccJ25 MccC MccE492 Outer membrane FhuA OmpF Inner membrane SbmA Yej ABEF Inhibition of RNA polymerase Inhibition of Asp-tRNA synthetase Figure 5.1 Schematic overview of mode of action of three different microcins; MccJ25, MccC, and MccE492. The enzyme parasitizes different transport systems in the outerand inner membrane to gain access to their Bacteriocins Fep/ Cir/ Fiu IID IIC IIC IID Man-PTS Pore formation target site. Transport of microcins via the iron siderophore receptors (FhuA, Fep, Cir, or Fiu, shown in dark) also require energy generated by the inner membrane located Tonsystem, which is not depicted in this figure. (<5 kDa), which are often plasmid encoded and have extensive PTMs. Class II consists of larger peptides without (Class IIa) or with (Class IIa) PTMs. It should be noted that the recent classification scheme proposed by Arnison et al. [8], separates the microcins in a number of different groups, according to their different modifications. Microcins can kill sensitive cells by using either intracellular or extracellular targets. In general, the mode of action of a microcin includes two steps (Figure 5.1). The first step involves translocation of the peptide across the outer membrane and sometimes the inner membrane to reach the target site. Such translocation is often achieved by parasitizing different bacterial transport systems [15]. This means that the peptides contain molecular structures that mimic structures that are recognized and taken up by bacteria. For example, the iron-uptake system is utilized by several microcins [16]. Bacteria secrete the socalled siderophore chelators (low-molecular-mass iron-binding compounds) to scavenge environmental iron; when siderophores have bound iron extracellularly they are recognized by siderophore receptors (e.g., FhuA, FepA, Cir, Fiu) in the outer membrane and are transported into the periplasm. Several microcins (e.g., MccE492, MccH47) contain PTMs to mimic the siderophores, causing the bacteria to recognize the microcin as a siderophore and facilitate active translocation across the outer membrane. Some microcins need to be further translocated from the periplasm and across the inner membrane, and such transport may be achieved by different transporters or uptake proteins (e.g., the ABC transporter YejABEF, which transports MccC or the uptake protein SbmA) [15]. 75 76 5 Antimicrobial Peptides from Prokaryotes The second step in the mode of action of microcins is the cytotoxic action. As mentioned above, there are, in principle, two different target sites: the inner membrane or the cytoplasm. In the inner membrane, microcins can act by forming lethal pores, such as microcin E492, which binds to a sugar transporter complex known as the mannose phosphotransferase system to initiate pore formation. Cytoplasmically active microcins act by inhibiting active enzymatic processes. For example, the lasso peptide MccJ25 binds and blocks one of the channels of RNA polymerase [17], while MccC is a non-hydrolysable mimic of the nucleoide aspartyl adenylate that blocks protein synthesis by inhabiting aspartyl-tRNA synthetase [18]. 5.2.2 Lanthibiotics – Post-translationally Modified Peptides from Gram-Positive Bacteria The lantibiotics (also referred to as lantipeptides or Class I bacteriocins) are small peptides of <40 aas that contain one or several PTMs. The best known member of Class I is nisin, which has been studied for decades. The major PTMs of the lantibiotics are thioether-based internal ring structures known as lanthionine or 𝛽-methyllanthionine. These are formed by dehydration of selected serine and/or threonine residues followed by formation of a thiol bridge between the dehydrated residue and the proximally located cysteine residue [19]. Lanthibiotics may also contain other unusual amino acids formed by post-translational processes, including D-alanine [20]. Because of large structural variations, the subclassification of lantibiotics is not straightforward. In the recent classification of RiPPs by Arnison et al. [8], lantibiotics are classified on the basis of the biosynthetic enzymes responsible for the PTMs to create lanthionine or β-methyllanthionine motifs (Table 5.1). Here, Class I are lantibiotics where dehydration and cyclization to form lanthionine or β-methyllanthionine rings occur by the action of two separate enzymes known as LanB (the dehydratase) and LanC (the cyclase). Well-known members of this class are nisin, Pep5, and subtilin. Class II, III, and IV lantibiotics, on the other hand, are modified by the action of a single enzyme (LanM for Class II, LanKC for Class III, and LanL for Class IV) that carries out both the dehydration and cyclization steps, but by different mechanisms [8]. Notable peptides such as nukacin ISK-1, mersacidin, as well as the two-peptide lantibiotics lacticin 3147 and haloduracin belong to Class II. In the latter examples, the antimicrobial activity requires the combined activity of two individual peptides. Lantibiotics generally have a broader inhibitory spectrum than other prokaryotic AMPs and can kill a broad range of Gram-positive bacteria (but not Gram-negative species). All lantibiotics kill sensitive bacteria by targeting their cell envelope. The mode of action involves either pore formation or inhibition of cell wall synthesis, or both these actions combined. For efficient targeting, the lantibiotic recognizes specific molecules in the membrane of sensitive cells. The most important lantibiotic target receptor is lipid II. Lipid II is a key intermediate in peptidoglycan biosynthesis. It is synthesized intracellularly and 5.2 Bacteriocins translocated across the phospholipid bilayer to supply peptidoglycan subunits to the growing cell wall [21]. Binding to lipid II by antimicrobial compounds appears to be an effective means to kill bacteria, as this molecule is targeted by at least three other types of antibiotics in addition to lantibiotics, namely, glycopeptides antibiotics (vancomycin), mannopeptimycin, and ramoplanin [21]. Nisin and epidermin were the first lantibiotics shown to use lipid II as a docking molecule [22, 23], and the mechanism of action for nisin has been characterized in great detail. Nisin binds lipid II via the characteristic lantibiotic ring structures in the N-terminal part of the peptide, and pores containing both nisin and lipid II are formed [24]. In addition, nisin also inhibits target cells by blocking cell wall formation [25]. This mechanism is independent of the pore-forming activity and involves relocation of lipid II into patches outside their functional location. A number of different lantibiotics with N-terminal ring structures similar to nisin kill target cells by lipid II-mediated pore formation [21]. These include subtilin and members of the epidermin family as well as some two-component lantibiotics, such as lacticin 3147 [21, 26]. Mersacidin, on the other hand, also binds lipid II, but the mechanism of killing involves only inhibition of cell wall synthesis and pores are not formed in this case [23]. 5.2.3 Non-modified Peptides from Gram-Positive Bacteria In addition to the lantibiotics described above, Gram-positive bacteria also produce a wide variety of peptide bacteriocins that do not contain PTMs; these are often referred to as Class II bacteriocins [27]. These peptides can be classified into subgroups on the basis of their sequence and physiochemical properties (Table 5.1). Most of these peptides are cationic and amphiphilic and they kill target cells by creating pores in the membrane, disrupting the membrane integrity, or permeabilizing the membrane of the target cells in other ways. Such mechanisms cause leakage of low molecular weight compounds (e.g., ions, K+ , PO4 2− , H+ ), leading to dissipation of a proton motive force that is deleterious for the cell [11]. Similarly to lantibiotics, Class II bacteriocins seem to target specific molecules in the membrane of sensitive cells to lethally damage the membrane; however, such receptors/targets have only been identified for some of the Class II bacteriocins. The group of pediocin-like bacteriocins (Class IIa) are named after the first characterized member of this group, pediocin PA-1 from Pediococcus pentosaceus [28]. These peptides are 36–79 aa long and are grouped in this subclass based on the presence of a highly conserved N-terminal consensus sequence (YGNGVxCxxxxCxVxWxxA, where x is any amino acid). Structural analysis has shown that this conserved N-terminal consensus sequence is part of a β-sheet structure, while the less conserved N-terminal part of the peptides form a hairpin structure consisting of one of two alpha-helices (helix-turn-helix structure). Pediocin-like bacteriocins are particularly efficient in inhibiting species within the genera of Listeria and Enterococcus, and are therefore of medical interest. To kill sensitive 77 78 5 Antimicrobial Peptides from Prokaryotes Nisin Outside Inside Lipid II Pore formation (a) Class lla bacteriocin Outside Outside IID IIC IIC IID IID IIC IIC IID Inside Inside Man-PTS Pore formation (b) Figure 5.2 Schematic overview of mode of action of two different types of poreforming bacteriocins from Gram-positive bacteria. (a) a pore by insertion of the peptide into the lipid bilayer. Nisin also has a second mode of action not depicted in the figure, which involves blocking of cell wall by binding to lipid II. (b) The class IIa bacteriocins (pediocin-like bacteriocins) bind to the sugar transporter known as the mannosephosphotransferase system to form pores. cells, pediocin-like bacteriocins target the membrane-located proteins of a sugar transporter complex known as the mannose phosphotransferase system on sensitive cells [29–31] (Figure 5.2b). More specifically, this glucose/mannosespecific translocation channel, consisting of proteins IIC and IID together form the receptor, and a 40 aa extracellular loop of the IIC protein is involved in the specific recognition [31, 32]. In order to avoid self-killing, these bacteriocins have an intracellular immunity protein that blocks the bacteriocin-induced pore formation by binding tightly to its own mannose phosphotransferase system [33]. Also worth noting is that resistance toward Class IIa bacteriocins seems to develop quite easily, and the main mechanism is probably downregulation of receptor expression [34]. Class IIb consists of bacteriocins, whose activity depends on the complementary action of two individual peptides [35]. The two genes encoding the peptides of length between 25 and 38 aas are located next to each other on the same operon. Their structures are characterized by a well-defined, central α-helix region with flexible regions in both ends. Although no structure has been determined for the peptide heterodimers, it has been shown that there is direct physical interaction between the complementary peptides when they exert antimicrobial activity 5.3 Applications of Prokaryotic AMPs [35, 36]. The inhibitory spectra of these bacteriocins are narrow; for example, lactococcin G is active only against strains of Lactococcus, while plantaricins EF and JK, which are coproduced by the same host, display activity only against a few strains of Lactobacillus and Pediococcus. One group of antimicrobial peptides from Gram-positive bacteria needs to undergo a cyclization process in order to be active; this is Class IIc, the cyclic or circular bacteriocins. In these peptides, the N- and C-terminal ends are covalently linked by an amide bond [37, 38], but the molecular details underlying this process are still unclear. The circular bacteriocins are both remarkably stable and display very potent antimicrobial activity [39]. Circular bacteriocins kill target cells by disrupting the membrane integrity [38]; however, it is not clear whether circular bacteriocins need a target receptor. While enterocin AS-48 is able to form pores in lipid bilayers [40], it has been shown for garvicin ML that the maltose ABC transporter is important for the sensitivity, and may function as a docking molecule [41]. Some unmodified, linear, non-pediocin-like bacteriocins do not fit into any of the classes mentioned above and are therefore placed in Class IId. One member of this group is lactococcin A, a 54 aa long peptide produced by Lactococcus lactis. Interestingly, this peptide has a similar mode of action as the pediocin-like bacteriocins and microcin MccE492; it uses the mannose phosphotransferase system as receptor on target cells [33]. This similarity in the mode of action is found despite a lack of the sequence similarity between these groups of peptides, indicating that the mannose phosphotransferase system is a weak spot for bacteria when it comes to antimicrobial attack. The leaderless bacteriocins constitute a significant group of antibacterial peptides that has been given little attention. They have been isolated from different Gram-positive bacteria such as Staphylococcus aureus, Enterococcus faecium, L. lactis, as well as other bacteria. It has been shown that L. lactis subsp. lactis BGMN1-5 produces a leaderless Class II bacteriocin called LsbB [42]. Recently, it was published that a membranebound peptidase gene was involved in bacteriocin sensitivity in target cells. It was concluded that this membrane-bound peptidase acts as a specific receptor for the LsbB bacteriocins [43]. 5.3 Applications of Prokaryotic AMPs 5.3.1 Food Biopreservation Biopreservation is explained as improved safety of foods as well as extended storage time using natural microflora in the form of protective cultures and/or their metabolites as antimicrobial agents [44]. The bacteriocins from lactic acid bacteria (LAB) are well accepted as natural means of food biopreservation [45], 79 80 5 Antimicrobial Peptides from Prokaryotes and the well-known lantibiotic nisin has been used for this purpose for decades. Three different strategies have been explored for application of bacteriocins in food products: addition in purified form, in situ production by bacteriocinogenic bacteria, and binding of bacteriocins to polymeric packaging [45, 46]. Bacteriocins such as purified or semi-purified nisin and enterocin AS-48 can be added to food as biopreservatives to prolong shelf-life and reduce the usage of conventional preservatives with negative effects for human health such as nitrates. They have been found to inhibit many Gram-positive and also some Gram-negative bacterial species. This broad inhibitory spectrum has encouraged the researchers to evaluate their antimicrobial efficacy in foods. For example, enterocin AS-48 in ready-to-eat fruit and vegetable products always retained above 65% of the activity [47]; nisin can be incorporated into kimchi and cooked mashed potatoes to control and preserve the product by inhibiting lactobacilli (which are responsible for the over-ripening of kimchi [48]) as well as Bacillus and Clostridium (which have caused several food-borne outbreaks [46]). Interestingly, another practical approach is to introduce the bacteriocinogenic strains (particularly LAB) as a starter culture directly into fermented sausage or dairy product without purification to increase food quality and safety [49, 50]. Enterocin AS-48 produced by bacteriocinogenic strains can interact directly to target spoilage and poisonous bacteria such as Listeria monocytogenes in model sausages [51] and S. aureus in milk [50]. Development of packaging films with antimicrobial entity is a suitable alternative to preserve a complex food environment [52, 53]. Bacteriocins are the most interesting antimicrobial agents in this regard because of their natural and safe properties [54]. The efficacy of films coated by nisin [55], enterocin A and B [56], and enterocin 416K1 [57] in the strong inhibition of L. monocytogenes in cooked meat products has been proved. Such a method provides longer preservation in comparison with addition of purified enterocins into foods [58]. 5.3.2 Bacteriocinogenic Probiotics Recent studies have shown that the impact of bacteriocin-producing bacteria as probiotics on gut health (where they will possibly secrete bacteriocins) are significantly more effective than purified bacteriocin [59–61]. Probiotic strains may work better because of their prophylactic benefits (interact directly with the sensitive organisms in the intestine); however, purified bacteriocins possess the potential to target specific pathogens in established infection. Furthermore, the peptide-based structure of AMPs that are susceptible to proteolytic digestion in the stomach provides some limitation regarding their application in the food and pharmaceutical industry [49, 62, 63]. Most compelling, Corr et al. [64] showed that L. monocytogenes infection in the mice gut could be inhibited by a bacteriocin-producing probiotic strain of Lactobacillus salivarius, and they also demonstrated that this protection depended strictly on the bacteriocin and not other probiotic effects. Furthermore, in a study by Bhardwaj et al. [65] it was 5.3 Applications of Prokaryotic AMPs demonstrated that consuming bacteriocin-producing E. faecium KH24 in mice significantly modulated fecal microbiota in GI tract of mice. The authors emphasized that Lactobacillus population in mice fed with bacteriocin-producing E. faecium is much greater than those mice fed with non-producing strains. These studies highlight the potential of such probiotics to serve to control the indigenous microbiota in a beneficial manner. 5.3.3 Clinical Application Nisin A is one of the first AMPs that were studied in animal infection model as early as 1952 [66]. In spite of the rapid clearance of nisin A from blood, it has the same efficacy as penicillin in the treatment of infections related to Mycobacterium tuberculosis, Streptococcus pyogenes, and S. aureus in mice. Interestingly, owing to the rapid bactericidal action of nisin in comparison to vancomycin, two intravenous doses of 0.16 mg kg−1 nisin are even more effective than two intravenous doses of 1.25 mg kg−1 vancomycin in treating mice infected with Streptococcus pneumonia [66–68]. In another study by Okuda et al. [69] the anti-biofilm effect of nisin A, lacticin Q, and nukacin ISK-1 were evaluated against a clinical isolate of methicillin-resistant S. aureus (MRSA). Interestingly, among the abovementioned bacteriocins, nisin A demonstrated the highest bactericidal activity against planktonic as well as biofilm cells. Mechanistically, the authors suggested that nisin A can form stable pores on biofilm cells, and therefore it can effectively be used to prevent biofilm-associated infections, especially in patients using central venous catheters [69]. Nisin has also been tested for functions beyond the direct antimicrobial effect. For example, prevention of cell proliferation in vitro and in vivo in head and neck squamous cell carcinoma (HNSCC) was recently assessed [70]. Apoptosis, also known as programmed cell death, is a natural process that eliminates older cells in multicellular organisms; however, cancer cells are resistant to apoptosis [71]. Joo et al. demonstrated that nisin decreases HNSCC tumorigenesis by inducing preferential apoptosis and inhibiting proliferation in HNSCC cells compared to primary keratinocytes. Mechanistically, nisin acts by increasing the intracellular calcium, induction of cell cycle arrest, and activation of CHAC1 (a proapoptotic cation transport regulator) expression. Joo et al. [70] proposed application of nisin as a novel antitumor agent for HNSCC in the near future. The discovery of the sactibiotic thuricin CD by Rea et al. [72], which is produced by Bacillus thuringiensis, showed that Clostridium difficile-associated diarrhea (CDAD) can be treated without prescribing broad-spectrum antibiotics in a model of the human distal colon. Antibiotics such as vancomycin and metronidazole, which are used clinically to treat CDAD, dramatically modulate the resident gut microbiota, whereas thuricin CD, which has comparable antimicrobial activity, did not change the composition of the commensal microbiota much. Thus, thuricin CD can fight CDAD without causing the unwanted side effects often faced with conventional antibiotics. 81 82 5 Antimicrobial Peptides from Prokaryotes 5.3.4 Applications in Dental Care Bacteriocins can play a significant role in controlling the ecological balance in human oral microbial community. S. pyogenes (the important etiological agent in human dental caries) and Streptococcus salivarius (predominant component of oral commensal throughout life) both colonize on the oral mucosal surface. However, bacteriocins of S. salivarius can block the growth of a virulent S. pyogenes biofilm by signal transduction interaction. Therefore, oral bacteria and their bacteriocins allow bacteria to select their “neighbors” and establish a stable oral microbiota [73–75]. In recent years, antimicrobial peptides such as nisin, mutacin, and ϵ-poly-Llysine have been widely studied and seem to have practical potential to target the harmful cariogenic bacteria such as Streptococcus mutans and Streptococcus sobrinus [76, 77]. Nisin, which is highly active and stable at low pH (2–6) [54, 78], may suffer from drawbacks regarding instability, low solubility, and consequently lower efficacy in the neutral and weakly acidic condition in human oral cavity [76]. In this respect, according to the published research of Rollema et al. [78] solubility and stability of nisin with acceptable activity at neutral pH has been improved by the application of protein engineering approaches. ϵ-Poly-L-lysine is another relatively broad spectrum, wide pH range stable and water soluble generally recognized as safe (GRAS) antimicrobial peptide [79, 80]. In addition, it is the secondary metabolite of Streptomyces albulus, which has been approved as a natural preservative since the late 1980s and in January 2004 in Japan and the United States, respectively [79, 81]. Interestingly in a study, Najjar et al. [82] addressed the synergistic activity of nisin and ϵ-poly-L-lysine on S. mutans. An implication of the above-mentioned finding is the high possibility of anti-caries combination therapy of nisin and poly-L-lysine. Despite extensive in vitro research regarding the effectiveness as well as safety application of nisin in chewing gum and oral formulations against cariogenic pathogens [83–85] and oral diseases such as gingivitis in animal model [86], very little progress has been made to develop commercial applications. 5.4 Development and Discovery of Novel AMP The group of antimicrobials referred to as prokaryotic AMPs offer a wide variety of different peptides that have promising applications in different settings and against many important pathogens. Since most of these compounds have not yet undergone clinical tests, knowledge about resistance development only comes from laboratory-based research [6]. This has shown that sensitive cells can develop resistance to some Class II bacteriocins (i.e., Class IIa bacteriocins and lactococcin A) by downregulating the expression of the target receptor [34]. Furthermore, resistance against microcins may develop through mutations in genes encoding 5.4 Development and Discovery of Novel AMP the bacteriocins target; for example, resistance to MccJ25 can occur by mutation in RNA polymerase [87]. Lantibiotics seem to have less of these problems, since they do not target proteins; however, transient lantibiotic resistance could emerge from changes in the cell envelope composition [88, 89]. Nevertheless, it is worth noting that nisin has been used in different food applications for decades already without any major concern about resistance development. Resistance development among different prokaryotic AMPs still needs to be examined under in vivo settings; however, one great advantage with this group of antimicrobials is their gene-encoded nature. This creates huge possibilities for in silico discovery as well as bioengineering approaches to obtain novel peptide variants that can overcome potential problems with resistance development. As mentioned before, biosynthesis of bacteriocins relies on three or four different types of genes: (i) structural gene(s), (ii) immunity gene(s), (iii) transport genes, and in some cases, and (iv) genes responsible for PTMs. Since these genes often are co-located on the genome and also have some well-known characteristics, softwares such as BAGEL (http://bagel.molgenrug.nl) can be made to automatically mine new bacterial genome sequences for candidate bacteriocin genes. Furthermore, bioengineering approaches have huge potential to generate new and even synthetic variants of prokaryotic AMPs [90, 91]. For example, by sitedirected mutagenesis in the bacteriocin structural genes, new peptide variants can be constructed. As further advancement, by using different synthetic biology approaches and heterologous expression systems, nonexpressed bacteriocin genes can be produced and novel combinations of modifications can be introduced in the same peptide [90, 92]. Lastly, chemical synthesis of peptides, based on knowledge of natural peptides and their mode of action can further increase the repertoire of prokaryotic AMPs with improved potency, stability, or inhibition spectrum. In this context, it is also interesting to note that peptide engineering has been used to change the activity of other, non-peptide, antimicrobial molecules. For example, pheromonicin is an engineered peptide that consists of the S. aureus pheromone gene (AgrD1), which is fused to the colicin Ia [93]. While the poreforming colicin Ia (a pore-forming protein) is only active against Escherichia coli, fusion of the AgrD1 sequence, directs its activity toward S. aureus (which is not its natural target). Pheromonicin was found active against both methicillin-sensitive S. aureus (MSSA) and MRSA. Strikingly, growth was inhibited by 60% in resistant MRSA (resistant cells). Furthermore, the efficacy of pheromonicin was also shown in mice infected by MRSA [93]. In another study, colicin Ia was fused to another pheromone gene, namely, cCF10 of E. faecalis to construct pheromonicin PMCEF. Using this strategy, colicin activity was directed against vancomycin-resistant Enterococcus (VRE) both in vitro and in mice-made bacteremia by VRE [94]. Furthermore, Janiszewska and Urbanczyk-Lipkowska [95] used peptide engineering to create a new class of low molecular weight dendrimeric antimicrobial peptides [95], where the antimicrobial activity of linear peptides was transferred to the so-called dendrimers. Dendrimers are new synthetic branched macromolecules, which are characterized by tree-like structures with a high number of functional 83 84 5 Antimicrobial Peptides from Prokaryotes groups on the molecular surface [95, 96]. Their well-defined scaffold makes them applicable for various biomedical purposes, for example, protein mimetics [97], diagnostic purposes [98], and as a carrier in drug and gene delivery [99, 100]. They obtained peptide dendrimers with amphiphilic properties and positive charges (two key structural elements for antimicrobial activity) [101–103] and expressed high antimicrobial effect against E. coli, S. aureus, as well as Candida albicans because of their interaction with the cell membrane [95]. References 1. Overbye, K.M. and Barrett, J.F. (2005) 2. 3. 4. 5. 6. 7. Antibiotics: where did we go wrong? Drug Discovery Today, 10, 45–52. Hassan, M., Kjos, M., Nes, I.F., Diep, D.B., and Lotfipour, F. (2012) Natural antimicrobial peptides from bacteria: characteristics and potential applications to fight against antibiotic resistance. J. Appl. Microbiol., 113, 723–736. Finch, R. and Hunter, P.A. (2006) Antibiotic resistance–action to promote new technologies: report of an EU Intergovernmental conference held in Birmingham, UK, 12-13 December 2005. J. Antimicrob. Chemother., 58 (Suppl. 1), i3–i22. Belguesmia, Y., Madi, A., Sperandio, D., Merieau, A., Feuilloley, M., Prevost, H., Drider, D., and Connil, N. (2011) Growing insights into the safety of bacteriocins: the case of enterocin S37. Res. Microbiol., 162, 159–163. Hassan, M., Javadzadeh, Y., Lotfipour, F., and Badomchi, R. (2011) Determination of comparative minimum inhibitory concentration (MIC) of bacteriocins produced by enterococci for selected isolates of multi-antibiotic resistant Enterococcus spp. Adv. Pharm. Bull., 1, 75–79. Cotter, P.D., Ross, R.P., and Hill, C. (2013) Bacteriocins - a viable alternative to antibiotics? Nat. Rev. Microbiol., 11, 95–105. Nes, I.F., Diep, D.B., and Holo, H. (2007) Bacteriocin diversity in Streptococcus and Enterococcus. J. Bacteriol., 189, 1189–1198. 8. Arnison, P.G., Bibb, M.J., Bierbaum, G., Bowers, A.A., Bugni, T.S., Bulaj, G., Camarero, J.A., Campopiano, D.J., Challis, G.L., Clardy, J., Cotter, P.D., Craik, D.J., Dawson, M., Dittmann, E., Donadio, S., Dorrestein, P.C., Entian, K.D., Fischbach, M.A., Garavelli, J.S., Goransson, U., Gruber, C.W., Haft, D.H., Hemscheidt, T.K., Hertweck, C., Hill, C., Horswill, A.R., Jaspars, M., Kelly, W.L., Klinman, J.P., Kuipers, O.P., Link, A.J., Liu, W., Marahiel, M.A., Mitchell, D.A., Moll, G.N., Moore, B.S., Muller, R., Nair, S.K., Nes, I.F., Norris, G.E., Olivera, B.M., Onaka, H., Patchett, M.L., Piel, J., Reaney, M.J., Rebuffat, S., Ross, R.P., Sahl, H.G., Schmidt, E.W., Selsted, M.E., Severinov, K., Shen, B., Sivonen, K., Smith, L., Stein, T., Sussmuth, R.D., Tagg, J.R., Tang, G.L., Truman, A.W., Vederas, J.C., Walsh, C.T., Walton, J.D., Wenzel, S.C., Willey, J.M., and van der Donk, W.A. (2013) Ribosomally synthesized and posttranslationally modified peptide natural products: overview and recommendations for a universal nomenclature. Nat. Prod. Rep., 30, 108–160. 9. Cintas, L.M., Casaus, P., Holo, H., Hernandez, P.E., Nes, I.F., and Havarstein, L.S. (1998) Enterocins L50A and L50B, two novel bacteriocins from Enterococcus faecium L50, are related to staphylococcal hemolysins. J. Bacteriol., 180, 1988–1994. 10. Iwatani, S., Yoneyama, F., Miyashita, S., Zendo, T., Nakayama, J., and Sonomoto, K. (2012) Identification of the genes involved in the secretion and self-immunity of lacticin Q, an unmodified leaderless bacteriocin from References 11. 12. 13. 14. 15. 16. 17. 18. Lactococcus lactis QU 5. Microbiology, 158, 2927–2935. Eijsink, V.G., Axelsson, L., Diep, D.B., Havarstein, L.S., Holo, H., and Nes, I.F. (2002) Production of class II bacteriocins by lactic acid bacteria; an example of biological warfare and communication. Antonie Van Leeuwenhoek, 81, 639–654. Rosengren, K.J. and Craik, D.J. (2009) How bugs make lassos. Chem. Biol., 16, 1211–1212. Rosengren, K.J., Blond, A., Afonso, C., Tabet, J.C., Rebuffat, S., and Craik, D.J. (2004) Structure of thermolysin cleaved microcin J25: extreme stability of a two-chain antimicrobial peptide devoid of covalent links. Biochemistry, 43, 4696–4702. Rebuffat, S. (2012) Microcins in action: amazing defence strategies of Enterobacteria. Biochem. Soc. Trans., 40, 1456–1462. Duquesne, S., Destoumieux-Garzon, D., Peduzzi, J., and Rebuffat, S. (2007) Microcins, gene-encoded antibacterial peptides from enterobacteria. Nat. Prod. Rep., 24, 708–734. Destoumieux-Garzon, D., Duquesne, S., Peduzzi, J., Goulard, C., Desmadril, M., Letellier, L., Rebuffat, S., and Boulanger, P. (2005) The ironsiderophore transporter FhuA is the receptor for the antimicrobial peptide microcin J25: role of the microcin Val11-Pro16 beta-hairpin region in the recognition mechanism. Biochem. J., 389, 869–876. Adelman, K., Yuzenkova, J., La Porta, A., Zenkin, N., Lee, J., Lis, J.T., Borukhov, S., Wang, M.D., and Severinov, K. (2004) Molecular mechanism of transcription inhibition by peptide antibiotic Microcin J25. Mol. Cell, 14, 753–762. Metlitskaya, A., Kazakov, T., Kommer, A., Pavlova, O., Praetorius-Ibba, M., Ibba, M., Krasheninnikov, I., Kolb, V., Khmel, I., and Severinov, K. (2006) Aspartyl-tRNA synthetase is the target of peptide nucleotide antibiotic Microcin C. J. Biol. Chem., 281, 18033–18042. 19. Bierbaum, G. and Sahl, H.G. (2009) 20. 21. 22. 23. 24. 25. 26. 27. Lantibiotics: mode of action, biosynthesis and bioengineering. Curr. Pharm. Biotechnol., 10, 2–18. Skaugen, M., Nissen-Meyer, J., Jung, G., Stevanovic, S., Sletten, K., Inger, C., Abildgaard, M., and Nes, I.F. (1994) In vivo conversion of L-serine to D-alanine in a ribosomally synthesized polypeptide. J. Biol. Chem., 269, 27183–27185. Breukink, E. and de Kruijff, B. (2006) Lipid II as a target for antibiotics. Nat. Rev. Drug Discovery, 5, 321–332. Breukink, E., Wiedemann, I., van Kraaij, C., Kuipers, O.P., Sahl, H.G., and de Kruijff, B. (1999) Use of the cell wall precursor lipid II by a poreforming peptide antibiotic. Science, 286, 2361–2364. Brotz, H., Bierbaum, G., Leopold, K., Reynolds, P.E., and Sahl, H.G. (1998) The lantibiotic mersacidin inhibits peptidoglycan synthesis by targeting lipid II. Antimicrob. Agents Chemother., 42, 154–160. Hsu, S.T., Breukink, E., Tischenko, E., Lutters, M.A., de Kruijff, B., Kaptein, R., Bonvin, A.M., and van Nuland, N.A. (2004) The nisin-lipid II complex reveals a pyrophosphate cage that provides a blueprint for novel antibiotics. Nat. Struct. Mol. Biol., 11, 963–967. Hasper, H.E., Kramer, N.E., Smith, J.L., Hillman, J.D., Zachariah, C., Kuipers, O.P., de Kruijff, B., and Breukink, E. (2006) An alternative bactericidal mechanism of action for lantibiotic peptides that target lipid II. Science, 313, 1636–1637. Wiedemann, I., Bottiger, T., Bonelli, R.R., Wiese, A., Hagge, S.O., Gutsmann, T., Seydel, U., Deegan, L., Hill, C., Ross, P., and Sahl, H.G. (2006) The mode of action of the lantibiotic lacticin 3147 - A complex mechanism involving specific interaction of two peptides and the cell wall precursor lipid II. Mol. Microbiol., 61, 285–296. Kjos, M., Borrero, J., Opsata, M., Birri, D.J., Holo, H., Cintas, L.M., Snipen, L., Hernandez, P.E., Nes, I.F., and Diep, D.B. (2011) Target recognition, resistance, immunity and genome mining 85 86 5 Antimicrobial Peptides from Prokaryotes 28. 29. 30. 31. 32. 33. 34. 35. of class II bacteriocins from Grampositive bacteria. Microbiology, 157, 3256–3267. Nieto Lozano, J.C., Meyer, J.N., Sletten, K., Pelaz, C., and Nes, I.F. (1992) Purification and amino acid sequence of a bacteriocin produced by Pediococcus acidilactici. J. Gen. Microbiol., 138, 1985–1990. Ramnath, M., Beukes, M., Tamura, K., and Hastings, J.W. (2000) Absence of a putative mannose-specific phosphotransferase system enzyme IIAB component in a leucocin A-resistant strain of Listeria monocytogenes, as shown by two-dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Appl. Environ. Microbiol., 66, 3098–3101. Hechard, Y. and Sahl, H.G. (2002) Mode of action of modified and unmodified bacteriocins from Grampositive bacteria. Biochimie, 84, 545–557. Kjos, M., Nes, I.F., and Diep, D.B. (2009) Class II one-peptide bacteriocins target a phylogenetically defined subgroup of mannose phosphotransferase systems on sensitive cells. Microbiology, 155, 2949–2961. Kjos, M., Snipen, L., Salehian, Z., Nes, I.F., and Diep, D.B. (2010) The Abi proteins and their involvement in bacteriocin self-immunity. J. Bacteriol., 192, 2068–2076. Diep, D.B., Skaugen, M., Salehian, Z., Holo, H., and Nes, I.F. (2007) Common mechanisms of target cell recognition and immunity for class II bacteriocins. Proc. Natl. Acad. Sci. U.S.A., 104, 2384–2389. Kjos, M., Nes, I.F., and Diep, D.B. (2011) Mechanisms of resistance to bacteriocins targeting the mannose phosphotransferase system. Appl. Environ. Microbiol., 77, 3335–3342. Oppegard, C., Rogne, P., Emanuelsen, L., Kristiansen, P.E., Fimland, G., and Nissen-Meyer, J. (2007) The twopeptide class II bacteriocins: structure, production, and mode of action. J. Mol. Microbiol. Biotechnol., 13, 210–219. 36. Rogne, P., Fimland, G., Nissen-Meyer, 37. 38. 39. 40. 41. 42. 43. 44. J., and Kristiansen, P.E. (2008) Threedimensional structure of the two peptides that constitute the two-peptide bacteriocin lactococcin G. Biochim. Biophys. Acta, 1784, 543–554. van Belkum, M.J., Martin-Visscher, L.A., and Vederas, J.C. (2011) Structure and genetics of circular bacteriocins. Trends Microbiol., 19, 411–418. Montalban-Lopez, M., Sanchez-Hidalgo, M., Cebrian, R., and Maqueda, M. (2012) Discovering the bacterial circular proteins: bacteriocins, cyanobactins, and pilins. J. Biol. Chem., 287, 27007–27013. Sanchez-Hidalgo, M., Montalban-Lopez, M., Cebrian, R., Valdivia, E., Martinez-Bueno, M., and Maqueda, M. (2012) AS-48 bacteriocin: close to perfection. Cell. Mol. Life Sci., 68, 2845–2857. Maqueda, M., Gálvez, A., Bueno, M.M., Sanchez-Barrena, M.J., González, C., Albert, A., Rico, M., and Valdivia, E. (2004) Peptide AS-48: prototype of a new class of cyclic bacteriocins. Curr. Protein Pept. Sci., 5, 399–416. Gabrielsen, C., Brede, D.A., Hernandez, P.E., Nes, I.F., and Diep, D.B. (2012) The maltose ABC transporter in Lactococcus lactis facilitates high-level sensitivity to the circular bacteriocin garvicin ML. Antimicrob. Agents Chemother., 56, 2908–2915. Gajic, O., Buist, G., Kojic, M., Topisirovic, L., Kuipers, O.P., and Kok, J. (2003) Novel mechanism of bacteriocin secretion and immunity carried out by lactococcal multidrug resistance proteins. J. Biol. Chem., 278, 34291–34298. Uzelac, G., Kojic, M., Lozo, J., Aleksandrzak-Piekarczyk, T., Gabrielsen, C., Kristensen, T., Nes, I.F., Diep, D.B., and Topisirovic, L. (2013) A Zn-dependent metallopeptidase is responsible for sensitivity to LsbB, a class II leaderless bacteriocin of Lactococcus lactis subsp. Lactis BGMN1-5. J. Bacteriol., 195, 5614–5621. Stiles, M.E. (1996) Biopreservation by lactic acid bacteria. Antonie Van Leeuwenhoek, 70, 331–345. References 45. Galvez, A., Lopez, R.L., Abriouel, H., 46. 47. 48. 49. 50. 51. 52. 53. 54. Valdivia, E., and Omar, N.B. (2008) Application of bacteriocins in the control of foodborne pathogenic and spoilage bacteria. Crit. Rev. Biotechnol., 28, 125–152. Settanni, L. and Corsetti, A. (2008) Application of bacteriocins in vegetable food biopreservation. Int. J. Food Microbiol., 121, 123–138. Grande, M.J., Lucas, R., Valdivia, E., Abriouel, H., Maqueda, M., Omar, N.B., Martinez-Canamero, M., and Galvezi, A. (2005) Stability of enterocin AS-48 in fruit and vegetable juices. J. Food Prot., 68, 2085–2094. Choi, M.H. and Park, Y.H. (2000) Selective control of lactobacilli in kimchi with nisin. Lett. Appl. Microbiol., 30, 173–177. De Vuyst, L. and Leroy, F. (2007) Bacteriocins from lactic acid bacteria: production, purification, and food applications. J. Mol. Microbiol. Biotechnol., 13, 194–199. Mañoz, A., Ananou, S., Gálvez, A., Martínez-Bueno, M., Rodríguez, A., Maqueda, M., and Valdivia, E. (2007) Inhibition of Staphylococcus aureus in dairy products by enterocin AS-48 produced in situ and ex situ: bactericidal synergism with heat. Int. Dairy J., 17, 760–769. Khan, H., Flint, S., and Yu, P.L. (2010) Enterocins in food preservation. Int. J. Food Microbiol., 141, 1–10. Mauriello, G., Ercolini, D., La Storia, A., Casaburi, A., and Villani, F. (2004) Development of polythene films for food packaging activated with an antilisterial bacteriocin from Lactobacillus curvatus 32Y. J. Appl. Microbiol., 97, 314–322. Suppakul, P., Miltz, J., Sonneveld, K., and Bigger, S.W. (2003) Active packaging technologies with an emphasis on antimicrobial packaging and its applications. J. Food Sci., 68, 408–420. Cleveland, J., Montville, T.J., Nes, I.F., and Chikindas, M.L. (2001) Bacteriocins: safe, natural antimicrobials for food preservation. Int. J. Food Microbiol., 71, 1–20. 55. Neetoo, H., Ye, M., Chen, H., Joerger, 56. 57. 58. 59. 60. 61. 62. 63. R.D., Hicks, D.T., and Hoover, D.G. (2008) Use of nisin-coated plastic films to control Listeria monocytogenes on vacuum-packaged cold-smoked salmon. Int. J. Food Microbiol., 122, 8–15. Marcos, B., Aymerich, T., Monfort, J.M., and Garriga, M. (2007) Use of antimicrobial biodegradable packaging to control Listeria monocytogenes during storage of cooked ham. Int. J. Food Microbiol., 120, 152–158. Iseppi, R., Pilati, F., Marini, M., Toselli, M., de Niederhausern, S., Guerrieri, E., Messi, P., Sabia, C., Manicardi, G., Anacarso, I., and Bondi, M. (2008) Anti-listerial activity of a polymeric film coated with hybrid coatings doped with Enterocin 416 K1 for use as bioactive food packaging. Int. J. Food Microbiol., 123, 281–287. Quintavalla, S. and Vicini, L. (2002) Antimicrobial food packaging in meat industry. Meat Sci., 62, 373–380. Cruchet, S., Obregon, M.C., Salazar, G., Diaz, E., and Gotteland, M. (2003) Effect of the ingestion of a dietary product containing Lactobacillus johnsonii La1 on Helicobacter pylori colonization in children. Nutrition, 19, 716–721. Lesbros-Pantoflickova, D., Corthesy-Theulaz, I., and Blum, A.L. (2007) Helicobacter pylori and probiotics. J. Nutr., 137, 812S–818S. Coconnier, M.H., Lievin, V., Hemery, E., and Servin, A.L. (1998) Antagonistic activity against Helicobacter infection in vitro and in vivo by the human Lactobacillus acidophilus strain LB. Appl. Environ. Microbiol., 64, 4573–4580. Gillor, O., Etzion, A., and Riley, M.A. (2008) The dual role of bacteriocins as anti- and probiotics. Appl. Microbiol. Biotechnol., 81, 591–606. Hassan, M., Diep, D.B., Javadzadeh, Y., Dastmalchi, S., Nes, I.F., Sharifi, Y., Yari, S., Farajnia, S., and Lotfipour, F. (2012) Prevalence of bacteriocin activities and bacteriocin-encoding genes in enterococcal clinical isolates in Iran. Can. J. Microbiol., 58, 359–368. 87 88 5 Antimicrobial Peptides from Prokaryotes 64. Corr, S.C., Li, Y., Riedel, C.U., O’Toole, 65. 66. 67. 68. 69. 70. 71. 72. 73. P.W., Hill, C., and Gahan, C.G.M. (2007) Bacteriocin production as a mechanism for the antiinfective activity of Lactobacillus salivarius UCC118. Proc. Natl. Acad. Sci. U.S.A., 104, 7617–7621. Bhardwaj, A., Gupta, H., Kapila, S., Kaur, G., Vij, S., and Malik, R.K. (2010) Safety assessment and evaluation of probiotic potential of bacteriocinogenic Enterococcus faecium KH 24 strain under in vitro and in vivo conditions. Int. J. Food Microbiol., 141, 156–164. Bavin, E.M., Beach, A.S., Falconer, R., and Friedmann, R. (1952) Nisin in experimental tuberculosis. Lancet, 1, 127–129. Goldstein, B.P., Wei, J., Greenberg, K., and Novick, R. (1998) Activity of nisin against Streptococcus pneumoniae, in vitro, and in a mouse infection model. J. Antimicrob. Chemother., 42, 277–278. Mota-Meira, M., Morency, H., and Lavoie, M.C. (2005) In vivo activity of mutacin B-Ny266. J. Antimicrob. Chemother., 56, 869–871. Okuda, K.I., Zendo, T., Sugimoto, S., Iwase, T., Tajima, A., Yamada, S., Sonomoto, K., and Mizunoe, Y. (2013) Effects of bacteriocins on methicillinresistant Staphylococcus aureus biofilm. Antimicrob. Agents Chemother., 57, 5572–5579. Joo, N.E., Ritchie, K., Kamarajan, P., Miao, D., and Kapila, Y.L. (2012) Nisin, an apoptogenic bacteriocin and food preservative, attenuates HNSCC tumorigenesis via CHAC1. Cancer Med., 1, 295–305. Mattson, M.P. and Chan, S.L. (2003) Calcium orchestrates apoptosis. Nat. Cell Biol., 5, 1041–1043. Rea, M.C., Sit, C.S., Clayton, E., O’Connor, P.M., Whittal, R.M., Zheng, J., Vederas, J.C., Ross, R.P., and Hill, C. (2010) Thuricin CD, a posttranslationally modified bacteriocin with a narrow spectrum of activity against Clostridium difficile. Proc. Natl. Acad. Sci. U.S.A., 107, 9352–9357. Wescombe, P.A., Hale, J.D.F., Heng, N.C.K., and Tagg, J.R. (2012) Developing oral probiotics from Streptococcus 74. 75. 76. 77. 78. 79. 80. 81. 82. 83. salivarius. Future Microbiol., 7, 1355–1371. Favier, C.F., Vaughan, E.E., De Vos, W.M., and Akkermans, A.D. (2002) Molecular monitoring of succession of bacterial communities in human neonates. Appl. Environ. Microbiol., 68, 219–226. Wescombe, P.A., Heng, N.C.K., Burton, J.R., and Tagg, J.R. (2010) Something old and something new: an update on the amazing repertoire of bacteriocins produced by Streptococcus salivarius. Probiotics Antimicrob. Proteins, 2, 37–45. Pepperney, A. and Chikindas, M.L. (2011) Antibacterial peptides: opportunities for the prevention and treatment of dental caries. Probiotics Antimicrob. Proteins, 3, 68–96. Chikindas, M.L., Novak, J., Driessen, A.J., Konings, W.N., Schilling, K.M., and Caufield, P.W. (1995) Mutacin II, a bactericidal antibiotic from Streptococcus mutans. Antimicrob. Agents Chemother., 39, 2656–2660. Rollema, H.S., Kuipers, O.P., Both, P., de Vos, W.M., and Siezen, R.J. (1995) Improvement of solubility and stability of the antimicrobial peptide nisin by protein engineering. Appl. Environ. Microbiol., 61, 2873–2878. Yoshida, T. and Nagasawa, T. (2003) epsilon-Poly-L-lysine: microbial production, biodegradation and application potential. Appl. Microbiol. Biotechnol., 62, 21–26. Shima, S., Matsuoka, H., Iwamoto, T., and Sakai, H. (1984) Antimicrobial action of epsilon-poly-L-lysine. J. Antibiot. (Tokyo)., 37, 1449–1455. FDA (2004) Agency Response Letter GRAS. Notice No. GRN 000135. Najjar, M.B., Kashtanov, D., and Chikindas, M.L. (2009) Natural antimicrobials ε-Poly-l-lysine and Nisin A for control of oral microflora. Probiotics Antimicrob. Proteins, 1, 143–147. Blackburn, P. and Goldstein, B. P. (1995) Nisin compositions to prevent the promotion of tooth decay by suppressing formation of acid from foods by oral bacteria, International Patent References 84. 85. 86. 87. 88. 89. 90. 91. 92. Application WO 97/10801, Applied a combination of various lantibiotic Microbiology, Inc. modification enzymes. ACS Synth. Biol., McConville, P. (1996) A chewing gum 2, 397–404. composition containing a bacteriocin 93. Qiu, X.Q., Wang, H., Lu, X.F., Zhang, antibacterial agent, International Patent J., Li, S.F., Cheng, G., Wan, L., Yang, Application WO 97/06772, AMBI, Inc., L., Zuo, J.Y., Zhou, Y.Q., Wang, H.Y., SmithKline Beecham Plc. Cheng, X., Zhang, S.H., Ou, Z.R., Tong, Z., Dong, L., Zhou, L., Tao, R., Zhong, Z.C., Cheng, J.Q., Li, Y.P., and and Ni, L. (2010) Nisin inhibits dental Wu, G.Y. (2003) An engineered mulcaries-associated microorganism in tidomain bactericidal peptide as a vitro. Peptides, 31, 2003–2008. model for targeted antibiotics against Howell, T.H., Fiorellini, J.P., Blackburn, specific bacteria. Nat. Biotechnol., 21, P., Projan, S.J., de la Harpe, J., and 1480–1485. Williams, R.C. (1993) The effect of 94. Qiu, X.Q., Zhang, J., Wang, H., and a mouthrinse based on nisin, a bacWu, G.Y. (2005) A novel engineered teriocin, on developing plaque and peptide, a narrow-spectrum antibiotic, gingivitis in beagle dogs. J. Clin. Periis effective against vancomycin-resistant odontol., 20, 335–339. Enterococcus faecalis. Antimicrob. Yuzenkova, J., Delgado, M., Nechaev, S., Agents Chemother., 49, 1184–1189. Savalia, D., Epshtein, V., Artsimovitch, 95. Janiszewska, J. and UrbanczykI., Mooney, R.A., Landick, R., Farias, Lipkowska, Z. (2007) Amphiphilic R.N., Salomon, R., and Severinov, K. dendrimeric peptides as model non(2002) Mutations of bacterial RNA sequential pharmacophores with polymerase leading to resistance to antimicrobial properties. J. Mol. Micromicrocin j25. J. Biol. Chem., 277, biol. Biotechnol., 13, 220–225. 50867–50875. 96. Cheng, Y., Xu, Z., Ma, M., and Xu, Kramer, N.E., van Hijum, S.A., Knol, J., T. (2008) Dendrimers as drug carriKok, J., and Kuipers, O.P. (2006) Traners: applications in different routes of scriptome analysis reveals mechanisms drug administration. J. Pharm. Sci., 97, by which Lactococcus lactis acquires 123–143. nisin resistance. Antimicrob. Agents 97. Ramshaw, J.A., Werkmeister, J.A., and Chemother., 50, 1753–1761. Glattauer, V. (1996) Collagen-based Collins, B., Curtis, N., Cotter, P.D., biomaterials. Biotechnol. Genet. Eng. Hill, C., and Ross, R.P. (2010) The ABC Rev., 13, 335–382. transporter AnrAB contributes to the 98. Misselwitz, B., Schmitt-Willich, H., innate resistance of Listeria monocytoEbert, W., Frenzel, T., and Weinmann, genes to nisin, bacitracin, and various H.J. (2001) Pharmacokinetics of beta-lactam antibiotics. Antimicrob. Gadomer-17, a new dendritic magnetic Agents Chemother., 54, 4416–4423. resonance contrast agent. MAGMA, 12, Knerr, P.J. and van der Donk, W.A. 128–134. (2012) Discovery, biosynthesis, and engineering of lantipeptides. Annu. Rev. 99. Dufes, C., Uchegbu, I.F., and Schatzlein, A.G. (2005) Dendrimers in gene Biochem., 81, 479–505. delivery. Adv. Drug Delivery Rev., 57, Montalban-Lopez, M., Zhou, L., 2177–2202. Buivydas, A., van Heel, A.J., and 100. Thankappan, U.P., Madhusudana, S.N., Kuipers, O.P. (2012) Increasing the Desai, A., Jayamurugan, G., Rajesh, success rate of lantibiotic drug discovY.B., and Jayaraman, N. (2011) Denery by Synthetic Biology. Expert Opin. dritic poly(ether imine) based gene Drug Discovery, 7, 695–709. delivery vector. Bioconjugate Chem., 22, van Heel, A.J., Mu, D., Montalban115–119. Lopez, M., Hendriks, D., and Kuipers, 101. Lequin, O., Bruston, F., Convert, O., O.P. (2013) Designing and producChassaing, G., and Nicolas, P. (2003) ing modified, new-to-nature peptides with antimicrobial activity by use of Helical structure of dermaseptin B2 89 90 5 Antimicrobial Peptides from Prokaryotes in a membrane-mimetic environment. Biochemistry, 42, 10311–10323. 102. Papo, N. and Shai, Y. (2003) Exploring peptide membrane interaction using surface plasmon resonance: differentiation between pore formation versus membrane disruption by lytic peptides. Biochemistry, 42, 458–466. 103. Powers, J.P. and Hancock, R.E. (2003) The relationship between peptide structure and antibacterial activity. Peptides, 24, 1681–1691. 91 6 Peptidomimetics as Antimicrobial Agents Peng Teng, Haifan Wu, and Jianfeng Cai 6.1 Introduction The abuse of traditional antibiotics has led to the significantly increased incidence of antibiotic resistance in recent years [1]. The World Health Organization recently specifically identified antimicrobial resistance as one of the three greatest threats facing mankind in the twenty-first century. Therefore, the generation of new antibiotics with novel mechanisms is urgently needed to treat bacterial infections that are unresponsive to conventional antibiotics, as many bacteria (e.g., methicillin-resistant Staphylococcus aureus (MRSA)) cause severe, and often lethal, community-, and hospital-acquired infections [1, 2]. More noticeably, those drug-resistant Gram-negative pathogens, such as Pseudomonas aeruginosa, pose even more severe threats because they are more dangerous and much harder to kill than Gram-positive bacterial strains. As such, over the last decade, significant interest has been developed in the exploitation of cationic host defense peptides (HDPs) as a new generation of antibiotic agents [1, 2]. HDPs, frequently referred as antimicrobial peptides (AMPs), are small cationic amphiphilic peptides found in virtually all living organisms [2]. They are an ancient and vital part of the innate immune system, and play a key role in the defense against bacterial infections [1–5]. Compared with conventional antibiotics, which target specific metabolic processes [6], HDPs are able to form globally amphipathic structures, in which cationic and hydrophobic groups are segregated into two regions, facilitating interaction with the negatively charged bacterial membranes [7]. However, the exact mechanism of action of HDPs is still controversial and requires further exploration. For instance, the implication of cationicity of HDPs is currently under debate. The cationic charge of HDPs was previously believed to be the determining factor for the selectivity of HDPs against bacteria over mammalian cells. This is because bacterial membranes are overall negatively charged owing to the presence of teichoic acids in the cell wall of Gram-positive bacteria and lipopolysaccharides (LPSs) in Gram-negative bacteria [1–5]. In contrast, the outer layer of mammalian cell membranes is composed of zwitterionic phosphatidylcholines [7], resulting in much weaker electrostatic interaction with cationic HDPs. Novel Antimicrobial Agents and Strategies, First Edition. Edited by David A. Phoenix, Frederick Harris and Sarah R. Dennison. © 2015 Wiley-VCH Verlag GmbH & Co. KGaA. Published 2015 by Wiley-VCH Verlag GmbH & Co. KGaA. 92 6 Peptidomimetics as Antimicrobial Agents However, cationicity alone could not explain the bactericidal activity and strain selectivity of HDPs according to recent findings [8]. In addition, different modes of interaction can occur after HDPs dock on bacterial membranes, and a few models have been proposed, including carpet-like, barrel stave, toroidal channels, and peptide–lipids aggregates [4, 9–15]. Nevertheless, these interactions all ultimately compromise the physical integrity of the lipid membranes, leading to the loss of membrane function and bacterial cell death. Furthermore, HDPs can also translocate into the cells directly and interact with internal targets that are critical to bacterial signaling pathway. Such mechanisms of action may account for the structural similarity and diversity of HDPs. Although HDPs have a variety of secondary structures such as α-helices, β-sheets, and extended conformation [1], they are overall cationic charged, containing 15–50 residues and sharing globally amphipathic conformations. Examples of HDPs include defensin [16–18], magainin [19–22], and indolicidin [23–27], which have different secondary structures. Since interactions between HDPs and bacterial membranes are physical interactions and lack of specific cell wall targets, and their precise sequences are less critical, it is believed that HDPs are less prone to induce resistance in bacteria observed for current antibiotic treatments [2], because the circumnavigation of physical membrane disruption is minimally observed. Therefore, HDPs are promising therapeutics as a new generation of antibiotics with novel mechanisms. Despite significant enthusiasm, there are intrinsic drawbacks associated with the development of HDP antibiotics, which include their common susceptibility to enzymatic degradation, moderate activity, and their inconvenient optimization [28–30]. Peptidomimetics rise either from modifications of canonical peptides by introducing non-natural side chains, by including amide bond isosteres via the introduction of heteroatoms, or by designing non-natural systems that are similar to peptides. They are generally highly resistant to proteolytic degradation because they are not well recognized by enzymes [31–33]. It is therefore envisioned that peptidomimetics that mimic the structure and mechanism of action of HDPs can potentially overcome the intrinsic drawbacks associated with HDPs. In addition, there are enormous chemically diverse functional groups that can be introduced into peptidomimetics, and as such it is promising to identify and develop lead compounds that are more potent than HDPs. In the last decade, there has been tremendous effort attributed to the development of new antimicrobial peptidomimetics, including peptoids [7], β-peptides [34], arylamide oligomers [35], and AApeptides [1, 2, 36–40]. In this chapter, we review the recent development of synthetic mimics of HDPs (since 2009) based on a variety of backbones other than canonical peptides. Some cyclic peptides [41, 42], although they are potent antimicrobial agents, are not discussed here as most of their residues are canonical amino acids. Some other HDP mimics are based on non-peptidic scaffolds including carbohydrates [43], aryls [44, 45], dendrimers [46], and polymers [47], which are also not included because this chapter focuses on antimicrobial peptidic oligomers. 6.2 Antimicrobial Peptidomimetics 93 6.2 Antimicrobial Peptidomimetics 6.2.1 Peptoids Peptoids are unnatural oligomers of N-substituted glycines [48]. Although they have the same backbone as α-peptides, their side chains are attached to the backbone amide nitrogen rather than to the alpha carbon. As a result, they cannot form intramolecular hydrogen bonds that are critical for the helical conformation of α-peptides. However, peptoids can still form helical structure by incorporating chiral side chains [49], which provides the basis for the rational design of amphipathic antimicrobial peptoids mimicking HDPs (Figure 6.1a). Similar to HDPs, amphipathic peptoids with a proper balance of cationic charge and hydrophobicity can be potential antimicrobial agents [7]. It is found that antimicrobial peptoids have good selectivity, with limited toxicity to mammalian cells [7]. Peptoids also display excellent antifouling activity. They can be fabricated onto the solid surface, and were found to damage Escherichia coli membranes rapidly [50]. Antimicrobial peptoids can also affect the phenotype of fungi Candida albicans [51]. It is known that C. albicans can undergo phenotypic switching between an invasive multicellular form and a latent unicellular type. After administration of an antimicrobial peptoid (Figure 6.1a) [7], the invasive multicellular phenotype was significantly (a) (b) (c) H-(NLys-Nspe-Nspe)4-NH2 H-Ntridec-(NLys-Nspe-Nspe-NLys)-NH2 c(NapNdp)3 N N O N O O NH2 NLys, N-(4-aminobutyl)glycine N Nspe, (S)-N-(1-phenylethyl)glycine Ntridec, N-(tridecyl)glycine N O O NH2 Nap, N-(3-aminopropyl)glycine Ndp, N-(2,2-diphenylethyl)glycine Figure 6.1 Antimicrobial peptoids [7, 53–56]: (a) a helical peptoid; (b) a short peptoid with an alkyl tail; and (c) a cyclic peptoid. 94 6 Peptidomimetics as Antimicrobial Agents suppressed, and the latent unicellular type was favored [51]. To assess the potential of antimicrobial peptoids as bioavailable antibiotics, the in vivo pharmacokinetics of peptoids was studied [52]. The 64 Cu-labeled 1,4,7,10-tetraazacyclododecane1,4,7,10-tetraacetic acid (DOTA) was conjugated to peptoids and the resulting compounds were analyzed by positron emission tomography (PET). It is interesting that the amphipathicity of peptoids significantly affects their biodistributions, implying the potential for the rational design of peptoids for the specific delivery of therapeutic agents to a specific tissue or organs [52]. On the basis of the development of helical antimicrobial peptoids and structure–function relationship studies [7], Barron et al. [53] found that short peptoids with alkyl tails could still possess potent and broad-spectrum antimicrobial activity, even though no helical structures are formed. For instance, an alkylated short peptoid (Figure 6.1b) is comparable to the helical peptoid (Figure 6.1a) and superior to the synthetic HDP Pexiganan (a synthetic analog of magainin II) [53]. This alkylated cationic peptoid, as well as the helical peptoid, shows significant reductions in biomass and cell viability of P. aeruginosa biofilms [54]. More surprisingly, the alkylated short peptoid was even more potent than the helical peptoid against tuberculosis, and was most selective [56]. In contrast, the unalkylated peptoids did not exhibit any activity against Mycobacterium tuberculosis, further demonstrating the importance of alkylation in antimicrobial peptoids [56]. In addition to helical peptoids and alkylated peptoids, the antimicrobial activity of cyclic peptoids was also investigated. The head-to-tail cyclization of peptoids (Figure 6.1c) yielded a few cyclic peptoids that display enhanced antibacterial activity against MRSA strains (twofold more potent than linear ones) [55]. It is hypothesized that macrocyclization can pre-organize side chain groups of peptoids and force them to project toward different faces of the planar macrocycle in a predicted manner. Therefore, a globally amphiphilic structure can be formed with enhanced stability, which may improve the ability of cyclic peptoids for the interaction and disruption of bacteria membranes. The synergistic effect of peptoids co-administered with HDPs was also studied. It is interesting that simultaneous administration of both antimicrobial peptoids and HDPs could further boost the antimicrobial efficacy [57], which opens a new avenue for the development of HDP-based antibiotics. 6.2.2 𝛃-Peptides β-peptides are oligomers consisting of β-amino acids, and they have been extensively studied for their ability to mimic the structure and function of peptides [58, 59]. Similar to other classes of peptidomimetics, β-peptides are completely resistant to proteolytic degradation. Furthermore, β-peptides exhibit strong folding propensity and can fold into a variety of well-defined secondary structures including “12-helices” and “14-helices” [60]. As such, the early design of antimicrobial β-peptides was based on their helical conformations, which display segregated amphipathic cationic charges and hydrophobic surfaces (Figure 6.2) [59, 61]. 6.2 H-(β3-X-β3-HLys-β3-HLeu)n-OH Antimicrobial Peptidomimetics 95 n=2-6; X = HVal or HLeu NH2 O O OH H2N β3-HAla (a) O H N O H N O β3-HLeu H N N H2 O ⊕ H N O β3-HLys H N N H2 O ⊕ OH H2N OH H 2N β3-HVal H N (b) OH H2N O O H N O NH2 O Figure 6.2 Helical antimicrobial β-peptides: (a) a 14-helix [61] and (b) a 12-helix [59]. The resulting β-peptides are expected to mimic globally amphiphilic conformations of HDPs and display potent and broad-spectrum antimicrobial activities. Gellman et al. [62] soon after discovered that a helical structure is not necessary for potent antimicrobial activity, as they observed that a sequence containing both α and β residues does not show good folding propensity; however, it has excellent antimicrobial activity. The findings have been used widely for the design of new antimicrobial peptidomimetics later on. A recent report on antimicrobial β-peptides focused on their activity against C. albicans. C. albicans is one of the most prevalent fungal strains found in humans, and this pathogen has been highly unresponsive to HDPs [63]. To develop β-peptides that can kill C. albicans effectively, a focused library of 14-helical β-peptides was prepared. Their structure–function relationship was studied, which reveals that the globally amphiphilic conformation is critical for the antifungal activity of β-peptides. The lead helical β-peptide (Figure 6.3) was found to have potent antifungal activity under physiological conditions [63]. In addition to killing C. albicans cells, this class of β-peptides can even prevent the formation of biofilms by C. albicans cells. C. albicans biofilms have been found to contaminate the surfaces of medical device and to induce recurrent infections [64]. They are also very resistant to drug treatment. As such, prevention of C. albicans is highly significant. To gain insight on how β-peptides kill planktonic C. albicans cells as well as biofilms, mechanistic studies were carried out by using fluorescently labeled β-peptides, which indicate that β-peptides can disrupt cell membranes of C. albicans and accumulate in the cytoplasm of both planktonic and biofilm-forming cells [64]. This observation is consistent with the general bactericidal mechanism of HDPs and antimicrobial peptidomimetics, even though C. albicans is a fungus rather than a bacterium. Nonetheless, the disruption of C. albicans cell membranes and the cell entry of the β-peptides directly led to the cell death. These β-peptides were then fabricated into multilayered polyelectrolyte films to arrest the growth of C. albicans and its biofilm formation [65]. 3 96 6 Peptidomimetics as Antimicrobial Agents β3Tyr-(ACHC-β3Val-β3Lys)3 HO O O N H N H β3Tyr Trans-2-aminocyclohexanecarboxylic acid (ACHC) NH2 O O N H N H β3Lys β3Val Figure 6.3 The helical antifungal β-peptide [63]. 6.2.3 Arylamides The development of peptidomimetics that mimic the structure and function of HDPs has largely overcome the issues associated with HDPs including low stability and moderate activity. However, the synthesis and scale-up of these agents may still be obstacles for the development of the next generation of antibiotics. Therefore, design of molecules with smaller molecular weight (∼1000 Da) but still capturing the bactericidal mechanism and function of HDPs may be more appealing. In this regard, Degrado et al. [35] have developed small arylamide foldamers that mimic the amphipathic structures of HDPs (Figure 6.4). The arylamide scaffold adopts an almost planar conformation stabilized by intramolecular hydrogen bonding; thus, hydrophobic and hydrophilic groups can be appended onto either side to make the global amphipathic structures. The structure–function relationship and lead optimization of arylamides are summarized in a recently published review [60]. Certain arylamides exhibited potent inhibitions toward a number of Gram-positive and Gram-negative strains, R1 H2N H N NH R2 Y H N H N O O R3 X X R2 Y R1 H N H N H N O O NH2 NH R3 Figure 6.4 Antimicrobial arylamides. X is either N or H, Y can be S or H, R1 and R2 are different cationic groups, and R3 represents hydrophobic groups [35, 66, 67]. 6.2 Antimicrobial Peptidomimetics and the lead compounds even successfully arrested the growth of S. aureus in a mouse thigh burden infection model [35]. Indeed, arylamides are the most successful antimicrobial peptidomimetics that mimic HDPs. One lead compound PMX-30063 is currently in a phase II clinical trial for the treatment of skin infections by MRSA strains. The initial results based on 80 patients are very favorable, demonstrating the effectiveness and minimal side effects of PMX-30063 treatment, with a maximum tolerated single dose at 2.5 mg kg−1 . Unlike conventional antibiotics, PMX-30063 not only has broader spectrum activity against a variety of Gram-positive and Gram-negative bacteria it also does not elicit bacterial resistance even up to 20 serial passages. In addition to PMX-30063, a few of the other arylamide derivatives have also shown promising activities toward oral Candida strains and biofilms of periodontal pathogens, and their clinical trials are expected to be conducted in the near future [66, 67]. 6.2.4 𝛃-Peptoid–Peptide Hybrid Oligomers The fact that α/β chimeric peptidomimetics [62] possess potent antimicrobial activity attracted the study of other antimicrobial peptidomimetics with heterogeneous backbones. One recent example is the development of β-peptoids [68, 69] and the investigation of the antibacterial activity of β-peptoid–peptide hybrid oligomers [70]. The building blocks of these sequences consist of cationic amino acid residues Lys or Arg, and a hydrophobic β-peptoid residue (Figure 6.5). Therefore, these build blocks can be viewed as amphiphilic. Although the secondary folding conformations of these hybrids are not further discussed, these sequences are expected to form a globally amphiphilic structure when interacting with bacterial membranes. Indeed, these molecules also display broad-spectrum activity against both bacterial strains and C. albicans. The structure–function relationship studies reveal that Arg residues are more critical to boost antimicrobial activity than Lys residues. These β-peptoid–peptide hybrid oligomers are another class of antimicrobial peptidomimetics with heterogeneous O H N O N R1 NH2 R1 = O NH2 n R2 R2 = NH N H NH2 Figure 6.5 Antimicrobial β-peptoid–peptide hybrid oligomers [70]. 97 98 6 Peptidomimetics as Antimicrobial Agents backbones, which shed light on the development of new antimicrobial agents based on currently available molecular frameworks. 6.2.5 Oligourea and 𝛄4 -Peptide-Based Oligomers It is interesting to understand how the molecular frameworks impact the antimicrobial activity of peptidomimetics. To address this point, Guichard et al. [71] prepared a few helical peptidomimetics with similar secondary structures, including oligoureas, γ4 -peptides, and oligomers with heterogeneous backbones (Figure 6.6). However, they have shown distinct antimicrobial activity, even though their side chains are identical. The researchers concluded that the antimicrobial activity of peptidomimetics is not only related to their amphipathic conformations but also to their backbones. Polar backbones may promote the antimicrobial activity by increasing the strength of the interaction with negatively charged bacterial membranes. 6.2.6 AApeptides AApeptides are a new class of peptidomimetics developed in our group recently in order to expand the application of peptidomimetics in chemical biology [72–79]. They are termed AApeptides because they are composed of N-acylatedN-aminoethyl amino acid units that are derived from the chiral PNA backbone. Depending on the relative positions of the side chains, two subclasses of AApeptides, α-AApeptides, and γ-AApeptides, have been developed and studied for their biological activity (Figure 6.7). Compared with natural α-peptides, the repeating unit (building block) of AApeptides is comparable to a dipeptide residue. As such, AApeptides project an identical number of side groups as conventional peptides of the same lengths. Since half of the side chains come from any carboxylic acids, the potential of generating AApeptides with chemically diverse functional groups is limitless. We anticipate that AApeptides would be promising candidates for the design of antimicrobial agents, not only because of their high stability [75, 80] and unlimited potential for derivatization [75, 81] but also as a result of their balanced conformational backbone rigidity and flexibility [36, 37]. In addition, AApeptides have two more dihedral angles compared to that of α-peptides, resulting in slightly increased flexibility. As such, we hypothesize that antimicrobial AApeptides can be designed simply by joining amphiphilic AApeptide building blocks (containing one hydrophobic and one cationic side chain) together, because such O H N n=8 X R n Figure 6.6 Antimicrobial oligoureas, γ4 -peptides, and the related heterogeneous oligomers [71]. 6.2 R N H O H N α-peptide O R R O O N N H Antimicrobial Peptidomimetics α-AApeptide R R N H O γ-AApeptide N O R Figure 6.7 Structures of α-peptides, α-AApeptides, and γ-AApeptides. Amphipathic AApeptide building block (a) Cationic group Hydrophobic group Membrane interaction (b) Random conformation Globally amphipathic conformation Figure 6.8 Illustration of the mechanism of antimicrobial AApeptide: (a) schematic representation of an amphiphilic AApeptide building block and (b) the amphipathic conformation of AApeptides upon interaction with bacterial membranes. AApeptides are expected to adopt overall amphipathic structures by adjusting their conformation after they sit on bacterial membranes (Figure 6.8). Fine tuning of their activity and selectivity is readily achieved by adjusting the nature of the hydrophobic and hydrophilic groups. On the basis of this hypothesis, different subclasses of antimicrobial AApeptides (linear, lipo-linear, cyclic, lipo-cyclic) have been developed by our group, all of which can mimic the mechanism of HDPs by disrupting bacterial membranes [36, 37, 72, 76, 82, 83] and show broad-spectrum activity against a range of Gram-positive and Gram-negative bacteria (Figure 6.9). 6.2.6.1 𝛂-AApeptides To test the design of antimicrobial AApeptides, we initially prepared a focused library of α-AApeptides composed of amphiphilic building blocks [74]. One α-AApeptide 𝛂1, containing seven building blocks and comparable to a 14-mer peptide in length (Figure 6.9), showed most potent activity to inhibit the growth of E. coli (Gram-negative), Bacillus subtilis (Gram-positive), as well as the 99 100 6 Peptidomimetics as Antimicrobial Agents NH2 H2N NH2 H N N O O NH2 H N N O NH2 H N N O H N H N O NH2 O H2N H N N O NH2 O H N N NH2 O O O O NH2 NH2 O O O O O H N N O O α2 O O H N N O NH2 N O NH2 O H N γ1 NH2 N O O NH2 NH2 H N H N NH2 N O O N α1 NH2 N O H N N H N N H N O NH2 O H N N O O NH2 N O H N NH2 O H N O N O NH2 N O O N O H N N O O NH2 O O H N N NH2 H N N O NH2 O O H2N O H N N NH2 N O O γ2 O H N N O NH2 O N O HN NH2 γ3 NH O N N O N H O O O N O O N H NH2 NH2 Figure 6.9 The structures of lead antimicrobial AApeptides, including α-AApeptide 𝛂1 and 𝛂2 [74, 84], and γ-AApeptide 𝛄1, 𝛄2, and 𝛄3 [72, 76, 83]. 6.2 Antimicrobial Peptidomimetics multidrug-resistant Staphylococcus epidermidis (Gram-positive). Follow-up SEM and fluorescence microscopy studies suggested that the bactericidal activity of 𝛂1 may originate from the disruption of bacterial membranes. It is noted that 𝛂1 is highly selective, and has only negligible hemolytic activity even up to 250 μg ml−1 . The results also suggest that the size of α-AApeptides is critical since shorter sequences exhibit minimal antimicrobial activity. The initial studies demonstrated that the AApeptide backbone is very suitable for antimicrobial development. Lipopeptide antibiotics have been widely studied in clinical trials and commercialized in market [85, 86]. Although the mechanism of their antimicrobial functions are different from that of HDPs [87, 88], it is widely accepted that lipidation can enhance the ability of peptides to interact with bacterial membranes through membrane insertion. Therefore, we expected that lipidation of linear α-AApeptides would lead to more potent antimicrobial agents. As such, a few lipidated α-AApeptides were designed and tested for their capability to arrest the growth of bacterial strains [76]. One lead lipo-α-AApeptide, α2 (Figure 6.9), displays potent and broad-spectrum activity against both Gram-positive and Gram-negative bacteria, including multidrug-resistant strains. 6.2.6.2 𝛄-AApeptides As γ-AApeptides have a scaffold similar to α-AApeptides, it was speculated that the same rule employed for the design of antimicrobial α-AApeptides could be used to direct the development of γ-AApeptides that mimic HDPs. Indeed, with the same size and slightly different hydrophobic groups, γ-AApeptide 𝛄1 has shown much improved potency and broader spectrum activity than α-AApeptide 𝛂1 [76]. It also effectively kills the fungus C. albicans. In addition, it does not induce bacterial resistance even after 17 serial passages, suggesting its potential as a new class of antimicrobial peptidomimetics. Akin to lipidated-α-AApeptides, we also explored the ability of lipo-γAApeptides as potential antimicrobial agents [76]. Interestingly, some of these lipo-peptidomimetics are even better antibiotic agents than 𝛄1. The lead lipo-γAApeptide 𝛄2, is very active against a range of Gram-positive and Gram-negative bacterial strains including clinically relevant pathogens, as well as fungus C. albicans. Subsequent fluorescence microscopy, drug-resistance study, and membrane depolarization again suggest that lipo-γ-AApeptides capture the mechanism of action of HDPs by damaging bacterial membranes. In addition, γ-AApeptides with unsaturated lipid tails generally show less hemolytic activity than γ-AApeptides with saturated alkyl tails, whereas they do not compromise the antimicrobial activity. The mechanism still remains elusive; however, the observation can be used for the future design of different classes of antimicrobial peptidomimetics. The recent development of antimicrobial γ-AApeptides involves the design and evaluation of a library of lipo-cyclic γ-AApeptides [83]. Lipo-cyclic peptide antibiotics such as daptomycin [89] and polymyxins [90] have been used as the last resort to treat drug-resistant pathogens. Daptomycin is a negatively charged lipo-cyclic peptide, and it binds to Gram-positive bacterial membranes, causing 101 102 6 Peptidomimetics as Antimicrobial Agents membrane depolarization. However, daptomycin can only weakly associate with membranes of Gram-negative bacteria, and thus exhibits almost no activity toward these pathogens. Polymyxins bind to LPSs in the outer membrane of Gram-negative bacteria and utilize their hydrophobic tails to damage the membranes [85]. However, the tails cannot penetrate the thick peptidoglycan layer in Gram-positive bacteria, and thus polymyxins are not active against Gram-positive bacterial pathogens. On the basis of the cationic amphipathic structures of γ-AApeptides, we anticipated that lipo-cyclic γ-AApeptides would mimic the mechanism of HDPs rather than the above-mentioned lipo-cyclic peptide antibiotics. As expected, the lead lipo-cyclic γ-AApeptide 𝛄3 effectively arrests a number of drug-resistant Gram-positive and Gram-negative pathogens [83]. More noticeably, this class of peptidomimetics can even mimic HDPs [91] by exhibiting dual functional roles in fighting bacterial infections: they can kill bacteria directly, and they can also suppress pro-inflammatory cytokines such as TNF-α. The findings open a new avenue for the development of antimicrobial peptidomimetics. 6.3 Discussion Significant advances are achieved in the past several years since the development of antimicrobial peptidomimetics a decade ago. These peptidomimetics have cationic amphipathic conformations and mechanism of action similar to HDPs. The most successful example is arylamide foldamers developed by DeGrado et al., which are currently in Phase II clinical trials against MRSA infection. Some other lead compounds from this series of foldamers have also shown promising efficacy against bacteria, fungi, virus, and even tropical diseases. It is therefore speculated that antimicrobial peptidomimetics are promising antibiotics with a novel mechanism to combat drug-resistant bacteria. Future direction for the development of antimicrobial peptidomimetics could at least focus on the following aspects. First, the functional groups on the peptidomimetics could be further diversified. For those examples discussed in this chapter, so far only a few hydrophobic and hydrophilic groups are explored. One of the most attractive features of peptidomimetics is the enormous chemical diversity. It is therefore envisioned that the activity and selectivity of antimicrobial peptidomimetics can be further improved if a wide variety of hydrophobic, bulky, and hydrophilic groups are introduced. In addition, it is plausible to design antimicrobial peptidomimetics with new scaffolds so as to identify more potent antimicrobial agents. Each class of peptidomimetics has its own framework, which can differ in the backbone polarity, as well as precise three dimensional structures, which significantly impact the strength of their interactions with bacteria. Moreover, the selectivity of antimicrobial peptidomimetics is expected to be further enhanced. It is generally realized that potent antimicrobial peptidomimetics are always accompanied with visible hemolytic activity and cytotoxicity. However, this problem can be References mitigated by varying the ratio and nature of hydrophobic and hydrophilic chains in peptidomimetics. Emphasis should be given to the identification of more potent antimicrobial peptidomimetics to kill Gram-negative bacteria such as P. aeruginosa. It is widely accepted that the prevention of infections caused by Gram-negative bacteria is more difficult than that of Gram-positive bacteria. Furthermore, the immunomodulatory function of antimicrobial peptidomimetics should be considered and elaborated in parallel in the future, since HDPs may defend organisms by suppressing inflammatory responses to avoid septic shock, in addition to direct bacterial killing. Peptidomimetics bearing the dual functions may hold greater promise for antimicrobial development. Last, but not the least, more systematic and comprehensive mechanistic studies should be conducted for antimicrobial peptidomimetics in order to evaluate their potential for the mimicry of HDPs and to assess their probability to induce drug resistance in bacteria. Such work will provide persuasive proof for the development of antimicrobial peptidomimetics as the next generation of antibiotics with novel mechanisms. Acknowledgments The work is supported by the USF start-up fund. References 1. Hancock, R.E., and Sahl, H.G. (2006) Antimicrobial and host-defense peptides as new anti-infective therapeutic strategies. Nat. Biotechnol., 24, 1551–1557. 2. Marr, A.K., Gooderham, W.J., and Hancock, R.E. (2006) Antibacterial peptides for therapeutic use: obstacles and realistic outlook. Curr. Opin. Pharmacol., 6, 468–472. 3. Zhang, L., Dhillon, P., Yan, H., Farmer, S., and Hancock, R.E. (2000) Interactions of bacterial cationic peptide antibiotics with outer and cytoplasmic membranes of Pseudomonas aeruginosa. Antimicrob. Agents Chemother., 44, 3317–3321. 4. Wu, M., Maier, E., Benz, R., and Hancock, R.E.W. (1999) Mechanism of interaction of different classes of cationic antimicrobial peptides with planar bilayers and with the cytoplasmic membrane of Escherichia coli. Biochemistry, 38, 7235–7242. 5. Friedrich, C.L., Moyles, D., Beveridge, 6. 7. 8. 9. T.J., and Hancock, R.E. (2000) Antibacterial action of structurally diverse cationic peptides on Gram-positive bacteria. Antimicrob. Agents Chemother., 44, 2086–2092. Alekshun, M.N. and Levy, S.B. (2007) Molecular mechanisms of antibacterial multidrug resistance. Cell, 128, 1037–1050. Chongsiriwatana, N.P., Patch, J.A., Czyzewski, A.M., Dohm, M.T., Ivankin, A., Gidalevitz, D., Zuckermann, R.N., and Barron, A.E. (2008) Peptoids that mimic the structure, function, and mechanism of helical antimicrobial peptides. Proc. Natl. Acad. Sci. U.S.A., 105, 2794–2799. Lehrer, R.I. and Lu, W.Y. (2012) alphaDefensins in human innate immunity. Immunol. Rev., 245, 84–112. Shai, Y. (2002) Mode of action of membrane active antimicrobial peptides. Biopolymers, 66, 236–248. 103 104 6 Peptidomimetics as Antimicrobial Agents 10. Matsuzaki, K. (1998) Magainins as 11. 12. 13. 14. 15. 16. 17. 18. 19. paradigm for the mode of action of pore forming polypeptides. Biochim. Biophys. Acta, 1376, 391–400. Brogden, K.A. (2005) Antimicrobial peptides: pore formers or metabolic inhibitors in bacteria? Nat. Rev. Microbiol., 3, 238–250. Matsuzaki, K., Sugishita, K., and Miyajima, K. (1999) Interactions of an antimicrobial peptide, magainin 2, with lipopolysaccharide-containing liposomes as a model for outer membranes of Gram-negative bacteria. FEBS Lett., 449, 221–224. Sal-Man, N., Oren, Z., and Shai, Y. (2002) Preassembly of membraneactive peptides is an important factor in their selectivity toward target cells. Biochemistry, 41, 11921–11930. Oren, Z., Ramesh, J., Avrahami, D., Suryaprakash, N., Shai, Y., and Jelinek, R. (2002) Structures and mode of membrane interaction of a short alpha helical lytic peptide and its diastereomer determined by NMR, FTIR, and fluorescence spectroscopy. Eur. J. Biochem., 269, 3869–3880. Sitaram, N. and Nagaraj, R. (2002) Host-defense antimicrobial peptides: importance of structure for activity. Curr. Pharm. Des., 8, 727–742. Lehrer, R.I., Barton, A., Daher, K.A., Harwig, S.S., Ganz, T., and Selsted, M.E. (1989) Interaction of human defensins with Escherichia coli. Mechanism of bactericidal activity. J. Clin. Invest., 84, 553–561. Tang, Y.Q., Yuan, J., Osapay, G., Osapay, K., Tran, D., Miller, C.J., Ouellette, A.J., and Selsted, M.E. (1999) A cyclic antimicrobial peptide produced in primate leukocytes by the ligation of two truncated alpha-defensins. Science (New York, N.Y.), 286, 498–502. Thennarasu, S. and Nagaraj, R. (1999) Synthetic peptides corresponding to the beta-hairpin loop of rabbit defensin NP2 show antimicrobial activity. Biochem. Biophys. Res. Commun., 254, 281–283. Patch, J.A. and Barron, A.E. (2003) Helical peptoid mimics of magainin-2 amide. J. Am. Chem. Soc., 125, 12092–12093. 20. Epand, R.F., Umezawa, N., Porter, E.A., 21. 22. 23. 24. 25. 26. 27. 28. 29. Gellman, S.H., and Epand, R.M. (2003) Interactions of the antimicrobial betapeptide beta-17 with phospholipid vesicles differ from membrane interactions of magainins. Eur. J. Biochem., 270, 1240–1248. Chen, H.C., Brown, J.H., Morell, J.L., and Huang, C.M. (1988) Synthetic magainin analogues with improved antimicrobial activity. FEBS Lett., 236, 462–466. Ge, Y., MacDonald, D.L., Holroyd, K.J., Thornsberry, C., Wexler, H., and Zasloff, M. (1999) In vitro antibacterial properties of pexiganan, an analog of magainin. Antimicrob. Agents Chemother., 43, 782–788. Falla, T.J. and Hancock, R.E. (1997) Improved activity of a synthetic indolicidin analog. Antimicrob. Agents Chemother., 41, 771–775. Ahmad, I., Perkins, W.R., Lupan, D.M., Selsted, M.E., and Janoff, A.S. (1995) Liposomal entrapment of the neutrophilderived peptide indolicidin endows it with in vivo antifungal activity. Biochim. Biophys. Acta, 1237, 109–114. Ando, S., Mitsuyasu, K., Soeda, Y., Hidaka, M., Ito, Y., Matsubara, K., Shindo, M., Uchida, Y., and Aoyagi, H. (2010) Structure-activity relationship of indolicidin, a Trp-rich antibacterial peptide. J. Pept. Sci., 16, 171–177. Nan, Y.H., Bang, J.K., and Shin, S.Y. (2009) Design of novel indolicidinderived antimicrobial peptides with enhanced cell specificity and potent anti-inflammatory activity. Peptides, 30, 832–838. Subbalakshmi, C. and Sitaram, N. (1998) Mechanism of antimicrobial action of indolicidin. FEMS Microbiol. Lett., 160, 91–96. Giuliani, A. and Rinaldi, A.C. (2011) Beyond natural antimicrobial peptides: multimeric peptides and other peptidomimetic approaches. Cell. Mol. Life Sci., 68, 2255–2266. Bruhn, O., Grotzinger, J., Cascorbi, I., and Jung, S. (2011) Antimicrobial peptides and proteins of the horse – insights into a well-armed organism. Vet. Res., 42, 98. References 30. Zaiou, M. (2007) Multifunctional antimi- 31. 32. 33. 34. 35. 36. 37. 38. 39. 40. 41. crobial peptides: therapeutic targets in several human diseases. J. Mol. Med. (Berlin, Germany), 85, 317–329. Tew, G.N., Scott, R.W., Klein, M.L., and Degrado, W.F. (2009) De novo design of antimicrobial polymers, foldamers, and small molecules: from discovery to practical applications. Acc. Chem. Res., 43, 30–39. Scott, R.W., DeGrado, W.F., and Tew, G.N. (2008) De novo designed synthetic mimics of antimicrobial peptides. Curr. Opin. Biotechnol., 19, 620–627. Tew, G.N., Liu, D., Chen, B., Doerksen, R.J., Kaplan, J., Carroll, P.J., Klein, M.L., and DeGrado, W.F. (2002) De novo design of biomimetic antimicrobial polymers. Proc. Natl. Acad. Sci. U.S.A., 99, 5110–5114. Epand, R.F., Raguse, T.L., Gellman, S.H., and Epand, R.M. (2004) Antimicrobial 14-helical beta-peptides: potent bilayer disrupting agents. Biochemistry, 43, 9527–9535. Choi, S., Isaacs, A., Clements, D., Liu, D., Kim, H., Scott, R.W., Winkler, J.D., and DeGrado, W.F. (2009) De novo design and in vivo activity of conformationally restrained antimicrobial arylamide foldamers. Proc. Natl. Acad. Sci. U.S.A., 106, 6968–6973. Niu, Y., Wu, H., Li, Y., Hu, Y., Padhee, S., Li, Q., Cao, C., and Cai, J. (2013) AApeptides as a new class of antimicrobial agents. Org. Biomol. Chem., 11, 4283–4290. Niu, Y., Wang, R.E., Wu, H., and Cai, J. (2012) Recent development of small antimicrobial peptidomimetics. Future Med. Chem., 4, 1853–1862. Goodman, C.M., Choi, S., Shandler, S., and DeGrado, W.F. (2007) Foldamers as versatile frameworks for the design and evolution of function. Nat. Chem. Biol., 3, 252–262. Gellman, S. (2009) Structure and function in peptidic foldamers. Biopolymers, 92, 293. Wu, Y.D. and Gellman, S. (2008) Peptidomimetics. Acc. Chem. Res., 41, 1231–1232. Srinivas, N., Jetter, P., Ueberbacher, B.J., Werneburg, M., Zerbe, K., Steinmann, J., 42. 43. 44. 45. 46. 47. 48. 49. Van der Meijden, B., Bernardini, F., Lederer, A., Dias, R.L., Misson, P.E., Henze, H., Zumbrunn, J., Gombert, F.O., Obrecht, D., Hunziker, P., Schauer, S., Ziegler, U., Kach, A., Eberl, L., Riedel, K., DeMarco, S.J., and Robinson, J.A. (2010) Peptidomimetic antibiotics target outer-membrane biogenesis in Pseudomonas aeruginosa. Science (New York, N.Y.), 327, 1010–1013. Obrecht, D., Robinson, J.A., Bernardini, F., Bisang, C., DeMarco, S.J., Moehle, K., and Gombert, F.O. (2009) Recent progress in the discovery of macrocyclic compounds as potential anti-infective therapeutics. Curr. Med. Chem., 16, 42–65. Guell, I., Ferre, R., Sorensen, K.K., Badosa, E., Ng-Choi, I., Montesinos, E., Bardaji, E., Feliu, L., Jensen, K.J., and Planas, M. (2012) Multivalent display of the antimicrobial peptides BP100 and BP143. Beilstein J. Org. Chem., 8, 2106–2117. Thaker, H.D., Sgolastra, F., Clements, D., Scott, R.W., and Tew, G.N. (2011) Synthetic mimics of antimicrobial peptides from triaryl scaffolds. J. Med. Chem., 54, 2241–2254. Thaker, H.D., Som, A., Ayaz, F., Lui, D.H., Pan, W.X., Scott, R.W., Anguita, J., and Tew, G.N. (2012) Synthetic mimics of antimicrobial peptides with immunomodulatory responses. J. Am. Chem. Soc., 134, 11088–11091. Young, A., Liu, Z.G., Zhou, C.H., and Kallenbach, N.R. (2009) Dendrimeric antimicrobial peptides as antibacterials. Abstracts of Papers of the American Chemical Society 238. Kuroda, K. and Caputo, G.A. (2013) Antimicrobial polymers as synthetic mimics of host-defense peptides. Wires Nanomed. Nanobiotechnol., 5, 49–66. Simon, R.J., Kania, R.S., Zuckermann, R.N., Huebner, V.D., Jewell, D.A., Banville, S., Ng, S., Wang, L., Rosenberg, S., Marlowe, C.K. et al. (1992) Peptoids: a modular approach to drug discovery. Proc. Natl. Acad. Sci. U.S.A., 89, 9367–9371. Armand, P., Kirshenbaum, K., Goldsmith, R.A., Farr-Jones, S., Barron, A.E., Truong, K.T., Dill, K.A., Mierke, 105 106 6 Peptidomimetics as Antimicrobial Agents 50. 51. 52. 53. 54. 55. 56. 57. D.F., Cohen, F.E., Zuckermann, R.N., and Bradley, E.K. (1998) NMR determination of the major solution conformation of a peptoid pentamer with chiral side chains. Proc. Natl. Acad. Sci. U.S.A., 95, 4309–4314. Statz, A.R., Park, J.P., Chongsiriwatana, N.P., Barron, A.E., and Messersmith, P.B. (2008) Surface-immobilised antimicrobial peptoids. Biofouling, 24, 439–448. Uchida, M., McDermott, G., Wetzler, M., Le Gros, M.A., Myllys, M., Knoechel, C., Barron, A.E., and Larabell, C.A. (2009) Soft X-ray tomography of phenotypic switching and the cellular response to antifungal peptoids in Candida albicans. Proc. Natl. Acad. Sci. U.S.A., 106, 19375–19380. Seo, J., Ren, G., Liu, H., Miao, Z., Park, M., Wang, Y., Miller, T.M., Barron, A.E., and Cheng, Z. (2012) In vivo biodistribution and small animal PET of (64)Cu-labeled antimicrobial peptoids. Bioconjugate Chem., 23, 1069–1079. Chongsiriwatana, N.P., Miller, T.M., Wetzler, M., Vakulenko, S., Karlsson, A.J., Palecek, S.P., Mobashery, S., and Barron, A.E. (2011) Short alkylated peptoid mimics of antimicrobial lipopeptides. Antimicrob. Agents Chemother., 55, 417–420. Kapoor, R., Wadman, M.W., Dohm, M.T., Czyzewski, A.M., Spormann, A.M., and Barron, A.E. (2011) Antimicrobial peptoids are effective against Pseudomonas aeruginosa biofilms. Antimicrob. Agents Chemother., 55, 3054–3057. Huang, M.L., Shin, S.B., Benson, M.A., Torres, V.J., and Kirshenbaum, K. (2012) A comparison of linear and cyclic peptoid oligomers as potent antimicrobial agents. ChemMedChem, 7, 114–122. Kapoor, R., Eimerman, P.R., Hardy, J.W., Cirillo, J.D., Contag, C.H., and Barron, A.E. (2011) Efficacy of antimicrobial peptoids against Mycobacterium tuberculosis. Antimicrob. Agents Chemother., 55, 3058–3062. Chongsiriwatana, N.P., Wetzler, M., and Barron, A.E. (2011) Functional synergy between antimicrobial peptoids and 58. 59. 60. 61. 62. 63. 64. 65. 66. peptides against Gram-negative bacteria. Antimicrob. Agents Chemother., 55, 5399–5402. Cheng, R.P., Gellman, S.H., and DeGrado, W.F. (2001) beta-peptides: from structure to function. Chem. Rev., 101, 3219–3232. Porter, E.A., Weisblum, B., and Gellman, S.H. (2002) Mimicry of host-defense peptides by unnatural oligomers: antimicrobial beta-peptides. J. Am. Chem. Soc., 124, 7324–7330. Tew, G.N., Scott, R.W., Klein, M.L., and Degrado, W.F. (2010) De novo design of antimicrobial polymers, foldamers, and small molecules: from discovery to practical applications. Acc. Chem. Res., 43, 30–39. Liu, D. and DeGrado, W.F. (2001) De novo design, synthesis, and characterization of antimicrobial beta-peptides. J. Am. Chem. Soc., 123, 7553–7559. Schmitt, M.A., Weisblum, B., and Gellman, S.H. (2004) Unexpected relationships between structure and function in alpha,beta-peptides: antimicrobial foldamers with heterogeneous backbones. J. Am. Chem. Soc., 126, 6848–6849. Karlsson, A.J., Pomerantz, W.C., Weisblum, B., Gellman, S.H., and Palecek, S.P. (2006) Antifungal activity from 14-helical beta-peptides. J. Am. Chem. Soc., 128, 12630–12631. Karlsson, A.J., Pomerantz, W.C., Neilsen, K.J., Gellman, S.H., and Palecek, S.P. (2009) Effect of sequence and structural properties on 14-helical beta-peptide activity against Candida albicans planktonic cells and biofilms. ACS Chem. Biol., 4, 567–579. Karlsson, A.J., Flessner, R.M., Gellman, S.H., Lynn, D.M., and Palecek, S.P. (2010) Polyelectrolyte multilayers fabricated from antifungal beta-peptides: design of surfaces that exhibit antifungal activity against Candida albicans. Biomacromolecules, 11, 2321–2328. Hua, J., Scott, R.W., and Diamond, G. (2010) Activity of antimicrobial peptide mimetics in the oral cavity: II. Activity against periopathogenic biofilms and anti-inflammatory activity. Mol. Oral Microbiol., 25, 426–432. References 67. Hua, J., Yamarthy, R., Felsenstein, 68. 69. 70. 71. 72. 73. 74. S., Scott, R.W., Markowitz, K., and Diamond, G. (2010) Activity of antimicrobial peptide mimetics in the oral cavity: I. Activity against biofilms of Candida albicans. Mol. Oral Microbiol., 25, 418–425. Olsen, C.A. (2009) Peptoid-peptide hybrid backbone architectures. ChemBioChem, 11, 152–160. Olsen, C.A., Lambert, M., Witt, M., Franzyk, H., and Jaroszewski, J.W. (2008) Solid-phase peptide synthesis and circular dichroism study of chiral beta-peptoid homooligomers. Amino Acids, 34, 465–471. Olsen, C.A., Ziegler, H.L., Nielsen, H.M., Frimodt-Moller, N., Jaroszewski, J.W., and Franzyk, H. (2010) Antimicrobial, hemolytic, and cytotoxic activities of beta-peptoid-peptide hybrid oligomers: improved properties compared to natural AMPs. ChemBioChem, 11, 1356–1360. Claudon, P., Violette, A., Lamour, K., Decossas, M., Fournel, S., Heurtault, B., Godet, J., Mely, Y., Jamart-Gregoire, B., Averlant-Petit, M.C., Briand, J.P., Duportail, G., Monteil, H., and Guichard, G. (2010) Consequences of isostructural main-chain modifications for the design of antimicrobial foldamers: helical mimics of hostdefense peptides based on a heterogeneous amide/urea backbone. Angew. Chem. Int. Ed., 49, 333–336. Niu, Y., Padhee, S., Wu, H., Bai, G., Harrington, L., Burda, W.N., Shaw, L.N., Cao, C., and Cai, J. (2011) Identification of gamma-AApeptides with potent and broad-spectrum antimicrobial activity. Chem. Commun. (Camb.), 47, 12197–12199. Niu, Y., Jones, A.J., Wu, H., Varani, G., and Cai, J. (2011) gamma-AApeptides bind to RNA by mimicking RNAbinding proteins. Org. Biomol. Chem., 9, 6604–6609. Padhee, S., Hu, Y., Niu, Y., Bai, G., Wu, H., Costanza, F., West, L., Harrington, L., Shaw, L.N., Cao, C., and Cai, J. (2011) Non-hemolytic alpha-AApeptides as antimicrobial peptidomimetics. Chem. Commun. (Camb.), 47, 9729–9731. 75. Niu, Y., Hu, Y., Li, X., Chen, J., and Cai, 76. 77. 78. 79. 80. 81. 82. 83. 84. J. (2011) [gamma]-AApeptides: design, synthesis and evaluation. New J. Chem., 35, 542–545. Niu, Y., Padhee, S., Wu, H., Bai, G., Qiao, Q., Hu, Y., Harrington, L., Burda, W.N., Shaw, L.N., Cao, C., and Cai, J. (2012) Lipo-gamma-AApeptides as a new class of potent and broad-spectrum antimicrobial agents. J. Med. Chem., 55, 4003–4009. Bai, G., Padhee, S., Niu, Y., Wang, R.E., Qiao, Q., Buzzeo, R., Cao, C., and Cai, J. (2012) Cellular uptake of an alphaAApeptide. Org. Biomol. Chem., 10, 1149–1153. Niu, Y., Bai, G., Wu, H., Wang, R.E., Qiao, Q., Padhee, S., Buzzeo, R., Cao, C., and Cai, J. (2012) Cellular translocation of a gamma-AApeptide mimetic of tat peptide. Mol. Pharm., 9, 1529–1534. Hu, Y., Li, X., Sebti, S.M., Chen, J., and Cai, J. (2011) Design and synthesis of AApeptides: a new class of peptide mimics. Bioorg. Med. Chem. Lett., 21, 1469–1471. Yang, Y., Niu, Y., Hong, H., Wu, H., Zhang, Y., Engle, J., Barnhart, T., Cai, J., and Cai, W. (2012) Radiolabeled gammaAApeptides: a new class of tracers for positron emission tomography. Chem. Commun., 48, 7850–7852. Wu, H., Amin, M.N., Niu, Y., Qiao, Q., Harfouch, N., Nimer, A., and Cai, J. (2012) Solid-phase synthesis of gammaAApeptides using a submonomeric approach. Org. Lett., 14, 3446–3449. Wu, H., Niu, Y., Padhee, S., Wang, R.E., Li, Y., Qiao, Q., Ge, B., Cao, C., and Cai, J. (2012) Design and synthesis of unprecedented cyclic gamma-AApeptides for antimicrobial development. Chem. Sci., 3, 2570–2575. Li, Y., Smith, C., Wu, H., Padhee, S., Manoj, N., Cardiello, J., Qiao, Q., Cao, C., Yin, H., and Cai, J. (2013) Lipidated cyclic gamma-AApeptides display both antimicrobial and antiinflammatory activity. ACS Chem. Biol. doi: 10.1021/cb4006613 Hu, Y., Amin, M.N., Padhee, S., Wang, R.E., Qiao, Q., Bai, G., Li, Y., Mathew, A., Cao, C., and Cai, J. (2012) Lipidated 107 108 6 Peptidomimetics as Antimicrobial Agents 85. 86. 87. 88. peptidomimetics with improved antimi- 89. Nailor, M.D. and Sobel, J.D. (2011) crobial activity. ACS Med. Chem. Lett., 3, Antibiotics for Gram-positive bacterial 683–686. infection: vancomycin, teicoplanin, quinupristin/dalfopristin, oxazolidinones, Vaara, M. (2010) Polymyxins and their daptomycin, telavancin, and ceftaroline. novel derivatives. Curr. Opin. Microbiol., Med. Clin. North Am., 95, 723–742. 13, 574–581. Wu, G., Abraham, T., Rapp, J., Vastey, 90. Kvitko, C.H., Rigatto, M.H., Moro, A.L., F., Saad, N., and Balmir, E. (2011) Dapand Zavascki, A.P. (2011) Polymyxin tomycin: evaluation of a high-dose B versus other antimicrobials for the treatment strategy. Int. J. Antimicrob. treatment of pseudomonas aeruginosa Agents, 38, 192–196. bacteraemia. J. Antimicrob. Chemother., Muraih, J.K., Pearson, A., Silverman, J., 66, 175–179. and Palmer, M. (2011) Oligomerization 91. Mookherjee, N., Brown, K.L., Bowdish, of daptomycin on membranes. Biochim. D.M.E., Doria, S., Falsafi, R., Hokamp, Biophys. Acta, 1808, 1154–1160. K., Roche, F.M., Mu, R.X., Doho, G.H., Pistolic, J., Powers, J.P., Bryan, Mishra, N.N., McKinnell, J., Yeaman, J., Brinkman, F.S.L., and Hancock, R.E.W. M.R., Rubio, A., Nast, C.C., Chen, L., (2006) Modulation of the TLR-mediated Kreiswirth, B.N., and Bayer, A.S. (2011) inflammatory response by the endogeIn vitro cross-resistance to daptomycin nous human host defense peptide LL-37. and host defense cationic antimicrobial J. Immunol., 176, 2455–2464. peptides in clinical methicillin-resistant staphylococcus aureus isolates. Antimicrob. Agents Chemother., 55, 4012–4018. 109 7 Synthetic Biology and Therapies for Infectious Diseases Hiroki Ando, Robert Citorik, Sara Cleto, Sebastien Lemire, Mark Mimee, and Timothy Lu 7.1 Current Challenges in the Treatment of Infectious Diseases Following the remarkable success of antibiotics in the mid-twentieth century, US Surgeon General William Stewart is said to have declared, “It is time to close the book on infectious diseases, and declare the war against pestilence won” [1]. Since this declaration, however, antibiotic-resistant pathogens have progressively emerged and grown in significance without concomitant improvements in antibiotic development. In addition to drug-resistant superbugs, we are facing newly emerging and re-emerging infectious diseases. Thus, the book on infectious diseases remains open for the foreseeable future. Of the 58.8 million annual deaths worldwide, 15 million are estimated to be directly related to infectious diseases [2, 3] (Figure 7.1). There are many different types of infectious diseases that afflict mankind. Many established infectious diseases have been prevalent for a long period of time and cause a relatively stable level of morbidity and mortality. These include viral and bacterial respiratory and diarrheal diseases, drug-susceptible tuberculosis (TB), tropical diseases such as helminthic and parasitic diseases including drug-susceptible malaria, and nosocomial infections [3]. There are also newly emerging infectious diseases that are recently adapted to the human host [3]. For example, in 2011, 34 million people lived with human immunodeficiency virus (HIV), 2.5 million people were infected for the first time, and 1.7 million people died from HIV-related illnesses [4]. In addition, some infectious agents of nonhuman hosts can cross over to humans, but when these are not passed from person to person, they only achieve dead-end transmission. However, infections that are transmitted from animals to humans (zoonoses) and those transmitted between vertebrates by the bite of infected arthropod vectors (vector-borne diseases) have been identified. For example, rodent species and viruses such as arenavirus and hantavirus have co-evolved [5]. Environmental and human behaviors have increased human contact with these animals and have given these viruses the opportunity to be transmitted from their natural Novel Antimicrobial Agents and Strategies, First Edition. Edited by David A. Phoenix, Frederick Harris and Sarah R. Dennison. © 2015 Wiley-VCH Verlag GmbH & Co. KGaA. Published 2015 by Wiley-VCH Verlag GmbH & Co. KGaA. 110 7 Synthetic Biology and Therapies for Infectious Diseases Respiratory infections 4.3 2.2 2 Diarrheal diseases HIV 1.5 Tuberculosis 0.9 Malaria 0.8 Childhood-cluster diseases 0.3 Meningitis 0.2 Tropical-cluster diseases STDs excluding HIV Hepatitis B Hepatitis C Dengue 0.1 0.1 0.05 0.02 Intestinal nematode 0.01 0.006 Leprosy 0.005 Japanese encephalitis 0.0 1.5 3.0 4.5 No. of deaths (millions) Figure 7.1 Leading causes of death due to infectious diseases [2, 3]. Childhoodcluster diseases include pertussis, diphtheria, poliomyelitis, tetanus, and measles. Tropicalcluster diseases include schistosomiasis, trypanosomiasis, Chagas disease, and leishmaniasis. Sexually transmitted diseases (STDs), excluding HIV, include syphilis, chlamydia, and gonorrhea. Intestinal nematode infections include ascariasis and trichuriasis. hosts to humans. Another example of zoonosis is variant Creutzfeldt–Jakob disease (vCJD). This disease is thought to be related to the prion associated with bovine spongiform encephalopathy (BSE), which is commonly called mad cow disease. Unlike almost all known prions, the new BSE prion easily infects humans and a number of species, suggesting that the variants could cause unforeseeable transmission from animals to humans and be a serious threat to human health [6, 7]. Indirect transmission, in which infectious agents are transferred to humans or between humans, accounts for other zoonotic and non-zoonotic diseases. Examples include enterohemorrhagic Escherichia coli O157:H7 and Campylobacter jejuni transmitted via food, milk, or direct contact, Legionella pneumophila transmitted via artificial environments such as hot spring facilities and airconditioning systems, and Vibrio cholerae O139 and Cryptosporidium parvum transmitted via the fecal–oral route [5]. In addition, infectious agents not only cause acute health problems but can also result in chronic diseases [5]. For example, hepatitis viruses type B and C, human herpesvirus 8, and Helicobacter pylori can lead to liver cirrhosis and cancer, Kaposi sarcoma, and gastric ulcers and cancer, respectively [8, 9]. Other infectious diseases have long histories of infecting humans but have recently increased in prevalence in human populations, evolved, or changed their 7.1 Current Challenges in the Treatment of Infectious Diseases epidemiology or drug susceptibility [3]. These include West Nile virus, influenza, polio, dengue, drug-resistant TB and malaria, nosocomial infections, and cholera. Malaria, caused by the protozoan parasite Plasmodium falciparum, is a major infectious disease that continues to afflict mankind. The number of malaria cases was reduced due to global malaria eradication efforts in the 1950s and 1960s [10]. However, the introduction of the insecticide dichlorodiphenyltrichloroethane (DDT) led to the emergence of drug-resistant mosquitoes as well as concerns about its potentially harmful effects on humans and nature. As DDT use has decreased, malaria has resurged in prevalence and the emergence of resistance to anti-malarial drugs, such as chloroquine, has worsened the situation [11]. The emergence and dissemination of drug-resistant bacterial pathogens constitutes another major growing threat to public health [12]. For example, methicillin-resistant Staphylococcus aureus (MRSA) is one of the most wellknown drug-resistant pathogens in the world. MRSA emerged several decades ago and is still a major cause of healthcare-associated infections. For example, the US Centers for Disease Control and Prevention (CDC) reported that MRSA killed 11 285 people in the United States in 2011 [13]. The CDC also recently classified three antibiotic-resistant pathogens at “urgent hazard levels”: Clostridium difficile, carbapenem-resistant Enterobacteriaceae (CRE), and drug-resistant Neisseria gonorrhoeae [13]. These organisms are resistant to most commonly used antibiotics. In particular, the treatment of CRE infections is extremely difficult because these pathogens are resistant to almost all available antibiotics. In addition, there are many other multidrug-resistant (MDR) and pandrugresistant (PDR) Gram-negative bacteria, including Acinetobacter baumannii, Pseudomonas aeruginosa, and extended-spectrum β-lactamase-producing Enterobacteriaceae. These bacteria can exhibit broad resistance to antibiotics (e.g., β-lactams, aminoglycosides, tetracyclines, and polymyxins) [14]. MDR and extensively drug-resistant (XDR) Mycobacterium tuberculosis also constitute a significant and growing class of bacterial infections, especially in developing countries [15]. TB is responsible for causing 8.8 million incident cases and 1.1 million deaths among HIV-negative patients, as well as 0.35 million more deaths from TB associated with HIV in 2010 [16]. MDR-TB is defined as resistance to both isoniazid and rifampicin, with or without resistance to other first- and second-line drugs [17]. MDR-TB plus resistance to any fluoroquinolone and a second-line injectable drug is defined as XDR-TB [17]. Generally, MDR-TB requires 2 years of treatment with potentially serious side effects while the treatment of XDR-TB is even more difficult and often nearly impossible [18]. As drug-resistant superbugs continue to grow in significance, there have been few clinical approvals of new antibiotics to meet the challenge. From 1983 to 1992, the U.S. FDA (Food and Drug Administration) approved 30 new antibiotics. In the 10 years that followed, that number was reduced to 17 and, in the last decade, only seven new antimicrobial drugs have been approved for marketing in the United States [19, 20] (Figure 7.2). Over the last 40 years, only two mechanistically 111 7 Synthetic Biology and Therapies for Infectious Diseases 1983 − 1987 16 1988 − 1992 Years 112 14 1993 − 1997 10 1998 − 2002 7 2003 − 2007 5 2008 − 2012 2 0 6 12 18 No. of drugs Figure 7.2 Antimicrobial drugs approved by the U.S. FDA for use in humans over the last 30 years. (Modified from Spellberg et al. [20] and Boucher et al. [19].) and structurally new classes of antibiotics, linezolid and daptomycin, have been introduced [21]. This lack of productivity has resulted in the continued growth of life-threatening MDR, XDR, and PDR pathogens [22]. Although government, academia, and industry are starting to recognize and address this issue, novel approaches to discovering new antimicrobials are increasingly necessary. In 2012, the European Union’s Innovative Medicines Initiative launched a public–private partnership called NewDrugs4BadBugs, which was aimed at bringing together academia and industry to tackle antibiotic resistance. In addition, the United States also recently enacted new incentives to encourage drugmakers to develop new therapies against drug-resistant bacteria [19]. 7.2 Introduction to Synthetic Biology We believe that synthetic biology presents new opportunities to combat infectious diseases. The field of synthetic biology is focused on engineering biological systems to achieve new functionalities using genetic engineering strategies that are increasingly more robust, rapid, inexpensive, and multiplexable. Synthetic biology has been accelerated by the development of next-generation DNA sequencing, synthesis, and assembly techniques, thus enabling rapid and parallelized construction and modification of biological systems [23]. These tools enable the design of biomolecular and cellular systems that can address biomedical applications, including infectious diseases [24–26]. We refer the interested reader to other reviews for more generalized descriptions of synthetic biology [23, 27, 28]. Here, we highlight existing approaches to combat infectious diseases with a primary focus on bacteria. In addition, we discuss advances in the application of synthetic biology to other infectious diseases and the potential of synthetic biology to work synergistically with other fields [26] (Figure 7.3). 7.3 Synthetic vaccine strains with effective antigens, attenuated virulence, and delayed lysis ATGC TACG Pyocin Bacteriocin Synthetic probiotics Synthetic bacteriophages with broad host ranges, biofilm-dispersing enzymes, and antibiotic-boosting activity B AB Synthetic biology In silico mining and synthetic pathway engineering for natural products ATGC TACG T7 dspB 113 Synthetic antibiotics Reverse vaccinology With desired functions by in silico analysis and individual antigen screening Lysin P A Vaccinology Next-generation genetics Gibson assembly, yeast platforms, CRISPR/Cas-based RGNs M13 lexA3 Figure 7.3 Schematic overview of synthetic biology approaches to combat infectious diseases. 7.3 Vaccinology Vaccination is probably the most successful anti-infection strategy devised by modern medicine. Interestingly, the majority of vaccines have been developed empirically with little knowledge regarding how and why they confer protection. Instead of allowing infections to establish themselves before initiating treatment, vaccines are given prophylactically to harness the natural capacity of the body to defend itself. Vaccines have proved effective against many viral and bacterial diseases such as smallpox, polio, measles, mumps, rubella, yellow fever, rabies, tetanus, diphtheria, pertussis, and bacterial meningitis. However, vaccination has also met significant failures, for example, against pathogens such as HIV, Salmonella, V. cholerae, E. coli, and P. falciparum [29–36]. The scope of the following chapters is mostly limited to the recent developments of vaccines against bacterial infections, especially when antibiotic resistance is already or is becoming a significant issue for treatment. Vaccinology relies on the establishment of immunological memory of a foreign agent such that the immune system can elicit a more potent, protective response against subsequent exposure. The mechanisms underlying vaccinology are well described in the recent review by Pulendran and Ahmed [37] and we refer the reader to this work for more in-depth understanding. Briefly, the innate immune system constitutes the first line of defense, wherein antigen-presenting cells, 114 7 Synthetic Biology and Therapies for Infectious Diseases such as dendritic cells and macrophages, sense pathogens through various signal transduction pathways. This information is transmitted to the effectors of the adaptive immune system (T and B cells), which mount a specific response to the threat in the form of dedicated killer cells or antibody-producing cells. In addition, the response can generate memory cells that archive this information in order to ready the body for a more rapid and robust response in future challenges with the same pathogen. A successful vaccine can trigger all levels of the immune response, including memory generation, in order to obtain effective long-term protection. Some vaccines are killed or inactivated pathogens that trigger a protective reaction against a related microbe. In addition, live attenuated vaccines are derived from actual pathogens that have accumulated mutations that weaken their disease-causing capabilities while leaving important antigens and immunogenicity intact. Examples of such vaccines include bacille Calmette-Guérin (BCG) against M. tuberculosis, Ty21a against Salmonella typhi, and MMR against measles, mumps, and rubella. Inactivated/killed vaccines, such as specific polio or hepatitis A vaccines, consist of the whole pathogen killed, usually through heating. It was also discovered that an immune response could be obtained through exposure to only parts of the pathogen and that this may also decrease side effects from exposure to the whole pathogen. Those parts may be toxins or part of toxins; such vaccines are referred to as toxoid vaccines and examples include vaccines against diphtheria and tetanus. Components of the pathogen surface, such as the capsule, lipopolysaccharides (LPSs), or outer membrane proteins, may also be used in subunit vaccines; examples include hepatitis B, pneumococcal, and meningococcal vaccines [38]. Live attenuated vaccines are usually longer acting than subunit vaccines, which generally require booster injections at regular intervals to maintain efficacy [39]. 7.3.1 Genetic Engineering and Vaccine Development The first live, attenuated vaccines, such as BCG or S. typhi Ty21a, were developed by empirical selection of attenuated strains that confer protective immunity against otherwise lethal challenges by their respective associated pathogen, Mycobacterium tuberculosis (Mtb), responsible for TB, and Salmonella typhi (Sty), responsible for typhoid fever. Both vaccines display incomplete protection, and therefore, intensive efforts with genetic engineering have been employed to improve them. Drug-resistant TB has increased steadily in recent years to the point where strains refractory to all first-line antibiotics (isoniazid, rifampicin, ethambutol, and pyrazinamide) now appear in 10–20% of all TB patients [16]. TB is a chronic infection involving a constant battle between bacteria and the human immune system. After initial infection, acute primary TB develops in 5–10% of patients and an estimated 20–50% of individuals manifest as asymptomatic carriers [40]. Immunodeficiency, such as in AIDS patients, leads not only to enhanced susceptibility, 7.3 Vaccinology morbidity, and mortality to the disease but also to increased reactivation in latently infected individuals, making TB one of the most frequent and lethal of the AIDSassociated co-infections [16]. BCG is an attenuated mutant of Mycobacterium bovis (Mb), the causative agent of bovine TB, and was obtained by serial passage of the bacilli in laboratory medium [41]. BCG was first commercialized in the 1920s, but its efficacy has since been called into question. First, BCG does not provide universal protection against all pathogenic strains of Mtb and the extent of immunity varies between individuals. Second, when there is an immune response in the host, the degree of protection it offers against pulmonary TB, the most dangerous and contagious form of the disease, is variable and ranges from 77% in some studies to 0% in others [40]. Finally, it is protective only if administered during early childhood [42]. As a result of serial passaging, the various strains of BCG have all lost the RD1 locus, which encodes the majority of Mb’s and Mtb’s virulence factors, thus resulting in attenuation [42]. Mycobacteria are intracellular pathogens that reside in heavily modified phagolysosomes, which may restrict immune access to antigens. Thus, toward the goal of improving the vaccine strain, it was hypothesized that liberating Mycobacterium into the cytosol could increase the antigenicity of BCG. A derivative of BCG (VPM1002) was genetically engineered to carry a replacement of ureC, a gene involved in pH neutralization inside the Mycobacterium-containing phagolysosome, with the gene encoding listeriolysin O (LLO), a virulence factor from Listeria monocytogenes that allows it to escape into the cytosol of infected cells. VPM1002 proved significantly more immunogenic and equivalently safe versus BCG in a randomized Phase 1 trial reported recently by Grode and colleagues [43] and is now undergoing Phase 2a trials. Another group led by Marcus Horwitz at the University of California, Los Angeles, and the company Aeras adopted a different approach by genetically engineering BCG to express Ag85B (encoded by fbpB), a known antigen of Mtb absent from Mb. The resultant strain, rBCG30, exhibited increased immunogenicity and also cleared Phase 1 trials, thus demonstrating the power of rational genome engineering for creating live, attenuated vaccines [44–46]. rBCG30 was further modified by the deletion of mbtB, a siderophore transport protein, as well as panCD, which made the strain dependent on high levels of free iron and vitamin B5, respectively. These engineering steps resulted in an even weaker pathogen that replicates slowly and has potentially enhanced safety over BCG in immunocompromised patients [47]. Finally, most of these features were integrated into the recombinant vaccine strain AERAS-422. AERAS-422 has the ureC gene replaced by the Clostridium perfringens perforin gene to enable phagolysosome escape and also overexpresses three key Mtb antigens [48]. The examples provided above illustrate the usefulness of genetic engineering in live vaccine design, which has led to the development of promising new vaccine strains. In addition to TB, strain engineering strategies have been applied to other important diseases. For example, typhoid fever is still endemic in many parts of the world and causes severe diarrhea and fever that can be lethal in 20% of infected 115 116 7 Synthetic Biology and Therapies for Infectious Diseases individuals if proper medical treatment is not administered. As with most other bacterial diseases, multidrug resistance is on the rise and no effective vaccines are currently available [49]. S. typhi is capable of residing for decades in the gall bladders of infected individuals, resulting in a carrier state that enables shedding and dissemination of the pathogen from asymptomatic individuals [50]. The first live, attenuated vaccine available for Salmonella is known as Salmonella typhi Ty21a, although it does not protect against all typhi strains. Furthermore, longer term protection requires frequent booster shots and is not indicated in children below 6 years of age, where the toll of the disease is most severe [51]. Salmonella is a facultative intracellular pathogen that has evolved a complex and tightly orchestrated interaction with infected cells. At the heart of its pathogenicity lies two Type 3 Secretion Systems (T3SSs) encoded by Salmonella Pathogenicity Islands 1 and 2 (SPI-1 and SPI-2, respectively), which allow the bacterium to inject a diverse set of proteins and toxins into the cytoplasm of infected cells [52, 53]. These secreted factors enable the bacteria to remodel the host cell cytoskeleton for uptake, prevent maturation of the subsequent phagolysosome, and finally recruit membrane vesicles to form highly specific Salmonella-containing vacuoles where the bacteria can survive and multiply. SPI-1 is particularly involved in initial epithelial cell invasion, while SPI-2 is connected to systemic infection and survival inside of macrophages [54, 55]. The understanding of this pathogen’s biology along with its genetic tractability has enabled some of the most refined live, attenuated vaccines designed to date. Various auxotrophic mutations result in attenuation, but the most commonly studied are 𝛥fur, 𝛥phoP/Q, 𝛥aroC/D, 𝛥rpoS and the double mutant 𝛥cya 𝛥crp [56–59]. Fur (Ferric Uptake Regulator) is a regulator involved in iron homeostasis and acid tolerance, a requirement for surviving passage through the stomach or the lysosomes of infected macrophages [60, 61]. The genes phoP/Q encode a sensor kinase system involved in the sensing of external cues and proper expression of many virulence genes of Salmonella [62]. The aro genes encode proteins that are involved in the metabolism of aromatic compounds [56]. Mutations in the aroA, aroC, and aroD genes also alter membrane integrity, thus increasing sensitivity to various membrane stresses [63]. RpoS is a sigma factor involved in the response to stresses and/or regulation of virulence pathways in many bacterial pathogens [64]. Cya is an adenylate cyclase responsible for the synthesis of cAMP [56]. A key step in the use of Salmonella as a live vaccine was the development of a series of plasmids for the expression of heterologous cargo that do not require antibiotics for selection. In these constructs, stability is ensured through the complementation of a deleted essential Salmonella gene, such that plasmid loss is lethal to the bacterium [65, 66]. The genetic cargo carried on these plasmids can be used either to alter the life cycle of Salmonella, express heterologous antigens, or a combination of both, as illustrated in the following paragraphs. As knowledge about Salmonella’s interactions with eukaryotic cells grew, it became evident that the initial attenuated Salmonella strains described above were severely limited by pleiotropic effects linked with the mutations that weakened them and that part of the reduced virulence phenotypes were the 7.3 Vaccinology result of defective host colonization, which prevents the activation of a robust immunologic reaction [67]. To further leverage the usefulness of Salmonella as a vaccine agent, strains were engineered to have essential genes under the control of inducible promoters. These strains were viable in the laboratory, but died through lysis after a programmable number of replication cycles due to exhaustion of an essential bacterial component [65, 66]. The ensuing lysis enabled the delivery of antigenic cargo directly inside of antigen-presenting cells, thus enhancing immunogenicity. To further avoid the metabolic load associated with high-level synthesis of an antigen, the most recent Salmonella vaccine strains feature delayed overexpression of antigens. The result of this work is a set of strains collectively known as recombinant attenuated Salmonella vaccines (RASV s), which incorporate a variable set of genetically engineered solutions to the known limitations of Ty21a and transform Salmonella into an efficient antigen delivery system [68]. The various genetic modules, which have been engineered into RASV strains, are depicted in Figure 7.4. Several aspects regarding the development of these strains are discussed in the following paragraphs but the reader is referred to recent publications for a more complete overview [68–70]. Several Salmonella strains that penetrate the host at different depths are available, thus triggering more or less pronounced immune responses to the release of antigens. Strains completely deleted for phoPQ or rpoS fail to replicate past their initial port of entry, the intestinal epithelium [71, 72], while a fur deletion mutant is attenuated because it is incapable of mounting a proper acid tolerance response to the acidic environment of the stomach [60, 73]. Researchers have replaced the endogenous promoter for each of these genes with the arabinose-inducible promoter, PBAD . Thus, the expression level of these genes can be maintained in the laboratory with the addition of arabinose, but will gradually fall over the course of replication during infection as the human body does not contain arabinose. This results in delayed attenuation, which allows bacteria to reach deeper into the body than simple deletion strains. The depth of penetration is at least partially dependent on the number of modified regulatory genes introduced into the bacterium [74–76]. Delayed antigen overexpression was obtained through highlevel expression of the transcriptional repressors C2 and LacI from the arabinose promoter, which then downregulate the expression of antigens cloned under the control of their respective promoters, P22 PR or Plac [77–79]. With the abovementioned PBAD driven genes, C2 or LacI synthesis stops shortly after inoculation due to absence of arabinose, and the dilution of these repressors by division and decay gradually leads to antigen expression. A refinement of this method involved using promoters associated with the expression of late infection functions to drive the synthesis of antigens, thus ensuring that antigens are only produced when Salmonella receives specific environmental cues upon reaching its target site inside of macrophages [78]. Another strategy for delayed antigen liberation is achieved through the replacement of the murA promoter by the arabinose promoter. MurA is essential for cell wall synthesis and therefore, its gradual disappearance within arabinose-free host tissues eventually leads to cell wall collapse and lysis [80]. 117 118 7 Synthetic Biology and Therapies for Infectious Diseases Delayed lysis Delayed antigen delivery ΔasdA ΔmurA PBAD-asdA PBAD-murA PR(anti asdA) PR-(anti murA) PBAD-c2 SopE(N-ter)-antigen OmpC(N-ter)-antigen ΔsifA Delayed virulence attenuation PBAD-lacI Plac-antigen PrfaH::PBAD RASV Pfur::PBAD Delayed antigen overexpression Pcrp::PBAD PphoPQ::PBAD PrpoS::PBAD Arabinose promoter behaviour RASV Growth Arabinose PBAD condition In vitro + In vivo - Figure 7.4 Recombinant attenuated Salmonella vaccine (RASV) components. RASV are highly engineered Salmonella strains that may contain combinations of modifications to attenuate virulence, maximize immunogenicity, or deliver antigens. Those components may be chromosomally or plasmid encoded. This figure is not an exhaustive representation of all possible mutations that could create RASV strains. The arabinose promoter used in many of the strains is regulated by AraC, a chromosomally encoded, arabinose-responsive transcriptional regulator that activates the PBAD promoter. As arabinose is not readily available in eukaryotic cells, PBAD remains inactive during infection. LacI is a transcriptional repressor of the Plac promoter. If lacI is controlled by PBAD , any gene downstream of a Plac promoter will be upregulated during intracellular growth of RASV. Similarly, C2 is a repressor of the phage P22 promoter PR . rfaH, a transcriptional PsopE-antigen Plac-antigen PBAD-lacI PL-antigen PBAD-c2 anti-terminator essential to the synthesis of lipopolysaccharide (LPS), is an essential component of Salmonella virulence. The genes fur, crp, and rpoS encode general regulators of gene expression, while phoPQ is a twocomponent system that is essential for the proper expression of many virulence factors. SopE, a Salmonella Pathogenicity Island 1 (SPI-1) secreted effector, possesses an Nterminal domain that is sufficient for targeting proteins to the SPI-1 type III secretion system. OmpC is an outer membrane protein with an N-terminal export signal. SifA is a SPI-2 virulence effector involved in the maturation of Salmonella-containing vacuoles in which Salmonella resides during intracellular growth. Its absence leads to release of bacteria into the cytosol. AsdA and MurA are involved in cell-wall synthesis. As bacteria replicate, new cell walls need to be synthesized to accommodate growth; thus, a failure to synthesize cell walls leads to cell lysis. Engineered Salmonella vaccines have also proved to be useful immunogenic vectors in various animal models and against a range of non-Salmonella threats such as enterohemorrhagic E. coli [81], hepatitis B [82], TB [79], cancer [83–85], Bacillus anthracis [86], H. pylori [87, 88], Yersinia pestis [89, 90], Clostridium tetani and difficile [91–94], and L. monocytogenes [95]. For example, Salmonella possesses the capacity to secrete proteins directly from its cytoplasm into the 7.3 Vaccinology eukaryotic cytoplasm through dedicated channels encoded by the SPI-1 and SPI-2 T3SSs. Secretion is generally directed by small N-terminal domains, which can be fused to target proteins and guide them for secretion through the T3SS of Salmonella [96–98]. This capacity makes it possible for Salmonella to deliver antigens from within the vacuole it resides in into the cytoplasm of infected macrophages, a prime target for Salmonella replication during systemic infection. These macrophages can then display these cytoplasmic antigens on the macrophage surface for priming T cells and eliciting immune responses [99]. This strategy was used in the fusion of the 80-amino-acid N-terminal fragment of SopE, an SPI-1 secreted effector of Salmonella, with the Mtb-specific antigens ESAT-6 and CFP-10; this design provided protection against infection by aerosolized Mtb in mice, a model system for TB [100]. Despite all of the promises described above, RASVs are still not used in clinical medicine partially due to concerns that Salmonella is a pathogen. Laboratories have therefore worked on reproducing RASV features in organisms such as Lactococcus lactis or Bifidobacterium that are generally recognized as safe (GRAS). For example, Asensi and colleagues [101] successfully cloned staphylococcal enterotoxin B into L. lactis and triggered protective immunity against staphylococcal challenge in mice. In addition, bifidobacterium was also used to express antigens of E. coli or Salmonella and trigger at least some level of immune response against the cognate pathogen [102, 103]. Lactic acid bacteria have been also used as probiotics with reported benefits against inflammatory diseases, obesity, and allergies [104–107], thus paving the way toward engineered strains functioning at the intersection of vaccines and probiotics. In any of these live, attenuated vaccine strains, expressing a foreign antigen may be hampered by low transcriptional efficiency, translational efficiency, mRNA stability, or protein stability, leading to poor immunogenicity. Attempts to address these problems have leveraged strategies such as codon optimization and mRNA analysis and design [108, 109]. As synthetic biologists develop systematic strategies to tackle these issues for general organismal engineering [110–112], more tools will be available for strain engineering and vaccine design in the future. Furthermore, enhanced technologies for genome engineering should enable more rapid and precise genetic modifications of vaccine strains [113–115]. 7.3.2 Rational Antigen Design Through Reverse Vaccinology Traditional subunit vaccinology starts from a pathogen and dissects it into progressively smaller pieces that are each independently tested for immunogenicity. This process can identify individual subunits that provide robust and broad protection against the whole pathogen. This long, costly, and unpredictable process can be challenging to apply against pathogens that evolve more rapidly than our ability to update vaccines. 119 120 7 Synthetic Biology and Therapies for Infectious Diseases Reverse vaccinology describes an antigen-design strategy that makes heavy use of database mining, functional prediction algorithms, and three-dimensional protein structure prediction software to identify antigen candidates that can be tested experimentally for effectiveness [116]. The tools of synthetic biology can further advance the field of reverse vaccinology by enabling more rapid construction, expression, and testing of individual antigens. Reverse vaccinology starts from identifying open reading frames (ORFs) from the genome sequence of a pathogen. The predicted proteins are then analyzed for their potential involvement in virulence or their possible display on the bacterial surface. In addition, one attempts to identify pathways that may lead to LPS and murein synthesis in order to try to predict the resulting structures, as both components may be immunogenic. Further biological analysis is limited to those candidates identified by these approaches that usually encompass only a tiny subset of the original ORFs. These ORFs are then expressed in heterologous hosts and individually tested for immunogenicity. Although screening is still necessary in reverse vaccinology, the number of possible candidate antigens is drastically reduced by computational pre-screening, which eliminates genes whose products are unlikely to be immunogenic, because of reasons such as retention inside the cytoplasm of bacteria, and/or not specific to the pathogen. Reverse vaccinology also allows for the identification of antigens Traditional vaccinology Pathogen Reverse vaccinology Fractionation of cell components DNA extraction and sequencing ATGC… In silico analysis of ORFs for candidate antigens (surface exposed cell components) Subcloning of antigen candidate genes Independent testing of each fraction for immunogenicity etc… Expression and testing of individual antigen candidates Isolate Iterative subfractionation and testing protective antigens Isolate protective antigens Safety and efficacy testing in clinical trials (a) (b) Figure 7.5 Comparison of traditional and reverse vaccinology methodologies. Panel (a) presents the general workflow for antigen discovery in a traditional vaccinology study while the panel (b) illustrates the workflow in a reverse vaccinology process, in which the search for antigens starts from the pathogen’s DNA instead of the pathogen itself. 7.3 Vaccinology that may be missed in traditional vaccinology owing to low expression levels from the original pathogen. A comparative schematic of traditional and reverse vaccinology is presented in Figure 7.5. One early successful implementation of this technique was for group B meningococcus (MenB). Meningococci are natural residents of human airways, but occasionally move into the bloodstream and can cross the blood–brain barrier to cause meningitis, a highly lethal and contagious disease [117]. Some vaccines existed, but they did not cover MenB, the most prevalent serogroup in the Americas and Europe [118], until the introduction of Bexsero® whose construction is described in the following paragraphs. The most important virulence factor of Neisseria meningitidis is a polysaccharide capsule that shields it from the immune response and adverse conditions [117]. The MenB capsule is made of polysialic acid, which closely resembles human matrix components and is therefore very poorly immunogenic [119]. Moreover, due to the extreme variability of the capsule, early subunit vaccines based on capsule components had a very restricted spectrum (serogroups A, C, Y, and W135). In addition, variability in the displayed outer membrane proteins from strain to strain within a given serogroup presents a significant challenge to the development of a MenB vaccine [120]. Starting from the genome of N. meningitidis strain MC58, about 300 ORFs were predicted to be either virulence factors or externally displayed proteins. These were cloned into E. coli, overexpressed, and used to immunize mice [119]. Out of those tested, 91 ORFs were found to elicit an immune response, but only 28 generated a protective response. Out of those 28, only 3 were found to have a robust immunogenicity and a reasonably wide coverage spectrum: Genome-derived Neisseria antigens (GNAs) 2132 (Neisserial Heparin Binding Antigen, NHBA), 1870 (fHbp), and 1994 (NadA). Later, GNA2091 and GNA1030 were included because, although they did not meet all selection criteria, they still offered good protection. To ease production of the subunit antigens, GNA1030 and GNA2132 were fused together, while GNA1870 and GNA2091 were also fused into a single polypeptide. The resulting multicomponent vaccine, named 4CMenB or Bexsero, contained these antigens and outer membrane vesicles and provided protection against 78% of strains from a large panel of different N. meningitidis group B strains [119]. Reverse vaccinology was also successfully applied to other pathogens, including Brucella melitensis [121], an important animal pathogen, E. coli [122], and various Streptococcus strains [123–125]. Reverse vaccinology also involves the use of structure-based approaches for antigen design. Here, knowledge and predictions regarding the three-dimensional conformation of an antigen are used to remodel it for better antigenicity. One of the antigens used in the 4CMenB vaccine, GNA1870, is known to have more than 300 variants across Neisseria strains, which fall into only three structural subgroups [126]. Nevertheless, antibodies against one subgroup are not active against the others. The 3D structures of all three antigen variants were determined by nuclear magnetic resonance (NMR), leading to the identification of the epitope structures recognized by antibodies against each individual subtype. Protective 121 122 7 Synthetic Biology and Therapies for Infectious Diseases monoclonal antibodies against each epitope type targeted different regions of the protein [119, 127]. Thus, it was conceivable to create a synthetic GNA1870 that would display all three epitopes, which was expected to have broader immunogenicity. Although challenging, such a protein was eventually developed and was shown to provide broader spectrum protection [127]. The process involved creating a large bank of GNA1870 hybrids based on variant 1 but harboring various fractions of the GNA1870 C-terminal domain from variant 2 and/or 3. The screen was limited to the C-terminal domain because it was shown that most of the protective antibodies against variants 2 and 3 bound within this region. Each hybrid was assessed for its capacity to elicit production of cross-reacting antibodies against all three classes of GNA1870 after injection into mice and also to protect mice against meningococcal infection [127]. This approach is useful for tackling diseases caused by pathogens with highly variable genomes and is currently being used to create a vaccine against group B Streptococcus [128]. Structural vaccinology can also be used to create subunit vaccines that have been depleted of domains that mask strong epitopes or trigger their instability or rapid clearance. For example, GNA1870 was shown to be more active when its factor H binding domain was deleted [129], thus exemplifying the power of modern tools in the fight against pathogenic bacteria. Next-generation sequencing and high-throughput expression analysis technologies, such as microarrays or RNA-sequencing (RNA-seq), are expected to play a growing role in reverse vaccinology. These technologies can accelerate the characterization of the diversity of pathogen populations and gene expression. Detailed datasets can help refine predictive algorithms and be used to improve the genome annotations on which reverse vaccinology relies, thus increasing the precision of antigen predictions. As understanding of the systems biology of pathogen/host relationships matures, it is also likely to help in the identification of pathways of importance for effective vaccination. 7.4 Bacteriophages: A Re-emerging Solution? 7.4.1 A Brief History of Bacteriophages Viruses that infect bacteria, or bacteriophages, were discovered around the time of World War I for their capacity to lyse cultures of dysentery-causing bacilli. The stools of patients surviving dysentery were found to contain filterable substances (now known to be viruses) that formed areas of growth inhibition on lawns of the disease-causing agent and could lyse the bacteria in culture [130]. When administered to patients, these bacteriophages were able to ameliorate disease symptoms, although the results were unpredictable and were not obtained via rigorous double-blinded studies [131]. 7.4 Bacteriophages: A Re-emerging Solution? The discovery of phages and their viral nature was received with a high level of scrutiny that was only resolved when electron microscopes became available and the viral particles could be visualized [132]. The chaotic history of bacteriophages delayed their initial general acceptance as antimicrobials and they were further disregarded in much of the Western world when penicillin became routinely available around the 1950s [28, 133]. However, with the growth of antibiotic resistance in recent years, interest in phage therapy has rebounded, especially with advances enabling increasingly more efficient genetic engineering of bacteriophages. Although not prominent in the West, phage therapy was practiced in the United States until the 1960s, in France until the early 1990s, and in other countries as well [134]. Furthermore, phage therapy was used in the Soviet bloc as an alternative to antibiotics. Two approaches to phage therapy differ on the basis of the diversity of the pathogenic populations being targeted. The more generalized, symptombased approach is to create complex phage cocktails targeted at many different pathogens that share commonality in the presentation or location of infection. For example, Pyophage is a formulation aimed at treating open wounds while Intestiphage contains a different collection of phage for targeting common causes of gastrointestinal infections [134]. In both formulations, the actual bacteriophage composition is updated on a regular basis to cope with the evolution of bacterial populations and is therefore not statically defined. Alternatively, a more targetspecific approach to phage therapy is to use phages as a last resort when antibiotics have failed and when phage(s) specific to the disease-causing bacteria can be isolated from a phage library and administered to the patient. In this approach, phage therapy is a highly personalized medical therapy. We will not review the abundant literature on phage therapy efficacy in this paper and instead refer the interested reader to other detailed reviews on the subject [28, 134–141]. Phage therapy presents several potential advantages compared to antibiotics [28]. First, a given phage often infects only a subset of strains for a given pathogen. This specificity means that phages are innocuous to the resident commensal microflora and do not trigger the dysbiosis that can result from harsh antibiotic treatments [142, 143]. Phages also have very low inherent toxicity as they cannot infect human cells, and humans are constantly exposed to them in the environment. Phages can replicate in their bacterial hosts, which means they can have efficacy at very low doses, although this property can lead to complex pharmacokinetics/pharmacodynamics (PK/PD) that are quite different from that of small molecules. A few important principles for effective phage therapy have been outlined [144]: (i) the phage and the bacterium should be in direct contact, which makes phage therapy attractive as a topical treatment; (ii) active phage preparations that target the infectious bacteria should be assembled and used in a timely manner; and (iii) a regulatory framework to evaluate safety and efficacy should be established. Phage therapy must address several areas of concern to become a practical clinical therapy [28]. One of the major obstacles to the Western adoption of phage therapeutics is the regulatory process. Although the Soviet states accumulated a wealth of knowledge about phage therapy and there is evidence about its efficacy 123 124 7 Synthetic Biology and Therapies for Infectious Diseases in specific cases, the vast majority of this data is not freely available and may be archived in languages and formats not easily interpretable by the rest of the world. In addition, most existing safety and efficacy studies were not conducted in well-controlled clinical trials. Moreover, the sudden lysis of infective bacteria due to phage administration has the potential to cause an excessive release of endotoxins and other toxins that can result in septic and/or toxic shock. Phages can be immunogenic, which can lead to rapid clearance from the body and establishment of immunological memory, making it potentially ineffective to use the same phage multiple times in a given patient in case of relapse or re-infection. In addition, it is challenging to patent non-engineered phages, since they are natural biological particles that can be found in the environment. Furthermore, the highly specific nature of phages means that one must ensure that the causative bacteria are susceptible to the phages applied and one must also account for the evolution of phage-resistant bacteria over time. These difficulties, along with the PK/PD of phage therapy, may account for a large extent of the lack of interest of large pharmaceutical companies and investors in phage therapy. Phages have evolved to prey on bacteria and, in doing so, have adopted countless ways to subvert their hosts and kill them. No single natural phage has all the desirable features for phage therapy, but synthetic biology is potentially capable of addressing many of their shortcomings through phage engineering as described in the following sections. Furthermore, harvesting the killing potential of phages independent of their viral lifestyle is a way to circumvent many of the regulatory hurdles linked with phage therapy per se and can lead to either new antibacterial protein therapeutics and/or new targets for the design of antimicrobials. 7.4.2 Addressing the Problem of the Restricted Host Range of Phages Most natural phages have restricted host ranges (Figure 7.6a). One way to address this problem relies on phage cocktails containing several different phages that collectively target all possible variants of a pathogen. However, this approach is challenging for the regulatory framework employed in Western medicine. Although the U.S. FDA does not disallow the possibility of licensing cocktails, it requires that each individual phage be tested independently for safety and activity [145]. For infection to proceed, phages first need to recognize and adsorb to specific receptors on host cell surfaces. These can include proteins, LPS components, capsule components, pili, other molecules, or any combination of these factors [149]. Once adsorption to the receptor is stable, the phage may inject its DNA (and sometimes proteins) into the bacterium where its life cycle will initiate. Much of the host specificity of a phage is determined by the presence or absence of its specific receptor(s) on the surface of target cells and thus, mutations in phage receptors are often sufficient to confer resistance [150]. This mechanism of phage resistance is the most common under laboratory conditions, with frequencies ranging from 10−5 to 10−8 depending on the particular host/phage considered [151, 152]. 7.4 Bacteriophages: A Re-emerging Solution? Flipping site Tail A Tail B A B Tail A Tail B Tail A Tail B Flipping C Tail A A B C C Bacteria A Bacteria B Bacteria A Bacteria B (a) Tail B D D D D Bacteria A Bacteria B (b) (c) Figure 7.6 Bacteriophage host range and strategies used to enhance access to host receptors. (a) Phage A carrying tail A infects bacteria A, and phage B carrying tail B infects bacteria B. Phage A cannot infect bacteria B, and phage B cannot infect bacteria A. Bacterial host range can be dictated by available bacterial receptors that can be recognized by phages [146]. (b) Phage C carries two separate tail genes, tail A and B, with different hydrolytic properties that allow for drilling through both types of capsules [147]. (c) Phage D has an invertible segment that allows switching their host ranges. In contrast with phage C, phage D does not express the two versions of the tail proteins at the same time. The flipping is mediated by a site-specific recombinase [148]. Receptor recognition by tailed phages usually results from proteins from the tail itself or associated structures, such as the distal tail fiber, the tail fiber, or the tail spike [149]. In the most simple adsorption systems, the adhesin at the tip of a tail fiber will recognize a bacterial outer membrane protein or other bacterial outer membrane components, such as LPS, and then reversibly anchor the phage to its target [149]. Many phages may require several receptors for efficient adsorption [146]. Some phages also have the capacity to degrade outer membrane appendages, such as LPS or capsules, in order to access secondary receptors that are hidden by these surface components [147, 153, 154]. Phages that are not tailed still require a specific host receptor on the outer membrane to initiate nucleic acid injection [155, 156]. For example, for filamentous phages such as Fd, host recognition proceeds through the product of gene pIII, which is attached at only one end of the virion [155]. Fd’s preferred host is F-pilus-expressing E. coli; however, phage adsorption to E. coli may still occur in the absence of F although with much reduced efficiency [157]. Fd can be engineered to infect V. cholerae upon replacement of its pIII gene with its ortholog from vibriophage CTXϕ, orfU [157]. 125 126 7 Synthetic Biology and Therapies for Infectious Diseases While most phages have a single adhesin, some have several recognition elements they can use to widen their host range or to target other hosts when the supply of a specific host is exhausted (Figure 7.6b and c). The switch can be actuated by a DNA inversion system that inverts a DNA fragment carrying the adhesin domain and replaces it with another one [158, 159]. In addition, some Bordetella phages have evolved a complex diversity-generating system to track the fast evolution of the surface of their hosts [160]. One can envision leveraging these natural strategies and engineering them into synthetic phages to gain more precise control over phage host ranges. In addition, K1-5 is a strictly lytic T7-like coliphage that preys on strains harboring either a K1 or a K5 capsule. As these two types of capsule are structurally different, they cannot be targeted by a single factor. Thus, K1-5 phage carries two separate tail spikes with different hydrolytic properties to allow drilling through both types of capsules (Figure 7.6b). The endosialidase-type tail spike (gp47) enables binding and degradation of the K1 capsule while the lyase-type tail spike (gp46) enables binding and degradation of the K5 capsule. Inactivation of any one of these tail spikes restricts K1-5 to a single type of encapsulated E. coli [147]. Both tail spikes are assembled into the phage capsids, side by side [161]. K1-5 is a very close relative of phage K1E, which lost most of gp46 and therefore targets K1 strains, and phage K5, which only has gp46 and thus only infects K5 strains [162]. Lysogenic coliphages Mu and P1 both have an invertible segment that allows them to switch their host ranges at a predetermined frequency (Figure 7.6c). In sharp contrast with K1-5, they do not express the two versions of their tail-fiber adhesins at the same time, but can adapt to another niche if one specific E. coli host is depleted or changes its expressed receptor. The switch is operated by a site-specific recombinase that inverts the C-terminal fragment of the tail fiber gene while leaving the N-terminus intact, which is required for binding of the side tail fiber to the tail [158, 163]. A close relative of P1, the defective prophage p15B, harbors an even more complex multiple inversion system that can create 240 different variants of the tail fiber gene through reassortment of the 5′ end of the gene. Interestingly, a tail-fiber-deficient P1 phage can be complemented by the p15B Min locus, which indicates that the Min locus encodes a functional tail fiber and also that it is capable of binding to the tail-fiber-less capsids of the above-mentioned P1 mutant [148]. T4, a strictly lytic coliphage of the T-even family, has its host specificity encoded within the N-terminal segment of gene gp37, which forms the distal portion of its side tail fibers and binds to receptors on the host surface, the OmpC porin [164]. In most other members of the T-even family, such as T6 or T2, the adhesin is separated from the distal tail fiber gene and is encoded right downstream of it in gene gp38 [146]. Such adhesins are composed of conserved N- and C-terminal domains required for binding to the tail fiber. The actual host recognition domain of both types of adhesins is composed of alternating highly variable regions separated by highly conserved glycine-rich spacers [165]. Interestingly, the duplication of the second variable domain of gp37 is sufficient to switch T4 from targeting E. coli to Yersinia pseudotuberculosis [166]. Moreover, phage T6 and T2 can be brought to 7.4 Bacteriophages: A Re-emerging Solution? ignore their normal host receptor, Tsx and OmpA, respectively, to recognize other surface proteins and different bacteria through exchange of their gp37-gp38 region with that of related phages recognizing those other surface markers [165–168]. In addition, Salmonella phage vB_SenM-S16 is able to infect E. coli when the latter expresses the Salmonella receptor of the phage, OmpCSTM , in lieu of the E. coli OmpC [169]. Another example demonstrating the importance of host adsorption in host range lies with the Salmonella phage SP6. SP6 shares most of its biology with coliphages of the T7 family. SP6 normally recognizes the Salmonella LPS through its six tail spikes encoded by gene gp46 but it has been shown to be infective of E. coli strains expressing Salmonella LPS after cloning of the Salmonella rfa (waa) locus into E. coli. SP6 could even be adapted to infect rough strains that only have the core lipid A and no side chains on their LPS. Inversely, coliphage T7 was shown by the same authors to be adaptable to rough Salmonella strains, indicating that host recognition and the ensuing DNA injection are major factors of host range limitation within the T7 family. Mutations that allowed these adaptations were located in the tail spikes of SP6, the nozzle gene (gp33), and other structural genes [170]. The gp33 nozzle gene is responsible for the synthesis of the spindle-like structure that is found at the very tip of the tail and comes into direct contact with the bacterium’s outer membrane [171]. These examples suggest that a major limitation to phage infection is host recognition and that when brought to recognize alternative receptors, phages can target different hosts. This capacity is being exploited by a French company, Pherecydes Pharma, which has devised high-throughput methods to generate T4 mutants that can infect a variety of Gram-negative hosts [172]. These systems could be, in principle, harvested to create synthetic phages with potentially wide host ranges. These phages could have their host ranges adjusted ad libitum by the precise replacement of the recognition elements that confer host specificity via genetic engineering. This capability could enable the transition from an empirical search for phages that can target a given pathogen to the rational design of phages with precisely engineered host ranges through synthetic biology. It may even be possible to build phages that differentiate between pathogenic and non-pathogenic variations of a bacterium, based on surface targets or DNA sequences. Another determinant of phage host range involves anti-phage systems carried by infected bacteria. The co-evolution of phages and bacteria has led to a continuous arms race wherein bacteria acquire defense mechanisms while phages develop countermeasures [150, 173]. Many anti-phage systems are carried by prophages or defective prophage remnants integrated into bacterial genomes and are generally described as superinfection exclusion (SIE) systems. Others appear to be bacterially evolved and are generally recognized as abortive infection (ABI) systems. Most of these systems prevent the spread of the phage infection by triggering some sort of altruistic suicide wherein the infected bacterium dies before the incoming phage has sufficient time to reproduce. Others may prevent phage DNA 127 128 7 Synthetic Biology and Therapies for Infectious Diseases injection by masking the phage receptors or via largely unknown mechanisms [150, 174, 175]. Phage resistance may also result from possession of a clustered regularly interspaced short palindromic repeats/CRISPR associated system (or CRISPR/Cas). Detected in nearly 40% of bacterial and 90% of archaeal sequenced genomes [176], these systems can mediate resistance to bacteriophages and other mobile genetic elements by catalyzing double-stranded breaks (DSBs) in incoming DNA. Although CRISPR/Cas modules display a rich, diverse phylogeny across bacterial species [177], they retain a common mechanism of action. Composed of short, palindromic, direct repeats separated by spacer sequences, the CRISPR locus encodes an immature non-coding RNA, called the pre-crRNA, which is processed into short crRNAs upon transcription. Each processed crRNA corresponds to a nucleotide spacer sequence which, with the aid of accessory proteins or RNAs, licenses the Cas endonuclease to cleave DNA sequences complementary to the spacer (protospacers). In order to distinguish between self and non-self-target sequences, protospacers must lie adjacent to a short, highly conserved and system-specific nucleotide motif, called a protospacer adjacent motif (PAM). Multiple lines of evidence support the role of CRISPR/Cas as an adaptive barrier of horizontal gene transfer. Bioinformatics analysis has revealed that the majority of spacer sequences display homology to bacteriophage genomes or mobile plasmids, and rarely to chromosomal elements [176]. In vitro experiments have directly demonstrated that the CRISPR/Cas system encodes sequence-specific resistance to phages and plasmids [178, 179] and can catalyze DSBs in cognate DNA sequences. Spacer addition and loss occurs in response to beneficial or deleterious mobile genetic elements circulating in microbial populations [180]. Although adoption of CRISPR loci remains poorly understood, two Cas accessory proteins, Cas1 and Cas2, are implicated in de novo acquisition of spacers in response to bacteriophage attack [181]. Moreover, protective CRISPR/Cas activity toward target sequences primes the gain of additional spacers derived from the same piece of DNA [181]. By evolving a rapidly adaptive immunity system, bacteria have developed an effective means to defend against continually changing viral threats. Outside of its natural setting, biological engineers have capitalized on the potential of CRISPR/Cas-based RNA-guided nucleases (RGNs) for a variety of applications. Most notably, the Type II CRISPR/Cas system from Streptococcus pyogenes has been engineered as a genome editing tool in bacteria [115], zebrafish [182], mice [183], and human cells [184–187], among many others. RGNs can generate targeted gene knockouts in complex eukaryotic genes by creating DSBs that are erroneously repaired by non-homologous end joining (NHEJ), leading to insertions and deletions that inactivate gene products. Moreover, RGNs can elicit specific chromosomal modifications as the DSBs promote homologous recombination between an editing template and its target. Unlike zinc-finger nucleases (ZFNs) and transcription-activator-like effector nucleases (TALENs) that rely on protein engineering, the target specificity of RGNs can be reprogrammed by simple modifications of the short spacer sequences [188]. 7.4 Bacteriophages: A Re-emerging Solution? Although the specificity of CRISPR/Cas is sufficient to mediate resistance against mobile genetic elements in prokaryotes, genome editing in human cells using RGNs also yields high frequency off-target effects, which may need to be addressed before it can find widespread use [189–192]. By inactivating the catalytic residues of the Cas nuclease, the CRISPR/Cas system has also been used to produce RNA-guided transcriptional regulators able to enact tunable activation or repression of target genes in bacteria, yeast, and mammalian cells [111, 193, 194]. Owing to the inherent multiplexibility of the CRISPR/Cas system, these custom transcription factors can be easily engineered to act at multiple loci and thus provide an effective method to implement synthetic gene networks and to study natural network dynamics by simultaneously perturbing multiple nodes. 7.4.3 Phage Genome Engineering for Enhanced Therapeutics The design of artificial phages to combat infectious diseases is currently limited by the difficulty of modifying phage genomes. Indeed, viral genomes are not engineerable while encapsidated and are thus often targeted during infection, which only lasts for a very short time, or in vitro after DNA extraction from the capsid if the genome is short enough (below about 50 kb) to be amenable to such manipulations. Moreover, there is a lack of information on the biology and function of many phage genes, especially for phages outside of those well-studied in the laboratory such as λ, T4, or T7. A conventional strategy for phage engineering involves cloning the region one wishes to modify into a high-copy-number plasmid, introducing the desired mutations in the cloned DNA fragment, infecting cells harboring the modified allele with a phage that may or may not have a counter-selectable mutation in the locus to modify, and screening the progeny for a virus carrying the desired modifications resulting from homologous recombination between the donor plasmid and the recipient phage [146, 168, 195]. This process is hampered by the fact that many regions of lytic phages are not clonable in their bacterial hosts because of toxicity and that many phages will degrade resident DNA on entry into a cell, including the plasmid(s) carrying the DNA to be introduced into the phage, thus resulting in very low recombination efficiencies. Finally, screening for modified progeny can be extremely time-intensive without selective markers for the introduced mutations or if the recombinant phage is nonviable or has a growth defect. Newly emerging strategies for genome engineering may accelerate the ability to improve the efficacy of phage therapeutics. As part of their effort to create the first fully synthetic bacterial genome, Gibson and colleagues [196] developed a whole toolkit for the cloning and modification of prokaryotic DNAs in the heterologous host Saccharomyces cerevisiae, where they are expected to be transcriptionally and translationally silent. This strategy was recently adapted for phage genome capture and redesign by Sample6 Technologies, a Boston-area startup company focused on engineering phages as rapid microbial diagnostics [27, 197]. By using 129 130 7 Synthetic Biology and Therapies for Infectious Diseases yeast as an orthogonal host for phage genomes, the issue of phage toxicity can be minimized. Furthermore, S. cerevisiae provides a robust platform for targeted genome engineering using highly efficient homologous recombination. Thus, this technique has the potential to enable the fast and precise generation of engineered phages for therapeutic and diagnostic applications. One example of a function that has been genetically introduced into phages to boost efficiency is the expression of biofilm-dispersing enzymes that help the phage to degrade biofilms. Using phage T7 and E. coli biofilms as a model, Lu and Collins [198] showed that engineering dispersin B expression into the T7 genome enhanced biofilm destruction by about 2 orders of magnitude compared with unmodified phages (Figure 7.7a). Moreover, gene expression dspB (1) T7DspB (2) (3) (4) (a) Antibiotics (3) lexA3 (1) (2) SOS response DNA damage (4) M13lexA3 Cell death (b) Figure 7.7 (a) Engineered T7 phage disrupts bacterial biofilms [198]. DspBexpressing T7 phage (T7DspB ) infects E. coli (1) and produces progeny T7DspB and DspB (2). Both phage and DspB are released by cell lysis (3). DspB degrades the biofilm, enabling phages to further penetrate into the biofilm and infect more bacterial cells (4). (b) Engineered M13 phage acts as adjuvant for antibiotic treatment against bacteria [201]. LexA3-expressing M13 phage (M13lexA3 ) infects E. coli (1) and produces LexA3 (2). LexA3 suppresses the SOS response (3), which is thus unable to repair DNA damage caused by antibiotics, leading to cell death (4). 7.4 Bacteriophages: A Re-emerging Solution? studies followed by network analysis can help identify genetic factors that can be delivered into bacteria via nonlytic phages to interrupt bacterial defense systems. For example, Dwyer et al. [199] and Kohanski et al. [200] showed that reactive oxygen species can be generated by bactericidal antibiotics, thus contributing to cell death. These reactive oxygen species are thought to trigger DNA damage and subsequent repair via the SOS response. To target this pathway, Lu and Collins [201] engineered nonlytic M13 phage to express lexA3, a non-inducible dominant negative version of the SOS regulator lexA, to prevent activation of the SOS response. This modified phage enhanced the efficacy of three major classes of co-administered antibiotics, that is, β-lactams, aminoglycosides, and fluoroquinolones, against E. coli (Figure 7.7b). These engineered phages could resensitize resistant bacteria to antibiotics, decrease the evolution of antibiotic resistance, and enhance the survival of infected mice when co-applied with antibiotics. Another group demonstrated an interesting strategy for using M13 phage to interfere with horizontal transfer through conjugation, a common dissemination pathway for plasmids carrying antibiotic resistance genes [202]. Lytic phages kill bacteria before actually lysing them and a primary function of lysis is to release progeny phages [203]. Lysis can potentially trigger complications during phage therapy, such as the sudden release of endotoxin and super-antigens. Such issues could be potentially avoided by engineering phages that do not lyse bacteria or that lyse bacteria more gradually. Recombinant replication-deficient phages, which are usually also lysis deficient, and recombinant lysis-deficientonly phages have been tested in several different experimental animal infection models, where despite the lack of phage multiplication, animals were protected against lethal bacterial infections [204–207]. These studies show that, at least in some settings, it is not necessary to completely eradicate the pathogen population and that simply decreasing its presence below a certain threshold is sufficient to allow the immune system to complete the process. Another strategy for decreasing phage virulence without completely abrogating its replication could be to adopt the approach of Mueller et al. [208] where key genes of poliovirus were systematically codon deoptimized so that protein synthesis would be slowed and the viral burst delayed or reduced, thus yielding attenuated viruses. The immunogenicity of phages leads to clearance by the reticuloendothelial system and potential reductions in therapeutic efficacy. Phage immunogenicity can be diminished in order to increase the therapeutic residence time and to limit the risk of treatment failure with repeated applications of the same (or a very related) phage in the same patient. By serially passaging bacteriophage λ and P22 through mice, Merril and coworkers [209] selected longer circulating phage mutants that displayed increased antibacterial activity. This approach was very time-consuming, but it is likely that through genetic engineering strategies enabled by synthetic biology and antigen prediction via reverse and structural vaccinology, the process of designing phages with lower immunogenicity could be simplified and expedited. 131 132 7 Synthetic Biology and Therapies for Infectious Diseases 7.4.4 Phages as Delivery Agents for Antibacterial Cargos Phages can be used to deliver DNA to recipient bacteria through several distinct routes. Lysogenic phages propagate their genomes in bacteria either as integrated DNA elements or as stable plasmids and, in turn, often confer their hosts with new functions such as phage resistance systems and/or virulence factors that can be essential for bacterial pathogenicity [150, 210, 211]. Another phage-mediated transfer system is transduction, whereby bacterial DNA is incidentally encapsulated instead of, or in addition to, viral DNA [212]. This DNA may then be delivered to recipient cells where it can recombine into bacterial genomes. Finally, phagemids, artificially created plasmids that harbor a phage packaging site, may be captured during phage infection, specifically incorporated into capsids in lieu of native phage DNA, and delivered to recipient cells via injection by phage particles [213, 214]. Applications of all of these methods of delivering DNA via phages can be found in the literature. For example, Edgar et al. [215] used an engineered version of the well-studied phage λ to lysogenize antibiotic-resistant recipient cells with mutated rpsL and gyrA genes by integrating wild-type versions of these genes. Spontaneous mutations in these genes can confer resistance to streptomycin and nalidixic acid, respectively, but the mutant gene products are recessive to the wild-type so that addition of the wild-type genes restores antibiotic sensitivity. In addition, the filamentous phage M13 can be engineered with standard molecular cloning methods and has a well-characterized packaging signal for targeting phagemids into the progeny phage [216, 217]. M13-packaged phagemids encoding addiction module toxins have been used to deliver and express these toxins in recipient cells to exert antimicrobial effects [218]. Furthermore, phage P1 has been used to transfer genomic markers between bacterial strains since the discovery of this property by Lennox in 1955 [219]. In the past decade, multiple studies have demonstrated the successful use of P1 phagemid vectors that can be packaged into P1 particles and delivered to a variety of Gram-negative organisms to transduce antibiotic markers or fluorescent reporters [214, 220]. The advantages of this strategy may be that DNA can be delivered without placing significant selective pressure on the recipient due to phage propagation and that concerns of phage biocontainment should be mitigated since phagemids themselves are not self-transmissible after delivery. A recent form of alternative therapy has been developed by Phico Therapeutics using inactivated phages to target various bacteria, whereby genes coding for small acid-soluble proteins (SASPs) are delivered to target bacteria via these phage-derived vehicles (SASPject™). These SASPs are DNA-coating enzymes, a desirable function for protecting endospore DNA but a lethal one for active vegetative cells [221]. Although commonly used to deliver genetic material into bacterial hosts for therapeutic purposes, phages can also be engineered to act as diagnostic agents or to target drugs and other molecules to specific recipients. As mentioned earlier, Sample6 Technologies is engineering phage cocktails that infect specific 7.5 Isolated Phage Parts as Antimicrobials microbial pathogens and deliver genes encoding reporter proteins that generate detectable signals, such as light, as surrogates for the presence of specific microbes [222]. Phage-based diagnostics can be both specific and sensitive if care is taken to engineer phages with desired host ranges and high-level reporter gene expression. Furthermore, a survey of M13 phage delivery in the contemporary literature reveals its frequent usage in targeting to eukaryotic cells by fusing the coat protein with peptides that exhibit binding to specific target cells [223]. This technique has been applied toward the treatment of cells infected by Chlamydia trachomatis. M13 phages, which display an integrin-binding peptide and a C. trachomatis-derived peptide, are actively endocytosed by human cells and interfere with propagation of the pathogen, probably by preventing or lowering the export of bacterial proteins that allow the pathogen to take control over its host [224]. In addition, bacteriophages native to S. aureus or filamentous phages engineered to bind to this pathogen have been used for targeted delivery of a photosensitizing chemical or a chloramphenicol prodrug to specified recipients. These engineered phages have been used to achieve lethal (and local) effects on activation of the payloads [225, 226]. Another possibility for the use of phage DNA delivery includes CRISPR-based systems for genome editing. In a striking example of host mimicry, the bacteriophage ICP1 encodes its own CRISPR/Cas system to prey on V. cholerae strains that possess a chromosomal phage defense locus [227]. The piracy of CRISPR/Cas as a predatory strategy suggests that a similar rationale can be used to synthetically engineer CRISPR/Cas-loaded phages to mediate sequence-specific killing of cells harboring antibiotic resistance or virulence determinants. 7.5 Isolated Phage Parts as Antimicrobials In addition to the use of engineered phages as antimicrobial or diagnostic agents, phage-derived parts may find utility in antimicrobial applications. The synthesis, expression, and optimization of such parts may be accelerated with synthetic biology tools for DNA synthesis, assembly, and mutagenesis. 7.5.1 Engineered Phage Lysins Lysins and holins are used by bacteriophages to digest the cell wall of their hosts and trigger their lysis. Different bacteria have different cell wall structures and phages have consequently evolved various types of lysins to cleave these structures. In Gram-positive bacteria, the cell wall is directly accessible to the external milieu and can be attacked by exogenous lysins. In Gram-negative bacteria, the outer membrane protects the cell wall. Gram-positive phage lysins are usually organized around two domains: the C-terminal domain is responsible for binding 133 134 7 Synthetic Biology and Therapies for Infectious Diseases and specificity by anchoring the lysin to specific cell wall moieties before activating the catalytic N-terminal domain [228]. Lysin activity is tightly controlled to avoid early lysis and damage to surrounding cells that the released phage may subsequently prey upon. For example, the enzymatic activity of Gram-positive lysins is only activated once the binding domain has anchored itself to the peptidoglycan. Gram-negative lysins are regulated by their release into the periplasmic space by holins. Synergy between different lysins and between lysins and antibiotics may delay the evolution of resistance [229–232]. Several companies are pursuing engineered lysin-based technologies, including Gangagen and Contrafect, as novel antimicrobial agents. The modularity of Gram-positive phage lysins allows one to target specific bacteria by engineering the binding domain and the nature of the bond to be cut through the enzymatic domain. As a proof of concept, Diaz and colleagues [233] swapped the catalytic domain of a streptococcal lysin, allowing it to keep its recognition specificity, but changing the cell-wall degradation mechanism. Fueled by the ever-cheaper cost of DNA synthesis and enhanced genetic engineering techniques, this approach is being applied to create new types of lysins that perform better than natural ones in terms of bactericidal properties and/or pathogen coverage [232, 234–236]. For example, a hybrid lysin made with the catalytic enzyme of the Twort phage and the binding domain of phiNM3 lysin was easier to produce than either of the two original lysins and also had elevated activity against its target, MRSA [232]. As mentioned above, a major hurdle for the use of lysins to treat Gramnegative bacteria is the inaccessibility of the cell wall to external agents due to the presence of the outer membrane. However, Lukacik et al. [237] recently succeeded in designing synthetic phage lysins that efficiently target Gramnegative bacteria by fusing a lysin to outer membrane transport signals from bacteriocins. Bacteriocins are small proteinaceous molecules that are synthesized by a wide variety of bacteria to control the population of other prokaryotes present in their environment. Bacteriocin import into target cells is dependent on the recognition of specific receptors, and producing strains are immune to their own bacteriocins through the production of inactivating antidotes [238]. For example, the FyuA outer membrane protein is a virulence-related iron transporter found in some strains of Yersinia and E. coli, which is specifically recognized by the Yersinia bacteriocin pesticin [239, 240], leading to its uptake into the bacterium’s periplasm. The FyuA protein is a useful target considering its strong association with pathogenic bacteria [240] and relative absence from non-pathogenic microbes. This bacteriocin was fused to the cell-wall-degrading lysozyme of phage T4 based on 3D-structural analyses to ensure that the fusion would not impair receptor recognition or lysozyme function (Figure 7.8). The resulting protein efficiently killed FyuA-displaying Gram-negative bacteria [237]. This strategy could, in principle, be reproduced with other bacteriocin receptors for specific applications against Gram-negative pathogens. 7.5 Conserved FyuA binding domain Figure 7.8 Structural alignment of the wildtype Yersinia toxin pesticin (pink) and the first anti-Gram-negative engineered lysin (blue). By keeping the receptor-binding domain of pesticin and fusing it to the cell-wall degrading lysozyme of phage T4, Lucacik and his colleagues created a antimicrobial molecule that specifically recognizes FuyA expressing cells and lyses them independently of whether those cells are Isolated Phage Parts as Antimicrobials Variable toxin domain sensitive to the original toxin pesticin. This structural alignment was done using the Vector Alignment Search Tool (VAST) server on the NCBI website and visualized using Cn3D software [241] and highlights the conservation of the recognition domain and the variability of the catalytic domain. (Reference [417] Reproduced with permission. Copyright © 2007 Elsevier.) 7.5.2 Pyocins: Deadly Phage Tails Many pseudomonads are bactericidal to other Pseudomonas strains. Upon stress conditions, such as starvation or DNA damage, pseudomonads can release phagetail-like particles called pyocins that can kill susceptible pseudomonads by depolarization of their membrane potential. Pyocins belong to two families depending on their morphology. Those that appear to have contractile sheaths belong to the R-type family while those that resemble flexible phage tails belong to the S-type family [242]. In both cases, bactericidal activity is dependent on specific recognition of an outer membrane receptor by the pyocin, thus limiting host range. Exchange of the host recognition domain located at the tip of the tail fibers has permitted rerouting of R-pyocins from their usual hosts toward various E. coli strains [243–246]. As myophages having similar tails to R-pyocins are widespread in nature, it is conceivable to create synthetic pyocins targeting virtually any Gramnegative species. In addition, pyocins have recently been discovered in the Grampositive bacterium C. difficile, which suggests that their scope of action may be even further broadened via genetic engineering [247]. 135 136 7 Synthetic Biology and Therapies for Infectious Diseases 7.5.3 Untapped Reservoirs of Antibacterial Activity With phages outnumbering bacteria by a factor of 10 or more [248] and most new phage genomes showing a majority of genes with no known homologs in databases, it is likely that the vast wealth of phage biology still has much to teach us about killing bacteria. From the highly limited sample of phages that have been heavily studied, it is already clear there is a plethora of ways to appropriate host cell resources. As an example, coliphage T4 encodes proteins that digest bacterial DNA for selfish reuse (e.g., ndd, various restriction endonucleases) and others that stop host transcription and redirect transcription toward its own genes (e.g., alc, asiA, motA, etc.). Moreover, some of its early promoters are so strong that they are capable of sequestering RNA polymerase away from bacterial use. All of those functions are orchestrated to lead to bacterial death within minutes of infection [249]. In addition, T4 [250] as well as other phages such as phiEco32 [251] and phiEcoM-GJ1 [252] may encode their own sigma factors that can efficiently compete with endogenous host sigma factors to redirect the host transcription machinery onto phage genomes. Finally, other phages free themselves from many host requirements by encoding their own RNA polymerases and other important functions. Examples include coliphage T7 [253], Xanthomonas phage XP10 [254], Pseudomonas phage phiKMV [255], and their many relatives. Detailed screens for phage genes with antimicrobial activity are being performed by academic and industrial laboratories in the hope of discovering new bioactive compounds or killing mechanisms that could be exploited in the fight against pathogens with multidrug resistance. These efforts can be accelerated through cheaper and more rapid gene synthesis and expression technologies. 7.6 Predatory Bacteria and Probiotic Bacterial Therapy New genetic engineering technologies and strategies are not only accelerating phage-based antimicrobials, but are also setting the stage for an entirely novel class of anti-infectives in the form of cell-based therapeutics [256]. For example, some bacteria have evolved to prey on other bacteria, either exclusively or facultatively, for growth. The most widely studied group of such predatory bacteria is composed Gram-negative prokaryotes that share three features: a curved rod morphology, small size, and the predatory lifestyle. These are collectively referred to as Bdellovibrio and like organisms (BALO) [257, 258]. BALO are motile bacteria that swim, invade the periplasm, or attach to the surface of their prey, and reproduce at the expense of the infected bacteria, producing fewer than five progeny BALO per infection [259]. Most BALO are promiscuous and will readily prey on any Gram-negative bacterium. Their wide bactericidal activity and their ubiquity in the environment [260, 261] and the human gut [262] have 7.6 Predatory Bacteria and Probiotic Bacterial Therapy led to interest in their potential use as therapeutics [263], and small-animal trials have yielded promising results [264, 265]. However, very little is known about how BALO bacteria regulate predation, with concerns over their ability to indiscriminately prey on both pathogenic and commensal bacteria. In time, it may be possible to engineer more stringent prey specificity, but technologies to manipulate their genomes and study their biology are just emerging [266]. Moreover, the very high hydrolase content of BALO may also present opportunities for the development of bactericidal compounds [267]. In addition to BALO, probiotic bacteria are being explored for their antimicrobial and immunomodulatory properties. Probiotic efficacy has been studied in various applications such as the treatment and prevention of allergies [268], C. difficile colitis [269], inflammatory bowel diseases [270, 271], shigellosis or salmonellosis [272–274], and even complex metabolic diseases such as diabetes, metabolic syndrome, or obesity [275]. Moreover, consumption of Lactobacillus rhamnosus GG has been shown to be effective at eliminating vancomycin-resistant Enterococci (VRE) from the gastrointestinal tract of colonized children [276]. However, the literature on probiotics studies have yielded irregular and conflicting results, which may be due to factors such as heterogeneity in probiotic strains, preparations, and delivery methods; thus, stronger standards and regulations around the use and marketing of probiotic bacteria are likely needed to ensure reproducible, safe, and efficacious use [268, 277, 278]. Although these natural probiotic therapies have demonstrated promise in the treatment of bacterial infections, biological engineering can potentially further augment the efficacy of probiotics. An application of our growing understanding of interbacterial communication and its potentiation by synthetic biology can be found in the work of Duan and colleagues [279], who developed a probiotic strain that can decrease V. cholerae virulence in a murine model of infection by targeting its quorum-sensing-based signaling pathways. Quorum sensing refers to a process through which bacteria modulate gene expression in response to a critical concentration of self-produced autoinducer (AI) molecules in the environment [280]. Quorum sensing has been described as a social behavior in bacteria in which populations undergo concerted changes in gene expression to produce gene products that are only beneficial at high cell densities [280]. For example, the marine bacterium Vibrio fischeri employs a quorum-sensing mechanism to only achieve bioluminescence at high cell densities in the light organ of its symbiotic host, but not when free-living in the ocean [281]. Similarly, P. aeruginosa uses quorum-sensing circuits to control the expression of virulence factors, such as extracellular proteases and phenazine pigments, which promote infection [281]. This population-level coordination of gene expression ensures that individual cells will not incur a strong metabolic cost for gene products that are only valuable at high cell concentrations. In V. cholerae, the expression of virulence genes, such as cholera toxin and the toxin co-regulated pilus, is repressed in the presence of two autoinducers, AI-2 and cholera autoinducer 1 (CAI-1). Thus, Duan and colleagues engineered the probiotic E. coli Nissle 1917, already a native producer of AI-2, to constitutively express and secrete CAI-1 to molecularly confuse virulence 137 138 7 Synthetic Biology and Therapies for Infectious Diseases (2) (3) CqsS CAI-1 (4) (1) Signal transduction (5) cqsA Engineered E. coli Figure 7.9 Engineered probiotic E. coli prevents cholera infection in infant mice [279]. Engineered E. coli carrying cqsA produces cholera autoinducer 1 (CAI-1) (1), and secretes it into the environment (2). At high cell densities, the CAI-1 concentration is Virulence expression V. cholerae sufficiently elevated to permit binding and inhibition of its cognate sensor kinase, CqsS, in V. cholerae (3). CqsS inactivation triggers a signal transduction cascade (4) that leads to the repression of virulence genes (5). gene regulation in V. cholerae (Figure 7.9). Pre-treatment of mice with the modified probiotic increased survival by 92% and decreased cholera toxin binding to the mouse intestine by 80%. As this type of therapy targets a component of virulence as opposed to a core component of bacterial physiology, one would expect that resistance would emerge at a much slower rate than conventional chemical antibiotics. This work serves as an illustrative example of using synthetic biology to rationally design probiotic bacteria that can defend against infectious disease. As discussed above, a myriad of quorum-sensing mechanisms have been described in a wide range of bacterial species [281], with each quorum-sensing molecule often acting as a molecular signature of a particular species of microorganism. Using these signatures, both Saeidi et al. [282] and Gupta et al. [283] developed “sentinel cells” able to sense and destroy P. aeruginosa in vitro. LasR, a transcription factor that responds to an acyl-homoserine lactone quorumsensing molecule produced specifically by P. aeruginosa, was introduced into E. coli such that the presence of the pathogen would elicit gene expression of a toxic bacteriocin and a lysis protein. At a critical intracellular concentration of the lysis protein, the E. coli chassis would burst open, releasing pyocin and killing P. aeruginosa. This engineered system could mediate a 100-fold reduction in P. aeruginosa cell numbers in planktonic cultures and could prevent biofilm formation by nearly 90%. Further work demonstrated that sentinel cells could be engineered to actively migrate toward P. aeruginosa biofilms and secrete antimicrobial peptides and DNases to elicit cell killing and biofilm disassembly [284]. These E. coli sentinels lay the groundwork for the development of more sophisticated synthetic “immune cells” that may be able to integrate and compute additional environment cues and eradicate a wider range of pathogens. Further use of synthetic gene circuits that can implement integrated logic and memory or perform wide-dynamic-range analog biosensing could enhance the sense-and-response capabilities of these systems [285–288]. 7.7 Natural Products Discovery and Engineering An exciting extension of probiotic therapy is the prospect of microbiota engineering with the tools of synthetic biology. The potential of this approach is inspired by encouraging results from microbiome transplantation, the practice of colonizing a diseased individual with the microbiome from a healthy donor, which has shown promise in the treatment of recurrent C. difficile infections [289]. Although the mysteries of the human microbiome are only starting to be uncovered [290], we expect that synthetic biology strategies for manipulating the human microbiota in a precise and controlled manner may open up exciting new applications in the decades to come. To achieve this promise, new tools for additive and subtractive manipulation of complex microbial communities at the level of bacteria and their constituent genes are needed. 7.7 Natural Products Discovery and Engineering Many clinically relevant molecules are of natural origin, meaning they are produced by living organisms, such as bacteria, fungi, and plants [291]. Antibiotic discovery has been dominated by microbially secreted molecules since the discovery of penicillin in 1928 [292]. Sir Alexander Fleming observed that microorganisms could produce molecules that kill or inhibit growth of their counterparts. The realization that these molecules could treat infections led to Fleming, Ernst Chain, and Sir Howard Florey receiving the Nobel Prize in Physiology [293, 294]. Bacteria have dominated the study of antimicrobial production, especially soil-dwelling isolates belonging to the Streptomyces genus. Given the success with Streptomyces spp., many efforts have been made to find novel natural products from microorganisms that can act as antimicrobials [295–297]. Below, we describe extensive efforts to accelerate the discovery and modification of natural products through computational and genetic engineering strategies. These efforts can further leverage the tools of synthetic biology to accelerate the construction, expression, and optimization of new natural product pathways [298, 299], as discussed in greater detail in the following sections. Actinomycetales is an order of Gram-positive bacteria that includes the genus Streptomyces and is among the most prolific sources of natural products. Actinomycetales have yielded about 3000 antibiotics as well as antitumor, antiparasitic, antiviral, and immunosuppressant drugs [291, 300]. These molecules, which include non-ribosomal peptides (NRPs), polyketides (PKs), and hybrids of both, do not result from direct ribosomal translation. Instead, very large enzymatic complexes, called nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), assemble complete natural-product molecules by selecting, uploading, and modifying particular precursors, namely, aryl and amino acids (for NRPs) and acetyl/malonyl/methylmalonyl-CoA (for PKs) [301–304]. NRPS and PKS are modular: each module is usually capable of selecting and loading unit to the nascent molecule by specific domains [301, 302]. Specialized domains 139 140 7 Synthetic Biology and Therapies for Infectious Diseases also allow for additional structure modifications and release of the molecule from the enzymatic machinery [301–304]. In the assembly of NRPs, the monomer to be incorporated into the growing molecule is selected by the adenylation domain. This domain contains a specific amino acid signature that determines the aryl or amino acid to be incorporated, which is subsequently transferred to the downstream thiolation domain. The thiolation domain is characterized by containing a thiol group, to which monomers or the growing molecule is attached. When additional units are incorporated, an amide bond is formed between the aminoacyl group of a downstream unit and the peptidyl group of the upstream one. This step is catalyzed by the condensation domain [301, 303]. For NRPSs, the core domains for chain elongation are the condensation, adenylation, and thiolation domains, forming the most basic module. The first module – initiation module – is traditionally a two-domain module consisting of an adenylation and thiolation domain, as no condensation reaction is required for the first module. Termination of chain elongation is carried out by a thioesterase domain. This domain catalyzes the release of the molecule from the enzymatic machinery [301, 303]. The assembly of PKs shares the logic with the assembly of NRPs. Here, the three core PKS domains for chain elongation have homologous functions with those of the NRPSs: the acyltransferase is responsible for selecting the unit to be incorporated (either malonyl or methylmalonyl-CoA). Also, a thiolation domain provides the thiol group for unit and growing chain attachment. C–C bond formation in PKs is catalyzed by the ketosynthase domain [301, 302, 304]. Chain translocation across NRPS–PKSs and PKS–NRPSs can occur, thus resulting in hybrid PK–NRP molecules [301, 302]. We refer the interested reader to extended reviews on NRPS and PKS biochemistry [301–304]. 7.7.1 In Silico and In Vitro Genome Mining for Natural Products With the rapid development of next-generation DNA sequencing technologies, the cost for full genome sequencing has plummeted. This has enabled natural product scientists to collect a wealth of informatics data, mostly freely accessible from the National Center for Biotechnology Information (NCBI), that can be screened for gene clusters predicted to biosynthesize natural products [305]. Nonetheless, it is important to highlight that, despite the presence of biosynthetic genes, one cannot directly assume that these genes are active. In some cases, biosynthetic clusters are expressed only under very specific conditions or not at all (cryptic/silent clusters) [295, 296, 306]. Software algorithms, which specifically search for subregions of genes that will be translated into catalytic domains, can be used to determine whether a certain microorganism might be able to produce an NRP or PK. These domains determine enzymatic activity and can be used to predict the type, and sometimes even the structure, of the molecule that will be generated (Figure 7.10). Examples of these software tools include the following: 7.7 Natural Products Discovery and Engineering DNA Predicted protein domains Predicted precursors Predicted molecule (a) DNA Predicted protein domains Predicted precursors P P Precursor labeling Labeled molecule P (b) Figure 7.10 In silico genome mining allows for fast and less laborious screening of large sets of genomic data for the potential capacity to produce natural products. (a) Software algorithms can be used to predict the protein coded by a gene and even the structure of the final natural product. (b) These predictions can be confirmed by feeding a labeled presumed precursor and tracing its incorporation into molecules, a process that can culminate with the identification of the natural product. • ClustScan (cluster scanner) allows for a quick scan of genomes in the search for DNA sequences encoding NRPSs and PKSs. It offers additional tools for genome annotation and displays e-values, protein alignments, and both nucleotide and amino acid coordinates for the regions of interest detected. Another useful feature of this software is the prediction of possible structures for the molecules encoded by the identified clusters. It uses a simplified molecular-input line-entry system (SMILES) that enables the description of chemical nomenclature as well as the structure of a given molecule. It can be converted into two-dimensional and three-dimensional structures using 141 142 7 Synthetic Biology and Therapies for Infectious Diseases appropriate software freely available online. ClustScan is available for download at http://bioserv.pbf.hr/cms [307]. • NP.Searcher (natural products searcher) is a web-based software that predicts the structure of natural products from the analysis of input data (full or partial genome sequences, in FASTA format). It then produces SMILEs that can be translated into a structure using other available SMILE converter tools. NP.Searcher can be found at http://dna.sherman.lsi.umich.edu [308]. • antiSMASH (antibiotics and secondary metabolite analysis shell) is a webbased software that allows for full-genome analysis of clusters for a wide range of molecules: PKs, NRPs, aminoglycosides, beta-lactams, aminocoumarins, butyrolactones, siderophores, indolocarbazoles, terpenes, bacteriocins, lantibiotics, nucleosides, and melanins, among others. This tool also reports on the similarity of clusters within the sequence under analysis with fully characterized and available sequences of clusters for other known molecules. In addition, one can click on ORFs and automatically submit the corresponding amino acid sequence for a blast alignment at NCBI. antiSMASH can be found at http://antismash.secondarymetabolites.org [309]. Despite the utility of the aforementioned tools, careful annotation of catalytic units often requires the use of additional databases. These allow for more thorough and precise mining, prediction and annotation of protein domains. Some of the most thorough and reliable are: Web-CD search tool – http://www.ncbi.nlm.nih.gov/Structure/bwrpsb/bwrpsb.cgi [310–312], SMART – http://www.ebi.ac.uk/interpro [313, 314], NRPSpredictor – http://ab. inf.uni-tuebingen.de/software/NRPSpredictor [315], NRPSpredictor2 – http:// nrps.informatik.uni-tuebingen.de/Controller?cmd=SubmitJob [316], PKS/NRPS analysis website – http://nrps.igs.umaryland.edu/nrps [317], and SBSPKS – http://www.nii.ac.in/∼pksdb/sbspks/master.html [318]. With these tools, it is possible to glean important information on the structural and physiochemical characteristics of predicted products, which can help design targeted isolation procedures [307, 319, 320]. Any such information is useful, considering the cumbersome task of purifying metabolic products [305, 321]. Predictions made by these bioinformatics tools are usually validated with in vivo and/or in vitro experimentation. One experimental approach to the identification of molecules originating from a given cluster is the genomisotopic approach, which involves feeding stable-isotope-labeled predicted precursors to the producing organism [305, 322]. If incorporated as predicted, the resulting molecule is immediately labeled, facilitating its identification within the complex mixture of molecules and thus the subsequent purification of the natural product of interest. Other authors [323] have devised peptidogenomic methods using massspectrometry (MS)-guided methods that connect the chemotypes of peptidic natural products to the biosynthetic gene cluster, following the biosynthetic logic of NRPs [323, 324]. In silico genome screening for natural products is relatively straightforward using existing tools, but it is limited to microorganisms whose genomes are 7.7 Natural Products Discovery and Engineering TTCGTAATGCTAGCTATGCCT ACCCTTAGTCTATTGAAAGG CCCTAAGCCCTAGATCGATAA CTCGGATAAATGCCTGCTATC AAATGCTCCCTGGCTCGCTCT AGAAATCGCTACTTAGATTTC (b) (a) P (c) Figure 7.11 Strategies used for wholegenome mining in the search for naturalproduct-encoding gene clusters: (a) in silico genome mining, using algorithms that specifically search for natural product-related enzymes; (b) high-throughput phage display of phosphopantetheinyl transferases; and (c) in vitro screening of natural-productrelated genes by degenerate primers and DNA probes. sequenced. This limits the number and diversity of genomes that can be explored, especially if one takes into account that the number of genome sequences available is an extremely small fraction of the microorganisms in nature. According to the Joint Genome Institute (US Department of Energy), more than 4300 genomes belonging to the bacteria, eukarya, and archaea domains have been fully sequenced so far, and over 12 000 other sequencing projects are in progress [325]. Yet, this is a very small proportion of the ∼500 000 species of bacteria predicted to exist [326]. Complementary technologies for genome mining have been developed, including high-throughput in vitro strategies (Figure 7.11a). For example, Yin et al. [327] performed high-throughput mining of bacterial genomes with a phage display strategy. This study leveraged Sfp, a protein with phosphopantetheinyl transferase activity, which is crucial for the activation of NRPS and PKS carrier proteins. This enzyme was used to biotinylate carrier proteins expressed from genome fragments, which were fused to a phagecoat-protein gene. The biotinylated phages were subsequently enriched and the proteins/genes from NRPS/PKS clusters were then sequenced. Using this technique, one can perform high-throughput screens for isolates that have been sequenced as well as for entire communities of microorganisms, including those considered unculturable (Figure 7.11b) [322, 327]. An alternative technique for the detection of NRP/PK-related biosynthetic genes is the use of labeled DNA probes and Southern blotting. The labeled probe, if designed to hybridize with a region of genes coding for natural products, will hybridize with homologous regions within the sample. Schirmer and colleagues 143 144 7 Synthetic Biology and Therapies for Infectious Diseases [328–330] designed ketosynthase probes to search at low stringency for PKS genes within metagenomic libraries containing over 4 Gb of bacterial genomes obtained from samples of marine sponges; others have performed studies using a similar approach. Similarly, sets of degenerate PCR primers can be used to screen for the presence of NRP/PK biosynthetic clusters, expressed or cryptic, in metagenomic libraries and/or microbial isolates (Figure 7.11c) [331–334]. DNA sequence availability opens a whole range of opportunities for the discovery of novel, bioactive, and natural products. In the absence of genome sequences, diversity is generated through the screening of organisms for the production of novel molecules. DNA sequence availability and new DNA synthesis technologies afford researchers the ability to synthesize parts and pieces that can be altered, combined, and swapped to generate unnatural diversity. Furthermore, knowing the genetic makeup of a biosynthetic pathway and understanding how the pathway cooperates to generate a known molecule can help researchers create optimal or novel synthetic pathways through combinatorial and rational design [320, 335–341]. 7.7.2 Strain Engineering for Natural Products There are several reasons why one would choose a heterologous host, rather than the native producer, for the expression of genes, operons, or clusters, with a major factor being genetic tractability. For model organisms such as E. coli, Arabidopsis thaliana, and S. cerevisiae, an incredibly wide range of genetic tools has been developed over the years that enable the facile engineering of their genomes [342, 343]. Yet, the same cannot be said for other organisms, in which routine protocols used in model organisms are often difficult or even impossible. When engineering pathways and/or overexpressing molecules, the use of well-characterized hosts allows for a better understanding of the behavior of interest, enhanced abilities to manipulate strains or pathways and perhaps the capability to achieve higher titers of the target molecule [344, 345]. Another reason involves growth conditions and speed. For example, although the diversity of molecules that are produced by Streptomyces spp. remains unmatched by any other known genus, cell growth is slow and the production of target molecules is generally dependent on medium composition [321, 346]. The existence of transcriptional repressors and/or unactivated activators can limit the titer of a given molecule in its native host. By transferring the pathway of interest to a heterologous host, one can eliminate unknown regulation and place the biosynthetic pathway under control of inducible or constitutive promoters, thus transferring control of expression over to the researcher [347, 348]. Reengineering pathways involved in the biosynthesis of natural products might, at first, seem a relatively easy undertaking from a technical standpoint. Yet, the issues faced by synthetic biologists in assembling novel pathways include challenges associated with manipulating large DNA fragments, dealing with downstream issues such as ensuring precursor flux, and deciphering the 7.7 Natural Products Discovery and Engineering grammar underlying the assembly of proteins and domains to achieve proper molecular synthesis. Although natural products are small, the proteins involved in their assembly are particularly large, varying between 200 and 2000 kDa [323, 349]. For example, cyclosporin synthase is a 1.7 MDa enzyme catalyzing 40 different reaction steps to synthesize the immunosuppressant cyclosporin from precursors. This enzyme is encoded by a mega-gene, spanning 45 800 bp of DNA [350]. Thus, the heterologous expression and rational reprogramming of natural pathways often result in the challenging cloning and manipulation of synthetic genes [338]. Fortunately, advances in DNA synthesis and assembly techniques (e.g., Gibson, Golden Gate, and other assembly strategies) may provide the ability to tackle these DNA construction challenges [351, 352]. Despite these potential advantages, heterologous hosts can also be limited by differences in precursor availability, challenges in achieving optimal levels of gene expression with synthetic regulation, and variations in codon usage and post-translational modifications [346, 353, 354]. Given the diversity of genes involved in the biosynthesis of natural products that display clinically relevant activities, engineered combinations of these clusters might produce functional, novel molecules. For example, the replacement of a gene from the antitumoral drug echinomycin with one from the poorly characterized SW-163 compound resulted in the novel NRPS, ecolimycin. Although this hybrid pathway was originally from Streptomyces spp., it was completely and successfully engineered in E. coli [355]. When constructing synthetic pathways in heterologous hosts, it is important to keep in mind that precursors may be lacking or that regulatory mechanisms need to be fine-tuned. These factors can result in pathway imbalances that result in low product titers; thus, computational and experimental approaches have been employed to circumvent these challenges [356]. Below, we discuss several examples where natural product pathways have been engineered within heterologous hosts as well as their native hosts using the tools of genetic engineering and synthetic biology. 7.7.2.1 Production of the Antimalarial Artemisinin Every year, the insect-borne malarial disease caused by the Plasmodium parasite sp. infects over 200 million new people [357]. Malaria is particularly severe in poor, developing countries and mostly affects children under 5 years of age who lack adequate immunity [357, 358]. Aggravating this issue is the fact that the commonly used drugs for malaria, chloroquine and sulfadoxine-pyrimethamine, are now mostly ineffective, as the most important etiologic agents, P. falciparum and P. vivax, have developed resistance. Currently, the World Health Organization (WHO) advises the use of artemisinin and derivatives, in combination with schizontocidal drugs (artemisinin-based combination therapies, ACTs) as efficient therapies with reduced probabilities for evolving resistance [344, 359]. However, in 2007–2008, only 15% of infected children under the age of 5 with malarial fever actually received ACT treatment [357]. Artemisinin is a sesquiterpene lactone peroxide naturally produced by the shrub Artemisia annua. There is a scarcity of this molecule, with prices fluctuating with 145 146 7 Synthetic Biology and Therapies for Infectious Diseases variations in supply – for example, its price shifted from $350 kg−1 to as much as $1000 kg−1 in 2004. Despite the potential to chemically synthesize this natural molecule, the complexity of the process, aggravated by low yield, has discouraged production in vitro [357, 360]. An early approach to increase artemisinin availability was to cultivate the shrub and extract the active ingredient. In China and Vietnam alone, there was a approximately sevenfold increase in the number of companies extracting artemisinin [360]. Yet, considering the massive number of new patients every year and the need for low cost production, synthetic biologists have worked to direct the artemisinin production pathway from A. annua to heterologous hosts, such as bacteria and yeast. The ability to use industrial-scale fermentation for the growth of an artemisinin-producing organism would allow for large quantities of an active pharmaceutical ingredient (API) to be produced in a short period of time [358, 360, 361]. The Keasling group undertook the challenge of developing a yeast-based platform for the production of artemisinin through a low-cost fermentation method, in collaboration with Amyris Biotechnologies and the Institute for OneWorld Health and with funding from the Bill and Melinda Gates Foundation [344, 357, 358]. The strategy was to engineer the artemisinin production pathway in S. cerevisiae for the generation of precursors all the way up to artemisinic acid. This engineering endeavor involved three steps: 1) Engineering the farnesyl pyrophosphate biosynthetic pathway – in this pathway, the production of farnesyl pyrophosphate is upregulated and its conversion to the unwanted sterols downregulated. 2) Cloning of the amorphadiene synthase (ADS) gene from A. annua – this enabled the heterologous host with the capacity to convert farnesyl pyrophosphate to amorphadiene, a step required for artemisinin production. Amorphadiene production was further increased by the overexpression of a truncated and soluble 3-hydroxy-3-methylglutaryl-coenzyme A reductase. 3) Cloning the gene for a novel cytochrome P450 capable of converting amorphadiene to artemisinic acid through a three-step oxidation reaction. This is one of the most important enzymes involved in the production of natural products by plants [361]. The adjustments performed on this heterologous host allowed for a large increase in amorphadiene production, rising from 370 μg l−1 to 153 mg l−1 . The artemisinic acid recovery rate reached 96% from the cell pellet via alkaline buffer washing [344, 362]. Additional advantages of this production method are that it is relatively environmentally friendly (no additional terpenes produced, contrary to plant hosts) and that its production depends solely on the fermentation capacities of an engineered facility rather than being dependent on climatic variations [344]. In 2012, Westfall et al. [357] described S. cerevisiae-based processes for the production of amorphadiene, a precursor to artemisinic acid. Production levels above 40 g l−1 were achieved, which was a considerable increase from the 0.5 g l−1 achieved previously in the bacterial host (E. coli) and 153 mg l−1 in yeast. The subsequent step converting this molecule to dihydroartemisinic acid was also engineered [357, 363]. Yet another yeast strain was engineered for the production 7.7 Natural Products Discovery and Engineering of the artemisinin precursor artemisinic acid by building a construct expressing three plant genes involved in this process: ADS, amorphadiene oxidase, and cytochrome P450 reductase. Together, these genes have the capability to channel carbon flux from farnesyl diphosphate to the artemisinin pathway, resulting in titers of 1 g l−1 of artemisinic acid [364–366]. 7.7.2.2 Daptomycin (Cubicin) Daptomycin is a potent U.S. FDA-approved lipopeptide antibiotic naturally produced by Streptomyces roseosporus. Used in the treatment of skin and skin structure infections, this NRP targets both the cell wall and membrane, acting as a cationic dipeptide in Gram-positive bacteria [367, 368]. Daptomycin’s fermentation process depends highly on the precursor feed into the bioreactor. Lipid removal from the medium leads to the production of a family of lipoproteins (A21978C) by S. roseosporus, which vary in their N-terminal fatty acid chain [367, 369]. By adding decanoic acid during the fermentation process, biosynthesis can be directed toward the production of daptomycin. Attempts have also been made at improving the yields of daptomycin production by expressing daptomycin biosynthetic genes in heterologous hosts. Yet, results so far have not reached a high level or even the same levels as the natural producer strains, thus requiring additional engineering. For example, Streptomyces lividans has been used for chromosomal and extrachromosomal expression of these genes under the control of a constitutive strong Streptomyces promoter, ermE*p [369]. Engineered S. lividans produced 10 mg l−1 daptomycin, which was lower than the native S. roseosporus host, where it varies from 150 mg l−1 to 1 g l−1 . By deletion of the biosynthetic cluster coding for the benzoisochromanequinone polyketide antibiotic actinorhodin and adjustment of growth medium composition, production levels rose to 55 mg l−1 [367, 369]. Additional engineering is still required to achieve yields comparable to those obtained by native lipopeptide expression. Interestingly, novel compounds with increased structural diversity and activity spectra were also generated by genetically engineering Streptomyces fradiae clusters for daptomycin and the related A54145 molecule, also a lipopeptide antibiotic [370, 371]. 7.7.2.3 Echinomycin Echinomycin is a quinoxaline antibiotic that contains quinoxaline chromophores attached to the depsipeptide core structure and displays potent antibacterial, anticancer, and antiviral activities [372]. It has been isolated from an assortment of bacteria, namely, Streptomyces lasaliensis and Streptomyces echinatus [373–375]. Upon discovery of the gene cluster responsible for the biosynthesis of this molecule within a linear plasmid in S. lasaliensis, successful attempts were made to overexpress it in E. coli, at a concentration of 0.6 mg l−1 [372]. Levels as high as 126 mg l−1 of echinomycin have been reported, upon medium optimization [375]. 147 148 7 Synthetic Biology and Therapies for Infectious Diseases The endeavor to express echinomycin in E. coli involved the construction of a synthetic cluster derived from the original echinomycin one. The cluster was separated into three plasmids comprising 15 genes from S. lasaliensis and sfp, which encodes an acyl carrier protein (ACP) activator, from Bacillus subtilis. Each gene was given a dedicated T7 promoter, ribosome-binding site, and T7 transcriptional terminator. Moreover, by removing a single gene from this multi-plasmid and multi-monocistronic synthetic pathway, it was possible to convert echinomycin to the antitumor agent triostin A [372]. 7.7.2.4 Clavulanic Acid β-lactam antibiotics contain a lactam ring and can be used to treat Gram-positive and Gram-negative bacteria by targeting bacterial cell wall biosynthetic enzymes, called penicillin-binding proteins (PBPs). This class, which includes penicillins, cephalosporins, carbapenems, and others, represents over 65% of the antibiotic market owing to its high effectiveness, low cost, and minimal side effects [376, 377]. However, some groups of antibiotic-resistant bacteria produce β-lactamases, which specifically inactivate these molecules by hydrolyzing the amide bond of their β-lactam ring [376, 377]. Clavulanic acid, discovered in 1976 as being produced by the soil organism Streptomyces clavuligerus, can be used in combination therapy with β-lactams to inhibit the action of β-lactamases. Similarly to β-lactam antibiotics, clavulanic acid displays a structure with a β-lactam ring. However, rather than being hydrolyzed from the enzyme after catalysis and permitting the turnover of an additional substrate, this compound remains irreversibly bound to the active site of β-lactamase. Formulations combining this β-lactamase inhibitor and β-lactams are available and represent several billion U.S. dollars in annual sales [378]. The production of clavulanic acid still relies on the fermentation of S. clavuligerus. Thus, there is interest in potentiating this bacterium’s capacity to produce the β-lactamase inhibitor. Seeking to increase the titers of clavulanic acid, researchers have resorted to intensive random mutagenesis and screening-based techniques. For example, Li and Townsend were able to double the yields obtained from the fermentation of S. clavuligerus. To achieve this, two distinct glyceraldehyde-3-phosphate dehydrogenases (gap1 and gap2) were removed from the glycolytic pathway. By disrupting these genes, glyceraldehyde3-phosphate converted from glycerol is channeled to the carboxyethyl-L-arginine synthesis pathway, instead of the Krebs cycle, thus leading to the production of clavulanic acid [378]. Deletion of other genes also enhanced production levels of clavulanic acid. By generating null mutants of relA, which codes for a protein involved in the regulation of phosphorylation of guanosine nucleotides, Gomes-Escribano et al. [379] engineered S. clavuligerus to overproduce both clavulanic acid and the β-lactam antibiotic cephamycin C. Clavulanic acid levels were three to fourfolds higher than in the wild type, and cephamycin C was overproduced by up to 2.6-fold. Efforts have also been undertaken to understanding the difference, at the whole-genome level, between clavulanic-acid-producing strains and their 7.7 Natural Products Discovery and Engineering wild-type counterparts. This research can enable one to better understand the natural mutations, which may result in a higher yield of the drug and can suggest additional targets for mutagenesis to further enhance production levels [380]. 7.7.2.5 Production of the Antiparasitic Avermectin and Its Analogs Doramectin and Ivermectin In the late 1970s, Merck and the Kitasato Institute in Japan discovered a family of potent antihelminthic PKs [381]. Produced by Streptomyces avermetilis, these molecules were specifically antiparasitic and did not display activity against bacteria or fungi [381, 382]. The biosynthetic cluster, made up of nine genes spanning over 90 000 bp, was elucidated over 20 years later [383], with AveR as a putative regulatory protein [381, 383, 384]. Soon after the discovery of avermectin, Pfizer produced a more efficient analog, doramectin, through targeted mutagenesis of natural precursor pathways and exogenous feeding of alternative ones [385, 386]. A collection of analogs with different C25 substituents and different levels of activity were obtained by feeding carboxylic acids or their precursors to a producing mutant strain [386]. Furthermore, Wang and colleagues [387] were able to produce doramectin without the need to feed these exogenous precursors by modifying the avermectin biosynthetic pathway and replacing its loading module with the cyclohexanecarboxylic (CHC) module from the PK phoslactomycin. Ivermectin, another antiparasitic drug used in veterinary medicine, is also an analog of avermectin [388, 389]. Ivermectin is now a semisynthetic drug, resulting from the chemical reduction of bonds in the intermediate avermectin B1, produced by Streptomyces avermitilis [385, 388]. Zhang et al. [388] was able to fully synthesize ivermectin in S. avermitilis by synthetically engineering the avermectin pathway through the replacement of two domains from one of the modules from the avermectin PKS. More precisely, the dehydratase and ketoreductase were replaced by the corresponding domains of the pikromycin PKS from a strain of Streptomyces venezuelae. Despite the resulting low yield, this represented a major advancement and allowed for an easier route to lower cost industrial production of ivermectin [388, 389]. 7.7.2.6 Production of Doxorubicin/Daunorubicin In addition to antibiotics, the production of other highly important molecules can be optimized through genetic engineering. Initially valued for their antibiotic properties, daunorubicin (DNR) and doxorubicin (DXR) are two related anthracyclines produced by Streptomyces peucetius strains that became invaluable chemotherapeutic agents. Currently, DXR is partly synthesized from the more abundant DNR. This is due to the fact that strains capable of producing high levels of DNR, but not DXR, have been found. DNR can be converted to DXR by hydroxylation of its C14 [390–392]. The high demand for DXR, exceeding 225 kg year−1 in 1999, has led researchers to synthetically engineer strains for increased production. Attempts have been made to increase the yield of DXR produced by the native host. Since production can lead to host toxicity and thus put a ceiling on maximal 149 150 7 Synthetic Biology and Therapies for Infectious Diseases yield, one of these attempts involved overexpressing the DXR resistance genes drrABC under the control of a stronger constitutive promoter, ermE*p [393]. A fivefold increase in the production of DXR was observed when drrC was overexpressed and an approximately twofold increase when drrAB and drrABC were overexpressed. In all cases, the increase was only observed at 72 and 84 h of incubation [393]. Overexpression of dnmT, required for daunosamine moiety biosynthesis, also led to an increase of almost 10-fold of DNR production. The authors found that the inactivation of drnH (which encodes a glycosyl transferase) resulted in a DNR increase of 8.5-fold, with DXR itself being overproduced as well. These mutated genes are located within the DXR cluster [394]. Other studies have found that disrupting some of the genes in the pathway – dnrU and dnrX – in S. peucetius resulted in a 36% increase in DXR yield, with the triple mutant of dnrX (unknown function), dnrU (putative ketoreductase), and dnrH producing 86% more compound than the wild-type strain [395]. To this date, and to our best knowledge, the maximum reported increase in DXR production was 11.4-fold by Lomovkaya et al. in 1999 [395]. Further work is therefore needed to increase DXR production levels, as this molecule is currently in shortage [396]. 7.7.2.7 Development of Hosts for the Expression of Nonribosomal Peptides and Polyketides For many NRP and PK compounds, heterologous hosts have been explored when the natural hosts are difficult to grow due to nutrient requirements or growth kinetics and because the natural yields are low. One of the first strains to be engineered for the biosynthesis of heterologous natural products was Streptomyces coelicolor CH999. Seeking to build a strain for expression of foreign PKs in considerable amounts, McDaniel et al. [397] removed the antibiotic actinorodin cluster from S. coelicolor A3(2) by homologous recombination. This strain also carried a mutation that disabled the synthesis of the pink antibiotic prodigiosin, and was used to express a multitude of antibiotics, including actinorhodin, granaticin, and tetracenomycin, from extrachromosomal material introduced into the new host strain. Yet, CH999 only accepts non-methylated DNA and exhibits low transformation efficiencies. Kosan Biosciences then built S. lividans strains (K4-114, K4-115) that can be transformed much more efficiently and with methylated DNA and also lack the actinorhodin cluster, similarly to CH999. These three strains, K4-114, K4-115, and CH999, have been tested for the capacity to produce the erythromycin precursor 6-deoxyerythronolide B (6dEB). They displayed equal efficiency in its production [339]. S. avermitilis, another soil isolate, is known for its capacity to produce the PK antibiotic avermectin [346, 398]. In order to engineer S. avermitilis into a versatile and ideal host for the expression of heterologous PK clusters, several rounds of gene deletions were performed. The initial strategy used was deletion by homologous recombination. However, this strategy turned out to be inefficient and resulted in irregular deletions, although two useful mutants were recovered 7.7 Natural Products Discovery and Engineering in strain SUKA2. The authors then decided to follow a different approach in which they used the Cre-Lox recombination system to remove a 1.5 Mb section of the 9 Mb chromosome of S. avermitilis to create a new strain named SUKA3. With the deletion of that large region, both the avermectin and filipin biosynthetic clusters were removed. Additional deletion strains were built upon SUKA2 and SUKA3 by removing the oligomycin synthesis genes, named SUKA4 and SUKA5, respectively. Further deletions removed terpene biosynthesis (geosmin, neopentalenolactone, and carotenoids) as well as 78% of the transposases found in the chromosome. This mutant, with a chromosome reduced to about 82% of its original size, is a useful host for the expression of clusters from both culturable and unculturable bacteria. It is also well suited for combinatorial synthesis approaches [399]. Gomez-Escribano and Bibb [400] took the genetic engineering of Streptomyces further. The availability of precursors and the capacity to withstand the production of potentially toxic molecules are major goals for engineering of Streptomyces spp. as heterologous hosts. These authors engineered S. coelicolor M145 by removing its capacity to produce antibiotics. This involved the elimination of the cluster responsible for the biosynthesis of actinorhodin (blue pigmented antibiotic), prodigiosin (red pigmented antibiotic), cryptic Type I polyketide (CPK), and the NRPS-derived calcium-dependent antibiotic (CDA). The goal of this work was to focus the host’s metabolic machinery primarily on the synthesis of heterologous pathways introduced into this strain. In order to pleiotropically achieve higher levels of metabolite production, an additional step was undertaken: point mutations were introduced in the rpoB (strain M1152) and both rpoB and rpsL genes (strain M1154), as it had been previously shown that these mutations resulted in an increased level of antibiotic production without affecting bacterial growth [401, 402]. These engineered strains not only facilitate the overexpression of heterologous natural products but also simplify the identification and study of these products. This latter effect is due to the simplicity of the HPLC chromatogram, which results from the removal of the major metabolites that are natively produced by this strain. This empowers the use of chromatography, coupled with MS, for the identification of novel peaks and molecules [400]. The well-studied host E. coli has also been used for the heterologous expression of natural products. However, there are additional challenges that must be overcome when trying to express natural products in E. coli. For example, heterologous pathways often need precursors that are not all naturally available in E. coli. Moreover, the biosynthesis of PKs requires proper folding and post-translational modifications of the biosynthetic enzymes. Therefore, when Pfeifer et al. [345] sought to synthesize complex PKs in E. coli, genetic engineering of this host was required. This involved the introduction of pathways for the production of certain precursors in the proper stoichiometries as well as the expression of genes involved in the post-translational modification of heterologous enzymes. In order to engineer E. coli to synthesize 6dEB, the DEBS genes were introduced, as well as a phosphopantetheinyl transferase from B. subtilis (for activation of the carrier proteins) and overexpression of genes prpE (for conversion of propionate into 151 152 7 Synthetic Biology and Therapies for Infectious Diseases propionyl-CoA) and birA (for overexpression of propionyl CoA carboxylase). This resulted in high-level synthesis of 6dEB from propionate in E. coli instead of the native Saccharoplyspora erythraea. 7.7.3 Generation of Novel Molecules by Rational Reprogramming Given the highly modular nature of NRPSs and PKSs, several attempts have been made at generating new molecules from the rational combination of genes or parts thereof [337]. Exchanging modules that determine the unit to be incorporated into the product can lead to the selection and loading of a different precursor. For example, and as briefly mentioned above, in the case of the antibiotic avermectin, switching the isobutyryl-CoA-uploading module with a CHC-uploading unit was successful. This single switch resulted in a novel molecule – doramectin – being produced [337, 385, 387]. Notably, the replacement of the unit-uploading machinery is independent of the unit biosynthesis machinery, meaning that although a given cluster can upload a new molecule, it does not necessarily mean that it can make it. Therefore, the genes involved in the biosynthesis of the unit CHC acid had to be cloned into the doramectin biosynthetic host as well [337, 387]. Attempting to engineer natural pathways can often result in failure; for example, when downstream processing domains do not recognize the precursor, no molecule can be successfully assembled [356]. Thus, the capacity to successfully reengineer biosynthetic pathways is directly related to the understanding of the pathways of interest or the ability to rapidly construct and test many pathway variants. Such knowledge is not merely at the level of DNA and protein sequences, but involves understanding how the proteins interact with each other, how specific the biosynthetic enzymes are to a certain substrate, and the stoichiometry of the pathway itself [320]. The first successful crystallization of NRPSs and PKSs, as well as NMR studies, has contributed to understanding how these enzymes cooperate and are organized in particular pathways. Reprogramming specialized metabolite production can be carried out by engineering the specific pathway of interest as well as global regulators (Figure 7.12) [403]. A regulator capable of controlling metabolite production across all species has yet to be discovered, but several regulators have been found to be involved in the expression control of a variety of molecules. Such is the case for DasR, PhoP, and ArpA, pleiotropic regulators that control compound production in several species and are useful targets for improving the titers of molecules produced by unknown pathways. For example, regulators such as SARPs (Streptomyces antibiotic regulatory proteins) act as transcriptional activators for a given pathway (Figure 7.12a and b), whereas others, such as TetR, are transcriptional repressors (Figure 7.12c and d). In addition, some families of proteins, such as MarR and LysR, include both repressors and activators and thus, their function cannot be predicted on the basis of family alone. A two- to threefold increase in natural product titers has been achieved in Streptomyces by the overexpression 7.7 Natural Products Discovery and Engineering (a) (b) (c) (d) Figure 7.12 (a) In the absence of molecule production, (b) cloning genes that encode pathway activator proteins can result in the transcription of the regulated pathway genes and thus, a metabolic product. In the same way, (c) if a repressor is disabling the biosynthesis of a molecule, (d) disruption of the gene encoding this repressor (inverted triangle) can lead to the resumption of transcription and the production of a molecule. 153 154 7 Synthetic Biology and Therapies for Infectious Diseases of pathway activators. For example, the transcriptional activator SARP was overexpressed to enhance the production of the drug C-1027. In addition, knocking out the transcriptional repressor encoded by ptmR1 increased the production of the antibiotics platensimycin and platencin in Streptomyces platensis MA7327 by about 100-fold [340] (Figure 7.12). Reprogramming biosynthetic pathways has been useful in the case of the antibiotic daptomycin. As described earlier, this antibiotic is approved for the treatment of skin infections, bacteremia, and right-side endocarditis by Gram-positive bacteria, such as S. aureus. Yet, it has failed the “at least as good as” criteria, also known as the non-inferiority criteria, in a clinical trial to treat community-acquired pneumonia (CAP) [367]. It is thought that this failure was due to the sequestration of this molecule in pulmonary surfactants, which help gas exchange in the alveolar space. NRPSs involved in the assembly of daptomycin were expressed from several different chromosomal loci that were determined experimentally to result in higher compound yield. The reengineering of the biosynthetic pathway also allowed for modifications of the core peptide, which were not possible to achieve synthetically [370, 404]. Hybrid lipopeptides were built by exchanging the third unit of DptD, the NRPS for daptomycin, with that of A54145, a CDA structurally very similar to daptomycin, together with the deletion of dptI and integration of heterologous replacements of dptI coding for different subunits. Seventy new lipopeptides varying in their side chains were generated, many with strong antimicrobial properties even in the presence of surfactants such as those found in the alveolar space [346, 367, 404]. 7.7.4 Engineering NRPS and PKS Domains Instead of just combining genes, the modular nature of NRPSs and PKSs also allows for combinatorics at the level of domains. One of the main determinants of enzyme selectivity is the adenylation domain, which is responsible for the selection of the amino acid to be incorporated [301]. By reengineering domains, it has also been found that the thiolation domain has no particular selectivity [405]. Similarly, the condensation domain only seems to display some selectivity at the donor level and for the size of the molecule it accepts. This same study showed that an elongation module has the potential to be converted into an initiation module for peptide bond formation by simple module relocation within the gene [405]. For example, several dozen different 6-dEB analogs were generated by swapping the adenylation, thiolation, and β-carbon processing domains for the enzymes responsible for synthesizing 6-dEB and rapamycin, both PKs. This process was carried out in a heterologous host and some of the generated variants had a fourfold increased affinity to the Hsp90 heat shock protein, which was chosen as a target because it is crucial for the survival of cells under stress such as tumor cells [346, 406]. In addition, as noted above, the semi-synthetic drug ivermectin is produced in a strain of S. avermitilis by PKSs. By switching the dehydratase and ketoreductase domains of one of the modules of the avermectin with the 7.7 Natural Products Discovery and Engineering dehydratase, enoyl reductase, and ketoreductase domains from another module involved in the synthesis of rapamycin, ivermectin was generated [388]. Furthermore, in an attempt to understand the mechanisms underlying the unidirectional growth of polyketide chains, Kapur et al. [407] engineered 6dEB synthase to repeat an elongation step by replacing the ACP domain with the ACP of an upstream enzyme. In other words, a non-iterative PKS was converted into an iterative one, such that intermediates undergo multiple rounds of elongation within the same module. The unidirectionality of an elongation domain depends on the helix I of a given ACP being unable to dock onto the ketosynthase-acyltransferase domains of the same module, such that the downstream didomain is the only option for elongation. When performing domain and module swaps, it is important to maintain proper protein–protein interactions. The small peptide regions between domains and modules, termed the interdomain and intermodule linkers respectively, have been found to play an important role in the molecular assembly line [408, 409]. Although these linkers are not conserved at the levels of primary and secondary structure, they seem to be responsible for the proper folding of their associated enzymes. Studies indicate that these regions have a tendency to form defined secondary folds, with the resulting turn being conformationally sensitive [405]. A certain degree of conservation has been found at the level of a single proline residue, which acts as a switch to coordinate domain activity. Thus, the role of these linkers seems to be structural, maintaining the domains in their proper locations [409]. To facilitate the identification of linker regions, software with specific algorithms that account for their low levels of conservation has been developed, such as the Udwary–Merski algorithm (UMA). These algorithms can endow synthetic biologists with the ability to predict candidate locations for the division of genes into parts to be reassembled. Without such tools, one risks subdividing genes into pieces that will not be functional because of nonideal protein–protein interactions [410]. 7.7.5 Activation of Cryptic Genes/Clusters The awakening of cryptic or silent gene clusters encoding natural molecules can gain much from the tools of synthetic biology (Figure 7.13a and b). These clusters, although seemingly capable of leading to the production of a given polyketide or NRP of a predicted structure, are not expressed at significant levels under tested conditions [308]. One successful strategy for activating these cryptic pathways has involved the overexpression of global secondary metabolism activators, such as laeA, in Aspergillus nidulans, which led to the expression of antimicrobial biosynthetic clusters [305, 411–413]. However, in certain cases, the key regulators are specific to a given pathway rather than being global in nature. In such situations, authors have successfully expressed putative pathway-specific activators (e.g., apdR) extrachromosomally under the control of inducible promoters (Figure 7.13) [295, 305, 413]. 155 156 7 Synthetic Biology and Therapies for Infectious Diseases (a) (b) (c) (d) Figure 7.13 (a) Silent cryptic biosynthetic pathways can be activated by (b) cloning a promoter upstream of the operon of interest that will drive its expression. HPLC chromatograms can then reveal the molecule that a given cluster is responsible for synthesizing. In the same way, (c) when a certain product is observed but whose biosynthetic origin is unknown, (d) interfering with the transcription of genes (e.g., by transposon mutagenesis, shown as an inverted triangle) permits connection of specific biosynthetic genes with specific product molecules with the aid of chromatograms. 7.8 Summary 7.7.6 Mutasynthesis as a Source of Novel Analogs Structural diversity in NRP and PK molecules can also be introduced by disrupting the endogenous production of precursors followed by exogenous feeding of alternative precursors to generate molecular analogs (mutasynthons), if the biosynthetic enzymes are promiscuous enough to accept different precursors [346]. This approach, termed mutasynthesis, has been used to generate new molecules, such as aminocoumarin antibiotics. For example, the selection of a less selective amide synthase (ClocL instead of CouL and SimL), responsible for linking the aminocoimarin moiety to the acyl group, allowed for more efficient generation of mutasynthons by expanding the diversity of precursors that could be utilized. This resulted in the generation of 12 new aminocoumarin-derived molecules, displaying both antibacterial and gyrase-inhibitory activities that were comparable or superior to that of the aminocoumarin novobiocin [414]. An improved version of the Hsp90 inhibitor geldanamycin was obtained by using this same approach. The precursor’s biosynthetic pathway was removed and a heterologous precursor was fed into the culture. The novel analog was a chlorosubstituted nonbenzoquinone and exhibited improved antibiotic properties [346, 415]. Analogs of the immunosuppressant rapamycin [346, 416] and the antibiotic balhimycin are also among many of the other molecules generated through mutasynthesis [346, 417]. 7.8 Summary Here, we have provided an overview of the fields of vaccinology, alternatives to antibiotics for the treatment of bacterial diseases, and natural products discovery. There has been a tremendous amount of research in these fields, but significant limitations still exist. We envision that these challenges can be tackled with advances across interdisciplinary areas, including synthetic biology. In particular, we have highlighted examples where the genetic engineering of pathways, proteins, phages, and organisms has led to new and/or optimized capabilities to treat infectious diseases. Synthetic biology expands upon the power of genetic engineering by providing tools for more rapid, precise, and high-throughput biological design. These tools include cheaper and faster DNA synthesis techniques, more scalable DNA assembly and genome engineering strategies, and complex gene regulatory systems with tunable functionalities. We envision that these technologies will continue to advance the development of therapeutics for infectious diseases. Acknowledgments The authors thank members of the Lu lab for comments. All authors are listed in alphabetical order, except for the last author (T.K.L.). We acknowledge support 157 158 7 Synthetic Biology and Therapies for Infectious Diseases from the National Science Foundation (1124247), National Institutes of Health (1DP2OD008435 and 1P50GM098792), the Ellison Foundation, the Office of Naval Research (N00014-11-1-0725, N00014-11-1-0687, and N00014-13-10424), the Army Research Office (W911NF-11-1-0281), the Defense Advanced Research Projects Agency, and the United States Presidential Early Career Award for Scientists and Engineers. H.A. acknowledges support from a JSPS Postdoctoral Fellowship for Research Abroad and the Naito Foundation. References 1. Spellberg, B. (2008) Dr. William H. 2. 3. 4. 5. 6. 7. 8. 9. 10. Stewart: mistaken or maligned? Clin. Infect. Dis., 47, 294. World Health Organization (2008) The Global Burden of Disease: 2004 Update. Fauci, A.S. and Morens, D.M. (2012) The perpetual challenge of infectious diseases. N. Engl. J. Med., 366, 454–461. World Health Organization (2011) Global Summary of the AIDS Epidemic. Morens, D.M., Folkers, G.K., and Fauci, A.S. (2004) The challenge of emerging and re-emerging infectious diseases. Nature, 430, 242–249. Beisel, C.E. and Morens, D.M. (2004) Variant Creutzfeldt-Jakob disease and the acquired and transmissible spongiform encephalopathies. Clin. Infect. Dis., 38, 697–704. Casalone, C., Zanusso, G., Acutis, P., Ferrari, S., Capucci, L., Tagliavini, F. et al. (2004) Identification of a second bovine amyloidotic spongiform encephalopathy: molecular similarities with sporadic Creutzfeldt-Jakob disease. Proc. Natl. Acad. Sci. U.S.A., 101, 3065–3070. Chang, Y., Cesarman, E., Pessin, M.S., Lee, F., Culpepper, J., Knowles, D.M. et al. (1994) Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi’s sarcoma. Science, 266, 1865–1869. Sanders, M.K. and Peura, D.A. (2002) Helicobacter pylori-associated diseases. Curr. Gastroenterol. Rep., 4, 448–454. Breeveld, F.J., Vreden, S.G., and Grobusch, M.P. (2012) History of 11. 12. 13. 14. 15. 16. 17. 18. 19. malaria research and its contribution to the malaria control success in Suriname: a review. Malar. J., 11, 95. Wellems, T.E. and Miller, L.H. (2003) Two worlds of malaria. N. Engl. J. Med., 349, 1496–1498. Fischbach, M.A. and Walsh, C.T. (2009) Antibiotics for emerging pathogens. Science, 325, 1089–1093. Centers for Disease Control and Prevention (2013) Antibiotic Resistance Threats in the United States, 2013. Falagas, M.E., Bliziotis, I.A., Kasiakou, S.K., Samonis, G., Athanassopoulou, P., and Michalopoulos, A. (2005) Outcome of infections due to pandrug-resistant (PDR) Gram-negative bacteria. BMC Infect. Dis., 5, 24. Dorman, S.E. and Chaisson, R.E. (2007) From magic bullets back to the magic mountain: the rise of extensively drugresistant tuberculosis. Nat. Med., 13, 295–298. World Health Organization (2011) Global Tuberculosis Report 2012. World Health Organization (2006) WHO Global Task Force Outlines Measures to Combat XDR-TB Worldwide. Kim, D.H., Kim, H.J., Park, S.K., Kong, S.J., Kim, Y.S., Kim, T.H. et al. (2008) Treatment outcomes and long-term survival in patients with extensively drug-resistant tuberculosis. Am. J. Respir. Crit. Care Med., 178, 1075–1082. Boucher, H.W., Talbot, G.H., Benjamin, D.K. Jr., Bradley, J., Guidos, R.J., Jones, R.N. et al. (2013) 10 x ′ 20 Progress–development of new drugs active against Gram-negative bacilli: an update from the Infectious References 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. Diseases Society of America. Clin. Infect. Dis., 56, 1685–1694. Spellberg, B., Powers, J.H., Brass, E.P., Miller, L.G., and Edwards, J.E. Jr., (2004) Trends in antimicrobial drug development: implications for the future. Clin. Infect. Dis., 38, 1279–1286. Roemer, T. and Boone, C. (2013) Systems-level antimicrobial drug and drug synergy discovery. Nat. Chem. Biol., 9, 222–231. Boucher, H.W., Talbot, G.H., Bradley, J.S., Edwards, J.E., Gilbert, D., Rice, L.B. et al. (2009) Bad bugs, no drugs: no ESKAPE! An update from the Infectious Diseases Society of America. Clin. Infect. Dis., 48, 1–12. Cheng, A.A. and Lu, T.K. (2012) Synthetic biology: an emerging engineering discipline. Annu. Rev. Biomed. Eng., 14, 155–178. Khalil, A.S. and Collins, J.J. (2010) Synthetic biology: applications come of age. Nat. Rev. Genet., 11, 367–379. Lu, T.K. (2010) Engineering scalable biological systems. Bioeng. Bugs, 1, 378–384. Ruder, W.C., Lu, T., and Collins, J.J. (2011) Synthetic biology moving into the clinic. Science, 333, 1248–1252. Lu, T.K., Bowers, J., and Koeris, M.S. (2013) Advancing bacteriophagebased microbial diagnostics with synthetic biology. Trends Biotechnol., 31, 325–327. Lu, T.K. and Koeris, M.S. (2011) The next generation of bacteriophage therapy. Curr. Opin. Microbiol., 14, 524–531. Clemens, J. (2011) Evaluation of vaccines against enteric infections: a clinical and public health research agenda for developing countries. Philos. Trans. R. Soc. Lond. B Biol. Sci., 366, 2799–2805. Walker, R.I., Steele, D., Aguado, T., and Ad Hoc, E.T.E.C. (2007) Analysis of strategies to successfully vaccinate infants in developing countries against enterotoxigenic E. coli (ETEC) disease. Vaccine, 25, 2545–2566. 31. Brumbaugh, A.R. and Mobley, H.L. 32. 33. 34. 35. 36. 37. 38. 39. 40. 41. 42. 43. (2012) Preventing urinary tract infection: progress toward an effective Escherichia coli vaccine. Expert Rev. Vaccines, 11, 663–676. Girard, M.P., Reed, Z.H., Friede, M., and Kieny, M.P. (2007) A review of human vaccine research and development: malaria. Vaccine, 25, 1567–1580. Girard, M.P., Osmanov, S.K., and Kieny, M.P. (2006) A review of vaccine research and development: the human immunodeficiency virus (HIV). Vaccine, 24, 4062–4081. Girard, M.P., Steele, D., Chaignat, C.L., and Kieny, M.P. (2006) A review of vaccine research and development: human enteric infections. Vaccine, 24, 2732–2750. Heppner, D.G. (2013) The malaria vaccine – status quo 2013. Travel Med. Infect. Dis., 11, 2–7. Schiffner, T., Sattentau, Q.J., and Dorrell, L. (2013) Development of prophylactic vaccines against HIV-1. Retrovirology, 10, 72. Pulendran, B. and Ahmed, R. (2011) Immunological mechanisms of vaccination. Nat. Immunol., 12, 509–517. Bonanni, P. and Santos, J.I. (2011) Vaccine evolution. Perspect. Vaccinol., 1, 1–24. Lauring, A.S., Jones, J.O., and Andino, R. (2010) Rationalizing the development of live attenuated virus vaccines. Nat. Biotechnol., 28, 573–579. Svenson, S., Kallenius, G., Pawlowski, A., and Hamasur, B. (2010) Towards new tuberculosis vaccines. Hum. Vaccin., 6, 309–317. Calmette, A. (1931) Preventive vaccination against tuberculosis with BCG. Proc. R. Soc. Med., 24, 1481–1490. Kaufmann, S.H. and Gengenbacher, M. (2012) Recombinant live vaccine candidates against tuberculosis. Curr. Opin. Biotechnol., 23, 900–907. Grode, L., Ganoza, C.A., Brohm, C., Weiner, J. III, Eisele, B., and Kaufmann, S.H. (2013) Safety and immunogenicity of the recombinant BCG vaccine VPM1002 in a phase 1 open-label randomized clinical trial. Vaccine, 31, 1340–1348. 159 160 7 Synthetic Biology and Therapies for Infectious Diseases 44. Hoft, D.F., Blazevic, A., Abate, G., 45. 46. 47. 48. 49. 50. 51. 52. 53. Hanekom, W.A., Kaplan, G., Soler, J.H. et al. (2008) A new recombinant bacille Calmette-Guerin vaccine safely induces significantly enhanced tuberculosisspecific immunity in human volunteers. J. Infect. Dis., 198, 1491–1501. Horwitz, M.A., Harth, G., Dillon, B.J., and Maslesa-Galic, S. (2006) A novel live recombinant mycobacterial vaccine against bovine tuberculosis more potent than BCG. Vaccine, 24, 1593–1600. Horwitz, M.A. (2005) Recombinant BCG expressing Mycobacterium tuberculosis major extracellular proteins. Microbes Infect., 7, 947–954. Tullius, M.V., Harth, G., Maslesa-Galic, S., Dillon, B.J., and Horwitz, M.A. (2008) A ReplicationLimited Recombinant Mycobacterium bovis BCG vaccine against tuberculosis designed for human immunodeficiency virus-positive persons is safer and more efficacious than BCG. Infect. Immun., 76, 5200–5214. Sun, R., Skeiky, Y.A., Izzo, A., Dheenadhayalan, V., Imam, Z., Penn, E. et al. (2009) Novel recombinant BCG expressing perfringolysin O and the over-expression of key immunodominant antigens; pre-clinical characterization, safety and protection against challenge with Mycobacterium tuberculosis. Vaccine, 27, 4412–4423. Zaki, S.A. and Karande, S. (2011) Multidrug-resistant typhoid fever: a review. J. Infect. Dev. Ctries., 5, 324–337. Gonzalez-Escobedo, G., Marshall, J.M., and Gunn, J.S. (2011) Chronic and acute infection of the gall bladder by Salmonella Typhi: understanding the carrier state. Nat. Rev. Microbiol., 9, 9–14. Martin, L.B. (2012) Vaccines for typhoid fever and other salmonelloses. Curr. Opin. Infect. Dis., 25, 489–499. Ehrbar, K. and Hardt, W.D. (2005) Bacteriophage-encoded type III effectors in Salmonella enterica subspecies 1 serovar Typhimurium. Infect. Genet. Evol., 5, 1–9. Srikanth, C.V., Mercado-Lubo, R., Hallstrom, K., and McCormick, B.A. 54. 55. 56. 57. 58. 59. 60. 61. 62. 63. (2011) Salmonella effector proteins and host-cell responses. Cell. Mol. Life Sci., 68, 3687–3697. Valdez, Y., Ferreira, R.B., and Finlay, B.B. (2009) Molecular mechanisms of Salmonella virulence and host resistance. Curr. Top. Microbiol. Immunol., 337, 93–127. Bakowski, M.A., Braun, V., and Brumell, J.H. (2008) Salmonellacontaining vacuoles: directing traffic and nesting to grow. Traffic, 9, 2022–2031. Tacket, C.O., Hone, D.M., Curtiss, R. III, Kelly, S.M., Losonsky, G., Guers, L. et al. (1992) Comparison of the safety and immunogenicity of delta aroC delta aroD and delta cya delta crp Salmonella typhi strains in adult volunteers. Infect. Immun., 60, 536–541. Schmitt, C.K., Darnell, S.C., and O’Brien, A.D. (1996) The attenuated phenotype of a Salmonella typhimurium flgM mutant is related to expression of FliC flagellin. J. Bacteriol., 178, 2911–2915. Levine, M.M., Galen, J., Barry, E., Noriega, F., Chatfield, S., Sztein, M. et al. (1996) Attenuated Salmonella as live oral vaccines against typhoid fever and as live vectors. J. Biotechnol., 44, 193–196. Cardenas, L. and Clements, J.D. (1992) Oral immunization using live attenuated Salmonella spp. as carriers of foreign antigens. Clin. Microbiol. Rev., 5, 328–342. Hall, H.K. and Foster, J.W. (1996) The role of fur in the acid tolerance response of Salmonella typhimurium is physiologically and genetically separable from its role in iron acquisition. J. Bacteriol., 178, 5683–5691. Foster, J.W. (1995) Low pH adaptation and the acid tolerance response of Salmonella typhimurium. Crit. Rev. Microbiol., 21, 215–237. Kato, A., Groisman, E.A., and I. Howard Hughes Medical (2008) The PhoQ/PhoP regulatory network of Salmonella enterica. Adv. Exp. Med. Biol., 631, 7–21. Sebkova, A., Karasova, D., Crhanova, M., Budinska, E., and References 64. 65. 66. 67. 68. 69. 70. 71. 72. 73. Rychlik, I. (2008) aro mutations in Salmonella enterica cause defects in cell wall and outer membrane integrity. J. Bacteriol., 190, 3155–3160. Dong, T. and Schellhorn, H.E. (2010) Role of RpoS in virulence of pathogens. Infect. Immun., 78, 887–897. Curtiss, R. III, Galan, J.E., Nakayama, K., and Kelly, S.M. (1990) Stabilization of recombinant avirulent vaccine strains in vivo. Res. Microbiol., 141, 797–805. Galan, J.E., Nakayama, K., and Curtiss, R. III, (1990) Cloning and characterization of the asd gene of Salmonella typhimurium: use in stable maintenance of recombinant plasmids in Salmonella vaccine strains. Gene, 94, 29–35. Galen, J.E. and Curtiss, R. III, (2014) The delicate balance in genetically engineering live vaccines. Vaccine, in press. Curtiss, R. III, Xin, W., Li, Y., Kong, W., Wanda, S.Y., Gunn, B. et al. (2010) New technologies in using recombinant attenuated Salmonella vaccine vectors. Crit. Rev. Immunol., 30, 255–270. Kong, W., Brovold, M., Koeneman, B.A., Clark-Curtiss, J., and Curtiss, R. III, (2012) Turning self-destructing Salmonella into a universal DNA vaccine delivery platform. Proc. Natl. Acad. Sci. U.S.A., 109, 19414–19419. Wang, S., Kong, Q., and Curtiss, R. III, (2013) New technologies in developing recombinant attenuated Salmonella vaccine vectors. Microb. Pathog., 58, 17–28. Miller, S.I. (1991) Phop Phoq – macrophage-specific modulators of Salmonella virulence. Mol. Microbiol., 5, 2073–2078. Nickerson, C.A. and Curtiss, R. III, (1997) Role of sigma factor RpoS in initial stages of Salmonella typhimurium infection. Infect. Immun., 65, 1814–1823. Lee, I.S., Lin, J., Hall, H.K., Bearson, B., and Foster, J.W. (1995) The stationaryphase sigma factor sigma S (RpoS) is required for a sustained acid tolerance response in virulent Salmonella 74. 75. 76. 77. 78. 79. 80. typhimurium. Mol. Microbiol., 17, 155–167. Gunn, B.M., Wanda, S.Y., Burshell, D., Wang, C., and Curtiss, R. III, (2010) Construction of recombinant attenuated Salmonella enterica serovar typhimurium vaccine vector strains for safety in newborn and infant mice. Clin. Vaccine Immunol., 17, 354–362. Curtiss, R. III, Wanda, S.Y., Gunn, B.M., Zhang, X., Tinge, S.A., Ananthnarayan, V. et al. (2009) Salmonella enterica serovar typhimurium strains with regulated delayed attenuation in vivo. Infect. Immun., 77, 1071–1082. Li, Y., Wang, S., Scarpellini, G., Gunn, B., Xin, W., Wanda, S.Y. et al. (2009) Evaluation of new generation Salmonella enterica serovar Typhimurium vaccines with regulated delayed attenuation to induce immune responses against PspA. Proc. Natl. Acad. Sci. U.S.A., 106, 593–598. Wang, S., Li, Y., Scarpellini, G., Kong, W., Shi, H., Baek, C.H. et al. (2010) Salmonella vaccine vectors displaying delayed antigen synthesis in vivo to enhance immunogenicity. Infect. Immun., 78, 3969–3980. Wang, S., Li, Y., Shi, H., Sun, W., Roland, K.L., and Curtiss, R. III, (2011) Comparison of a regulated delayed antigen synthesis system with in vivo-inducible promoters for antigen delivery by live attenuated Salmonella vaccines. Infect. Immun., 79, 937–949. Juarez-Rodriguez, M.D., Yang, J., Kader, R., Alamuri, P., Curtiss, R. III, and Clark-Curtiss, J.E. (2012) Live attenuated Salmonella vaccines displaying regulated delayed lysis and delayed antigen synthesis to confer protection against Mycobacterium tuberculosis. Infect. Immun., 80, 815–831. Kong, W., Wanda, S.Y., Zhang, X., Bollen, W., Tinge, S.A., Roland, K.L. et al. (2008) Regulated programmed lysis of recombinant Salmonella in host tissues to release protective antigens and confer biological containment. Proc. Natl. Acad. Sci. U.S.A., 105, 9361–9366. 161 162 7 Synthetic Biology and Therapies for Infectious Diseases 81. Oliveira, A.F., Cardoso, S.A., 82. 83. 84. 85. 86. 87. 88. Almeida, F.B., de Oliveira, L.L., Pitondo-Silva, A., Soares, S.G. et al. (2012) Oral immunization with attenuated Salmonella vaccine expressing Escherichia coli O157:H7 intimin gamma triggers both systemic and mucosal humoral immunity in mice. Microbiol. Immunol., 56, 513–522. Londono, L.P., Chatfield, S., Tindle, R.W., Herd, K., Gao, X.M., Frazer, I. et al. (1996) Immunisation of mice using Salmonella typhimurium expressing human papillomavirus type 16 E7 epitopes inserted into hepatitis B virus core antigen. Vaccine, 14, 545–552. Chorobik, P. and Marcinkiewicz, J. (2011) Therapeutic vaccines based on genetically modified Salmonella: a novel strategy in cancer immunotherapy. Pol. Arch. Med. Wewn., 121, 461–466. Xiong, G., Husseiny, M.I., Song, L., Erdreich-Epstein, A., Shackleford, G.M., Seeger, R.C. et al. (2010) Novel cancer vaccine based on genes of Salmonella pathogenicity island 2. Int. J. Cancer, 126, 2622–2634. Nishikawa, H., Sato, E., Briones, G., Chen, L.M., Matsuo, M., Nagata, Y. et al. (2006) In vivo antigen delivery by a Salmonella typhimurium type III secretion system for therapeutic cancer vaccines. J. Clin. Invest., 116, 1946–1954. Osorio, M., Wu, Y., Singh, S., Merkel, T.J., Bhattacharyya, S., Blake, M.S. et al. (2009) Anthrax protective antigen delivered by Salmonella enterica serovar Typhi Ty21a protects mice from a lethal anthrax spore challenge. Infect. Immun., 77, 1475–1482. Liu, D.S., Hu, S.J., Zhou, N.J., Xie, Y., and Cao, J. (2011) Construction and characterization of recombinant attenuated Salmonella typhimurium expressing the babA2/ureI fusion gene of Helicobacter pylori. Clin. Res. Hepatol. Gastroenterol., 35, 655–660. Liu, K.Y., Shi, Y., Luo, P., Yu, S., Chen, L., Zhao, Z. et al. (2011) Therapeutic efficacy of oral immunization with attenuated Salmonella typhimurium expressing Helicobacter 89. 90. 91. 92. 93. 94. 95. pylori CagA, VacA and UreB fusion proteins in mice model. Vaccine, 29, 6679–6685. Branger, C.G., Fetherston, J.D., Perry, R.D., and Curtiss, R. III, (2007) Oral vaccination with different antigens from Yersinia pestis KIM delivered by live attenuated Salmonella typhimurium elicits a protective immune response against plague. Adv. Exp. Med. Biol., 603, 387–399. Branger, C.G., Sun, W., Torres-Escobar, A., Perry, R., Roland, K.L., Fetherston, J. et al. (2010) Evaluation of Psn, HmuR and a modified LcrV protein delivered to mice by live attenuated Salmonella as a vaccine against bubonic and pneumonic Yersinia pestis challenge. Vaccine, 29, 274–282. Kulkarni, R.R., Parreira, V.R., Jiang, Y.F., and Prescott, J.F. (2010) A live oral recombinant Salmonella enterica serovar typhimurium vaccine expressing Clostridium perfringens antigens confers protection against necrotic enteritis in broiler chickens. Clin. Vaccine Immunol., 17, 205–214. Kulkarni, R.R., Parreira, V.R., Sharif, S., and Prescott, J.F. (2008) Oral immunization of broiler chickens against necrotic enteritis with an attenuated Salmonella vaccine vector expressing Clostridium perfringens antigens. Vaccine, 26, 4194–4203. Zekarias, B., Mo, H., and Curtiss, R. III, (2008) Recombinant attenuated Salmonella enterica serovar typhimurium expressing the carboxyterminal domain of alpha toxin from Clostridium perfringens induces protective responses against necrotic enteritis in chickens. Clin. Vaccine Immunol., 15, 805–816. Ward, S.J., Douce, G., Figueiredo, D., Dougan, G., and Wren, B.W. (1999) Immunogenicity of a Salmonella typhimurium aroA aroD vaccine expressing a nontoxic domain of Clostridium difficile toxin A. Infect. Immun., 67, 2145–2152. Verma, N.K., Ziegler, H.K., Wilson, M., Khan, M., Safley, S., Stocker, B.A. et al. (1995) Delivery of class I and class References 96. 97. 98. 99. 100. 101. 102. 103. II MHC-restricted T-cell epitopes of listeriolysin of Listeria monocytogenes by attenuated Salmonella. Vaccine, 13, 142–150. Dong, X., Zhang, Y.J., and Zhang, Z. (2013) Using weakly conserved motifs hidden in secretion signals to identify type-III effectors from bacterial pathogen genomes. PLoS One, 8, e56632. Niemann, G.S., Brown, R.N., Mushamiri, I.T., Nguyen, N.T., Taiwo, R., Stufkens, A. et al. (2013) RNA type III secretion signals that require Hfq. J. Bacteriol., 195, 2119–2125. Buchko, G.W., Niemann, G., Baker, E.S., Belov, M.E., Smith, R.D., Heffron, F. et al. (2010) A multipronged search for a common structural motif in the secretion signal of Salmonella enterica serovar Typhimurium type III effector proteins. Mol. Biosyst., 6, 2448–2458. Hegazy, W.A., Xu, X., Metelitsa, L., and Hensel, M. (2012) Evaluation of Salmonella enterica type III secretion system effector proteins as carriers for heterologous vaccine antigens. Infect. Immun., 80, 1193–1202. Russmann, H., Shams, H., Poblete, F., Fu, Y., Galan, J.E., and Donis, R.O. (1998) Delivery of epitopes by the Salmonella type III secretion system for vaccine development. Science, 281, 565–568. Asensi, G.F., de Sales, N.F., Dutra, F.F., Feijo, D.F., Bozza, M.T., Ulrich, R.G. et al. (2013) Oral immunization with Lactococcus lactis secreting attenuated recombinant staphylococcal enterotoxin B induces a protective immune response in a murine model. Microb. Cell Fact., 12, 32. Ma, Y., Luo, Y., Huang, X., Song, F., and Liu, G. (2012) Construction of Bifidobacterium infantis as a live oral vaccine that expresses antigens of the major fimbrial subunit (CfaB) and the B subunit of heat-labile enterotoxin (LTB) from enterotoxigenic Escherichia coli. Microbiology, 158, 498–504. Takata, T., Shirakawa, T., Kawasaki, Y., Kinoshita, S., Gotoh, A., Kano, Y. 104. 105. 106. 107. 108. 109. 110. 111. 112. 113. et al. (2006) Genetically engineered Bifidobacterium animalis expressing the Salmonella flagellin gene for the mucosal immunization in a mouse model. J. Gene Med., 8, 1341–1346. Mortaz, E., Adcock, I.M., Folkerts, G., Barnes, P.J., Paul Vos, A., and Garssen, J. (2013) Probiotics in the management of lung diseases. Mediators Inflamm., 2013, 751068. Sarowska, J., Choroszy-Krol, I., Regulska-Ilow, B., Frej-Madrzak, M., and Jama-Kmiecik, A. (2013) The therapeutic effect of probiotic bacteria on gastrointestinal diseases. Adv. Clin. Exp. Med., 22, 759–766. Isolauri, E., Rautava, S., and Salminen, S. (2012) Probiotics in the development and treatment of allergic disease. Gastroenterol. Clin. North Am., 41, 747–762. Million, M., Lagier, J.C., Yahav, D., and Paul, M. (2013) Gut bacterial microbiota and obesity. Clin. Microbiol. Infect., 19, 305–313. Pathangey, L., Kohler, J.J., Isoda, R., and Brown, T.A. (2009) Effect of expression level on immune responses to recombinant oral Salmonella enterica serovar Typhimurium vaccines. Vaccine, 27, 2707–2711. Kindsmuller, K. and Wagner, R. (2011) Synthetic biology: impact on the design of innovative vaccines. Hum. Vaccin., 7, 658–662. Lou, C., Stanton, B., Chen, Y.J., Munsky, B., and Voigt, C.A. (2012) Ribozyme-based insulator parts buffer synthetic circuits from genetic context. Nat. Biotechnol., 30, 1137–1142. Qi, L.S., Larson, M.H., Gilbert, L.A., Doudna, J.A., Weissman, J.S., Arkin, A.P. et al. (2013) Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression. Cell, 152, 1173–1183. Salis, H.M., Mirsky, E.A., and Voigt, C.A. (2009) Automated design of synthetic ribosome binding sites to control protein expression. Nat. Biotechnol., 27, 946–950. Isaacs, F.J., Carr, P.A., Wang, H.H., Lajoie, M.J., Sterling, B., Kraal, L. et al. (2011) Precise manipulation of 163 164 7 Synthetic Biology and Therapies for Infectious Diseases 114. 115. 116. 117. 118. 119. 120. 121. 122. chromosomes in vivo enables genomewide codon replacement. Science, 333, 348–353. Wang, H.H., Isaacs, F.J., Carr, P.A., Sun, Z.Z., Xu, G., Forest, C.R. et al. (2009) Programming cells by multiplex genome engineering and accelerated evolution. Nature, 460, 894–898. Jiang, W., Bikard, D., Cox, D., Zhang, F., and Marraffini, L.A. (2013) RNAguided editing of bacterial genomes using CRISPR-Cas systems. Nat. Biotechnol., 31, 233–239. Rappuoli, R. (2000) Reverse vaccinology. Curr. Opin. Microbiol., 3, 445–450. Rouphael, N.G. and Stephens, D.S. (2012) Neisseria meningitidis: biology, microbiology, and epidemiology. Methods Mol. Biol., 799, 1–20. Papaevangelou, V. and Spyridis, N. (2012) MenACWY-TT vaccine for active immunization against invasive meningococcal disease. Expert Rev. Vaccines, 11, 523–537. Serruto, D., Bottomley, M.J., Ram, S., Giuliani, M.M., and Rappuoli, R. (2012) The new multicomponent vaccine against meningococcal serogroup B, 4CMenB: immunological, functional and structural characterization of the antigens. Vaccine, 30 (Suppl. 2), B87–B97. Tondella, M.L., Popovic, T., Rosenstein, N.E., Lake, D.B., Carlone, G.M., Mayer, L.W. et al., and The Active Bacterial Core Surveillance Team (2000) Distribution of Neisseria meningitidis serogroup B serosubtypes and serotypes circulating in the United States. J. Clin. Microbiol., 38, 3323–3328. Gomez, G., Pei, J., Mwangi, W., Adams, L.G., Rice-Ficht, A., and Ficht, T.A. (2013) Immunogenic and invasive properties of Brucella melitensis 16M outer membrane protein vaccine candidates identified via a reverse vaccinology approach. PLoS One, 8, e59751. Nesta, B., Spraggon, G., Alteri, C., Moriel, D.G., Rosini, R., Veggi, D. et al. (2012) FdeC, a novel broadly conserved 123. 124. 125. 126. 127. 128. 129. 130. Escherichia coli adhesin eliciting protection against urinary tract infections. MBio, 3, e00010. Liu, L., Cheng, G., Wang, C., Pan, X., Cong, Y., Pan, Q. et al. (2009) Identification and experimental verification of protective antigens against Streptococcus suis serotype 2 based on genome sequence analysis. Curr. Microbiol., 58, 11–17. Tettelin, H., Medini, D., Donati, C., and Masignani, V. (2006) Towards a universal group B Streptococcus vaccine using multistrain genome analysis. Expert Rev. Vaccines, 5, 687–694. Maione, D., Margarit, I., Rinaudo, C.D., Masignani, V., Mora, M., Scarselli, M. et al. (2005) Identification of a universal Group B streptococcus vaccine by multiple genome screen. Science, 309, 148–150. Masignani, V., Comanducci, M., Giuliani, M.M., Bambini, S., Adu-Bobie, J., Arico, B. et al. (2003) Vaccination against Neisseria meningitidis using three variants of the lipoprotein GNA1870. J. Exp. Med., 197, 789–799. Scarselli, M., Arico, B., Brunelli, B., Savino, S., Di Marcello, F., Palumbo, E. et al. (2011) Rational design of a meningococcal antigen inducing broad protective immunity. Sci. Transl. Med., 3, 91ra62. Nuccitelli, A., Cozzi, R., Gourlay, L.J., Donnarumma, D., Necchi, F., Norais, N. et al. (2011) Structure-based approach to rationally design a chimeric protein for an effective vaccine against Group B Streptococcus infections. Proc. Natl. Acad. Sci. U.S.A., 108, 10278–10283. Johnson, S., Tan, L., van der Veen, S., Caesar, J., Goicoechea De Jorge, E., Harding, R.J. et al. (2012) Design and evaluation of meningococcal vaccines through structure-based modification of host and pathogen molecules. PLoS Pathog., 8, e1002981. D’Herelle, F. (2007) On an invisible microbe antagonistic toward dysenteric bacilli: brief note by Mr. F. D’Herelle, presented by Mr. Roux. 1917. Res. Microbiol., 158, 553–554. References 131. D’Herelle, F. (1931) Bacteriophage as a 132. 133. 134. 135. 136. 137. 138. 139. 140. 141. 142. 143. treatment in acute medical and surgical infections. Bull. N. Y. Acad. Med., 7, 329–348. Duckworth, D.H. (1976) Who discovered bacteriophage? Bacteriol. Rev., 40, 793–802. Summers, W.C. (2012) The strange history of phage therapy. Bacteriophage, 2, 130–133. Abedon, S.T., Kuhl, S.J., Blasdel, B.G., and Kutter, E.M. (2011) Phage treatment of human infections. Bacteriophage, 1, 66–85. Burrowes, B., Harper, D.R., Anderson, J., McConville, M., and Enright, M.C. (2011) Bacteriophage therapy: potential uses in the control of antibiotic-resistant pathogens. Expert Rev. Anti Infect. Ther., 9, 775–785. Denou, E., Bruttin, A., Barretto, C., Ngom-Bru, C., Brussow, H., and Zuber, S. (2009) T4 phages against Escherichia coli diarrhea: potential and problems. Virology, 388, 21–30. Filippov, A.A., Sergueev, K.V., and Nikolich, M.P. (2012) Can phage effectively treat multidrug-resistant plague? Bacteriophage, 2, 186–189. Gilmore, B.F. (2012) Bacteriophages as anti-infective agents: recent developments and regulatory challenges. Expert Rev. Anti Infect. Ther., 10, 533–535. Hunter, P. (2012) The return of the phage. EMBO Rep., 13, 20–23. Loc-Carrillo, C. and Abedon, S.T. (2011) Pros and cons of phage therapy. Bacteriophage, 1, 111–114. Pirnay, J.P., De Vos, D., Verbeken, G., Merabishvili, M., Chanishvili, N., Vaneechoutte, M. et al. (2011) The phage therapy paradigm: pret-aporter or sur-mesure? Pharm. Res., 28, 934–937. Balakrishnan, M. and Floch, M.H. (2012) Prebiotics, probiotics and digestive health. Curr. Opin. Clin. Nutr. Metab. Care, 15, 580–585. Stecher, B., Maier, L., and Hardt, W.D. (2013) ‘Blooming’ in the gut: how dysbiosis might contribute to pathogen evolution. Nat. Rev. Microbiol., 11, 277–284. 144. Krylov, V., Shaburova, O., Krylov, S., 145. 146. 147. 148. 149. 150. 151. 152. 153. 154. and Pleteneva, E. (2013) A genetic approach to the development of new therapeutic phages to fight pseudomonas aeruginosa in wound infections. Viruses, 5, 15–53. Brussow, H. (2012) What is needed for phage therapy to become a reality in Western medicine? Virology, 434, 138–142. Trojet, S.N., Caumont-Sarcos, A., Perrody, E., Comeau, A.M., and Krisch, H.M. (2011) The gp38 adhesins of the T4 superfamily: a complex modular determinant of the phage’s host specificity. Genome Biol. Evol., 3, 674–686. Scholl, D., Rogers, S., Adhya, S., and Merril, C.R. (2001) Bacteriophage K1-5 encodes two different tail fiber proteins, allowing it to infect and replicate on both K1 and K5 strains of Escherichia coli. J. Virol., 75, 2509–2515. Sandmeier, H., Iida, S., and Arber, W. (1992) DNA inversion regions Min of plasmid p15B and Cin of bacteriophage P1: evolution of bacteriophage tail fiber genes. J. Bacteriol., 174, 3936–3944. Rakhuba, D.V., Kolomiets, E.I., Dey, E.S., and Novik, G.I. (2010) Bacteriophage receptors, mechanisms of phage adsorption and penetration into host cell. Pol. J. Microbiol., 59, 145–155. Labrie, S.J., Samson, J.E., and Moineau, S. (2010) Bacteriophage resistance mechanisms. Nat. Rev. Microbiol., 8, 317–327. Projan, S. (2004) Phage-inspired antibiotics? Nat. Biotechnol., 22, 167–168. Schoolnik, G.K., Summers, W.C., and Watson, J.D. (2004) Phage offer a real alternative. Nat. Biotechnol., 22, 505–506; author reply 506-507. Bessler, W., Freund-Molbert, E., Knufermann, H., Rduolph, C., Thurow, H., and Stirm, S. (1973) A bacteriophage-induced depolymerase active on Klebsiella K11 capsular polysaccharide. Virology, 56, 134–151. Dobbins, A.T., George, M. Jr., Basham, D.A., Ford, M.E., Houtz, J.M., Pedulla, M.L. et al. (2004) Complete genomic sequence of the virulent 165 166 7 Synthetic Biology and Therapies for Infectious Diseases 155. 156. 157. 158. 159. 160. 161. 162. 163. Salmonella bacteriophage SP6. J. Bacteriol., 186, 1933–1944. Rakonjac, J., Bennett, N.J., Spagnuolo, J., Gagic, D., and Russel, M. (2011) Filamentous bacteriophage: biology, phage display and nanotechnology applications. Curr. Issues Mol. Biol., 13, 51–76. Lindberg, A.A. (1973) Bacteriophage receptors. Annu. Rev. Microbiol., 27, 205–241. Heilpern, A.J. and Waldor, M.K. (2003) pIIICTX, a predicted CTXphi minor coat protein, can expand the host range of coliphage fd to include Vibrio cholerae. J. Bacteriol., 185, 1037–1044. Iida, S. (1984) Bacteriophage P1 carries two related sets of genes determining its host range in the invertible C segment of its genome. Virology, 134, 421–434. Plasterk, R.H., Kanaar, R., and van de Putte, P. (1984) A genetic switch in vitro: DNA inversion by Gin protein of phage Mu. Proc. Natl. Acad. Sci. U.S.A., 81, 2689–2692. Doulatov, S., Hodes, A., Dai, L., Mandhana, N., Liu, M., Deora, R. et al. (2004) Tropism switching in Bordetella bacteriophage defines a family of diversity-generating retroelements. Nature, 431, 476–481. Leiman, P.G., Battisti, A.J., Bowman, V.D., Stummeyer, K., Muhlenhoff, M., Gerardy-Schahn, R. et al. (2007) The structures of bacteriophages K1E and K1-5 explain processive degradation of polysaccharide capsules and evolution of new host specificities. J. Mol. Biol., 371, 836–849. Scholl, D., Adhya, S., and Merril, C.R. (2002) Bacteriophage SP6 is closely related to phages K1-5, K5, and K1E but encodes a tail protein very similar to that of the distantly related P22. J. Bacteriol., 184, 2833–2836. Iida, S., Huber, H., Hiestand-Nauer, R., Meyer, J., Bickle, T.A., and Arber, W. (1984) The bacteriophage P1 sitespecific recombinase cin: recombination events and DNA recognition sequences. Cold Spring Harb. Symp. Quant. Biol., 49, 769–777. 164. Miller, E.S., Kutter, E., Mosig, G., 165. 166. 167. 168. 169. 170. 171. 172. Arisaka, F., Kunisawa, T., and Ruger, W. (2003) Bacteriophage T4 genome. Microbiol. Mol. Biol. Rev., 67, 86–156, table of contents. Tetart, F., Desplats, C., and Krisch, H.M. (1998) Genome plasticity in the distal tail fiber locus of the T-even bacteriophage: recombination between conserved motifs swaps adhesin specificity. J. Mol. Biol., 282, 543–556. Tetart, F., Repoila, F., Monod, C., and Krisch, H.M. (1996) Bacteriophage T4 host range is expanded by duplications of a small domain of the tail fiber adhesin. J. Mol. Biol., 258, 726–731. Mahichi, F., Synnott, A.J., Yamamichi, K., Osada, T., and Tanji, Y. (2009) Site-specific recombination of T2 phage using IP008 long tail fiber genes provides a targeted method for expanding host range while retaining lytic activity. FEMS Microbiol. Lett., 295, 211–217. Yoichi, M., Abe, M., Miyanaga, K., Unno, H., and Tanji, Y. (2005) Alteration of tail fiber protein gp38 enables T2 phage to infect Escherichia coli O157:H7. J. Biotechnol., 115, 101–107. Marti, R., Zurfluh, K., Hagens, S., Pianezzi, J., Klumpp, J., and Loessner, M.J. (2013) Long tail fibres of the novel broad-host-range T-even bacteriophage S16 specifically recognize Salmonella OmpC. Mol. Microbiol., 87, 818–834. Nguyen, A.H., Molineux, I.J., Springman, R., and Bull, J.J. (2012) Multiple genetic pathways to similar fitness limits during viral adaptation to a new host. Evolution, 66, 363–374. Cuervo, A., Pulido-Cid, M., Chagoyen, M., Arranz, R., Gonzalez-Garcia, V.A., Garcia-Doval, C. et al. (2013) Structural characterization of the bacteriophage T7 tail machinery. J. Biol. Chem., 288, 26290–26299. Pouillot, F., Blois, H., and Iris, F. (2010) Genetically engineered virulent phage banks in the detection and control of emergent pathogenic bacteria. Biosecur. Bioterror., 8, 155–169. References 173. Stern, A. and Sorek, R. (2011) The 174. 175. 176. 177. 178. 179. 180. 181. 182. phage-host arms race: shaping the evolution of microbes. Bioessays, 33, 43–51. Otsuka, Y. and Yonesaki, T. (2012) Dmd of bacteriophage T4 functions as an antitoxin against Escherichia coli LsoA and RnlA toxins. Mol. Microbiol., 83, 669–681. Friedman, D.I., Mozola, C.C., Beeri, K., Ko, C.C., and Reynolds, J.L. (2011) Activation of a prophage-encoded tyrosine kinase by a heterologous infecting phage results in a self-inflicted abortive infection. Mol. Microbiol., 82, 567–577. Grissa, I., Vergnaud, G., and Pourcel, C. (2007) The CRISPRdb database and tools to display CRISPRs and to generate dictionaries of spacers and repeats. BMC Bioinformatics, 8, 172. Makarova, K.S., Haft, D.H., Barrangou, R., Brouns, S.J., Charpentier, E., Horvath, P. et al. (2011) Evolution and classification of the CRISPR-Cas systems. Nat. Rev. Microbiol., 9, 467–477. Garneau, J.E., Dupuis, M.E., Villion, M., Romero, D.A., Barrangou, R., Boyaval, P. et al. (2010) The CRISPR/Cas bacterial immune system cleaves bacteriophage and plasmid DNA. Nature, 468, 67–71. Barrangou, R., Fremaux, C., Deveau, H., Richards, M., Boyaval, P., Moineau, S. et al. (2007) CRISPR provides acquired resistance against viruses in prokaryotes. Science, 315, 1709–1712. Jiang, W., Maniv, I., Arain, F., Wang, Y., Levin, B.R., and Marraffini, L.A. (2013) Dealing with the evolutionary downside of CRISPR immunity: bacteria and beneficial plasmids. PLoS Genet., 9, e1003844. Fineran, P.C. and Charpentier, E. (2012) Memory of viral infections by CRISPR-Cas adaptive immune systems: acquisition of new information. Virology, 434, 202–209. Hwang, W.Y., Fu, Y., Reyon, D., Maeder, M.L., Tsai, S.Q., Sander, J.D. et al. (2013) Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat. Biotechnol., 31, 227–229. 183. Wang, H., Yang, H., Shivalila, C.S., 184. 185. 186. 187. 188. 189. 190. 191. 192. Dawlaty, M.M., Cheng, A.W., Zhang, F. et al. (2013) One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering. Cell, 153, 910–918. Mali, P., Yang, L., Esvelt, K.M., Aach, J., Guell, M., DiCarlo, J.E. et al. (2013) RNA-guided human genome engineering via Cas9. Science, 339, 823–826. Cong, L., Ran, F.A., Cox, D., Lin, S., Barretto, R., Habib, N. et al. (2013) Multiplex genome engineering using CRISPR/Cas systems. Science, 339, 819–823. Cho, S.W., Kim, S., Kim, J.M., and Kim, J.S. (2013) Targeted genome engineering in human cells with the Cas9 RNA-guided endonuclease. Nat. Biotechnol., 31, 230–232. Jinek, M., East, A., Cheng, A., Lin, S., Ma, E., and Doudna, J. (2013) RNAprogrammed genome editing in human cells. Elife, 2, e00471. Gaj, T., Gersbach, C.A., and Barbas, C.F. III, (2013) ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends Biotechnol., 31 (7), 397–405. Pattanayak, V., Lin, S., Guilinger, J.P., Ma, E., Doudna, J.A., and Liu, D.R. (2013) High-throughput profiling of off-target DNA cleavage reveals RNAprogrammed Cas9 nuclease specificity. Nat. Biotechnol., 31, 839–843. Mali, P., Aach, J., Stranges, P.B., Esvelt, K.M., Moosburner, M., Kosuri, S. et al. (2013) CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Nat. Biotechnol., 31, 833–838. Hsu, P.D., Scott, D.A., Weinstein, J.A., Ran, F.A., Konermann, S., Agarwala, V. et al. (2013) DNA targeting specificity of RNA-guided Cas9 nucleases. Nat. Biotechnol., 31, 827–832. Fu, Y., Foden, J.A., Khayter, C., Maeder, M.L., Reyon, D., Joung, J.K. et al. (2013) High-frequency off-target mutagenesis induced by CRISPRCas nucleases in human cells. Nat. Biotechnol., 31, 822–826. 167 168 7 Synthetic Biology and Therapies for Infectious Diseases 193. Bikard, D., Jiang, W., Samai, P., 194. 195. 196. 197. 198. 199. 200. 201. 202. 203. 204. Hochschild, A., Zhang, F., and Marraffini, L.A. (2013) Programmable repression and activation of bacterial gene expression using an engineered CRISPR-Cas system. Nucleic Acids Res., 41, 7429–7437. Farzadfard, F., Perli, S.D., and Lu, T.K. (2013) Tunable and multifunctional eukaryotic transcription factors based on CRISPR/Cas. ACS Synth. Biol., 2, 604–613. Switala-Jelen, K., Dabrowska, K., Gorski, A., and Sliwa, L. (2002) Mutations in bacteriophage T4 genome. Acta Virol., 46, 57–62. Gibson, D.G. (2011) Gene and genome construction in yeast. Curr. Protoc. Mol. Biol., 94, 3.22.1–3.22.17. Lu, T.K., Koeris, M., Chevalier, B., Holder, J., McKensie, G., and Brownell, D. (2012) Recombinant phage and methods. US Patent US 13/627,060. Lu, T.K. and Collins, J.J. (2007) Dispersing biofilms with engineered enzymatic bacteriophage. Proc. Natl. Acad. Sci. U.S.A., 104, 11197–11202. Dwyer, D.J., Kohanski, M.A., Hayete, B., and Collins, J.J. (2007) Gyrase inhibitors induce an oxidative damage cellular death pathway in Escherichia coli. Mol. Syst. Biol., 3, 91. Kohanski, M.A., Dwyer, D.J., Hayete, B., Lawrence, C.A., and Collins, J.J. (2007) A common mechanism of cellular death induced by bactericidal antibiotics. Cell, 130, 797–810. Lu, T.K. and Collins, J.J. (2009) Engineered bacteriophage targeting gene networks as adjuvants for antibiotic therapy. Proc. Natl. Acad. Sci. U.S.A., 106, 4629–4634. Lin, A., Jimenez, J., Derr, J., Vera, P., Manapat, M.L., Esvelt, K.M. et al. (2011) Inhibition of bacterial conjugation by phage M13 and its protein g3p: quantitative analysis and model. PLoS One, 6, e19991. Young, R. (1992) Bacteriophage lysis: mechanism and regulation. Microbiol. Rev., 56, 430–481. Paul, V.D., Sundarrajan, S., Rajagopalan, S.S., Hariharan, S., 205. 206. 207. 208. 209. 210. 211. 212. 213. Kempashanaiah, N., Padmanabhan, S. et al. (2011) Lysis-deficient phages as novel therapeutic agents for controlling bacterial infection. BMC Microbiol., 11, 195. Hagens, S., Habel, A., von Ahsen, U., von Gabain, A., and Blasi, U. (2004) Therapy of experimental pseudomonas infections with a nonreplicating genetically modified phage. Antimicrob. Agents Chemother., 48, 3817–3822. Hagens, S. and Blasi, U. (2003) Genetically modified filamentous phage as bactericidal agents: a pilot study. Lett. Appl. Microbiol., 37, 318–323. Matsuda, T., Freeman, T.A., Hilbert, D.W., Duff, M., Fuortes, M., Stapleton, P.P. et al. (2005) Lysisdeficient bacteriophage therapy decreases endotoxin and inflammatory mediator release and improves survival in a murine peritonitis model. Surgery, 137, 639–646. Mueller, S., Papamichail, D., Coleman, J.R., Skiena, S., and Wimmer, E. (2006) Reduction of the rate of poliovirus protein synthesis through large-scale codon deoptimization causes attenuation of viral virulence by lowering specific infectivity. J. Virol., 80, 9687–9696. Merril, C.R., Biswas, B., Carlton, R., Jensen, N.C., Creed, G.J., Zullo, S. et al. (1996) Long-circulating bacteriophage as antibacterial agents. Proc. Natl. Acad. Sci. U.S.A., 93, 3188–3192. Brussow, H., Canchaya, C., and Hardt, W.D. (2004) Phages and the evolution of bacterial pathogens: from genomic rearrangements to lysogenic conversion. Microbiol. Mol. Biol. Rev., 68, 560–602, table of contents. Moons, P., Faster, D., and Aertsen, A. (2013) Lysogenic conversion and phage resistance development in phage exposed Escherichia coli biofilms. Viruses, 5, 150–161. Sternberg, N.L. and Maurer, R. (1991) Bacteriophage-mediated generalized transduction in Escherichia coli and Salmonella typhimurium. Methods Enzymol., 204, 18–43. Melnikov, A.A., Tchernov, A.P., Fodor, I., and Bayev, A.A. (1984) References 214. 215. 216. 217. 218. 219. 220. 221. 222. 223. Lambda phagemids and their transducing properties. Gene, 28, 29–35. Westwater, C., Schofield, D.A., Schmidt, M.G., Norris, J.S., and Dolan, J.W. (2002) Development of a P1 phagemid system for the delivery of DNA into Gram-negative bacteria. Microbiology, 148, 943–950. Edgar, R., Friedman, N., Molshanski-Mor, S., and Qimron, U. (2012) Reversing bacterial resistance to antibiotics by phage-mediated delivery of dominant sensitive genes. Appl. Environ. Microbiol., 78, 744–751. Qi, H., Lu, H.Q., Qiu, H.J., Petrenko, V., and Liu, A.H. (2012) Phagemid vectors for phage display: properties, characteristics and construction. J. Mol. Biol., 417, 129–143. Yanischperron, C., Vieira, J., and Messing, J. (1985) Improved M13 phage cloning vectors and host strains nucleotide-sequences of the M13mp18 and Puc19 vectors. Gene, 33, 103–119. Westwater, C., Kasman, L.M., Schofield, D.A., Werner, P.A., Dolan, J.W., Schmidt, M.G. et al. (2003) Use of genetically engineered phage to deliver antimicrobial agents to bacteria: an alternative therapy for treatment of bacterial infections. Antimicrob. Agents Chemother., 47, 1301–1307. Lennox, E.S. (1955) Transduction of linked genetic characters of the host by bacteriophage P1. Virology, 1, 190–206. Kittleson, J.T., Deloache, W., Cheng, H.Y., and Anderson, J.C. (2012) Scalable plasmid transfer using engineered P1-based phagemids. ACS Synth. Biol., 1, 583–589. Fairhead, H. (2009) Sasp gene delivery: a novel antibacterial approach. Drug News Perspect., 22, 197–203. Lu, T.K., Bowers, J., and Koeris, M.S. (2013) Advancing bacteriophagebased microbial diagnostics with synthetic biology. Trends Biotechnol., 31, 325–327. Haq, I.U., Chaudhry, W.N., Akhtar, M.N., Andleeb, S., and Qadri, I. (2012) Bacteriophages and their implications on future biotechnology: a review. Virol. J., 9, 9. 224. Bhattarai, S.R., Yoo, S.Y., Lee, S.W., and 225. 226. 227. 228. 229. 230. 231. 232. Dean, D. (2012) Engineered phagebased therapeutic materials inhibit Chlamydia trachomatis intracellular infection. Biomaterials, 33, 5166–5174. Embleton, M.L., Nair, S.P., Heywood, W., Menon, D.C., Cookson, B.D., and Wilson, M. (2005) Development of a novel targeting system for lethal photosensitization of antibiotic-resistant strains of Staphylococcus aureus. Antimicrob. Agents Chemother., 49, 3690–3696. Yacoby, I., Shamis, M., Bar, H., Shabat, D., and Benhar, I. (2006) Targeting antibacterial agents by using drug-carrying filamentous bacteriophages. Antimicrob. Agents Chemother., 50, 2087–2097. Seed, K.D., Lazinski, D.W., Calderwood, S.B., and Camilli, A. (2013) A bacteriophage encodes its own CRISPR/Cas adaptive response to evade host innate immunity. Nature, 494, 489–491. Fischetti, V.A. (2011) Exploiting what phage have evolved to control Grampositive pathogens. Bacteriophage, 1, 188–194. Djurkovic, S., Loeffler, J.M., and Fischetti, V.A. (2005) Synergistic killing of Streptococcus pneumoniae with the bacteriophage lytic enzyme Cpl-1 and penicillin or gentamicin depends on the level of penicillin resistance. Antimicrob. Agents Chemother., 49, 1225–1228. Loeffler, J.M. and Fischetti, V.A. (2003) Synergistic lethal effect of a combination of phage lytic enzymes with different activities on penicillinsensitive and -resistant Streptococcus pneumoniae strains. Antimicrob. Agents Chemother., 47, 375–377. Tafesh, A., Najami, N., Jadoun, J., Halahlih, F., Riepl, H., and Azaizeh, H. (2011) Synergistic antibacterial effects of polyphenolic compounds from olive mill wastewater. Evid. Based Complement. Alternat. Med., 2011, 431021. Daniel, A., Euler, C., Collin, M., Chahales, P., Gorelick, K.J., and Fischetti, V.A. (2010) Synergism 169 170 7 Synthetic Biology and Therapies for Infectious Diseases 233. 234. 235. 236. 237. 238. 239. 240. between a novel chimeric lysin and oxacillin protects against infection by methicillin-resistant Staphylococcus aureus. Antimicrob. Agents Chemother., 54, 1603–1612. Diaz, E., Lopez, R., and Garcia, J.L. (1990) Chimeric phage-bacterial enzymes: a clue to the modular evolution of genes. Proc. Natl. Acad. Sci. U.S.A., 87, 8125–8129. Donovan, D.M., Dong, S., Garrett, W., Rousseau, G.M., Moineau, S., and Pritchard, D.G. (2006) Peptidoglycan hydrolase fusions maintain their parental specificities. Appl. Environ. Microbiol., 72, 2988–2996. Rashel, M., Uchiyama, J., Ujihara, T., Uehara, Y., Kuramoto, S., Sugihara, S. et al. (2007) Efficient elimination of multidrug-resistant Staphylococcus aureus by cloned lysin derived from bacteriophage phi MR11. J. Infect. Dis., 196, 1237–1247. Gu, J., Xu, W., Lei, L., Huang, J., Feng, X., Sun, C. et al. (2011) LysGH15, a novel bacteriophage lysin, protects a murine bacteremia model efficiently against lethal methicillin-resistant Staphylococcus aureus infection. J. Clin. Microbiol., 49, 111–117. Lukacik, P., Barnard, T.J., Keller, P.W., Chaturvedi, K.S., Seddiki, N., Fairman, J.W. et al. (2012) Structural engineering of a phage lysin that targets Gram-negative pathogens. Proc. Natl. Acad. Sci. U.S.A., 109, 9857–9862. Cotter, P.D., Ross, R.P., and Hill, C. (2013) Bacteriocins - a viable alternative to antibiotics? Nat. Rev. Microbiol., 11, 95–105. Rakin, A., Saken, E., Harmsen, D., and Heesemann, J. (1994) The pesticin receptor of Yersinia enterocolitica: a novel virulence factor with dual function. Mol. Microbiol., 13, 253–263. Schubert, S., Rakin, A., Karch, H., Carniel, E., and Heesemann, J. (1998) Prevalence of the high-pathogenicity island of Yersinia species among Escherichia coli strains that are pathogenic to humans. Infect. Immun., 66, 480–485. 241. Wang, Y., Geer, L.Y., Chappey, C., 242. 243. 244. 245. 246. 247. 248. 249. 250. Kans, J.A., and Bryant, S.H. (2000) Cn3D: sequence and structure views for Entrez. Trends Biochem. Sci., 25, 300–302. Michel-Briand, Y. and Baysse, C. (2002) The pyocins of Pseudomonas aeruginosa. Biochimie, 84, 499–510. Scholl, D., Gebhart, D., Williams, S.R., Bates, A., and Mandrell, R. (2012) Genome sequence of E. coli O104:H4 leads to rapid development of a targeted antimicrobial agent against this emerging pathogen. PLoS One, 7, e33637. Ritchie, J.M., Greenwich, J.L., Davis, B.M., Bronson, R.T., Gebhart, D., Williams, S.R. et al. (2011) An Escherichia coli O157-specific engineered pyocin prevents and ameliorates infection by E. coli O157:H7 in an animal model of diarrheal disease. Antimicrob. Agents Chemother., 55, 5469–5474. Scholl, D., Cooley, M., Williams, S.R., Gebhart, D., Martin, D., Bates, A. et al. (2009) An engineered R-type pyocin is a highly specific and sensitive bactericidal agent for the food-borne pathogen Escherichia coli O157:H7. Antimicrob. Agents Chemother., 53, 3074–3080. Williams, S.R., Gebhart, D., Martin, D.W., and Scholl, D. (2008) Retargeting R-type pyocins to generate novel bactericidal protein complexes. Appl. Environ. Microbiol., 74, 3868–3876. Gebhart, D., Williams, S.R., Bishop-Lilly, K.A., Govoni, G.R., Willner, K.M., Butani, A. et al. (2012) Novel high-molecular-weight, R-type bacteriocins of Clostridium difficile. J. Bacteriol., 194, 6240–6247. Weinbauer, M.G. (2004) Ecology of prokaryotic viruses. FEMS Microbiol. Rev., 28, 127–181. Wood, W.B. and Revel, H.R. (1976) The genome of bacteriophage T4. Bacteriol. Rev., 40, 847–868. Fu, T.J., Geiduschek, E.P., and Kassavetis, G.A. (1998) Abortive initiation of transcription at a hybrid promoter. An analysis of the sliding clamp activator of bacteriophage T4 References 251. 252. 253. 254. 255. 256. 257. 258. 259. 260. late transcription, and a comparison of the sigma70 and T4 gp55 promoter recognition proteins. J. Biol. Chem., 273, 34042–34048. Savalia, D., Westblade, L.F., Goel, M., Florens, L., Kemp, P., Akulenko, N. et al. (2008) Genomic and proteomic analysis of phiEco32, a novel Escherichia coli bacteriophage. J. Mol. Biol., 377, 774–789. Jamalludeen, N., Kropinski, A.M., Johnson, R.P., Lingohr, E., Harel, J., and Gyles, C.L. (2008) Complete genomic sequence of bacteriophage phiEcoMGJ1, a novel phage that has myovirus morphology and a podovirus-like RNA polymerase. Appl. Environ. Microbiol., 74, 516–525. Studier, F.W. (1972) Bacteriophage T7. Science, 176, 367–376. Yuzenkova, J., Nechaev, S., Berlin, J., Rogulja, D., Kuznedelov, K., Inman, R. et al. (2003) Genome of Xanthomonas oryzae bacteriophage Xp10: an odd Todd phage. J. Mol. Biol., 330, 735–748. Kulakov, L.A., Ksenzenko, V.N., Shlyapnikov, M.G., Kochetkov, V.V., Del Casale, A., Allen, C.C. et al. (2009) Genomes of phiKMV-like viruses of Pseudomonas aeruginosa contain localized single-strand interruptions. Virology, 391, 1–4. Fischbach, M.A., Bluestone, J.A., and Lim, W.A. (2013) Cell-based therapeutics: the next pillar of medicine. Sci. Transl. Med., 5, 179ps7. Guerrero, R., Pedros-Alio, C., Esteve, I., Mas, J., Chase, D., and Margulis, L. (1986) Predatory prokaryotes: predation and primary consumption evolved in bacteria. Proc. Natl. Acad. Sci. U.S.A., 83, 2138–2142. Jurkevitch, E. (2012) Isolation and classification of Bdellovibrio and like organisms. Curr. Protoc. Microbiol., 26, 7B.1.1–7B.1.20. Pasternak, Z., Njagi, M., Shani, Y., Chanyi, R., Rotem, O., Lurie-Weinberger, M.N. et al. (2013) In and out: an analysis of epibiotic vs periplasmic bacterial predators. ISME J., 8 (3), 625–635. Richardson, I.R. (1990) The incidence of Bdellovibrio spp. in man-made water 261. 262. 263. 264. 265. 266. 267. 268. 269. systems: coexistence with legionellas. J. Appl. Bacteriol., 69, 134–140. Richards, G.P., Fay, J.P., Dickens, K.A., Parent, M.A., Soroka, D.S., and Boyd, E.F. (2012) Predatory bacteria as natural modulators of Vibrio parahaemolyticus and Vibrio vulnificus in seawater and oysters. Appl. Environ. Microbiol., 78, 7455–7466. Iebba, V., Santangelo, F., Totino, V., Nicoletti, M., Gagliardi, A., De Biase, R.V. et al. (2013) Higher prevalence and abundance of Bdellovibrio bacteriovorus in the human gut of healthy subjects. PLoS One, 8, e61608. Kadouri, D.E., To, K., Shanks, R.M., and Doi, Y. (2013) Predatory bacteria: a potential ally against multidrugresistant Gram-negative pathogens. PLoS One, 8, e63397. Chu, W.H. and Zhu, W. (2010) Isolation of Bdellovibrio as biological therapeutic agents used for the treatment of Aeromonas hydrophila infection in fish. Zoonoses Public Health, 57, 258–264. Atterbury, R.J., Hobley, L., Till, R., Lambert, C., Capeness, M.J., Lerner, T.R. et al. (2011) Effects of orally administered Bdellovibrio bacteriovorus on the well-being and Salmonella colonization of young chicks. Appl. Environ. Microbiol., 77, 5794–5803. Steyert, S.R. and Pineiro, S.A. (2007) Development of a novel genetic system to create markerless deletion mutants of Bdellovibrio bacteriovorus. Appl. Environ. Microbiol., 73, 4717–4724. Sockett, R.E. and Lambert, C. (2004) Bdellovibrio as therapeutic agents: a predatory renaissance? Nat. Rev. Microbiol., 2, 669–675. Nermes, M., Salminen, S., and Isolauri, E. (2013) Is there a role for probiotics in the prevention or treatment of food allergy? Curr. Allergy Asthma Rep., 13, 622–630. Friedman, G. (2012) The role of probiotics in the prevention and treatment of antibiotic-associated diarrhea and Clostridium difficile colitis. Gastroenterol. Clin. North Am., 41, 763–779. 171 172 7 Synthetic Biology and Therapies for Infectious Diseases 270. Veerappan, G.R., Betteridge, J., and 271. 272. 273. 274. 275. 276. 277. 278. 279. Young, P.E. (2012) Probiotics for the treatment of inflammatory bowel disease. Curr. Gastroenterol. Rep., 14, 324–333. Jonkers, D., Penders, J., Masclee, A., and Pierik, M. (2012) Probiotics in the management of inflammatory bowel disease: a systematic review of intervention studies in adult patients. Drugs, 72, 803–823. Carey, C.M. and Kostrzynska, M. (2013) Lactic acid bacteria and bifidobacteria attenuate the proinflammatory response in intestinal epithelial cells induced by Salmonella enterica serovar Typhimurium. Can. J. Microbiol., 59, 9–17. Carey, C.M., Kostrzynska, M., Ojha, S., and Thompson, S. (2008) The effect of probiotics and organic acids on Shiga-toxin 2 gene expression in enterohemorrhagic Escherichia coli O157:H7. J. Microbiol. Methods, 73, 125–132. Adams, C.A. (2010) The probiotic paradox: live and dead cells are biological response modifiers. Nutr. Res. Rev., 23, 37–46. Aggarwal, J., Swami, G., and Kumar, M. (2013) Probiotics and their effects on metabolic diseases: an update. J. Clin. Diagn. Res., 7, 173–177. Szachta, P., Ignys, I., and Cichy, W. (2011) An evaluation of the ability of the probiotic strain Lactobacillus rhamnosus GG to eliminate the gastrointestinal carrier state of vancomycin-resistant enterococci in colonized children. J. Clin. Gastroenterol., 45, 872–877. Sanders, M.E., Heimbach, J.T., Pot, B., Tancredi, D.J., Lenoir-Wijnkoop, I., Lahteenmaki-Uutela, A. et al. (2011) Health claims substantiation for probiotic and prebiotic products. Gut Microbes, 2, 127–133. Sanders, M.E. and Levy, D.D. (2011) The science and regulations of probiotic food and supplement product labeling. Ann. N. Y. Acad. Sci., 1219 (Suppl. 1), E1–E23. Duan, F. and March, J.C. (2010) Engineered bacterial communication 280. 281. 282. 283. 284. 285. 286. 287. 288. 289. 290. prevents Vibrio cholerae virulence in an infant mouse model. Proc. Natl. Acad. Sci. U.S.A., 107, 11260–11264. Schuster, M., Sexton, D.J., Diggle, S.P., and Greenberg, E.P. (2013) Acylhomoserine lactone quorum sensing: from evolution to application. Annu. Rev. Microbiol., 67, 43–63. Fuqua, W.C., Winans, S.C., and Greenberg, E.P. (1994) Quorum sensing in bacteria: the LuxR-LuxI family of cell density-responsive transcriptional regulators. J. Bacteriol., 176, 269–275. Saeidi, N., Wong, C.K., Lo, T.M., Nguyen, H.X., Ling, H., Leong, S.S. et al. (2011) Engineering microbes to sense and eradicate Pseudomonas aeruginosa, a human pathogen. Mol. Syst. Biol., 7, 521. Gupta, S., Bram, E.E., and Weiss, R. (2013) Genetically programmable pathogen sense and destroy. ACS Synth. Biol., 2 (12), 715–723. Hwang, I.Y., Tan, M.H., Koh, E., Ho, C.L., Poh, C.L., and Chang, M.W. (2013) Reprogramming microbes to be pathogen-seeking killers. ACS Synth. Biol., 3 (4), 228–237. Daniel, R., Rubens, J., Sarpeshkar, R., and Lu, T.K. (2013) Synthetic analog computation in living cells. Nature, 1497 (7451), 619–623. Siuti, P., Yazbek, J., and Lu, T.K. (2013) Synthetic circuits integrating logic and memory in living cells. Nat. Biotechnol., 31 (5), 448–452. Benenson, Y. (2012) Biomolecular computing systems: principles, progress and potential. Nat. Rev. Genet., 13, 455–468. Lu, T.K., Khalil, A.S., and Collins, J.J. (2009) Next-generation synthetic gene networks. Nat. Biotechnol., 27, 1139–1150. Gough, E., Shaikh, H., and Manges, A.R. (2011) Systematic review of intestinal microbiota transplantation (fecal bacteriotherapy) for recurrent Clostridium difficile infection. Clin. Infect. Dis., 53, 994–1002. Lemon, K.P., Armitage, G.C., Relman, D.A., and Fischbach, M.A. (2012) Microbiota-targeted therapies: References 291. 292. 293. 294. 295. 296. 297. 298. 299. 300. 301. an ecological perspective. Sci. Transl. Med., 4, 137rv5. Demain, A.L. (1999) Pharmaceutically active secondary metabolites of microorganisms. Appl. Microbiol. Biotechnol., 52, 455–463. Alexander, F. (1929) On the antibacetrial action of cultures of a penicillium, with special references to their use in the isolation of B. influenzae. Br. J. Exp. Pathol., 10, 226–236. Bentley, R. (2005) The development of penicillin: genesis of a famous antibiotic. Perspect. Biol. Med., 48, 444–452. Fleming, A. (2001) On the antibacterial action of cultures of a penicillium, with special reference to their use in the isolation of B. influenzæ. Bull. World Health Organ., 79, 780–790. Bergmann, S., Schumann, J., Scherlach, K., Lange, C., Brakhage, A.A., and Hertweck, C. (2007) Genomics-driven discovery of PKS-NRPS hybrid metabolites from Aspergillus nidulans. Nat. Chem. Biol., 3, 213–217. Corre, C. and Challis, G.L. (2009) New natural product biosynthetic chemistry discovered by genome mining. Nat. Prod. Rep., 26, 977–986. Ganesan, A. (2008) ChemInform abstract: natural products and combinatorial chemistry — An uneasy past but a glorious future. ChemInform, 39, 37–52. Zakeri, B. and Lu, T.K. (2012) Synthetic biology of antimicrobial discovery. ACS Synth. Biol., 2 (7), 358–372. Medema, M.H., Breitling, R., and Takano, E. (2011) Synthetic biology in Streptomyces bacteria. Methods Enzymol., 497, 485–502. Clardy, J., Fischbach, M.A., and Walsh, C.T. (2006) New antibiotics from bacterial natural products. Nat. Biotechnol., 24, 1541–1550. Fischbach, M.A. and Walsh, C.T. (2006) Assembly-line enzymology for polyketide and nonribosomal Peptide antibiotics: logic, machinery, and mechanisms. Chem. Rev., 106, 3468–3496. 302. Hertweck, C. (2009) The biosynthetic 303. 304. 305. 306. 307. 308. 309. 310. 311. logic of polyketide diversity. Angew. Chem. Int. Ed., 48, 4688–4716. Mootz, H.D., Schwarzer, D., and Marahiel, M.A. (2002) Ways of assembling complex natural products on modular nonribosomal peptide synthetases. ChemBioChem, 3, 490–504. Weissman, K.J. (2004) Polyketide biosynthesis: understanding and exploiting modularity. Philos. Trans. A Math. Phys. Eng. Sci., 362, 2671–2690. Zerikly, M. and Challis, G.L. (2009) Strategies for the discovery of new natural products by genome mining. ChemBioChem, 10, 625–633. Schroeckh, V., Scherlach, K., Nutzmann, H.W., Shelest, E., Schmidt-Heck, W., Schuemann, J. et al. (2009) Intimate bacterial-fungal interaction triggers biosynthesis of archetypal polyketides in Aspergillus nidulans. Proc. Natl. Acad. Sci. U.S.A., 106, 14558–14563. Starcevic, A., Zucko, J., Simunkovic, J., Long, P.F., Cullum, J., and Hranueli, D. (2008) ClustScan: an integrated program package for the semi-automatic annotation of modular biosynthetic gene clusters and in silico prediction of novel chemical structures. Nucleic Acids Res., 36, 6882–6892. Li, M.H., Ung, P.M., Zajkowski, J., Garneau-Tsodikova, S., and Sherman, D.H. (2009) Automated genome mining for natural products. BMC Bioinformatics, 10, 185. Medema, M.H., Blin, K., Cimermancic, P., de Jager, V., Zakrzewski, P., Fischbach, M.A. et al (2011) antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences. Nucleic Acids Res., 39, W339–W346. Marchler-Bauer, A., Anderson, J.B., Chitsaz, F., Derbyshire, M.K., DeWeese-Scott, C., Fong, J.H. et al. (2009) CDD: specific functional annotation with the Conserved Domain Database. Nucleic Acids Res., 37, D205–D210. Marchler-Bauer, A. and Bryant, S.H. (2004) CD-Search: protein domain 173 174 7 Synthetic Biology and Therapies for Infectious Diseases 312. 313. 314. 315. 316. 317. 318. 319. 320. 321. annotations on the fly. Nucleic Acids Res., 32, W327–W331. Marchler-Bauer, A., Lu, S., Anderson, J.B., Chitsaz, F., Derbyshire, M.K., DeWeese-Scott, C. et al. (2011) CDD: a Conserved Domain Database for the functional annotation of proteins. Nucleic Acids Res., 39, D225–D229. Letunic, I., Doerks, T., and Bork, P. (2009) SMART 6: recent updates and new developments. Nucleic Acids Res., 37, D229–D232. Schultz, J., Milpetz, F., Bork, P., and Ponting, C.P. (1998) SMART, a simple modular architecture research tool: identification of signaling domains. Proc. Natl. Acad. Sci., 95, 5857–5864. Rausch, C., Weber, T., Kohlbacher, O., Wohlleben, W., and Huson, D.H. (2005) Specificity prediction of adenylation domains in nonribosomal peptide synthetases (NRPS) using transductive support vector machines (TSVMs). Nucleic Acids Res., 33, 5799–5808. Rottig, M., Medema, M.H., Blin, K., Weber, T., Rausch, C., and Kohlbacher, O. (2011) NRPSpredictor2 – a web server for predicting NRPS adenylation domain specificity. Nucleic Acids Res., 39, W362–W367. Ansari, M.Z., Yadav, G., Gokhale, R.S., and Mohanty, D. (2004) NRPS-PKS: a knowledge-based resource for analysis of NRPS/PKS megasynthases. Nucleic Acids Res., 32, W405–W413. Anand, S., Prasad, M.V., Yadav, G., Kumar, N., Shehara, J., Ansari, M.Z. et al. (2010) SBSPKS: structure based sequence analysis of polyketide synthases. Nucleic Acids Res., 38, W487–W496. Florence, S. and Jürgen, B. (2006) Combinatorial Synthesis of Natural ProductBased Libraries, CRC Press, pp. 53–64. Wilkinson, B. and Micklefield, J. (2007) Mining and engineering naturalproduct biosynthetic pathways. Nat. Chem. Biol., 3, 379–386. Bucar, F., Wube, A., and Schmid, M. (2013) Natural product isolation – how to get from biological material to 322. 323. 324. 325. 326. 327. 328. 329. 330. pure compounds. Nat. Prod. Rep., 30, 525–545. Winter, J.M., Behnken, S., and Hertweck, C. (2011) Genomics-inspired discovery of natural products. Curr. Opin. Chem. Biol., 15, 22–31. Kersten, R.D., Yang, Y.L., Xu, Y., Cimermancic, P., Nam, S.J., Fenical, W. et al. (2011) A mass spectrometryguided genome mining approach for natural product peptidogenomics. Nat. Chem. Biol., 7, 794–802. Ibrahim, A., Yang, L., Johnston, C., Liu, X., Ma, B., and Magarvey, N.A. (2012) Dereplicating nonribosomal peptides using an informatic search algorithm for natural products (iSNAP) discovery. Proc. Natl. Acad. Sci. U.S.A., 109, 19196–19201. Grigoriev, I.V., Nordberg, H., Shabalov, I., Aerts, A., Cantor, M., Goodstein, D. et al. (2012) The genome portal of the Department of Energy Joint Genome Institute. Nucleic Acids Res., 40, D26–D32. Ward, B.B. (2002) How many species of prokaryotes are there? Proc. Natl. Acad. Sci. U.S.A., 99, 10234–10236. Yin, J., Straight, P.D., Hrvatin, S., Dorrestein, P.C., Bumpus, S.B., Jao, C. et al. (2007) Genome-wide highthroughput mining of natural-product biosynthetic gene clusters by phage display. Chem. Biol., 14, 303–312. Hildebrand, M., Waggoner, L.E., Lim, G.E., Sharp, K.H., Ridley, C.P., and Haygood, M.G. (2004) Approaches to identify, clone, and express symbiont bioactive metabolite genes. Nat. Prod. Rep., 21, 122–142. Kalaitzis, J.A., Lauro, F.M., and Neilan, B.A. (2009) Mining cyanobacterial genomes for genes encoding complex biosynthetic pathways. Nat. Prod. Rep., 26, 1447–1465. Schirmer, A., Gadkari, R., Reeves, C.D., Ibrahim, F., DeLong, E.F., and Hutchinson, C.R. (2005) Metagenomic analysis reveals diverse polyketide synthase gene clusters in microorganisms associated with the marine sponge Discodermia dissoluta. Appl. Environ. Microbiol., 71, 4840–4849. References 331. Brady, S.F., Simmons, L., Kim, J.H., and 332. 333. 334. 335. 336. 337. 338. 339. 340. 341. Schmidt, E.W. (2009) Metagenomic approaches to natural products from free-living and symbiotic organisms. Nat. Prod. Rep., 26, 1488–1503. Ehrenreich, I.M., Waterbury, J.B., and Webb, E.A. (2005) Distribution and diversity of natural product genes in marine and freshwater cyanobacterial cultures and genomes. Appl. Environ. Microbiol., 71, 7401–7413. Gontang, E.A., Gaudencio, S.P., Fenical, W., and Jensen, P.R. (2010) Sequence-based analysis of secondarymetabolite biosynthesis in marine actinobacteria. Appl. Environ. Microbiol., 76, 2487–2499. Savic, M. and Vasiljevic, B. (2006) Targeting polyketide synthase gene pool within actinomycetes: new degenerate primers. J. Ind. Microbiol. Biotechnol., 33, 423–430. Walsh, C.T. (2002) Combinatorial biosynthesis of antibiotics: challenges and opportunities. ChemBioChem, 3, 124–134. Wang, J., Xiong, Z., Meng, H., Wang, Y., and Wang, Y. (2012) Synthetic biology triggers new era of antibiotics development. Subcell. Biochem., 64, 95–114. Winter, J.M. and Tang, Y. (2012) Synthetic biological approaches to natural product biosynthesis. Curr. Opin. Biotechnol., 23, 736–743. Wong, F.T. and Khosla, C. (2012) Combinatorial biosynthesis of polyketides – a perspective. Curr. Opin. Chem. Biol., 16, 117–123. Ziermann, R. and Betlach, M.C. (1999) Recombinant polyketide synthesis in Streptomyces: engineering of improved host strains. Biotechniques, 26, 106–110. Chen, Y., Smanski, M.J., and Shen, B. (2010) Improvement of secondary metabolite production in Streptomyces by manipulating pathway regulation. Appl. Microbiol. Biotechnol., 86, 19–25. Xue, Y., Zhao, L., Liu, H.W., and Sherman, D.H. (1998) A gene cluster for macrolide antibiotic biosynthesis 342. 343. 344. 345. 346. 347. 348. 349. 350. 351. in Streptomyces venezuelae: architecture of metabolic diversity. Proc. Natl. Acad. Sci. U.S.A., 95, 12111–12116. Fields, S. and Johnston, M. (2005) Cell biology. Whither model organism research? Science, 307, 1885–1886. Nawy, T. (2011) Non–model organisms. Nat. Methods, 9, 37. Ro, D.K., Paradise, E.M., Ouellet, M., Fisher, K.J., Newman, K.L., Ndungu, J.M. et al. (2006) Production of the antimalarial drug precursor artemisinic acid in engineered yeast. Nature, 440, 940–943. Pfeifer, B.A., Admiraal, S.J., Gramajo, H., Cane, D.E., and Khosla, C. (2001) Biosynthesis of complex polyketides in a metabolically engineered strain of E. coli. Science, 291, 1790–1792. Pickens, L.B., Tang, Y., and Chooi, Y.H. (2011) Metabolic engineering for the production of natural products. Annu. Rev. Chem. Biomol. Eng., 2, 211–236. Malla, S., Niraula, N.P., Liou, K., and Sohng, J.K. (2010) Improvement in doxorubicin productivity by overexpression of regulatory genes in Streptomyces peucetius. Res. Microbiol., 161, 109–117. Smanski, M.J., Peterson, R.M., Rajski, S.R., and Shen, B. (2009) Engineered Streptomyces platensis strains that overproduce antibiotics platensimycin and platencin. Antimicrob. Agents Chemother., 53, 1299–1304. Ehmann, D.E., Shaw-Reid, C.A., Losey, H.C., and Walsh, C.T. (2000) The EntF and EntE adenylation domains of Escherichia coli enterobactin synthetase: sequestration and selectivity in acyl-AMP transfers to thiolation domain cosubstrates. Proc. Natl. Acad. Sci. U.S.A., 97, 2509–2514. Dittmann, J., Wenger, R.M., Kleinkauf, H., and Lawen, A. (1994) Mechanism of cyclosporin A biosynthesis. Evidence for synthesis via a single linear undecapeptide precursor. J. Biol. Chem., 269, 2841–2846. Gibson, D.G., Young, L., Chuang, R.Y., Venter, J.C., Hutchison, C.A. III, and Smith, H.O. (2009) Enzymatic assembly of DNA molecules up to several 175 176 7 Synthetic Biology and Therapies for Infectious Diseases 352. 353. 354. 355. 356. 357. 358. 359. hundred kilobases. Nat. Methods, 6, 343–345. Engler, C., Kandzia, R., and Marillonnet, S. (2008) A one pot, one step, precision cloning method with high throughput capability. PLoS One, 3, e3647. Pelzer, S., Wohlert, S.E., and Vente, A. (2005) Tool-box: tailoring enzymes for bio-combinatorial lead development and as markers for genome-based natural product lead discovery. Ernst Schering Res. Found. Workshop, 233–259. Zhang, W., Li, Y., and Tang, Y. (2008) Engineered biosynthesis of bacterial aromatic polyketides in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A., 105, 20683–20688. Watanabe, K., Hotta, K., Nakaya, M., Praseuth, A.P., Wang, C.C., Inada, D. et al. (2009) Escherichia coli allows efficient modular incorporation of newly isolated quinomycin biosynthetic enzyme into echinomycin biosynthetic pathway for rational design and synthesis of potent antibiotic unnatural natural product. J. Am. Chem. Soc., 131, 9347–9353. Na, D., Kim, T.Y., and Lee, S.Y. (2010) Construction and optimization of synthetic pathways in metabolic engineering. Curr. Opin. Microbiol., 13, 363–370. Westfall, P.J., Pitera, D.J., Lenihan, J.R., Eng, D., Woolard, F.X., Regentin, R. et al. (2012) Production of amorphadiene in yeast, and its conversion to dihydroartemisinic acid, precursor to the antimalarial agent artemisinin. Proc. Natl. Acad. Sci. U.S.A., 109, E111–E118. Hale, V., Keasling, J.D., Renninger, N., and Diagana, T.T. (2007) Microbially derived artemisinin: a biotechnology solution to the global problem of access to affordable antimalarial drugs. Am. J. Trop. Med. Hyg., 77, 198–202. Reyburn, H. (2010) New WHO guidelines for the treatment of malaria. Br. Med. J., 340, c2637. 360. Kindermans, J.M., Pilloy, J., Olliaro, P., 361. 362. 363. 364. 365. 366. 367. 368. and Gomes, M. (2007) Ensuring sustained ACT production and reliable artemisinin supply. Malar. J., 6, 125. Du, J., Shao, Z., and Zhao, H. (2011) Engineering microbial factories for synthesis of value-added products. J. Ind. Microbiol. Biotechnol., 38, 873–890. Jackson, B.E., Hart-Wells, E.A., and Matsuda, S.P. (2003) Metabolic engineering to produce sesquiterpenes in yeast. Org. Lett., 5, 1629–1632. Newman, J.D., Marshall, J., Chang, M., Nowroozi, F., Paradise, E., Pitera, D. et al. (2006) High-level production of amorpha-4,11-diene in a two-phase partitioning bioreactor of metabolically engineered Escherichia coli. Biotechnol. Bioeng., 95, 684–691. Anthony, J.R., Anthony, L.C., Nowroozi, F., Kwon, G., Newman, J.D., and Keasling, J.D. (2009) Optimization of the mevalonate-based isoprenoid biosynthetic pathway in Escherichia coli for production of the anti-malarial drug precursor amorpha-4,11-diene. Metab. Eng., 11, 13–19. Chang, M.C., Eachus, R.A., Trieu, W., Ro, D.K., and Keasling, J.D. (2007) Engineering Escherichia coli for production of functionalized terpenoids using plant P450s. Nat. Chem. Biol., 3, 274–277. Ro, D.K., Ouellet, M., Paradise, E.M., Burd, H., Eng, D., Paddon, C.J. et al. (2008) Induction of multiple pleiotropic drug resistance genes in yeast engineered to produce an increased level of anti-malarial drug precursor, artemisinic acid. BMC Biotechnol., 8, 83. Baltz, R.H. (2009) Daptomycin: mechanisms of action and resistance, and biosynthetic engineering. Curr. Opin. Chem. Biol., 13, 144–151. Straus, S.K. and Hancock, R.E. (2006) Mode of action of the new antibiotic for Gram-positive pathogens daptomycin: comparison with cationic antimicrobial peptides and lipopeptides. Biochim. Biophys. Acta, 1758, 1215–1223. References 369. Penn, J., Li, X., Whiting, A., Latif, M., 370. 371. 372. 373. 374. 375. 376. 377. 378. Gibson, T., Silva, C.J. et al. (2006) Heterologous production of daptomycin in Streptomyces lividans. J. Ind. Microbiol. Biotechnol., 33, 121–128. Nguyen, K.T., He, X., Alexander, D.C., Li, C., Gu, J.Q., Mascio, C. et al. (2010) Genetically engineered lipopeptide antibiotics related to A54145 and daptomycin with improved properties. Antimicrob. Agents Chemother., 54, 1404–1413. Fukuda, D.S., Du Bus, R.H., Baker, P.J., Berry, D.M., and Mynderse, J.S. (1990) A54145, a new lipopeptide antibiotic complex: isolation and characterization. J. Antibiot. (Tokyo), 43, 594–600. Watanabe, K., Hotta, K., Praseuth, A.P., Koketsu, K., Migita, A., Boddy, C.N. et al. (2006) Total biosynthesis of antitumor nonribosomal peptides in Escherichia coli. Nat. Chem. Biol., 2, 423–428. Low, C.M.L., Drew, H.R., and Waring, M.J. (1984) Sequence-specific binding of echinomycin to DNA: evidence for conformational changes affecting flanking sequences. Nucleic Acids Res., 12, 4865–4879. Foster, B., Clagett-Carr, K., Shoemaker, D.D., Suffness, M., Plowman, J., Trissel, L. et al. (1985) Echinomycin: the first bifunctional intercalating agent in clinical trials. Invest. New Drugs, 3, 403–410. Formica, J.V. and Waring, M.J. (1983) Effect of phosphate and amino acids on echinomycin biosynthesis by Streptomyces echinatus. Antimicrob. Agents Chemother., 24, 735–741. Wilke, M.S., Lovering, A.L., and Strynadka, N.C. (2005) Beta-lactam antibiotic resistance: a current structural perspective. Curr. Opin. Microbiol., 8, 525–533. Poole, K. (2004) Resistance to betalactam antibiotics. Cell. Mol. Life Sci., 61, 2200–2223. Li, R. and Townsend, C.A. (2006) Rational strain improvement for enhanced clavulanic acid production by genetic engineering of the glycolytic pathway in Streptomyces clavuligerus. Metab. Eng., 8, 240–252. 379. Gomez-Escribano, J.P., Martin, J.F., 380. 381. 382. 383. 384. 385. 386. Hesketh, A., Bibb, M.J., and Liras, P. (2008) Streptomyces clavuligerus relAnull mutants overproduce clavulanic acid and cephamycin C: negative regulation of secondary metabolism by (p)ppGpp. Microbiology, 154, 744–755. Medema, M.H., Alam, M.T., Heijne, W.H., van den Berg, M.A., Muller, U., Trefzer, A. et al. (2011) Genome-wide gene expression changes in an industrial clavulanic acid overproduction strain of Streptomyces clavuligerus. Microb. Biotechnol., 4, 300–305. Burg, R.W., Miller, B.M., Baker, E.E., Birnbaum, J., Currie, S.A., Hartman, R. et al. (1979) Avermectins, new family of potent anthelmintic agents: producing organism and fermentation. Antimicrob. Agents Chemother., 15, 361–367. Yoon, Y.J., Kim, E.S., Hwang, Y.S., and Choi, C.Y. (2004) Avermectin: biochemical and molecular basis of its biosynthesis and regulation. Appl. Microbiol. Biotechnol., 63, 626–634. Ikeda, H., Nonomiya, T., Usami, M., Ohta, T., and Omura, S. (1999) Organization of the biosynthetic gene cluster for the polyketide anthelmintic macrolide avermectin in Streptomyces avermitilis. Proc. Natl. Acad. Sci. U.S.A., 96, 9509–9514. Zhuo, Y., Zhang, W., Chen, D., Gao, H., Tao, J., Liu, M. et al. (2010) Reverse biological engineering of hrdB to enhance the production of avermectins in an industrial strain of Streptomyces avermitilis. Proc. Natl. Acad. Sci. U.S.A., 107, 11250–11254. Goudie, A.C., Evans, N.A., Gration, K.A., Bishop, B.F., Gibson, S.P., Holdom, K.S. et al. (1993) Doramectin – a potent novel endectocide. Vet. Parasitol., 49, 5–15. Dutton, C.J., Gibson, S.P., Goudie, A.C., Holdom, K.S., Pacey, M.S., Ruddock, J.C. et al. (1991) Novel avermectins produced by mutational biosynthesis. J. Antibiot. (Tokyo), 44, 357–365. 177 178 7 Synthetic Biology and Therapies for Infectious Diseases 387. Wang, J.B., Pan, H.X., and Tang, G.L. 388. 389. 390. 391. 392. 393. 394. 395. 396. (2011) Production of doramectin by rational engineering of the avermectin biosynthetic pathway. Bioorg. Med. Chem. Lett., 21, 3320–3323. Zhang, X., Chen, Z., Li, M., Wen, Y., Song, Y., and Li, J. (2006) Construction of ivermectin producer by domain swaps of avermectin polyketide synthase in Streptomyces avermitilis. Appl. Microbiol. Biotechnol., 72, 986–994. Omura, S. and Crump, A. (2004) The life and times of ivermectin - a success story. Nat. Rev. Microbiol., 2, 984–989. Niraula, N.P., Kim, S.H., Sohng, J.K., and Kim, E.S. (2010) Biotechnological doxorubicin production: pathway and regulation engineering of strains for enhanced production. Appl. Microbiol. Biotechnol., 87, 1187–1194. Malla, S., Niraula, N.P., Singh, B., Liou, K., and Sohng, J.K. (2010) Limitations in doxorubicin production from Streptomyces peucetius. Microbiol. Res., 165, 427–435. Hutchinson, C.R. and Colombo, A.L. (1999) Genetic engineering of doxorubicin production in Streptomyces peucetius: a review. J. Ind. Microbiol. Biotechnol., 23, 647–652. Malla, S., Niraula, N.P., Liou, K., and Sohng, J.K. (2010) Self-resistance mechanism in Streptomyces peucetius: overexpression of drrA, drrB and drrC for doxorubicin enhancement. Microbiol. Res., 165, 259–267. Scotti, C. and Hutchinson, C.R. (1996) Enhanced antibiotic production by manipulation of the Streptomyces peucetius dnrH and dnmT genes involved in doxorubicin (adriamycin) biosynthesis. J. Bacteriol., 178, 7316–7321. Lomovskaya, N., Otten, S.L., Doi-Katayama, Y., Fonstein, L., Liu, X.C., Takatsu, T. et al. (1999) Doxorubicin overproduction in Streptomyces peucetius: cloning and characterization of the dnrU ketoreductase and dnrV genes and the doxA cytochrome P-450 hydroxylase gene. J. Bacteriol., 181, 305–318. Loftus, P. (2011) J&J Is Short of Cancer Drug Doxil, 29 May, 397. 398. 399. 400. 401. 402. 403. 404. 405. 2013, http://online.wsj.com/article/ SB100014240531119035549045764 60290484704816.html (accessed 19 April 2014). McDaniel, R., Ebert-Khosla, S., Hopwood, D., and Khosla, C. (1993) Engineered biosynthesis of novel polyketides. Science, 262, 1546–1550. Takahashi, Y. (2002) Streptomyces avermectinius sp. nov., an avermectinproducing strain. Int. J. Syst. Evol. Microbiol., 52, 2163–2168. Komatsu, M., Uchiyama, T., Omura, S., Cane, D.E., and Ikeda, H. (2010) Genome-minimized Streptomyces host for the heterologous expression of secondary metabolism. Proc. Natl. Acad. Sci. U.S.A., 107, 2646–2651. Gomez-Escribano, J.P. and Bibb, M.J. (2011) Engineering Streptomyces coelicolor for heterologous expression of secondary metabolite gene clusters. Microb. Biotechnol., 4, 207–215. Shima, J., Hesketh, A., Okamoto, S., Kawamoto, S., and Ochi, K. (1996) Induction of actinorhodin production by rpsL (encoding ribosomal protein S12) mutations that confer streptomycin resistance in Streptomyces lividans and Streptomyces coelicolor A3(2). J. Bacteriol., 178, 7276–7284. Hu, H., Zhang, Q., and Ochi, K. (2002) Activation of antibiotic biosynthesis by specified mutations in the rpoB gene (encoding the RNA polymerase beta subunit) of Streptomyces lividans. J. Bacteriol., 184, 3984–3991. Wang, J., Zhang, Y., Chen, Y., Lin, M., and Lin, Z. (2012) Global regulator engineering significantly improved Escherichia coli tolerances toward inhibitors of lignocellulosic hydrolysates. Biotechnol. Bioeng., 109, 3133–3142. Coeffet-Le Gal, M.F., Thurston, L., Rich, P., Miao, V., and Baltz, R.H. (2006) Complementation of daptomycin dptA and dptD deletion mutations in trans and production of hybrid lipopeptide antibiotics. Microbiology, 152, 2993–3001. Doekel, S. and Marahiel, M.A. (2000) Dipeptide formation on engineered References 406. 407. 408. 409. 410. 411. hybrid peptide synthetases. Chem. Biol., 7, 373–384. Miyata, Y., Nakamoto, H., and Neckers, L. (2013) The therapeutic target Hsp90 and cancer hallmarks. Curr. Pharm. Des., 19, 347–365. Kapur, S., Lowry, B., Yuzawa, S., Kenthirapalan, S., Chen, A.Y., Cane, D.E. et al. (2012) Reprogramming a module of the 6-deoxyerythronolide B synthase for iterative chain elongation. Proc. Natl. Acad. Sci. U.S.A., 109, 4110–4115. Vosburg, D.A. and Walsh, C.T. (2005) Natural product biosynthetic assembly lines: prospects and challenges for reprogramming. Ernst Schering Research Foundation Workshop, pp. 261–284. Durfahrt, T. and Marahiel, M.A. (2005) Functional and structural basis for targeted modification of non-ribosomal peptide synthetases. Ernst Schering Research Foundation Workshop, pp. 79–106. Udwary, D.W., Merski, M., and Townsend, C.A. (2002) A method for prediction of the locations of linker regions within large multifunctional proteins, and application to a type I polyketide synthase. J. Mol. Biol., 323, 585–598. D’Onofrio, A., Crawford, J.M., Stewart, E.J., Witt, K., Gavrish, E., Epstein, S. et al. (2010) Siderophores from neighboring organisms promote 412. 413. 414. 415. 416. 417. the growth of uncultured bacteria. Chem. Biol., 17, 254–264. Bok, J.W. and Keller, N.P. (2004) LaeA, a regulator of secondary metabolism in Aspergillus spp. Eukaryot. Cell, 3, 527–535. Challis, G.L. (2008) Mining microbial genomes for new natural products and biosynthetic pathways. Microbiology, 154, 1555–1569. Heide, L. (2009) Genetic engineering of antibiotic biosynthesis for the generation of new aminocoumarins. Biotechnol. Adv., 27, 1006–1014. Menzella, H.G., Tran, T.T., Carney, J.R., Lau-Wee, J., Galazzo, J., Reeves, C.D. et al. (2009) Potent non-benzoquinone ansamycin heat shock protein 90 inhibitors from genetic engineering of Streptomyces hygroscopicus. J. Med. Chem., 52, 1518–1521. Gregory, M.A., Petkovic, H., Lill, R.E., Moss, S.J., Wilkinson, B., Gaisser, S. et al. (2005) Mutasynthesis of rapamycin analogues through the manipulation of a gene governing starter unit biosynthesis. Angew. Chem. Int. Ed., 44, 4757–4760. Weist, S., Kittel, C., Bischoff, D., Bister, B., Pfeifer, V., Nicholson, G.J. et al. (2004) Mutasynthesis of glycopeptide antibiotics: variations of vancomycin’s AB-ring amino acid 3,5dihydroxyphenylglycine. J. Am. Chem. Soc., 126, 5942–5943. 179 181 8 Nano-Antimicrobials Based on Metals Maria Chiara Sportelli, Rosaria Anna Picca, and Nicola Cioffi 8.1 Introduction Some metals and inorganic oxides have been recognized as antibacterial agents since ancient times; especially Ag, Cu, and ZnO have found applications in different fields [1–3]. For centuries, silver has been in use for the treatment of burns and chronic wounds [4, 5]. In particular, AgNO3 was used in the treatment of ulcers in the eighteenth century [6]. The use of silver dates back to Greeks and Romans Empires, thanks to its medical, preservative, and restorative properties. Analogously to Ag, the first reported medical use of copper is mentioned in the Smith Papyrus (between 2600 and 2200 B.C.) about water disinfection and wounds treatment [7]. Copper and its complexes in general spread through different populations (e.g., Romans) to heal different infections and to keep hygiene until the advent of antibiotics (early twentieth century). ZnO was also reported to heal skin wounds and to inhibit Escherichia coli growth, protecting intestinal cells [8]. However, after the introduction of penicillin, antibiotics became the standard treatment for bacterial infections and the use of such metals reduced significantly [6]. Unfortunately, the development of molecular antibiotics and their misuse have rapidly led to the emergence of the “antimicrobial resistance” (AMR) phenomenon [9], as also highlighted by the World Health Organization (WHO) [10]. A high percentage of hospital-acquired infections are caused by highly resistant bacteria such as methicillin-resistant Staphylococcus aureus (MRSA) and vancomycin or multidrug-resistant enterococci Gram-negative bacteria [10]. As a result, microbial contamination and pathogenic infections represent major threats to public health and environment in several fields, ranging from food packaging [11] to textile [12] and paint [13] industries, just to cite a few. To this end, nanotechnology has been exploited to create engineered nanostructures /nanocomposites (NSs) based on well-known antimicrobial materials (e.g., silver, copper, zinc oxide), generally classified as nano-antimicrobials [14], with improved bioactive performances and controlled toxicity to human beings. It has already been accepted by the scientific community that nanostructuration of such materials is helpful in generating antimicrobial agents with Novel Antimicrobial Agents and Strategies, First Edition. Edited by David A. Phoenix, Frederick Harris and Sarah R. Dennison. © 2015 Wiley-VCH Verlag GmbH & Co. KGaA. Published 2015 by Wiley-VCH Verlag GmbH & Co. KGaA. 182 8 Nano-Antimicrobials Based on Metals improved performance, thanks to a synergic contribution from both size and high surface-to-volume ratio [4, 15, 16]. Moreover, the possibility to conjugate the surface of the NSs or to combine them with other materials (e.g., polymers, natural and synthetic fibers, clays) allows to achieve nano-antimicrobials with tunable properties in terms of efficient bioactivity against the targeted microorganisms and limited, if any, toxicity toward human cells. In this chapter, we present several examples of nanomaterials based on three of the main inorganic materials with known antimicrobial action (i.e., silver – Section 8.2, copper – Section 8.3, and zinc oxide – Section 8.4). Considering the huge number of publications on this topic, we have focused our attention on the typical synthetic strategies involved in recent years in the development of the presented nano-antimicrobials. Some details on characterization and applications of the proposed antimicrobial agents are also shown. Some considerations on the design and the development of the next generation of nano-antimicrobials are provided in the conclusive paragraph. 8.2 Silver Nano-antimicrobials Much attention has been paid to metal nanoparticles (NPs) and NSs because of their fascinating chemical and physical properties. Silver is a noble metal, characterized by high thermal stability, low toxicity, and high antibacterial activity [17]. A myriad of shapes of Ag NSs have been already synthesized: in fact, it is known that the properties of metal NSs strongly depend on the involved sizes and shapes [18]. In spite of its fundamental and technological importance (as well as a long history of study), the challenge to synthetically and systematically control the shape of metal nanostructures (Me NSs) is not completely addressed [19]. Hence, a generic method for the preparation of morphologically defined Me NSs with related specific applications is still in development. In the following, we are going to synthetically list and describe the most common preparation methods of Ag NPs, the most diffused strategies to characterize them, and their main applications, especially in the antimicrobial field. 8.2.1 Synthesis of Silver Nanostructures A variety of synthesis routes have been developed for the preparation of Ag NSs, which can be mostly divided into a few large categories: physical, chemical, and electrochemical approaches [20]. As can be easily guessed, each method is characterized by its peculiar advantages and drawbacks; the choice of the most appropriate synthetic route is mainly dictated from the material’s final use. Here, we provide an overview of the most common techniques to synthesize Ag NSs and nanocomposites. 8.2 Silver Nano-antimicrobials 8.2.1.1 Physical Approaches One of the first physical methods employed for the production of silver NPs was a mechanical approach: the bulk metal underwent homogenization, grinding, or milling processes to generate small-sized Ag powders [21]. This technique is characterized by poor morphological control, although still widely used in the industrial or commercial production of Ag nanopowders [22]. Recently, one of the most used physical processes is the so-called evaporation–condensation method [23]. During this process, performed in a tube furnace, solid bulk Ag is heated in a small temperature-regulated crucible to produce vapors, which are then rapidly quenched on a cold surface (i.e., liquid nitrogen, metallic plates, etc.) in an inert atmosphere of argon gas [24]. A good shape control can be achieved this way [20], although many parameters have been found to affect the final material, such as temperature, evaporation power and rate, and argon pressure in the quenching phase [24, 25]. Other physical methods are based on the reduction of a silver saline precursor, catalyzed by ultrasounds [26–28], microwaves [29–32], UV light [33, 34], and so on. This technique is mostly used to obtain metal–polymer nanocomposites, avoiding complications related to in situ polymerization processes [35]. Immobilization of Ag nanophases onto polymeric materials has been recently reported by many research groups [36, 37]. Interestingly, Perkas et al. [38] modified industrial nylon 6,6 fibers with Ag NPs, capable to exert high antimicrobial activity; this innovative material paved the way as one of the first examples of reallife-applicable products. 8.2.1.2 Laser Ablation in Liquids In the past years, laser ablation synthesis in solution (LASiS) emerged as a reliable alternative to traditional methods for obtaining noble metal NPs. LASiS is a “green” technique for the synthesis of stable metal NPs in water or in organic solvents, which does not need stabilizing molecules or other chemicals [39]. The process is performed by irradiating a bulk metallic target immersed in solvents using intense laser light [40]. To the best of our knowledge, one of the first reports about LASiS of Ag NPs is the one from R.A. Ganeev et al. [41], who reported the synthesis of Ag NPs in the absence of stabilizing agents and with different solvents obtaining, however, small and well dispersed NPs. The use of water [42] or organic solvents [43] has been reported to affect the size and morphology of particles, as described in detail in some interesting studies [41, 44]. Laser parameters, such as fluence, power, repetition rate, and wavelength, were found to be useful tools to obtain good morphological control for synthesized NSs [45]. The chance to directly disperse Ag NPs in aqueous solutions of polymeric matrices was also envisaged, with the advantage of obtaining more stable and dispersed colloids [46–48]. Natural and biodegradable polymers such as chitosan (CS) were also used [49, 50]. 8.2.1.3 Chemical Approaches The synthesis of NSs by means of the chemical reduction approach is one of the most used methodologies for shape-controlled metal NPs [51]. This is a well-known technique: the principle was first reported in 1914 [52]; since then, 183 184 8 Nano-Antimicrobials Based on Metals many research papers about chemical reduction of silver ions have been published [53–55]. Both aqueous [53, 56] and organic [57] solvents can be used, often containing surfactants or polymers. The use of these substances is fundamental to achieve both colloidal stabilization and size control [58–61]. The reduction of silver ion takes place with the help of reducing agents; commonly used reductants are borohydride [62], citrate [63], ascorbate [64], and molecular hydrogen [65]. The use of a strong reductant such as borohydride results in small particles that are somewhat monodispersed, while the use of citrate or ascorbate, which are weaker reductants, results in a slower reduction rate and narrower size distribution [66]. The most important drawbacks of this method are related to agglomeration of silver NPs during the synthesis [67–69]. To overcome the limitation of chemical reduction and prevent particle aggregation, the reverse microemulsion (reverse micelle) method was introduced to obtain uniform and size-controlled NPs [70]. This method has the obvious advantage of synthesizing NPs with specific diameter and morphology [57], since nucleation and growth are restricted within the cores of the micelles [71]. The droplet dimension can be modulated by various parameters, in particular the molar ratio of water and the surfactant [72]. 8.2.1.4 Biological and Biotechnological Approaches The chemical method allows the preparation of uniform and size-controllable NPs; however, highly deleterious organic solvents with potential risks for environment and biological hazards are frequently employed. An increasing awareness toward green chemistry and biological processes is developing in the recent years, leading to the set-up of an environment-friendly approach for the synthesis of NPs [73]. Unlike other physical and chemical processes, biosynthesis of NPs is a completely eco-friendly approach [74, 75]. In 2002, a surprising discovery regarding protein and amino acids involved in biomineralization processes paved the way to the use of biomolecules as reducing agents of silver ions [76] for the synthesis of Ag NSs. Natural extracts from fungi and spores are among the first used for the synthesis of Ag NPs [77–79], acting as stabilizing and reducing agents at the same time. Moreover, they are cheap and easily available substances [80]. Some microorganisms have been explored as biofactories for the synthesis of Ag NPs, thanks to the presence of reductase and other enzymes on the bacterial cell wall [81–85]. Finally, natural extracts from leaves [86–90], flowers [91], and fruits [92, 93], containing proteins, enzymes, and polysaccharides, were found to give good results in the chemical synthesis of Ag NSs, although morphological control is quite difficult to achieve. 8.2.1.5 Electrochemical Approaches Electrochemical techniques are very interesting, since they allow obtaining metal NPs with high purity and crystallinity, controlling particles’ size by means of few experimental parameters [94]. Reetz and Helbig [95] were the first to develop an electrochemical process for the synthesis of colloidal transition metal NPs. In detail, a bulk metal sheet was anodically dissolved in an organic solution (a mixture of acetonitrile (ACN) and tetrahydrofuran) and the intermediate 8.2 Silver Nano-antimicrobials metal ions were reduced at the cathode, giving rise to metal particles stabilized by tetraalkylammonium salts. This strategy was first successfully adopted for the electrochemical synthesis of Ag NPs by Rodríguez-Sánchez and coworkers [96], in pure ACN containing tetrabutylammonium bromide. The authors found Reetz’s mixture unsuitable for Ag synthesis because the presence of tetrahydrofurane induced particles aggregation. Following a similar approach, Ag Nps were also obtained in ethanol [97], hexane [98], and N,N-dimethylformamide (DMF) [99]. The use of a zwitterionic surfactant in ACN, instead of an ammonium salt, was found to be susceptible to the growth of branched hierarchical NSs (specifically nanofractals NFs) [100]. Despite many advantages, such as size tuning and inexpensive experimental set-up, this method has intrinsic limitations: the use of potentially dangerous organic solvents – these substances may limit real-life applications of the as-prepared colloids [101]. This is why an important current issue in the electrochemical synthesis of metal NPs regards the preparation of aqueous and long-lived colloids [94, 101]. V. ten Kortenaar and coworkers [102] found that long-lived, subnanometer-sized silver oxide clusters could be prepared by anodic dispersion of a silver electrode in basic aqueous solutions (pH 10.5–12), free of stabilizing polymers, upon the application of a high DC voltage (65 V) between two silver electrodes. Synthetic parameters made this process energy and time consuming; this inconvenience can be overcome by employing electrochemical reduction of a silver salt in aqueous solution [103]. Electrochemical reduction of silver ions involves two competitive processes: the formation of Ag NPs and the deposition of a silver film onto the cathode surface. Usually, this second occurrence dominates over the first one, hence the need for the presence of a good stabilizer [104]. Typical stabilizing agents are both synthetic and natural polymers, ranging from poly(N-vinylpyrrolidone) (PVP) [103, 104], polyphenylpyrrole (PPP) [105], and polyethylene-glycol (PEG) [106, 107], to CS [108]. Supported metal NSs, that is, electrochemically deposited onto different substrates, are one of the most developed and important subjects of study in electrochemistry. To the best of our knowledge, one of the first examples of supported Ag NSs was provided by Zoval et al. [109], who employed a potentiostatic pulsed method to deposit ordered silver NPs onto atomically flat graphite. The intrinsic flexibility of this technique is responsible for its rapid technological development: many different substrates such as metal sheets [110, 111], graphene and graphite [112–115], and polymeric films [116], were used to deposit variously shaped NSs. A direct embedding of NPs in polymeric matrices can be also performed in a one-pot approach, using this technique: recently Zhitomirsky and Hashambhoy [117] proposed the deposition of inorganic Ag NPs contextually with a CS film, paving the way for a fast and controllable preparation of cheap and antimicrobial films for biomedical applications. 8.2.2 Characterization of Silver Nanostructures Characterization of nanosized materials is one of the challenges of the last decades, since they have special properties stemming from their nanoscale 185 186 8 Nano-Antimicrobials Based on Metals dimensions. Because of their high surface/volume ratio, their chemical and physical properties are strictly correlated to the so-called quantum mechanical effects [118]. The principal properties that have to be determined are dimensions, morphology, crystallinity, and chemical composition. UV–Vis spectroscopy is a useful tool to quickly obtain concentration and mean diameter of a Me–NP colloid [119]. A tight relation between particles dimension and their plasmon resonant spectral response is known to exist [120], supported by sophisticated and detailed quantum mechanics theories [121, 122]. A typical UV–Vis spectrum of Ag NPs shows a well-defined surface plasmon band centered at around 420 nm [123]. This plasmon band is broad, with an absorption tail in the longer wavelengths, which could be in practice due to the size distribution of the particle [124]. Dynamic light scattering (DLS) is a convenient technique, frequently used to determine the effective size and size distribution of silver particles suspended in solution. An average effective size, or hydrodynamic diameter, is calculated for Ag particles using the Stokes–Einstein relation between the diffusion coefficient and particle diameter [125]. In the last decade, the development and the diffusion of the electron microscopies, and particularly of transmission electron microscopy (TEM) [126, 127], have made morphological characterization of NPs direct and easy to understand. High-resolution TEM micrographs of Ag NSs are frequently found in the literature [28, 128–132]. Although scanning electron microscopy (SEM) and atomic force microscopy (AFM) can provide high-resolution images of nanometric crystallites surfaces, they are unlikely to clearly resolve the atomic lattices of NPs because of the unavoidable wobbling of nanocrystals under the scanning probe [133]. SEM technique is particularly useful in the study of supported NSs, in contrast to TEM, which mostly requires colloidal dispersions or ultrathin sections. Hence, SEM is especially used for the morphological characterization of Ag nanostructured surfaces, prepared by means of electrochemical [110–112, 115, 116] and physical [23, 24, 134, 135] methods. X-ray diffraction (XRD) or selected-area electron diffraction (SAED) measurements are necessary to assess the crystalline nature of the NSs. Nanometer-sized crystalline materials have been proposed to represent a solid-state structure that exhibits neither long-range order (like crystals) nor short-range order (like glasses). Structurally, these materials consist of the following two components, the volume fraction of which is about 50% each: a crystalline component, formed by all atoms located in the lattice of the crystallites, and an interfacial component comprising the atoms situated in the interfaces [136]. It is this interfacial component that was proposed to exhibit an atomic arrangement without short or long range, giving rise to peculiar features in XRD patterns [137]. Zero-valent nanosized silver crystals present an XRD pattern related to a face-centered cubic (fcc) unit cell, generally representing the 111, 200, 220, 311, and 222 crystal planes due to Bragg’s reflections [138]. A mathematical analysis of these Bragg’s peaks is undertaken to calculate the crystallite size using the Scherrer formula [139]. X-ray photoelectron spectroscopy (XPS) is an excellent tool for the investigation of the electronic structures and chemical bonding of materials; nevertheless, its application to the study of colloidal transition metal NPs has so far been limited, 8.2 Silver Nano-antimicrobials partly because limited chemical speciation can be achieved from photoelectronic binding energies (BEs) for most of the transition metals [140]. Moreover, the BEs of the Ag 3d5/2 core electrons obtained from NSs are not significantly different from those of bulk materials [141]. Anyway, studies regarding the size effect can be performed using Auger emissions and mathematical calculation of modified Auger parameters (α′ ) [100, 142]. 8.2.3 Applications of Silver Nanostructures Silver NPs are being used in numerous technologies and incorporated into a wide array of consumer products that take advantage of their desirable optical, conductive, and antibacterial properties. Silver NPs are used in conductive inks and integrated into composites to enhance thermal and electrical conductivity. Conductive films that are both stretchable and flexible found applications in electronic devices [143], sensors [144], actuators [145], and so on. A substantial amount of research has been carried out on conductive polymer composites containing Ag NPs, also in combination with carbon nanotubes (CNTs) and other nanosized metals [146–148]. Silver NPs are used to efficiently harvest light and for enhanced optical spectroscopies including surface-enhanced Raman scattering (SERS) [149]. The technique of SERS is a particularly sensitive and selective analytical tool for the detection of low concentrations of analytes adsorbed on noble metal NSs [150]. The morphology of the metallic NSs is a primary factor determining the magnitude of signal enhancement and sensitivity of detection. Ag nanorod (NR) arrays [151], nanoflakes [152], nanocubes [153], and NPs [154], deposited onto proper substrates, are the most used Ag NSs because, once deposited, they can produce surfaces with controllable and reproducible roughness [155]. The main application of Ag NPs is, however, as antimicrobial agent [14]: for decades, silver-based nanocomposites have been used extensively as antimicrobial agents in a number of areas including medical, pharmaceutical, textile, industrial food storage, and environmental applications [156]. This topic is discussed in detail in the following paragraph. 8.2.3.1 Silver-Based Nano-antimicrobials Silver has been known for antibacterial activity since the times of ancient Greece. Currently, the investigation of this phenomenon has regained importance owing to the increase of bacterial resistance to antibiotics, caused by their overuse [9]. Ag NPs exhibit very strong antibacterial activity against both Gram-positive and Gram-negative bacteria (Figure 8.1), including multiresistant strains [157]. Contrary to the bactericide effects of ionic silver, the antimicrobial activity of colloid silver particles is influenced by many parameters (Table 8.1), especially by their dimensions: the smaller the particles, the greater the antimicrobial effect [158]. 187 188 8 Nano-Antimicrobials Based on Metals B. thuringiensis (Gram-positive) Inhibition zones (mm) Chitosan 24 6h 27 12 h 28 18 h 30 24 h 35 Chitosan 26 6h 30 12 h 32 18 h 34 24 h 35 P. aeruginosa (Gram-negative) Inhibition zones (mm) Figure 8.1 Comparison between the bacterial inhibition zones (mm) of chitosan and the chitosan-Ag NPs developed at different times (6, 12, 18, and 24 h). (Reproduced from Ref. [108], Copyright (2012), with permission from Elsevier.) Table 8.1 Factors affecting Ag NSs toxicity. Factor Tendency Possible explanation Particle size Smaller particle size tends to enhance antibacterial properties Particle stability Higher stability produces higher antibacterial properties Particle Shape Particles with shapes containing more <111> facets like triangular particles tend to have strongest antibacterial properties Depending in a case to case base As size decreases, there is larger number of atoms on the surface available to interact with bacteria or to release a higher amount of silver ions Non-stable nanoparticles will tend to form aggregates; thus surface area will be reduced and the density of atoms available on the surface will be lower [160–162] <111> facets would contain larger atom densities; thus more atoms available for interaction [163] Water chemistry Since water chemistry affects particle suspension/solubility, particle size distribution, as well as bacterial ability to face environmental stresses, water chemistry will affect the interaction between nano-scaled silver and bacteria thus influencing the resulting toxicity Reproduced from Ref. [159], Table 4, Copyright (2010), with kind permission from Springer Science and Business Media. 8.2 Silver Nano-antimicrobials Enhanced antimicrobial activities have been reported in silver NPs modified by surfactants and in polymers [4]. This is probably due to the modulated ion release that can be obtained by embedding Ag NSs in a proper matrix. Examples are widely reported in literature: commonly used polymers are CS [128], polyvinyl alcohol [129], polylactic acid (PLA) [164], and poly-(vinyl-methyl ketone) [130]. Ag colloidal NSs can also be used to drench wound dressings [128] (Figure 8.2), to modify textiles [165], and so on. (a) (b) (c) (d) (e) (f) Figure 8.2 TEM micrographs of fibers containing Ag-NPs for wound dressing applications; (a–d) micrographs show individual fibers loaded with Ag-NPs; (e) nanofiber mat top-view; and (f ) crosssection nanofibers. (Reproduced from Ref. [128] Copyright (2013), with permission from Elsevier.) 189 190 8 Nano-Antimicrobials Based on Metals The use of proper surfactants, such as tetraalkylammonium salts, which are strong disinfectants, leads to a synergic antimicrobial effect deriving from both stabilizers and metal NPs [130]. Although silver has been used as a biocide for hundreds of years, the antimicrobial mechanism of silver has not been fully elucidated [159]. A variety of mechanisms may be involved in the antimicrobial activity of silver against a broad spectrum of organisms. Some of the commonly accepted mechanisms include silver–amino acid interaction [166], silver–DNA interaction [167], generation of reactive oxygen species (ROS) [168], and direct cell membrane damage, such as cell internalization [157]. 8.3 Copper Nano-antimicrobials Copper species are well-known bioactive agents, which induce an oxidative stress on proteins, nucleic acids, and lipids by producing reactive hydroxyl radicals with consequent damages to membrane and other cell organelles [13, 169, 170]. Despite these considerations, copper-based nanomaterials have been less studied in comparison to nanostructured silver [171, 172]. On the other hand, in some cases copper nanoparticles (Cu NPs) have demonstrated superior bioactivity [173]. It should be pointed out that either elemental copper or copper oxides have been proposed as nanostructured antimicrobial agents [174, 175]; however in the following paragraphs we review mainly the case of Cu(0) NPs. Firstly, we focus on the methods that are generally used for the synthesis of copper-based nano-antimicrobials. A brief overview of the main applications of Cu NPs as bioactive material is also given. 8.3.1 Preparation and Applications of Antimicrobial Cu Nanostructures In this section, we summarize shortly some approaches to the development of copper nano-antimicrobials. All the cited examples were chosen because the antimicrobial application was clearly addressed, considering their novelty and/or importance. It is beyond the scope of this chapter to give an extensive review of all the possible methods for the synthesis of Cu NSs, which have been reviewed elsewhere [176]. For clarity reasons, the reported approaches are classified in physical, wet-chemical, and other alternative approaches for the development of copper nano-antimicrobials, such as electrochemical syntheses, laser ablation in liquid (LAL), and biological syntheses. 8.3.1.1 Physical Methods These techniques are generally related to the single-step preparation of nanocomposites based on the formation of Cu nanoclusters in (or onto) an 8.3 Copper Nano-antimicrobials organic/inorganic coating. In many cases, no stabilization of Cu NPs occurs, leading to the formation of copper oxides shell. Plasma and sputtering approaches represent the main methods proposed in literature for the preparation of antimicrobial nanocomposites. Plasma immersion ion implantation (PIII) allows the penetration (and incorporation) of copper in the first layers of polymeric films (e.g., polyethylene, PE), thus conferring antimicrobial properties to the polymer without causing dramatic damages to its structure [177–180]. In particular, Zhang and coworkers [180] showed how a dual-plasma system (Cu/N2 ) was more efficient in the regulation of the copper release rate improving the longterm bioactivity of low density PE against E. coli and S. aureus. Other works employing unusual plasma approaches were also reported. A procedure based on a thermionic vacuum arc plasma (TVA process) for the deposition of Cu or Ag nanofilms on stainless steel and polymer spheres to treat nosocomial bacterial species was presented in [181]. An industrial method using thermal plasma (Tesima™) was employed to prepare several antimicrobial (e.g., CuO, Cu, Cu2 O, ZnO, and Ag) nanopowders in a continuous gas phase process [182]. Among sputtering techniques, magnetron sputtering and ion beam sputtering (IBS) are more frequently applied. Direct current (pulsed) magnetron sputtering has been proposed to modify TiN hard and wear-resistant coatings [183] as well as polyester surfaces [184]. In particular, in [183] co-deposition from two high purity targets, keeping constant the power for Ti and varying that for Cu to achieve different copper loadings in the nanocomposites in Ar–N2 atmosphere is reported. These nanocoatings showed very good performances against S. aureus. Cu-sputtered polyester surfaces exerted excellent bioactivity against the same methicillin-resistant bacteria [184]. Advantages of sputtering methods lie also in the deposition of mechanically durable and relatively well-adhered Cu layers directly on fabrics (e.g., cotton) [185]. Copper-doped diamond-like carbon films (useful to develop surgical devices) have also been produced by radio-frequency magnetron sputtering, also combining plasma-enhanced chemical vapor deposition (CVD) under various Ar/CH4 gas mixtures [186, 187]. Alternatively, nanocomposites incorporating copper nanoclusters (with a mixed CuO/CuF2 nature) in a fluoropolymeric matrix were prepared by simultaneous IBS of pure Cu and polytetrafluoroethylene (PTFE) targets. Copper content was adjusted by simply tuning the growth rates of the two materials [188]. Obviously, CVD technique was also applied to the development of Cu-based antimicrobial agents (in the form of thin films) as reported in [189], with particular focus on low cost ambient pressure approaches [190]. Recently, a strategy (the mixed melt method) based on the use of commercially available Cu (or CuO) NPs and polymer (polypropylene) was proposed by Palza and coworkers [191, 192] to produce novel bioactive nanocomposites. They found that NP content and NP composition (CuO compared to Cu) could greatly affect the release kinetics (and thus the bioactivity). Interestingly, despite other works considering only the first layers effective for Cu2+ release, they could not quantify the Cu surface concentration. However, they correlated the high bioactivity of the 191 192 8 Nano-Antimicrobials Based on Metals nanocomposites to the diffusion of water through the percolation network of the polymer, which allowed the “corrosion” of Cu (CuO) NPs. A procedure based on a flame aerosol reactor was described to synthesize Cu-doped TiO2 NPs using titanium tetra-isopropoxide and copper (II) ethyl hexanoate as precursors [193]. Some authors employed a mixed chemical–physical method – the molecular level mixing method (MLM), coupled with high energy ball milling (BM) – to fabricate Cu/CNTs nanocomposites [194, 195]. The electrospinning process was employed for the synthesis of Cu NPs-polyurethane nanofibers without adding any chemical precursors [196]. Another approach was introduced by Karlsson et al. [197], who synthesized Cu NPs by the electrical wire explosion technique [198], though this method generally leads to the formation of aggregates of Cu NPs. 8.3.1.2 Wet-Chemical Methods When Cu NPs are needed as antimicrobials or modifiers for advanced bioactive composites, approaches based on the chemical reduction of Cu(II) salts (chloride or sulfate) are the most widely applied. In general, sodium borohydride [199–208] and hydrazine [208–213] are used as reducing agents. The reaction is carried out under alkaline conditions (NaOH addition, pH ∼ 11) and in an inert atmosphere to prevent fast oxidation of Cu(0) NPs [201, 208]. Instead of nitrogen, some works reported the use of some “protecting/stabilizing” agents to overcome this issue and avoid aggregation of NPs. For example, poly(vinylalcohol) [203], CS [210, 212], ethylenediamine tetraacetic acid (EDTA) [194], or gelatin [211] were proposed with this aim. It should be pointed out however that, even in suitable conditions, this approach leads generally to the formation of Cu(0) core – Cu(I) shell NPs as also stated in some works [204]. The main advantage of this method resides in the possibility to modify in a single step some natural fibers (e.g., cellulose), which were considered effective in protecting NPs and avoiding their direct release in aqueous media [200, 202, 205–208]. In fact, the possible leaching of NPs may pose critical issues about their safe use [16] and it is then important to get a controlled ion release [188, 200]. As a result, many examples about the preparation of Cu NP/fabric composites were reported in the literature, as also recently reviewed [214]. A very elegant strategy was described by Cady et al. [200], who combined a layer-by-layer (LBL) electrostatic self-assembly process to make cellulose chelating Cu2+ ions for further chemical reduction to Cu NPs. In particular, natural cotton fiber was converted into anionic carboxymethyl cotton fiber with chloroacetic acid (Figure 8.3). The as-prepared materials showed good bioactivity against Acinetobacter baumannii, without toxicity against mammalian cells. Other fibers were also treated by the reduction method, such as nylon [215] or bamboo rayon [216]. In particular, in [215] Cu NPs were synthesized on/within polyamide chains of nylon fabric using ascorbic acid as natural antioxidant/reducing agent and cetyl-trimethylammonium bromide (CTAB) as capping/assembling agent. It was also proposed to synthesize Cu NPs by chemical reduction with ascorbic acid and then transfer them to sodium alginate-treated cotton by microwave heating [217]. 8.3 Copper Nano-antimicrobials 193 OH OH O HO O O O OH OH OH O O HO O Cu OH n O O CI − O Na+ OH O HO O O NaOH n O O O CuSO4 − O HO NaBH4 O HO O HO HO O O O O O Anionic cotton fiber O O O Cu O O O OH O HO O O O HO n O Nanoparticlecotton complex O O Figure 8.3 Scheme of the production of Cu NPs-modified cotton fibers. (Reproduced from Ref. [200], Scheme 1, Copyright (2011), with permission from Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.) Controlled-release Cu-based nano-antimicrobials were also produced by chemical reduction using clays as embedding matrices [209, 213, 218, 219]. These materials possess high surface area, chemical inertness, and nontoxicity, making them promising choices in the biomedical field. In some cases, NPs were prepared before mixing with clays [213] whereas their ion-exchange properties were employed to capture cupric ions for their further reduction directly inside the matrix [218]. Chemical reduction may also be combined with physical approaches as reported in [194], where high-energy BM follows the reduction step with NaBH4 to fabricate Cu/CNT nanocomposites as potential antimicrobial coatings on catheter linings, hospital trays, and food containers. A similar combination was also presented by Kamrupi and Dolui [220] to fabricate Cu NPs/polystyrene nanocomposites. Colloidal Cu NPs were prepared by NaBH4 reduction of CuCl2 into styrene droplets for its following polymerization using water in supercritical carbon dioxide (water-in-sc-CO2 ) at 70 ∘ C. The sol–gel approach was also widely employed, especially in works regarding the preparation of bioactive glasses [221–223] and silica-based materials [224, 225]. Bioactive glasses find applications in different clinical fields (e.g., dental devices), thanks to their high surface area and drug delivery properties [222]. In a simple manner, the precursors of glass (tetraethyl orthosilicate, triethyl phosphate, and calcium nitrate) and CuO (copper(II) salt) were used to carry out a sol–gel synthesis. The gels could undergo thermal treatments to obtain different composites (e.g., aged gels at 60 ∘ C, gel glasses at 600 ∘ C, and glass ceramics at 1050 ∘ C) [221, 222], which showed the presence of Cu2+ species, homogeneously distributed in the glass matrix, with low copper release (5 ppm) [221]. Alternatively, the same group proposed the so-called “impregnation” process based on the soaking into a solution of Cu(II) precursor of sol–gel prepared glasses (treated at 600 ∘ C). The modified glasses were then aged at 60 ∘ C followed by heat treatment at 700 ∘ C in N2 /H2 atmosphere, resulting in the reduction of Cu2+ to Cu(0) NPs [221, 222]. Cu NPs were mainly distributed on 194 8 Nano-Antimicrobials Based on Metals the glass surface, thus exerting higher copper release (65 ppm) [221]. The possible application of Cu NPs as effective antifungi additives for architectural paints and impregnates was demonstrated by Zielecka and collaborators [224] (Figure 8.4). They described the sol–gel synthesis of novel silica nanospheres immobilizing copper NPs (or Ag NPs). The most important advantage of these additives lies in the stability of copper NPs as well as in the harmlessness to human beings. Other protocols based on wet-chemical methods were also reported, for example, polyol reduction [226, 227], hydrothermal synthesis [228], microwave heating in the presence [229, 230] or absence of stabilizers (e.g., CS or starch) [231], or UV photoreduction [232]. Despite the diffusion and versatility of wet-chemical approaches, some “alternative” methodologies to produce efficient nano-antimicrobials were also considered by researchers for several reasons (e.g., reducing costs, environmental sustainability, controlled release, chemical speciation, and low toxicity of the final products). In the following section, three important approaches are reviewed as valid alternatives to purely physical and chemical ones. F Cu 0,1 2 F Cu 0,5 0 N 5 Figure 8.4 Activity of Cu NPs against algae after 48 h incubation. (Reproduced from Ref. [224], Copyright (2011), with permission from Elsevier.) 8.3 Copper Nano-antimicrobials 8.3.1.3 Electrochemical Syntheses Cathodic reduction Anodic dissolution Workin electro g de (Cu) Reference Electrochemical routes to the synthesis of nanomaterials are generally considered highly versatile and up scalable for industrial applications. In particular, they may allow the fine-tuning of size and shape control by operating either on chemical (pH, temperature, electrolytes, and solvents) or electrochemical (current density and potential) parameters [95]. Such features were considered appealing also in the field of nanostructured antimicrobials, as demonstrated by the publications on this topic [130, 233–238]. In particular, our group developed a suitable procedure to synthesize tetra-alkylammonium-stabilized Cu NPs (as well as Ag NPs) based on the “sacrificial anode electrolysis” [95] in organic solvents [130, 233–236]. Very stable colloidal dispersion of Cu NPs (spherical-shaped) was prepared by applying a constant potential (chosen accordingly) and using a three-electrode conventional cell. In particular, a high purity copper sheet, acting as working electrode, was used as the source of cupric ions. The presence of tetraoctylammonium chloride (considered one of the best performing species) allowed stabilization of the Cu(0) nuclei formed at the cathode (Pt sheet) and control of their growth in solution as NPs (Figure 8.5). Colloidal Cu NPs were effectively dispersed in commercial polymers (e.g., polyvinylmethylketone, polyvinylchloride) [130, 233–235] and successively deposited as thin nanocomposite films by a simple spin coating procedure on glass slides to test their bioactivity against different microorganisms. It was shown how ion release (as studied by atomic absorption spectroscopy) could be quantitatively correlated to their good antimicrobial performance. Later, a similar approach was also employed to mix Cu NPs with a silicon-based product, commonly used as a water-repellent/consolidant, to obtain bioactive nanocoatings to be applied on stone artworks [236]. Counte r electro de (Pt) + N + N + + N + N N + N Cu(0) + N Nanoparticle growth + N Core-shell nanoparticle Figure 8.5 Electrochemical synthesis of Cu NPs by sacrificial anode electrolysis. 195 8 Nano-Antimicrobials Based on Metals Colloid 500 nm Silicone resin Ethyl acetate 200 nm Ethyl acetate 500 nm Laser ablation of silver and copper in ethyl acetate and hexane n-hexane 200 nm Mixing with silicone resin, evaporating solvent under vacuum n-hexane Silicone polymer 200 nm Mixing with curing Ethyl acetate agent, polymerisation, ΔT 200 nm Degree of dispersion (%) 196 100 80 60 40 20 0 Ethyl n- acetate hexane n-hexane Figure 8.6 Laser ablation synthesis of Ag and Cu NPs in the presence of silicone matrix. (Reproduced from Ref. [243], Figure 4, Copyright (2010), with permission from Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.) Recently, CuO NPs were electrosynthesized at 12 V under ambient atmosphere by a template-free, low-temperature approach [238]. Copper bars were used as both cathode and anode and the electrolytic solution consisted of aqueous KCl/hydrogen peroxide. H2 O2 was used as oxidant in this process. In the absence of stabilizers, the electrochemical deposition of copper (in the presence hydrogen peroxide) led to CuO/Cu(OH)2 mixed NPs. A calcination step at 150 ∘ C allowed complete conversion to CuO NPs. CuO NPs showed fast deactivation kinetics against E. coli as well as other Gram-positive (Bacillus subtilis, S. aureus) and -negative (Salmonella typhi) bacteria. 8.3.1.4 Laser Ablation in Liquids In the last years, LAL has been receiving increasing attention thanks to the possibility of physically reducing a solid target to nano-colloids, without the use of chemical precursors [39, 239, 240]. Other advantages are represented by very short reaction times, mild temperature conditions, no by-products, and outstanding purity. Many researchers have envisaged the possibility to apply this technology to prepare nano-antimicrobial agents [241–247]. Since their early work on the generation of Ag NPs in ethylacetate doped with silicone resin [241], Hahn and collaborators [242–244] focused on the LA synthesis of Cu NPs embedded in a polymer matrix to get a controlled ion release. They showed how targeting the “therapeutic window” might allow inhibition of the proliferation of some cells (e.g., fibroblasts) without being toxic for others (e.g., neuronal cells). This approach was proposed to fabricate Cu NPs-treated cochlear implant (CI) electrodes. In particular, they prepared laser-ablated stable colloidal Cu NPs in n-hexane doped with 1% of silicone. n-Hexane behaved better than ethyl acetate leading to a homogenous distribution of NPs in the silicone matrix (Figure 8.6). LAL-synthesized copper antimicrobials were also considered in food packaging applications [245–247]. PLA materials filled with Cu NPs were prepared by either one- or two-step protocol in our laboratories [246]. The two-step preparation was 8.4 Zinc Oxide Nano-antimicrobials developed earlier [245] and consisted in the generation of Cu NPs in acetone using picosecond-pulsed laser ablation followed by their mixing with a PLA solution in an ultrasonic bath to get the composites. The one-pot synthesis allowed the laser ablation of the copper target in acetone in the presence of PLA as stabilizer [246]. In both cases, the composites could be deposited as thin films by drop casting. The as-prepared nanocomposites were used in preservation tests for fiordilatte cheese [247]. The bioactive films showed good antibacterial activity. In certain conditions, it was found that the proliferation of main spoilage microorganisms was delayed with a consequent preservation of sensory attributes. 8.3.1.5 Biological Syntheses All the presented protocols have pros and cons, which are often related also to limited eco-compatibility of the synthesis; therefore, attention toward “green” methods using natural substances has grown exponentially in recent times. Obviously, the expanding market of antimicrobials based on nanometals/oxides was also involved. In fact, recent reviews addressed the importance of biological synthesis [171, 175, 248] to develop copper-based nanomaterials – either simple natural compounds (e.g., glutathione) [249] or natural extracts [250–253]. An interesting approach by Barua et al. [250] was based on the chemical extraction of cellulose nanofibrils from an abundant source (Colocasia esculenta) followed by the reduction of Cu(II) acetate operated by the alcoholic extracts of Terminalia chebula fruit. The stem latex of a medicinally important plant, Euphorbia nivulia, was also successfully used to induce the synthesis of Cu (or Ag) NPs in high yield by microwave assistance. Euphol (a major latex component) was responsible for reduction whereas NP stabilization was ensured by certain peptides and terpenoids present within the latex (as assessed by FT-IR analysis) [251]. 8.4 Zinc Oxide Nano-antimicrobials The application of metal oxides in the form of nanostructured materials is continuously expanding. Among them, in the last decades, ZnO-based nanomaterials have attracted the interest of scientists and technologists as assessed by the huge amount of reports on the synthesis of nanosized zinc oxide materials. In fact, ZnO is a versatile wide band-gap semiconductor with tunable optoelectronic and piezoelectric properties. Furthermore, ZnO is chemically stable and almost harmless to humans showing also good bioactivity toward several microorganisms. 8.4.1 Synthesis of Zinc Oxide Nanostructures Various methods have been employed to synthesize ZnO NPs, including physical, chemical, and electrochemical techniques. Conventionally, these methods are grouped into two classes: top–down and bottom–up procedures [254]. The first 197 198 8 Nano-Antimicrobials Based on Metals are generally physical processes [255–257], reducing bulk materials to the nano-scale; large quantities of NPs can be produced, whereas the synthesis of monodispersed and size-controlled colloids might be difficult to achieve. Bottom–up methods, mainly chemical/electrochemical ones, on the other hand, can be used to produce, in laboratory scale, uniform and size-controlled NPs [258, 259]. 8.4.1.1 Physical Approaches Among physical approaches for the production of transition metal oxide NSs, CVD is one of the most used, as it can be considered time and cost effective [260]. This process may be defined as the deposition of a solid on a heated surface, from a chemical reaction in the vapor phase. It is a very versatile approach, because by easily controlling the experimental parameters, the morphological and chemical properties of the final product can be tuned [261]. Nevertheless, it is scarcely used for the production of antimicrobial coatings and surfaces, because of the need for high operating temperature that could degrade polymeric matrices and/or substrates [262]. Deposition techniques, such as radio-frequency (RF) magnetron sputtering [263, 264], IBS [265, 266], and so on, are mostly used for the production of ZnO-based antibacterial coatings. They are investigated to modify biomedical implants, in order to reduce bacterial adhesion and viability and overthrow implant-associated infections [267]. Deposition techniques have also been used for the functionalization of textiles and cotton fabrics, since they can easily provide uniform coverage of the surface [268]. Prospects of use of these thin films in sterile packaging [269, 270], wound dressing [271], and non-fouling textiles [272] have been envisaged. 8.4.1.2 Chemical Approaches The sol–gel chemical method has been widely used for producing metal oxide powders with high purity and homogeneity [259, 273]. The process involves the preparation of a colloidal suspension (sol), which is subsequently converted into a viscous gel using principles of precipitation, condensation, and hydrolyzation [274]. Surfactants can be useful for an accurate particle size tuning [275, 276]. ZnO colloids prepared with this approach have been used for the impregnation of manufactured goods, in order to confer them with antifungal/antimicrobial properties [277–279]. Recently, a report about in situ synthesized ZnO NSs, on the surface of cotton fabrics, was provided [280]. This modified material exerted high UV protection and antimicrobial activity against Gram-positive and Gram-negative bacteria. Hybrid organic–inorganic composites, prepared using sol–gel-produced ZnO colloids dispersed into polymeric matrices, have been employed to preserve food from degradation [281]. Most of these materials are characterized by multifunctionality, ease of processability, and the potential for large-scale manufacturing [282]. Biocompatible and biodegradable polymers have been used for this purpose, such as starch [269, 283–285], methylcellulose (MA) [282], PLA [285], polyvinyl chloride (PVC) [286], and poly-(propylene carbonate) (PPC) [287] (Figure 8.7). 8.4 Zinc Oxide Nano-antimicrobials A (c) A (b) A (a) B (c) B (b) Figure 8.7 Growth of A. flavus (A) and P. citrinum (B) after the treatment by the sample films with ZnO NPs; A (a, b) and B (a, b), ZnO NPs + PVC composite films; A (c) and B (a) B (c), blank PVC film as the control. (Reproduced from Ref. [286], Figure 3, Copyright (2009), with permission from Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.) 199 200 8 Nano-Antimicrobials Based on Metals Another typical chemical route is the hydrothermal process, which involves thermal decomposition of a precursor in the liquid phase [288]. Conveniently, particle morphology and size, capable of affecting the final antimicrobial activity [289, 290], can be modified by using different zinc precursors (nitrate, acetate, chloride, etc.) [288]. NSs produced this way are usually coated on different substrates: metallic sheets for biomedical implants [291], air filters [292], and wound dressing materials [293]. 8.4.1.3 Electrochemical Approaches Interesting electrochemical approaches to unsupported dispersible ZnO NSs are herein reviewed and classified into three main categories, according to the composition of the electrolytic bath: electrochemical deposition under oxidizing conditions (EDOC)-like, aqueous-based electrolyses, and alcoholbased electrolyses. EDOC-like processes, developed from the principle firstly illustrated by Reetz et al. [294] for the synthesis of CoO colloids, was firstly reported by Natter and coworkers [295, 296] for the preparation of ZnO NSs. Anyway, no antimicrobial applications are known for this synthetic approach. To the best of our knowledge, the very first example of aqueous electrochemical synthesis of ZnO colloids was reported in 2004 [297]; from there, the fabrication of ZnO NPs by the potentiostatic anodization (20–40 V) of a Zn sheet in 0.1 M NaOH solution at 15 ∘ C has been demonstrated [298]. The use of slightly high potentials to synthesize unsupported ZnO NPs has been overcome in the works by Venkatesha and coworkers [299–301]. They presented a hybrid electrochemical–thermal method using a NaHCO3 aqueous solution as alkaline medium under galvanostatic control at 10 mA cm−2 to generate a mixed species of zinc carbonate and hydroxide, which can be decomposed to ZnO by calcination at temperatures above 300 ∘ C [299, 300]. According to the electrochemical–thermal method, we have recently developed a novel approach based on the use of anionic stabilizers to better control the final particle size and morphology of ZnO NPs galvanostatically grown from aqueous media [302]. Few examples have been reported in the literature on the use of electrolytic baths containing alcohols as the main solvent for the synthesis of ZnO nano-colloids [303, 304]; high potentials and mixed ZnO/Zn colloids are obtained this way, unless a small percentage of water is introduced in the electrochemical media [305]. Finally, electrochemical approaches to ZnO nanomaterials are still mainly focused on the deposition of supported phases and/or well-ordered nano-arrays. We found few reports about antimicrobial activity of electrochemically deposited ZnO NSs [306]: Gupta and coworkers deposited ZnO NRs onto F-SnO2 substrate by electrochemical deposition method from aqueous solution, with a 15 mA/cm2 current density. The antibacterial activity of ZnO NRs was studied for E. coli, showing a high inhibition of bacterial growth. References 8.5 Conclusions As described in previous sections, several approaches have been employed to prepare metal or metal oxide nano-antimicrobials, all of them presenting both advantages and drawbacks. It should be considered that the final application of the bioactive nanomaterials drives the choice of the synthesis. Moreover, the proper design of effective nano-antimicrobials cannot exclude the knowledge of bioactivity mechanisms, generally associated to NSs. Some extensive works have already been presented on this topic, although some points have not been completely clarified [3, 4, 16, 159, 307]. Generation of ROS, ion release, DNA damage, oxidative stress as well as direct cell membrane damage [7, 172] were accounted among the possible mechanisms. However, a complete treatise on bioactivity of these agents is beyond the scope of the chapter. For perspective uses, besides nano-antimicrobials based on Ag, Cu, and ZnO, other appealing inorganic nanomaterials (such as TiO2 , Ga, Se, CNTs, etc.) are emerging as antimicrobial agents among the scientific community [308]. TiO2 antimicrobials possess the peculiar property of being photoactivated [309, 310], and are widely used in biomedical applications [311]. Ga(III), structurally similar to Fe(III), cannot be reduced under physiological conditions, having therefore the potential to serve as a Fe analog, capable of exerting high antibacterial activity, by means of cellular uptake [312]. Se NPs, mostly used for antibacterial biomedical coatings [313, 314], possess enormous antibacterial activity because of the massive ROS generation and growth inhibition [315]. The unique and tunable properties of carbon-based nanomaterials enable new technologies for the development of novel antimicrobial strategies: fast membrane perturbation or disruption occurs, leading bacteria in contact with CNTs [316], paving the way for the application of these NSs as building blocks for novel antimicrobial materials [317]. As a last remark, along the development of metal-based nano-antimicrobials, the study of their toxicity mechanisms toward important proteins, cells, tissues, and organisms is receiving increasing attention as nanometer-size objects can cause serious damages. As a result, the next generation of nano-antimicrobials should be developed according to a multidisciplinary approach involving biology, engineering, chemistry, and physics to ensure their large-scale production for safe use and real life applications. References 1. Silver, S., Phung, L.T., and Silver, G. (2006) Silver as biocides in burn and wound dressings and bacterial resistance to silver compounds. J. Ind. Microbiol. Biotechnol., 33, 627–634. 2. Borkow, G. and Gabbay, J. (2009) Copper, an ancient remedy returning to fight microbial, fungal and viral infections. Curr. Chem. Biol., 3, 272–278. 3. Jones, N., Ray, B., Ranjit, K.T., and Manna, A.C. (2008) Antibacterial activity of ZnO nanoparticle suspensions on a broad spectrum of microorganisms. FEMS Microbiol. Lett., 279, 71–76. 201 202 8 Nano-Antimicrobials Based on Metals 4. Rai, M., Yadav, A., and Gade, A. (2009) 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. Silver nanoparticles as a new generation of antimicrobials. Biotechnol. Adv., 27, 76–83. Klasen, H.J. (2000) Historical review of the use of silver in the treatment of burns. I. Early uses. Burns, 26, 117–130. Chopra, I. (2007) The increasing use of silver-based products as antimicrobial agents: a useful development or a cause for concern? J. Antimicrob. Chemother., 59, 587–590. Grass, G., Rensing, C., and Solioz, M. (2011) Metallic copper as an antimicrobial surface. Appl. Environ. Microbiol., 77, 1541–1547. Roselli, M., Finamore, A., Garaguso, I., Britti, M.S., and Mengheri, E. (2003) Zinc oxide protects cultured enterocytes from the damage induced by Escherichia coli. J. Nutr., 133, 4077–4082. Kolář, M., Urbánek, K., and Látal, T. (2001) Antibiotic selective pressure and development of bacterial resistance. Int. J. Antimicrob. Agents, 17, 357–363. WHO (2013) Antimicrobial Resistance Fact Sheet N. 194, WHO http://www.who.int/mediacentre/ factsheets/fs194/en/. Llorens, A., Lloret, E., Picouet, P.A., Trbojevich, R., and Fernandez, A. (2012) Metallic-based micro and nanocomposites in food contact materials and active food packaging. Trends Food Sci. Technol., 24, 19–29. Dastjerdi, R. and Montazer, M. (2010) A review on the application of inorganic nano-structured materials in the modification of textiles: focus on antimicrobial properties. Colloids Surf. B Biointerfaces, 79, 5–18. Kaiser, J.-P., Zuin, S., and Wick, P. (2013) Is nanotechnology revolutionizing the paint and lacquer industry? A critical opinion. Sci. Total Environ., 442, 282–289. Cioffi, N. and Rai, M. (2012) NanoAntimicrobials: Progress and Prospects Springer, Springer-Verlag, Berlin, Heidelberg. 15. Taylor, E. and Webster, T.J. (2011) 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. Reducing infections through nanotechnology and nanoparticles. Int. J. Nanomed., 6, 1463. Ingle, A., Duran, N., and Rai, M. (2013) Bioactivity, mechanism of action, and cytotoxicity of copperbased nanoparticles: a review. Appl. Microbiol. Biotechnol., 98, 1–9. Meng, X.K., Tang, S.C., and Vongehr, S. (2010) A review on diverse silver nanostructures. J. Mater. Sci. Technol., 26, 487–522. Wiley, B., Sun, Y., Mayers, B., and Xia, Y. (2005) Shape-controlled synthesis of metal nanostructures: the case of silver. Chem. Eur. J., 11, 454–463. Sau, K.T. and Rogach, A.L. (2012) Complex-Shaped Metal Nanoparticles: Bottom-Up Syntheses and Applications, Wiley-VCH Verlag GmbH. Kan, C.-X., Zhu, J.-J., and Zhu, X.G. (2008) Silver nanostructures with well-controlled shapes: synthesis, characterization and growth mechanisms. J. Phys. D: Appl. Phys., 41, 155304. Pimpang, P., Sutham, W., Mangkorntong, N., Mangkorntong, P., and Choopun, S. (2008) Effect of stabilizer on preparation of silver and gold nanoparticle using grinding method. Chiang Mai J. Sci., 40 (2008), 250–257. Tsuzuki, T. (2009) Commercial scale production of inorganic nanoparticles. Int. J. Nanotechnol., 6, 567–578. Förster, H., Wolfrum, C., and Peukert, W. (2012) Experimental study of metal nanoparticle synthesis by an arc evaporation/condensation process. J. Nanopart. Res., 14, 926 (16 pp). Simchi, A., Ahmadi, R., Reihani, S.M.S., and Mahdavi, A. (2007) Kinetics and mechanisms of nanoparticle formation and growth in vapor phase condensation process. Mater. Des., 28, 850–856. Harra, J., Mäkitalo, J., Siikanen, R., Virkki, M., Genty, G., Kobayashi, T., Kauranen, M., and Mäkelä, J.M. (2012) Size-controlled aerosol synthesis of silver nanoparticles for plasmonic materials. J. Nanopart. Res., 14, 870–880. References 26. Goharshadi, E.K. and Azizi- 27. 28. 29. 30. 31. 32. 33. 34. Toupkanloo, H. (2013) Silver colloid nanoparticles: ultrasound-assisted synthesis, electrical and rheological properties. Powder Technol., 237, 97–101. Vasileva, P., Stefanova, L., Vaklev, N., and Dushkin, C. (2008) Ultrasoundassisted synthesis of silver nanoparticles via sodium borohydride reduction. Nanosci. Nanotechnol., 8, 76. He, C., Liu, L., Fang, Z., Li, J., Guo, J., and Wei, J. (2014) Formation and characterization of silver nanoparticles in aqueous solution via ultrasonic irradiation. Ultrason. Sonochem., 21, 542–548. Chen, J., Wang, J., Zhang, X., and Jin, Y. (2008) Microwave-assisted green synthesis of silver nanoparticles by carboxymethyl cellulose sodium and silver nitrate. Mater. Chem. Phys., 108, 421–424. Hu, B., Wang, S.-B., Wang, K., Zhang, M., and Yu, S.-H. (2008) Microwaveassisted rapid facile “green” synthesis of uniform silver nanoparticles: selfassembly into multilayered films and their optical properties. J. Phys. Chem. C, 112, 11169–11174. Kudle, K.R., Donda, M.R., Merugu, R., Kudle, M.R., and Pratap, M.P.R. (2013) Microwave assisted green synthesis of silver nanoparticles using Boswellia Serrata flower extract and evaluation of their antimicrobial activity. Int. Res. J. Pharm., 4, 197–200. Manikprabhu, D. and Lingappa, K. (2013) Microwave assisted rapid and green synthesis of silver nanoparticles using a pigment produced by streptomyces coelicolor klmp33. Bioinorg. Chem. Appl., 2013, 1–5. Jia, H., Xu, W., An, J., Li, D., and Zhao, B. (2006) A simple method to synthesize triangular silver nanoparticles by light irradiation. Spectrochim. Acta, Part A Mol. Biomol. Spectrosc., 64, 956–960. Zhuo, Y., Du, C., Li, X., Sun, W., and Chu, Y. (2013) One-step synthesis and photoluminescence properties of polycarbazole spheres and Ag/polycarbazole 35. 36. 37. 38. 39. 40. 41. 42. 43. core/shell composites. Eur. Polym. J., 49, 1365–1372. Weimer, M.W., Chen, H., Giannelis, E.P., and Sogah, D.Y. (1999) Direct synthesis of dispersed nanocomposites by in situ living free radical polymerization using a silicate-anchored initiator. J. Am. Chem. Soc., 121, 1615–1616. Gao, F., Lu, Q., and Komarneni, S. (2005) Interface reaction for the selfassembly of silver nanocrystals under microwave-assisted solvothermal conditions. Chem. Mater., 17, 856–860. Perkas, N., Shuster, M., Amirian, G., Koltypin, Y., and Gedanken, A. (2008) Sonochemical immobilization of silver nanoparticles on porous polypropylene. J. Polym. Sci., Part A: Polym. Chem., 46, 1719–1729. Perkas, N., Amirian, G., Dubinsky, S., Gazit, S., and Gedanken, A. (2007) Ultrasound-assisted coating of nylon 6,6 with silver nanoparticles and its antibacterial activity. J. Appl. Polym. Sci., 104, 1423–1430. Amendola, V. and Meneghetti, M. (2009) Laser ablation synthesis in solution and size manipulation of noble metal nanoparticles. Phys. Chem. Chem. Phys., 11, 3805. Singh, S.C. (2012) Nanomaterials, Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, pp. 317–437. Ganeev, R.A., Baba, M., Ryasnyansky, A.I., Suzuki, M., and Kuroda, H. (2004) Characterization of optical and nonlinear optical properties of silver nanoparticles prepared by laser ablation in various liquids. Opt. Commun., 240, 437–448. Dell’Aglio, M., Gaudiuso, R., ElRashedy, R., Pascale, O.D., Palazzo, G., and Giacomo, A.D. (2013) Collinear double pulse laser ablation in water for the production of silver nanoparticles. Phys. Chem. Chem. Phys., 15, 20868–20875. Amendola, V., Polizzi, S., and Meneghetti, M. (2007) Free silver nanoparticles synthesized by laser ablation in organic solvents and their easy functionalization. Langmuir, 23, 6766–6770. 203 204 8 Nano-Antimicrobials Based on Metals 44. Tilaki, R.M., Iraji zad, A., and Mahdavi, 45. 46. 47. 48. 49. 50. 51. 52. 53. S.M. (2006) Stability, size and optical properties of silver nanoparticles prepared by laser ablation in different carrier media. Appl. Phys. A, 84, 215–219. Sreeja, R., Reshmi, R., Aneesh, P.M., and Jayaraj, M.K. (2012) Liquid phase pulsed laser ablation of metal nanoparticles for nonlinear optical applications. Sci. Adv. Mater., 4, 439–448. Tsuji, T., Thang, D.-H., Okazaki, Y., Nakanishi, M., Tsuboi, Y., and Tsuji, M. (2008) Preparation of silver nanoparticles by laser ablation in polyvinylpyrrolidone solutions. Appl. Surf. Sci., 254, 5224–5230. Tsuji, T., Mizuki, T., Ozono, S., and Tsuji, M. (2009) Laser-induced silver nanocrystal formation in polyvinylpyrrolidone solutions. J. Photochem. Photobiol., A Chem., 206, 134–139. Zamiri, R., Zakaria, A., Sadrolhosseini, A.R., Ahangar, H.A., and Drummen, G.P.C. (2013) Laser-Ablation synthesis and evaluation of thermal non-linear optical properties of silver nanoparticles in monoolein. Sci. Adv. Mater., 5, 748–757. Zamiri, R., Azmi, B.Z., Naseri, M.G., Ahangar, H.A., Darroudi, M., and Nazarpour, F.K. (2011) Laser based fabrication of chitosan mediated silver nanoparticles. Appl. Phys. A, 105, 255–259. Zamiri, R., Azmi, B.Z., Ahangar, H.A., Zamiri, G., Husin, M.S., and Wahab, Z.A. (2012) Preparation and characterization of silver nanoparticles in natural polymers using laser ablation. Bull. Mater. Sci., 35, 727–731. Basu, S. and Pal, T. (2009) in Advanced Wet-Chemical Synthetic Approaches to Inorganic Nanostructures (ed D.P. Cozzoli), Research Signpost, p. 219. Gibbons, V.L. and Getman, F.H. (1914) The potential of silver in non aqueous solutions of silver nitrat. J. Am. Chem. Soc., 36, 2091. Caswell, K.K., Bender, C.M., and Murphy, C.J. (2003) Seedless, surfactantless wet chemical synthesis of silver nanowires. Nano Lett., 3, 667–669. 54. Nagabhushana, K.S. and Bönnemann, 55. 56. 57. 58. 59. 60. 61. 62. 63. 64. H. (2004) in Nanotechnology in Catalysis (eds B. Zhou, S. Hermans, and G.A. Somorjai), Boston, MA, Springer, pp. 51–82. Pulit, J., Banach, M., and Kowalski, Z. (2013) Chemical reduction as the main method for obtaining nanosilver. J. Comput. Theor. Nanosci., 10, 276–284. Wang, W. and Gu, B. (2004) Concentrated Dispersions, ACS Symposium Series. American Chemical Society, pp. 1–14, 10.1021/bk-2004-0878.ch001. Li, D., Hong, B., Fang, W., Guo, Y., and Lin, R. (2010) Preparation of well-dispersed silver nanoparticles for oil-based nanofluids. Ind. Eng. Chem. Res., 49, 1697–1702. García-Barrasa, J., López-de-Luzuriaga, J.M., and Monge, M. (2010) Silver nanoparticles: synthesis through chemical methods in solution and biomedical applications. Cent. Eur. J. Chem., 9, 7–19. Punitha, N. and Ramesh, P.S. (2013) Characterization of polymer assisted nano silver by chemical reduction method. Asian J. Chem., 25, S157. Tiwari, A.D., Mishra, A.K., Mishra, S.B., Kuvarega, A.T., and Mamba, B.B. (2013) Stabilisation of silver and copper nanoparticles in a chemically modified chitosan matrix. Carbohydr. Polym., 92, 1402–1407. Yuan, W., Fu, J., Su, K., and Ji, J. (2010) Self-assembled chitosan/heparin multilayer film as a novel template for in situ synthesis of silver nanoparticles. Colloids Surf. B Biointerfaces, 76, 549–555. Xin, J., Yin, X., Chen, S., and Wu, A. (2012) Synthesis of uniform and stable silver nanoparticles by a gold seedmediated growth approach in a buffer system. J. Exp. Nanosci., 9, 1–9. Sathiya Priya, R., Geetha, D., and Ramesh, P.S. (2013) Antibacterial activity of nano-silver capped by βcyclodextrin. Carbon Sci. Technol., 5, 197. Tavallai, H. and Pouresmaeil, S. (2012) Determination of ascorbic acid by References 65. 66. 67. 68. 69. 70. 71. 72. 73. modified method based on photoluminescence of silver nanoparticles. Int. J. Chem. Tech. Res., 4, 304. Kwon, J.W., Yoon, S.H., Lee, S.S., Seo, K.W., and Shim, I.W. (2005) Preparation of silver nanoparticles in cellulose acetate polymer and the reaction chemistry of silver complexes in the polymer. Bull. Korean Chem. Soc., 26, 837–840. Oluwafemi, O.S., Lucwaba, Y., Gura, A., Masabeya, M., Ncapayi, V., Olujimi, O.O., and Songca, S.P. (2013) A facile completely “green” size tunable synthesis of maltose-reduced silver nanoparticles without the use of any accelerator. Colloids Surf. B Biointerfaces, 102, 718–723. Kuo, P.-L., Chen, C.-C., and Yuen, S.-M. (2004) Protection effects of hydrophile-grafted silicone copolymers on the formation of colloidal silver nanoparticles. J. Phys. Chem. B, 108, 5541–5546. Wang, H., Qiao, X., Chen, J., Wang, X., and Ding, S. (2005) Mechanisms of PVP in the preparation of silver nanoparticles. Mater. Chem. Phys., 94, 449–453. Wang, H., Qiao, X., Chen, J., and Ding, S. (2005) Preparation of silver nanoparticles by chemical reduction method. Colloids Surf., A Physicochem. Eng. Aspects, 256, 111–115. Solanki, J.N. and Murthy, Z.V.P. (2010) Highly monodisperse and sub-nano silver particles synthesis via microemulsion technique. Colloids Surf., A Physicochem. Eng. Aspects, 359, 31–38. Solanki, J.N. and Murthy, Z.V.P. (2011) Reduction of nitro aromatic compounds over Ag/Al2 O3 nanocatalyst prepared in water-in-oil microemulsion: effects of water-to-surfactant mole ratio and type of reducing agent. Ind. Eng. Chem. Res., 50, 7338–7344. Zhang, W., Qiao, X., and Chen, J. (2007) Synthesis of silver nanoparticles—Effects of concerned parameters in water/oil microemulsion. Mater. Sci. Eng., B, 142, 1–15. Verma, V. (2009) Biosynthesis of noble metal nanoparticles and their application. CAB Rev. Perspect. Agric. Vet. Sci. Nutr. Nat. Resour., 4 (026), 1–17. 74. Iravani, S. (2011) Green synthesis of 75. 76. 77. 78. 79. 80. 81. 82. 83. metal nanoparticles using plants. Green Chem., 13, 2638. Pavani, K.V., Kumar, N.S., and Gayathramma, K. (2012) Plants as ecofriendly nanofactories. J. Bionanosci., 6, 1–6. Naik, R.R., Stringer, S.J., Agarwal, G., Jones, S.E., and Stone, M.O. (2002) Biomimetic synthesis and patterning of silver nanoparticles. Nat. Mater., 1, 169–172. Ahmad, A., Mukherjee, P., Senapati, S., Mandal, D., Khan, M.I., Kumar, R., and Sastry, M. (2003) Extracellular biosynthesis of silver nanoparticles using the fungus Fusarium oxysporum. Colloids Surf. B Biointerfaces, 28, 313–318. Bhainsa, K.C. and D’Souza, S.F. (2006) Extracellular biosynthesis of silver nanoparticles using the fungus Aspergillus fumigatus. Colloids Surf. B Biointerfaces, 47, 160–164. Wei, X., Zhou, H., Xu, L., Luo, M., and Liu, H. (2014) Sunlight-induced biosynthesis of silver nanoparticles by animal and fungus biomass and their characterization. J. Chem. Technol. Biotechnol., 89, 305–311. Mukherjee, P., Ahmad, A., Mandal, D., Senapati, S., Sainkar, S.R., Khan, M.I., Parishcha, R., Ajaykumar, P.V., Alam, M., Kumar, R. et al. (2001) Fungus-mediated synthesis of silver nanoparticles and their immobilization in the mycelial matrix: a novel biological approach to nanoparticle synthesis. Nano Lett., 1, 515–519. Gurunathan, S., Kalishwaralal, K., Vaidyanathan, R., Venkataraman, D., Pandian, S.R.K., Muniyandi, J., Hariharan, N., and Eom, S.H. (2009) Biosynthesis, purification and characterization of silver nanoparticles using Escherichia coli. Colloids Surf. B Biointerfaces, 74, 328–335. Kalimuthu, K., Suresh Babu, R., Venkataraman, D., Bilal, M., and Gurunathan, S. (2008) Biosynthesis of silver nanocrystals by Bacillus licheniformis. Colloids Surf. B Biointerfaces, 65, 150–153. Malarkodi, C., Rajeshkumar, S., Paulkumar, K., Vanaja, M., Jobitha, 205 206 8 Nano-Antimicrobials Based on Metals 84. 85. 86. 87. 88. 89. 90. 91. G.D.G., and Annadurai, G. (2013) Bacselected human pathogens. J. Exp. Nanosci., 9, 197–209. tericidal activity of bio mediated silver 92. Roy, K., Biswas, B., and Banerjee, nanoparticles synthesized by Serratia P.C. (2013) “Green” synthesis of silver nematodiphila. Drug Invent. Today, 5, nanoparticles by using grape (Vitis 119–125. vinifera) fruit extract: characterization Malhotra, A., Dolma, K., Kaur, N., of the particles and study of antibacteRathore, Y.S., Ashish, Mayilraj, S., rial activity. Res. J. Pharm. Biol. Chem. and Choudhury, A.R. (2013) BiosynSci., 4, 1271. thesis of gold and silver nanoparti93. Vidhu, V.K. and Philip, D. (2014) Speccles using a novel marine strain of troscopic, microscopic and catalytic Stenotrophomonas. Bioresour. Technol., properties of silver nanoparticles syn142, 727–731. thesized using Saraca indica flower. Vidhu, V.K. and Philip, D. (2014) CatSpectrochim. Acta, Part A Mol. Biomol. alytic degradation of organic dyes using Spectrosc., 117, 102–108. biosynthesized silver nanoparticles. 94. Khaydarov, R.A., Khaydarov, R.R., Micron, 56, 54–62. Gapurova, O., Estrin, Y., and Scheper, Annamalai, A., Christina, V.L.P., T. (2009) Electrochemical method for Christina, V., and Lakshmi, P.T.V. (2014) the synthesis of silver nanoparticles. Green synthesis and characterisation J. Nanopart. Res., 11, 1193–1200. of Ag NPs using aqueous extract of 95. Reetz, M.T. and Helbig, W. (1994) SizePhyllanthus maderaspatensis L. J. Exp. selective synthesis of nanostructured Nanosci., 9, 113–119. transition metal clusters. J. Am. Chem. Ghaffari-Moghaddam, M. and Soc., 116, 7401–7402. Hadi-Dabanlou, R. (2013) Plant medi96. Rodríguez-Sánchez, L., Blanco, M.C., ated green synthesis and antibacterial and López-Quintela, M.A. (2000) activity of silver nanoparticles using Electrochemical synthesis of silver Crataegus douglasii fruit extract. J. Ind. nanoparticles. J. Phys. Chem. B, 104, Eng. Chem., 20, 739–744. 9683–9688. Nazeruddin, G.M., Prasad, N.R., 97. Starowicz, M., Stypuła, B., and Banaś, Waghmare, S.R., Garadkar, K.M., J. (2006) Electrochemical synthesis and Mulla, I.S. (2014) Extracellular of silver nanoparticles. Electrochem. biosynthesis of silver nanoparticle using Commun., 8, 227–230. Azadirachta indica leaf extract and its 98. Jian, Z., Xiang, Z., and Yongchang, W. anti-microbial activity. J. Alloys Compd., (2005) Electrochemical synthesis and 583, 272–277. fluorescence spectrum properties of Shankar, S.S., Ahmad, A., and Sastry, silver nanospheres. Microelectron. Eng., M. (2003) Geranium leaf assisted 77, 58–62. biosynthesis of silver nanoparticles. 99. Rabinal, M.K., Kalasad, M.N., Biotechnol. Prog., 19, 1627–1631. Praveenkumar, K., Bharadi, V.R., Shanmugam, N., Rajkamal, P., and Bhikshavartimath, A.M. (2013) Cholan, S., Kannadasan, N., Electrochemical synthesis and optical Sathishkumar, K., Viruthagiri, G., and properties of organically capped silver Sundaramanickam, A. (2014) Biosynnanoparticles. J. Alloys Compd., 562, thesis of silver nanoparticles from the 43–47. marine seaweed Sargassum wightii 100. Cioffi, N., Colaianni, L., Pilolli, R., and their antibacterial activity against Calvano, C., Palmisano, F., and some human pathogens. Appl. Nanosci., Zambonin, P. (2009) Silver nanofractals: September 2013, 1–8. electrochemical synthesis, XPS characDaniel, S.C.G.K., Banu, B.N., Harshiny, terization and application in LDI-MS. M., Nehru, K., Ganesh, P.S., Kumaran, Anal. Bioanal. Chem., 394, 1375–1383. S., and Sivakumar, M. (2014) Ipomea 101. Lee, C.-L. and Syu, C.-M. (2010) carnea-based silver nanoparticle synElectrochemical synthesis of thesis for antibacterial activity against hexadecyltrimethylammonium-coated References 102. 103. 104. 105. 106. 107. 108. 109. 110. 111. 112. Ag nanopeanuts and their self-assembly to nanonets. Colloids Surf., A Physicochem. Eng. Aspects, 358, 158–162. ten Kortenaar, M.V., Kolar, Z.I., and Tichelaar, F.D. (1999) Formation of long-lived silver clusters in aqueous solution by anodic dispersion. J. Phys. Chem. B, 103, 2054–2060. Yin, B., Ma, H., Wang, S., and Chen, S. (2003) Electrochemical synthesis of silver nanoparticles under protection of poly( N -vinylpyrrolidone). J. Phys. Chem. B, 107, 8898–8904. Ma, H., Yin, B., Wang, S., Jiao, Y., Pan, W., Huang, S., Chen, S., and Meng, F. (2004) Synthesis of silver and gold nanoparticles by a novel electrochemical method. ChemPhysChem, 5, 68–75. Johans, C. (2002) Electrosynthesis of polyphenylpyrrole coated silver particles at a liquid–liquid interface. Electrochem. Commun., 4, 227–230. Roldán, M.V., Pellegri, N., and de Sanctis, O. (2013) Electrochemical method for Ag-PEG nanoparticles synthesis. J. Nanopart., 2013, 1–7. Zhu, J.-J., Liao, X.-H., Zhao, X.-N., and Chen, H.-Y. (2001) Preparation of silver nanorods by electrochemical methods. Mater. Lett., 49, 91–95. Reicha, F.M., Sarhan, A., Abdel-Hamid, M.I., and El-Sherbiny, I.M. (2012) Preparation of silver nanoparticles in the presence of chitosan by electrochemical method. Carbohydr. Polym., 89, 236–244. Zoval, J.V., Stiger, R.M., Biernacki, P.R., and Penner, R.M. (1996) Electrochemical deposition of silver nanocrystallites on the atomically smooth graphite basal plane. J. Phys. Chem., 100, 837–844. Yuan, G., Chang, X., and Zhu, G. (2011) Electrosynthesis and catalytic properties of silver nano/microparticles with different morphologies. Particuology, 9, 644–649. Guan, D. and Wang, Y. (2012) Electrodeposition of Ag nanoparticles onto bamboo-type TiO2 nanotube arrays to improve their lithium-ion intercalation performance. Ionics, 19, 879–885. Fang, Y.-M., Lin, Z.-B., Zeng, Y.-M., Chen, W.-K., Chen, G.-N., Sun, J.-J., 113. 114. 115. 116. 117. 118. 119. 120. 121. 122. Ren, B., and Tian, Z.-Q. (2010) Facile electrochemical preparation of Ag nanothorns and their growth mechanism. Chem. Eur. J., 16, 6766–6770. Mazur, M. (2004) Electrochemically prepared silver nanoflakes and nanowires. Electrochem. Commun., 6, 400–403. Tang, Z., Liu, S., Dong, S., and Wang, E. (2001) Electrochemical synthesis of Ag nanoparticles on functional carbon surfaces. J. Electroanal. Chem., 502, 146–151. Zhong, L., Gan, S., Fu, X., Li, F., Han, D., Guo, L., and Niu, L. (2013) Electrochemically controlled growth of silver nanocrystals on graphene thin film and applications for efficient nonenzymatic H2 O2 biosensor. Electrochim. Acta, 89, 222–228. Tang, S., Meng, X., Wang, C., and Cao, Z. (2009) Flowerlike Ag microparticles with novel nanostructure synthesized by an electrochemical approach. Mater. Chem. Phys., 114, 842–847. Zhitomirsky, I. and Hashambhoy, A. (2007) Chitosan-mediated electrosynthesis of organic–inorganic nanocomposites. J. Mater. Process. Technol., 191, 68–72. Hache, F., Ricard, D., and Flytzanis, C. (1986) Optical nonlinearities of small metal particles: surface-mediated resonance and quantum size effects. J. Opt. Soc. Am. B, 3, 1647–1655. Lee, K.-C., Lin, S.-J., Lin, C.-H., Tsai, C.-S., and Lu, Y.-J. (2008) Size effect of Ag nanoparticles on surface plasmon resonance. Surf. Coat. Technol., 202, 5339–5342. Haiss, W., Thanh, N.T.K., Aveyard, J., and Fernig, D.G. (2007) Determination of size and concentration of gold nanoparticles from UV − vis spectra. Anal. Chem., 79, 4215–4221. Evanoff, D.D. and Chumanov, G. (2004) Size-controlled synthesis of nanoparticles. 2. Measurement of extinction, scattering, and absorption cross sections. J. Phys. Chem. B, 108, 13957–13962. Mock, J.J., Barbic, M., Smith, D.R., Schultz, D.A., and Schultz, S. (2002) 207 208 8 Nano-Antimicrobials Based on Metals 123. 124. 125. 126. 127. 128. 129. 130. 131. Shape effects in plasmon resonance of individual colloidal silver nanoparticles. J. Chem. Phys., 116, 6755–6759. Prema, P. (2011) Chemical mediated synthesis of silver nanoparticles and its potential antibacterial application, in Progress in Molecular and Environmental Bioengineering – From Analysis and Modeling to Technology Applications (ed A. Carpi), InTech. doi: 10.5772/22114 Sarkar, A., Kapoor, S., and Mukherjee, T. (2010) Oleic acidassisted phase transfer of nanosized silver colloids. Res. Chem. Intermed., 36, 403–410. Barth, H.G. and Flippen, R.B. (1995) Particle size analysis. Anal. Chem., 67, 257–272. Williams, D.B. and Carter, C.B. (2009) Transmission Electron Microscopy, 2nd edn, Springer Science & Business Media. Wang, Z.L. (2000) Transmission electron microscopy of shape-controlled nanocrystals and their assemblies. J. Phys. Chem. B, 104, 1153–1175. Abdelgawad, A.M., Hudson, S.M., and Rojas, O.J. (2014) Antimicrobial wound dressing nanofiber mats from multicomponent (chitosan/silverNPs/polyvinyl alcohol) systems. Carbohydr. Polym., 100, 166–178. Ataeefard, M. and Sharifi, S. (2014) Antibacterial flexographic ink containing silver nanoparticles. Prog. Org. Coat., 77, 118–123. Cioffi, N., Ditaranto, N., Torsi, L., Picca, R.A., Giglio, E.D., Sabbatini, L., Novello, L., Tantillo, G., Bleve-Zacheo, T., and Zambonin, P.G. (2005) Synthesis, analytical characterization and bioactivity of Ag and Cu nanoparticles embedded in poly-vinyl-methyl-ketone films. Anal. Bioanal. Chem., 382, 1912–1918. Panáček, A., Kvítek, L., Prucek, R., Kolář, M., Večeřová, R., Pizúrová, N., Sharma, V.K., Nevěčná, T., and Zbořil, R. (2006) Silver colloid nanoparticles: synthesis, characterization, and their antibacterial activity. J. Phys. Chem. B, 110, 16248–16253. 132. Shahverdi, A.R., Fakhimi, A., Shahverdi, 133. 134. 135. 136. 137. 138. 139. 140. 141. H.R., and Minaian, S. (2007) Synthesis and effect of silver nanoparticles on the antibacterial activity of different antibiotics against Staphylococcus aureus and Escherichia coli. Nanomed. Nanotechnol. Biol. Med., 3, 168–171. Joy, D.C. (2006) Scanning electron microscopy, in Materials Science and Technology, Wiley-VCH Verlag GmbH & Co. KGaA. Brook, L.A., Evans, P., Foster, H.A., Pemble, M.E., Steele, A., Sheel, D.W., and Yates, H.M. (2007) Highly bioactive silver and silver/titania composite films grown by chemical vapour deposition. J. Photochem. Photobiol., A Chem., 187, 53–63. Rill, M.S., Plet, C., Thiel, M., Staude, I., von Freymann, G., Linden, S., and Wegener, M. (2008) Photonic metamaterials by direct laser writing and silver chemical vapour deposition. Nat. Mater., 7, 543–546. Tzeng Lue, J. (2007) in Encyclopedia of Nanoscience and Nanotechnology (ed H.S. Nalwa), American Scientific Publishers, pp. 1–46. Zhu, X., Birringer, R., Herr, U., and Gleiter, H. (1987) X-ray diffraction studies of the structure of nanometersized crystalline materials. Phys. Rev. B, 35, 9085–9090. Khanna, P.K., Singh, N., Kulkarni, D., Deshmukh, S., Charan, S., and Adhyapak, P.V. (2007) Water based simple synthesis of re-dispersible silver nano-particles. Mater. Lett., 61, 3366–3370. Uvarov, V. and Popov, I. (2007) Metrological characterization of X-ray diffraction methods for determination of crystallite size in nano-scale materials. Mater. Charact., 58, 883–891. Wagner, C.D. (1979) Handbook of X-Ray Photoelectron Spectroscopy: A Reference Book of Standard Data for Use in X-Ray Photoelectron Spectroscopy, Physical Electronics Division, Perkin-Elmer Corp. Wertheim, G.K., DiCenzo, S.B., and Buchanan, D.N.E. (1986) Noble- and transition-metal clusters: the d bands of References 142. 143. 144. 145. 146. 147. 148. 149. 150. silver and palladium. Phys. Rev. B, 33, 5384–5390. Shin, H.S., Choi, H.C., Jung, Y., Kim, S.B., Song, H.J., and Shin, H.J. (2004) Chemical and size effects of nanocomposites of silver and polyvinyl pyrrolidone determined by X-ray photoemission spectroscopy. Chem. Phys. Lett., 383, 418–422. Schumm, B., Wisser, F.M., Mondin, G., Hippauf, F., Fritsch, J., Grothe, J., and Kaskel, S. (2012) Semi-transparent silver electrodes for flexible electronic devices prepared by nanoimprint lithography. J. Mater. Chem. C, 1, 638–645. Zhou, W. (2011) A label-free biosensor based on silver nanoparticles array for clinical detection of serum p53 in head and neck squamous cell carcinoma. Int. J. Nanomed., 6, 381–386. Chung, C.K., Fung, P.K., Hong, Y.Z., Ju, M.S., Lin, C.C.K., and Wu, T.C. (2006) A novel fabrication of ionic polymermetal composites (IPMC) actuator with silver nano-powders. Sens. Actuators, B Chem., 117, 367–375. Chun, K.-Y., Oh, Y., Rho, J., Ahn, J.-H., Kim, Y.-J., Choi, H.R., and Baik, S. (2010) Highly conductive, printable and stretchable composite films of carbon nanotubes and silver. Nat. Nanotechnol., 5, 853–857. Li, Y., Wu, Y., and Ong, B.S. (2005) Facile synthesis of silver nanoparticles useful for fabrication of highconductivity elements for printed electronics. J. Am. Chem. Soc., 127, 3266–3267. Wu, Y., Li, Y., and Ong, B.S. (2007) A simple and efficient approach to a printable silver conductor for printed electronics. J. Am. Chem. Soc., 129, 1862–1863. Wijesundera, D.N., Rajapaksa, I., Wang, X., Liu, J.-R., Rusakova, I., and Chu, W.-K. (2013) Ion beam engineered nano silver silicon substrates for surface enhanced Raman spectroscopy. J. Raman Spectrosc., 44, 1014–1017. Pinkhasova, P., Puccio, B., Chou, T., Sukhishvili, S., and Du, H. (2012) Noble metal nanostructure both as a SERS 151. 152. 153. 154. 155. 156. 157. 158. 159. nanotag and an analyte probe. Chem. Commun., 48, 9750–9752. Shanmukh, S., Jones, L., Driskell, J., Zhao, Y., Dluhy, R., and Tripp, R.A. (2006) Rapid and sensitive detection of respiratory virus molecular signatures using a silver nanorod array SERS substrate. Nano Lett., 6, 2630–2636. Abid, M.I., Wang, L., Zhang, X., and Xu, Y. (2013) Silver nano islands enhanced Raman scattering on large area grating substrates fabricated by two beam laser interference. Chem. Res. Chin. Univ., 29, 1006–1010. Fu, Q., Zhang, D., Chen, Y., Wang, X., Han, L., Zhu, L., Wang, P., and Ming, H. (2013) Surface enhanced Raman scattering arising from plasmonic interaction between silver nano-cubes and a silver grating. Appl. Phys. Lett., 103, 041122. Hossain, W., Ghosh, M., Sinha, C., Debnath, D.K., and Sarkar, U.K. (2013) SERS and DFT study of silver nano particle induced dark isomerisation in 1H-2(Phenylazo) imidazole. Chem. Phys. Lett., 586, 132–137. Orivnáková, R., Skantárová, L., Orivnák, A., Demko, J., Kupková, M., and Andersson, J.T. (2013) Electrochemical deposition of SERS active nanostructured silver films. Int. J. Electrochem. Sci., 8, 80–99. Kim, J.S., Kuk, E., Yu, K.N., Kim, J.-H., Park, S.J., Lee, H.J., Kim, S.H., Park, Y.K., Park, Y.H., Hwang, C.-Y. et al. (2007) Antimicrobial effects of silver nanoparticles. Nanomed. Nanotechnol. Biol. Med., 3, 95–101. Sondi, I. and Salopek-Sondi, B. (2004) Silver nanoparticles as antimicrobial agent: a case study on E. coli as a model for Gram-negative bacteria. J. Colloid Interface Sci., 275, 177–182. Lu, Z., Rong, K., Li, J., Yang, H., and Chen, R. (2013) Size-dependent antibacterial activities of silver nanoparticles against oral anaerobic pathogenic bacteria. J. Mater. Sci. Mater. Med., 24, 1465–1471. Marambio-Jones, C. and Hoek, E.M.V. (2010) A review of the antibacterial effects of silver nanomaterials and potential implications for human health 209 210 8 Nano-Antimicrobials Based on Metals 160. 161. 162. 163. 164. 165. 166. 167. 168. and the environment. J. Nanopart. Res., 12, 1531–1551. Kvítek, L., Panáček, A., Soukupová, J., Kolář, M., Večeřová, R., Prucek, R., Holecová, M., and Zbořil, R. (2008) Effect of Surfactants and Polymers on Stability and Antibacterial Activity of Silver Nanoparticles (NPs). J. Phys. Chem. C, 112, 5825–5834 Shrivastava, S., Bera, T., Roy, A., Singh, G., Ramachandrarao, P., and Dash, D. (2007) Characterization of enhanced antibacterial effects of novel silver nanoparticles. Nanotechnology, 18, 225103 (9pp). Teeguarden, J., Hinderliter, P., Orr, G., Thrall, B., and Pounds, J. (2007) Particokinetics in vitro: dosimetry considerations for in vitro nanoparticle toxicity assessments. Toxicol. Sci., 95, 300–312. Morones, J., Elechiguerra, J., Camacho, A., Holt, K., Kouri, J., Ramirez, J., and Yacaman, M. (2005) The bactericidal effect of silver nanoparticles. Nanotechnology, 16, 2346–2353. Stevanović, M., Bračko, I., Milenković, M., Filipović, N., Nunić, J., Filipič, M., and Uskoković, D.P. (2014) Multifunctional PLGA particles containing poly(l-glutamic acid)-capped silver nanoparticles and ascorbic acid with simultaneous antioxidative and prolonged antimicrobial activity. Acta Biomater., 10, 151–162. Dubas, S.T., Kumlangdudsana, P., and Potiyaraj, P. (2006) Layer-by-layer deposition of antimicrobial silver nanoparticles on textile fibers. Colloids Surf., A Physicochem. Eng. Aspects, 289, 105–109. Chappell, J.B. and Greville, G.D. (1954) Effect of silver ions on mitochondrial adenosine triphosphatase. Nature, 174, 930–931. Jensen, R.H. and Davidson, N. (1966) Spectrophotometric, potentiometric, and density gradient ultracentrifugation studies of the binding of silver ion by DNA. Biopolymers, 4, 17–32. Stohs, S. (1995) Oxidative mechanisms in the toxicity of metal ions. Free Radical Biol. Med., 18, 321–336. 169. Halliwell, B. and Gutteridge, J.M. (1984) 170. 171. 172. 173. 174. 175. 176. 177. 178. Oxygen toxicity, oxygen radicals, transition metals and disease. Biochem. J., 219, 1–14. Peña, M.M.O., Koch, K.A., and Thiele, D.J. (1998) Dynamic regulation of copper uptake and detoxification genes in saccharomyces cerevisiae. Mol. Cell. Biol., 18, 2514–2523. Varshney, R., Bhadauria, S., and Gaur, M.S. (2012) A review: biological synthesis of silver and copper nanoparticles. Nano Biomed. Eng., 4 (2), 99–106. Ruparelia, J.P., Chatterjee, A.K., Duttagupta, S.P., and Mukherji, S. (2008) Strain specificity in antimicrobial activity of silver and copper nanoparticles. Acta Biomater., 4, 707–716. Yoon, K.-Y., Hoon Byeon, J., Park, J.-H., and Hwang, J. (2007) Susceptibility constants of Escherichia coli and Bacillus subtilis to silver and copper nanoparticles. Sci. Total Environ., 373, 572–575. Longano, D., Ditaranto, N., Sabbatini, L., Torsi, L., and Cioffi, N. (2012) in Nano-Antimicrobials: Progress and Prospects (eds N. Cioffi and M. Rai), Springer-Verlag, Berlin, Heidelberg, pp. 85–117. Rubilar, O., Rai, M., Tortella, G., Diez, M., Seabra, A., and Durán, N. (2013) Biogenic nanoparticles: copper, copper oxides, copper sulphides, complex copper nanostructures and their applications. Biotechnol. Lett., 35, 1365–1375. Cioffi, N., Ditaranto, N., Torsi, L., and Sabbatini, L. (2009) in Metallic Nanomaterials Nanotechnologies for the Life Sciences (ed. C.S.S.R. Kumar), WileyVCH Verlag GmbH & Co. KGaA, Weinheim, pp. 3–70. Cheruthazhekatt, S., Černák, M., Slavíček, P., and Havel, J. (2010) Gas plasmas and plasma modified materials in medicine. J. Appl. Biomed., 8, 55–66. Zhang, W. and Chu, P.K. (2008) Enhancement of antibacterial properties and biocompatibility of polyethylene by silver and copper plasma immersion ion implantation. Surf. Coat. Technol., 203, 909–912. References 179. Zhang, W., Zhang, Y.-H., Ji, J.-H., 180. 181. 182. 183. 184. 185. 186. Zhao, J., Yan, Q., and Chu, P.K. (2006) Antimicrobial properties of copper plasma-modified polyethylene. Polymer, 47, 7441–7445. Zhang, W., Zhang, Y., Ji, J., Yan, Q., Huang, A., and Chu, P.K. (2007) Antimicrobial polyethylene with controlled copper release. J. Biomed. Mater. Res. A, 83A, 838–844. Codiã, I., Caplan, D.M., Drãgulescu, E.-C., Lixandru, B.-E., Coldea, I.L., Dragomirescu, C.C., Surdu-Bob, C., and Bãdulescu, M. (2010) Antimicrobial activity of copper and silver nanofilms on nosocomial bacterial species. Rom. Arch., 18, 204. Ren, G., Hu, D., Cheng, E.W.C., Vargas-Reus, M.A., Reip, P., and Allaker, R.P. (2009) Characterisation of copper oxide nanoparticles for antimicrobial applications. Int. J. Antimicrob. Agents, 33, 587–590. Kelly, P.J., Li, H., Benson, P.S., Whitehead, K.A., Verran, J., Arnell, R.D., and Iordanova, I. (2010) Comparison of the tribological and antimicrobial properties of CrN/Ag, ZrN/Ag, TiN/Ag, and TiN/Cu nanocomposite coatings. Surf. Coat. Technol., 205, 1606–1610. Rio, L., Kusiak-Nejman, E., Kiwi, J., Bétrisey, B., Pulgarin, C., Trampuz, A., and Bizzini, A. (2012) Comparison of methods for evaluation of the bactericidal activity of copper-sputtered surfaces against methicillin-resistant staphylococcus aureus. Appl. Environ. Microbiol., 78, 8176–8182. Osorio-Vargas, P., Sanjines, R., Ruales, C., Castro, C., Pulgarin, C., Rengifo-Herrera, A.-J., Lavanchy, J.C., and Kiwi, J. (2011) Antimicrobial Cu-functionalized surfaces prepared by bipolar asymmetric DC-pulsed magnetron sputtering (DCP). J. Photochem. Photobiol., A Chem., 220, 70–76. Tsai, M.-Y., Huang, M.-S., Chen, L.-K., Shen, Y.-D., Lin, M.-H., Chiang, Y.-C., Ou, K.-L., and Ou, S.-F. (2013) Surface properties of copper-incorporated diamond-like carbon films deposited by hybrid magnetron sputtering. Ceram. Int., 39, 8335–8340. 187. Chan, Y.-H., Huang, C.-F., Ou, K.-L., 188. 189. 190. 191. 192. 193. 194. 195. and Peng, P.-W. (2011) Mechanical properties and antibacterial activity of copper doped diamond-like carbon films. Surf. Coat. Technol., 206, 1037–1040. Cioffi, N., Ditaranto, N., Torsi, L., Picca, R.A., Sabbatini, L., Valentini, A., Novello, L., Tantillo, G., Bleve-Zacheo, T., and Zambonin, P.G. (2005) Analytical characterization of bioactive fluoropolymer ultra-thin coatings modified by copper nanoparticles. Anal. Bioanal. Chem., 381, 607–616. Varghese, S., ElFakhri, S., Sheel, D., Sheel, P., Bolton, F., and Foster, H. (2013) Antimicrobial activity of novel nanostructured Cu-SiO2 coatings prepared by chemical vapour deposition against hospital related pathogens. AMB Express, 3, 1–8. Hodgkinson, J.L., Massey, D., and Sheel, D.W. (2013) The deposition of copper-based thin films via atmospheric pressure plasma-enhanced CVD. 19th European Conference on Chemical Vapor Deposition EuroCVD19, Varna, Bulgaria, September 1–6, 2013, vol. 230, pp. 260–265. Palza, H., Gutiérrez, S., Delgado, K., Salazar, O., Fuenzalida, V., Avila, J.I., Figueroa, G., and Quijada, R. (2010) Toward tailor-made biocide materials based on poly(propylene)/copper nanoparticles. Macromol. Rapid Commun., 31, 563–567. Delgado, K., Quijada, R., Palma, R., and Palza, H. (2011) Polypropylene with embedded copper metal or copper oxide nanoparticles as a novel plastic antimicrobial agent. Lett. Appl. Microbiol., 53, 50–54. Wu, B., Huang, R., Sahu, M., Feng, X., Biswas, P., and Tang, Y.J. (2010) Bacterial responses to Cu-doped TiO2 nanoparticles. Sci. Total Environ., 408, 1755–1758. Singhal, S.K., Lal, M., Lata, Kabi, S.R., and Mathur, R.B. (2012) Synthesis of Cu/CNTs nanocomposites for antimicrobial activity. Adv. Nat. Sci.: Nanosci. Nanotechnol., 3, 045011 (10 pp). Lal, M., Singhal, S.K., Sharma, I., and Mathur, R.B. (2013) An alternative 211 212 8 Nano-Antimicrobials Based on Metals 196. 197. 198. 199. 200. 201. 202. 203. 204. improved method for the homogeneous dispersion of CNTs in Cu matrix for the fabrication of Cu/CNTs composites. Appl. Nanosci., 3, 29–35. Sheikh, F.A., Kanjwal, M.A., Saran, S., Chung, W.-J., and Kim, H. (2011) Polyurethane nanofibers containing copper nanoparticles as future materials. Appl. Surf. Sci., 257, 3020–3026. Karlsson, H.L., Cronholm, P., Hedberg, Y., Tornberg, M., De Battice, L., Svedhem, S., and Wallinder, I.O. (2013) Cell membrane damage and protein interaction induced by copper containing nanoparticles—Importance of the metal release process. Nanotoxicology, 313, 59–69. Kwon, Y.S., Ilyin, A.P., Tikhonov, D.V., Yablunovsky, G.V., and An, V.V. (2008) Characteristics of nanopowders produced by wire electrical explosion of tinned copper conductor in argon. Mater. Lett., 62, 3143–3145. Ozay, O., Akcali, A., Otkun, M.T., Silan, C., Aktas, N., and Sahiner, N. (2010) P(4-VP) based nanoparticles and composites with dual action as antimicrobial materials. Colloids Surf. B Biointerfaces, 79, 460–466. Cady, N.C., Behnke, J.L., and Strickland, A.D. (2011) Copper-based nanostructured coatings on natural cellulose: nanocomposites exhibiting rapid and efficient inhibition of a multi-drug resistant wound pathogen, A. baumannii, and mammalian cell biocompatibility in vitro. Adv. Funct. Mater., 21, 2506–2514. Chattopadhyay, D.P. and Patel, B.H. (2010) Effect of nanosized colloidal copper on cotton fabric. J. Eng. Fibers Fabr., 5, 1–6. Zhong, T., Oporto, G., Jaczynski, J., Tesfai, A., and Armstrong, J. (2013) Antimicrobial properties of the hybrid copper nanoparticles-carboxymethyl cellulose. Wood Fiber Sci., 45, 215–222. Chowdhury, M.N.K., Beg, M.D.H., Khan, M.R., and Mina, M.F. (2013) Synthesis of copper nanoparticles and their antimicrobial performances in natural fibres. Mater. Lett., 98, 26–29. Llorens, A., Lloret, E., Picouet, P., and Fernandez, A. (2012) Study of the 205. 206. 207. 208. 209. 210. 211. 212. antifungal potential of novel cellulose/copper composites as absorbent materials for fruit juices. Int. J. Food Microbiol., 158, 113–119. Jia, B., Mei, Y., Cheng, L., Zhou, J., and Zhang, L. (2012) Preparation of copper nanoparticles coated cellulose films with antibacterial properties through one-step reduction. ACS Appl. Mater. Interfaces, 4, 2897–2902. Grace, M., Chand, N., and Bajpai, S.K. (2009) Copper alginate-cotton cellulose (CACC) fibers with excellent antibacterial properties. J. Eng. Fibers Fabr., 4, 1–14. Grace, M., Bajpai, S.K., and Chand, N. (2009) Copper (II) ions and copper nanoparticles-loaded chemically modified cotton cellulose fibers with fair antibacterial properties. J. Appl. Polym. Sci., 113, 757–766. Pinto, R.J.B., Neves, M.C., Neto, C.P., and Trindade, T. (2012) Growth and chemical stability of copper nanostructures on cellulosic fibers. Eur. J. Inorg. Chem., 2012, 5043–5049. Bagchi, B., Kar, S., Dey, S.K., Bhandary, S., Roy, D., Mukhopadhyay, T.K., Das, S., and Nandy, P. (2013) In situ synthesis and antibacterial activity of copper nanoparticle loaded natural montmorillonite clay based on contact inhibition and ion release. Colloids Surf. B Biointerfaces, 108, 358–365. Mallick, S., Sharma, S., Banerjee, M., Ghosh, S.S., Chattopadhyay, A., and Paul, A. (2012) Iodine-stabilized Cu nanoparticle chitosan composite for antibacterial applications. ACS Appl. Mater. Interfaces, 4, 1313–1323. Chatterjee, A.K., Sarkar, R.K., Chattopadhyay, A.P., Aich, P., Chakraborty, R., and Basu, T. (2012) A simple robust method for synthesis of metallic copper nanoparticles of high antibacterial potency against E. coli. Nanotechnology, 23, 085103. Usman, M.S., Zowalaty, M.E.E., Shameli, K., Zainuddin, N., Salama, M., and Ibrahim, N.A. (2013) Synthesis, characterization, and antimicrobial properties of copper nanoparticles. Int. J. Nanomed., 8, 4467–4479. References 213. Bagchi, B., Dey, S., Bhandary, S., Das, 214. 215. 216. 217. 218. 219. 220. 221. S., Bhattacharya, A., Basu, R., and Nandy, P. (2012) Antimicrobial efficacy and biocompatibility study of copper nanoparticle adsorbed mullite aggregates. Mater. Sci. Eng. C, 32, 1897–1905. Giannossa, L.C., Longano, D., Ditaranto, N., Nitti, M.A., Paladini, F., Pollini, M., Rai, M., Sannino, A., Valentini, A., and Cioffi, N. (2013) Metal nanoantimicrobials for textile applications. Nanotechnol. Rev., 2, 307–331. Komeily-Nia, Z., Montazer, M., and Latifi, M. (2013) Synthesis of nano copper/nylon composite using ascorbic acid and CTAB. Colloids Surf., A Physicochem. Eng. Aspects, 439, 167–175. Teli, M.D. and Sheikh, J. (2013) Modified bamboo rayon–copper nanoparticle composites as antibacterial textiles. Int. J. Biol. Macromol., 61, 302–307. Díaz-Visurraga, J., Daza, C., Pozo, C., Becerra, A., von Plessing, C., and García, A. (2012) Study on antibacterial alginate-stabilized copper nanoparticles by FT-IR and 2D-IR correlation spectroscopy. Int. J. Nanomed., 7, 3597–3612. Drelich, J., Li, B., Bowen, P., Hwang, J.-Y., Mills, O., and Hoffman, D. (2011) Vermiculite decorated with copper nanoparticles: novel antibacterial hybrid material. Appl. Surf. Sci., 257, 9435–9443. Li, B., Bowen, P., Drelich, J., and Villeneuve, B. (2012) Inexpensive mineral copper materials with antibacterial surfaces. Surf. Innov., 1, 15–26. Kamrupi, I.R. and Dolui, S.K. (2011) Synthesis of copper–polystyrene nanocomposite particles using water in supercritical carbon dioxide medium and its antimicrobial activity. J. Appl. Polym. Sci., 120, 1027–1033. Aina, V., Cerrato, G., Martra, G., Malavasi, G., Lusvardi, G., and Menabue, L. (2013) Towards the controlled release of metal nanoparticles from biomaterials: physico-chemical, morphological and bioactivity features 222. 223. 224. 225. 226. 227. 228. 229. 230. of Cu-containing sol–gel glasses. Appl. Surf. Sci., 283, 240–248. Bonici, A., Lusvardi, G., Malavasi, G., Menabue, L., and Piva, A. (2012) Synthesis and characterization of bioactive glasses functionalized with Cu nanoparticles and organic molecules. J. Eur. Ceram. Soc., 32, 2777–2783, Special Issue ECerS XII, 12th Conference of the European Ceramic Society. Fritsche, A., Haenle, M., Zietz, C., Mittelmeier, W., Neumann, H.-G., Heidenau, F., Finke, B., and Bader, R. (2009) Mechanical characterization of anti-infectious, anti-allergic, and bioactive coatings on orthopedic implant surfaces. J. Mater. Sci., 44, 5544–5551. Zielecka, M., Bujnowska, E., Ke˛pska, B., Wenda, M., and Piotrowska, M. (2011) Antimicrobial additives for architectural paints and impregnates. Prog. Org. Coat., 72, 193–201. Zhang, N., Gao, Y., Zhang, H., Feng, X., Cai, H., and Liu, Y. (2010) Preparation and characterization of core–shell structure of SiO2 @Cu antibacterial agent. Colloids Surf. B Biointerfaces, 81, 537–543. Chapman, J., Weir, E., and Regan, F. (2010) Period four metal nanoparticles on the inhibition of biofouling. Colloids Surf. B Biointerfaces, 78, 208–216. Ramyadevi, J., Jeyasubramanian, K., Marikani, A., Rajakumar, G., and Rahuman, A.A. (2012) Synthesis and antimicrobial activity of copper nanoparticles. Mater. Lett., 71, 114–116. Singh, A., Krishna, V., Angerhofer, A., Do, B., MacDonald, G., and Moudgil, B. (2010) Copper coated silica nanoparticles for odor removal. Langmuir, 26, 15837–15844. Valodkar, M., Rathore, P.S., Jadeja, R.N., Thounaojam, M., Devkar, R.V., and Thakore, S. (2012) Cytotoxicity evaluation and antimicrobial studies of starch capped water soluble copper nanoparticles. J. Hazard. Mater., 201–202, 244–249. Cárdenas, G., Díaz, V.J., Meléndrez, M.F., Cruzat, C.C., and García Cancino, A. (2009) Colloidal Cu nanoparticles/chitosan composite film 213 214 8 Nano-Antimicrobials Based on Metals 231. 232. 233. 234. 235. 236. 237. 238. obtained by microwave heating for food package applications. Polym. Bull., 62, 511–524. Raspolli Galletti, A.M., Antonetti, C., Marracci, M., Piccinelli, F., and Tellini, B. (2013) Novel microwavesynthesis of Cu nanoparticles in the absence of any stabilizing agent and their antibacterial and antistatic applications. Appl. Surf. Sci., 280, 610–618. Schwarz, F., Thorwarth, G., and Stritzker, B. (2009) Synthesis of silver and copper nanoparticle containing a-C:Hby ion irradiation of polymers. E-MRS Spring Meeting 2008, vol. 11, pp. 1819–1823. Cioffi, N., Torsi, L., Ditaranto, N., Tantillo, G., Ghibelli, L., Sabbatini, L., Bleve-Zacheo, T., D’Alessio, M., Zambonin, P.G., and Traversa, E. (2005) Copper nanoparticle/polymer composites with antifungal and bacteriostatic properties. Chem. Mater., 17, 5255–5262. Cioffi, N., Torsi, L., Ditaranto, N., Sabbatini, L., Zambonin, P.G., Tantillo, G., Ghibelli, L., D’Alessio, M., Bleve-Zacheo, T., and Traversa, E. (2004) Antifungal activity of polymerbased copper nanocomposite coatings. Appl. Phys. Lett., 85, 2417–2419. Cioffi, N., Torsi, L., Ditaranto, N., Picca, R.A., Tantillo, G., Sabbatini, L., and Zambonin, P.G. (2004) Synthesis analytical characterization and bio-activity of Ag-and Cu-containing nano-structured membranes. J. Appl. Biomater. Biomech., 2, 1912–1918. Ditaranto, N., Loperfido, S., van der Werf, I., Mangone, A., Cioffi, N., and Sabbatini, L. (2011) Synthesis and analytical characterisation of copper-based nanocoatings for bioactive stone artworks treatment. Anal. Bioanal. Chem., 399, 473–481. Theivasanthi, T. and Alagar, M. (2011) Nano sized copper particles by electrolytic synthesis and characterizations. Int. J. Phys. Sci., 6, 3662–3671. Pandey, P., Merwyn, S., Agarwal, G.S., Tripathi, B.K., and Pant, S.C. (2012) Electrochemical synthesis of multi-armed CuO nanoparticles and their remarkable bactericidal 239. 240. 241. 242. 243. 244. 245. 246. potential against waterborne bacteria. J. Nanopart. Res., 14, 1–13. Bärsch, N., Jakobi, J., Weiler, S., and Barcikowski, S. (2009) Pure colloidal metal and ceramic nanoparticles from high-power picosecond laser ablation in water and acetone. Nanotechnology, 20, 445603. Barcikowski, S. and Compagnini, G. (2013) Advanced nanoparticle generation and excitation by lasers in liquids. Phys. Chem. Chem. Phys., 15, 3022–3026. Hahn, A. and Barcikowski, S. (2009) Production of bioactive nanomaterial using laser generated nanoparticles. JLMN-J. Laser Micro/Nanoeng., 4, 51–54. Hahn, A., Brandes, G., Wagener, P., and Barcikowski, S. (2011) Metal ion release kinetics from nanoparticle silicone composites. J. Controlled Release, 154, 164–170. Hahn, A., Stöver, T., Paasche, G., Löbler, M., Sternberg, K., Rohm, H., and Barcikowski, S. (2010) Therapeutic window for bioactive nanocomposites fabricated by laser ablation in polymerdoped organic liquids. Adv. Eng. Mater., 12, B156–B162. Hahn, A., Gunther, S., Wagener, P., and Barcikowski, S. (2011) Electrochemistry-controlled metal ion release from silicone elastomer nanocomposites through combination of different metal nanoparticles. J. Mater. Chem., 21, 10287–10289. Longano, D., Ditaranto, N., Cioffi, N., DiNiso, F., Sibillano, T., Ancona, A., Conte, A., Nobile, M.A., Sabbatini, L., and Torsi, L. (2012) Analytical characterization of laser-generated copper nanoparticles for antibacterial composite food packaging. Anal. Bioanal. Chem., 403, 1179–1186. Longano, D., Ditaranto, N., Cioffi, N., Di Niso, F., Sibillano, T., Mezzapesa, F.P., Ancona, A., Conte, A., Del Nobile, M.A., Sabbatini, L. et al. (2013) One- vs two-step preparation of antimicrobial coatings composed of laser ablated copper nanoparticles and poly-lactic acid. MRS Online Proc. Lib., 1453, DOI: 10.1557/opl.2012.1044 (6 pp). References 247. Conte, A., Longano, D., Costa, C., 248. 249. 250. 251. 252. 253. 254. 255. 256. 257. Ditaranto, N., Ancona, A., Cioffi, N., Scrocco, C., Sabbatini, L., Contò, F., and Del Nobile, M.A. (2013) A novel preservation technique applied to fiordilatte cheese. Innovative Food Sci. Emerg. Technol., 19, 158–165. Rai, M., Yadav, A., and Gade, A. (2008) CRC 675—current trends in phytosynthesis of metal nanoparticles. Crit. Rev. Biotechnol., 28, 277–284. Wang, C. and Huang, Y. (2013) Green route to prepare biocompatible and near infrared thiolate-protected copper nanoclusters for cellular imaging. Nano, 08, 1350054 (10 pp). Barua, S., Das, G., Aidew, L., Buragohain, A.K., and Karak, N. (2013) Copper-copper oxide coated nanofibrillar cellulose: a promising biomaterial. RSC Adv., 3, 14997–15004. Valodkar, M., Nagar, P.S., Jadeja, R.N., Thounaojam, M.C., Devkar, R.V., and Thakore, S. (2011) Euphorbiaceae latex induced green synthesis of non-cytotoxic metallic nanoparticle solutions: a rational approach to antimicrobial applications. Colloids Surf., A Physicochem. Eng. Aspects, 384, 337–344. Varshney, R., Bhadauria, S., Gaur, M.S., and Pasricha, R. (2010) Characterization of copper nanoparticles synthesized by a novel microbiological method. JOM, 62, 102–104. Silva, A.R. and Unali, G. (2011) Controlled silver delivery by silver–cellulose nanocomposites prepared by a one-pot green synthesis assisted by microwaves. Nanotechnology, 22, 315605 (6 pp). Whitesides, G.M. (2005) Nanoscience, nanotechnology, and chemistry. Small, 1, 172–179. Fan, Z. and Lu, J.G. (2005) Zinc oxide nanostructures: synthesis and properties. J. Nanosci. Nanotechnol., 5, 1561–1573. Wang, Z.L. (2004) Zinc oxide nanostructures: growth, properties and applications. J. Phys. Condens. Matter, 16, R829. Wang, Z.L. (2004) Nanostructures of zinc oxide. Mater. Today, 7, 26–33. 258. Meulenkamp, E.A. (1998) Synthesis and 259. 260. 261. 262. 263. 264. 265. 266. 267. 268. growth of ZnO nanoparticles. J. Phys. Chem. B, 102, 5566–5572. Spanhel, L. and Anderson, M.A. (1991) Semiconductor clusters in the solgel process: quantized aggregation, gelation, and crystal growth in concentrated zinc oxide colloids. J. Am. Chem. Soc., 113, 2826–2833. Vijayakumar, P.S., Blaker, K.A., Wieting, R.D., Wong, B., and Halani, A.T. (1988) Chemical vapor deposition of zinc oxide films and products. US 4751149 A. Pierson, H.O. (1999) Handbook of Chemical Vapor Deposition: Principles, Technology and Applications, 2nd edn, William Andrew. Panigrahi, J., Behera, D., Mohanty, I., Subudhi, U., Nayak, B.B., and Acharya, B.S. (2011) Radio frequency plasma enhanced chemical vapor based ZnO thin film deposition on glass substrate: a novel approach towards antibacterial agent. Appl. Surf. Sci., 258, 304–311. Carcia, P.F., McLean, R.S., Reilly, M.H., and Nunes, G. (2003) Transparent ZnO thin-film transistor fabricated by RF magnetron sputtering. Appl. Phys. Lett., 82, 1117–1119. Bidmeshkipour, S. and Shahtahmasebi, N. (2013) Different properties of aluminum doped zinc oxide nanostructured thin films prepared by radio frequency magnetron sputtering. Semiconductors, 47, 787–790. Tsai, H.-Y. (2007) Characteristics of ZnO thin film deposited by ion beam sputter. J. Mater. Process. Technol., 192-193, 55–59. Qu, Y. (1993) Electrical and optical properties of ion beam sputtered ZnO:Al films as a function of film thickness. J. Vac. Sci. Technol. Vac. Surf. Films, 11, 996–1000. Jansson, T., Clare-Salzler, Z.J., Zaveri, T.D., Mehta, S., Dolgova, N.V., Chu, B.-H., Ren, F., and Keselowsky, B.G. (2012) Antibacterial effects of zinc oxide nanorod surfaces. J. Nanosci. Nanotechnol., 12, 7132–7138. Athauda, T.J., Ozer, R.R., and Chalker, J.M. (2013) Investigation of cotton functionalized with ZnO nanorods and 215 216 8 Nano-Antimicrobials Based on Metals 269. 270. 271. 272. 273. 274. 275. 276. 277. its interaction with E. coli. RSC Adv., 3, 10662. Nafchi, A.M., Alias, A.K., Mahmud, S., and Robal, M. (2012) Antimicrobial, rheological, and physicochemical properties of sago starch films filled with nanorod-rich zinc oxide. J. Food Eng., 113, 511–519. Paisoonsin, S., Pornsunthorntawee, O., and Rujiravanit, R. (2013) Preparation and characterization of ZnO-deposited DBD plasma-treated PP packaging film with antibacterial activities. Appl. Surf. Sci., 273, 824–835. Sudheesh Kumar, P.T., Lakshmanan, V.K., Anilkumar, T.V., Ramya, C., Reshmi, P., Unnikrishnan, A.G., Nair, S.V., and Jayakumar, R. (2012) Flexible and microporous chitosan hydrogel/nano ZnO composite bandages for wound dressing: in vitro and in vivo evaluation. ACS Appl. Mater. Interfaces, 4, 2618–2629. Al-Balakocy, N.G., El-Badry, K.H., and Hassan, T.M. (2013) Multi-finishing of polyester and polyester cotton blend fabrics activated by enzymatic treatment and loaded with zinc oxide nanoparticles. J. Appl. Sci. Res., 9, 2767–2776. Znaidi, L. (2010) Sol–gel-deposited ZnO thin films: a review. Mater. Sci. Eng., B, 174, 18–30. Yang, D. and Zhang, H. (2004) Fabrication and characterization of ZnO nanostructures. Focus Nanotechnol. Res., 1, 173–215. Divya, M.J., Sowmia, C., Joona, K., and Dhanya, K.P. (2013) Synthesis of zinc oxide nanoparticle from hibiscus rosasinensis leaf extract and investigation of its antimicrobial activity. Res. J. Pharm. Biol. Chem. Sci., 4, 1137–1142. Rajiv Gandhi, R., Gowri, S., Suresh, J., and Sundrarajan, M. (2013) Ionic liquids assisted synthesis of ZnO nanostructures: controlled size, morphology and antibacterial properties. J. Mater. Sci. Technol., 29, 533–538. Subash, A.A., Chandramouli, K.V., Ramachandran, T., Rajendran, R., and Muthusamy, M. (2012) Preparation, characterization, and functional analysis of zinc oxide nanoparticle-coated 278. 279. 280. 281. 282. 283. 284. 285. cotton fabric for antibacterial efficacy. J. Text. Inst., 103, 298–303. Vigneshwaran, N., Kumar, S., Kathe, A.A., Varadarajan, P.V., and Prasad, V. (2006) Functional finishing of cotton fabrics using zinc oxide–soluble starch nanocomposites. Nanotechnology, 17, 5087. Uğur, Ş.S., Sarıışık, M., Aktaş, A.H., Uçar, M.Ç., and Erden, E. (2010) Modifying of cotton fabric surface with Nano-ZnO multilayer films by layerby-layer deposition method. Nanoscale Res. Lett., 5, 1204–1210. Shateri-Khalilabad, M. and Eh-Yazdanshenas, M. (2013) Biofunctionalization of cotton textiles by ZnO nanostructures: antimicrobial activity and ultraviolet protection. Text. Res. J., 83, 993–1004. Vigneshwaran, N., Bharimalla, A.K., Prasad, V., Kathe, A.A., and Balasubramanya, R.H. (2008) Functional behaviour of polyethylene-ZnO nanocomposites. J. Nanosci. Nanotechnol., 8, 4121–4126. Espitia, P.J.P., Soares, N.d.F.F., Teófilo, R.F., Coimbra, J.S.d.R., Vitor, D.M., Batista, R.A., Ferreira, S.O., de Andrade, N.J., and Medeiros, E.A.A. (2013) Physical–mechanical and antimicrobial properties of nanocomposite films with pediocin and ZnO nanoparticles. Carbohydr. Polym., 94, 199–208. Nafchi, A.M., Nassiri, R., Sheibani, S., Ariffin, F., and Karim, A.A. (2013) Preparation and characterization of bionanocomposite films filled with nanorod-rich zinc oxide. Carbohydr. Polym., 96, 233–239. Bajpai, S.K., Chand, N., and Chaurasia, V. (2010) Investigation of water vapor permeability and antimicrobial property of zinc oxide nanoparticles-loaded chitosan-based edible film. J. Appl. Polym. Sci., 115, 674–683. Pantani, R., Gorrasi, G., Vigliotta, G., Murariu, M., and Dubois, P. (2013) PLA-ZnO nanocomposite films: water vapor barrier properties and specific end-use characteristics. Eur. Polym. J., 49, 3471–3482. References 286. Li, X., Xing, Y., Jiang, Y., Ding, Y., and 287. 288. 289. 290. 291. 292. 293. 294. Li, W. (2009) Antimicrobial activities of ZnO powder-coated PVC film to inactivate food pathogens. Int. J. Food Sci. Technol., 44, 2161–2168. Seo, J., Jeon, G., Jang, E.S., Bahadar Khan, S., and Han, H. (2011) Preparation and properties of poly (propylene carbonate) and nanosized ZnO composite films for packaging applications. J. Appl. Polym. Sci., 122, 1101–1108. Baruah, S. and Dutta, J. (2009) Hydrothermal growth of ZnO nanostructures. Sci. Technol. Adv. Mater., 10, 013001. Raghupathi, K.R., Koodali, R.T., and Manna, A.C. (2011) Size-dependent bacterial growth inhibition and mechanism of antibacterial activity of zinc oxide nanoparticles. Langmuir, 27, 4020–4028. Ma, J., Liu, J., Bao, Y., Zhu, Z., Wang, X., and Zhang, J. (2013) Synthesis of large-scale uniform mulberry-like ZnO particles with microwave hydrothermal method and its antibacterial property. Ceram. Int., 39, 2803–2810. Femi, V., Prabha, P.H., Sudha, P., Jerald, A.L., and Reni, A. (2011) Evaluation of antibacterial potential of ZnO-Au nanocomposites. South Asian J. Exp. Biol., 1, 36–39. İpeksaç, T., Kaya, F., and Kaya, C. (2013) Hydrothermal synthesis of Zinc oxide (ZnO) nanotubes and its electrophoretic deposition on nickel filter. Mater. Lett., 100, 11–14. Wysokowski, M., Motylenko, M., Stöcker, H., Bazhenov, V.V., Langer, E., Dobrowolska, A., Czaczyk, K., Galli, R., Stelling, A.L., Behm, T. et al. (2013) An extreme biomimetic approach: hydrothermal synthesis of β-chitin/ZnO nanostructured composites. J. Mater. Chem. B, 1, 6469. Reetz, M.T., Quaiser, S.A., Winter, M., Becker, J.A., Schäfer, R., Stimming, U., Marmann, A., Vogel, R., and Konno, T. (1996) Nanostructured metal oxide clusters by oxidation of stabilized metal clusters with air. Angew. Chem. Int. Ed. Engl., 35, 2092–2094. 295. Dierstein, A., Natter, H., Meyer, 296. 297. 298. 299. 300. 301. 302. 303. F., Stephan, H.-O., Kropf, C., and Hempelmann, R. (2001) Electrochemical deposition under oxidizing conditions (EDOC): a new synthesis for nanocrystalline metal oxides. Scr. Mater., 44, 2209–2212. Natter, H. and Hempelmann, R. (2003) Tailor-made nanomaterials designed by electrochemical methods. Electrochim. Acta, 49, 51–61. Shkurankov, A., Natter, H., and Hempelmann, R. (2004) GDCh Grundlagen und Anwendungen der Elektrochemischen Oberflächentechnik, GDCh-Monographien, Gesellschaft Deutscher Chemiker (GDCh), pp. 247–255. Huang, G.S., Wu, X.L., Cheng, Y.C., Shen, J.C., Huang, A.P., and Chu, P.K. (2007) Fabrication and characterization of anodic ZnO nanoparticles. Appl. Phys. A, 86, 463–467. Chandrappa, K.G. and Venkatesha, T.V. (2012) Electrochemical synthesis and photocatalytic property of zinc oxide nanoparticles. Nano-Micro Lett., 4, 14–24. Chandrappa, K., Venkatesha, T., Vathsala, K., and Shivakumara, C. (2010) A hybrid electrochemical–thermal method for the preparation of large ZnO nanoparticles. J. Nanopart. Res., 12, 2667–2678. Venkatesha, T.G., Arthoba Nayaka, Y., Viswanatha, R., Vidyasagar, C.C., and Chethana, B.K. (2012) Electrochemical synthesis and photocatalytic behavior of flower shaped ZnO microstructures. Powder Technol., 225, 232–238. Picca, R.A., Sportelli, M.C., Sabbatini, L., and Cioffi, N. (2013) New insights on the electrochemical development of II generation nano-antimicrobials. 64th Annual Meeting of the International Society of Electrochemistry in Queretaro, Mexico, p. 37. Stypuła, B., Starowicz, M., Hajos, M., and Olejnik, E. (2011) Electrochemical synthesis of ZnO nanoparticles during anodic dissolution of zinc in alcohols solvents. Arch. Metall. Mater., 56, 286–292. 217 218 8 Nano-Antimicrobials Based on Metals 304. Starowicz, M. and Stypuła, B. (2008) 305. 306. 307. 308. 309. 310. Electrochemical synthesis of ZnO nanoparticles. Eur. J. Inorg. Chem., 2008, 869–872. Banaś, J., Stypuła, B., Banaś, K., Światowska-Mrowiecka, J., Starowicz, M., and Lelek-Borkowska, U. (2009) Corrosion and passivity of metals in methanol solutions of electrolytes. J. Solid State Electrochem., 13, 1669–1679. Gupta, A.K., Kashyap, V., Gupta, B.K., Nandi, S.P., Saxena, K., and Khare, N. (2013) Synthesis of ZnO nanorods by electrochemical deposition method and its antibacterial activity. J. Nanoeng. Nanomanuf., 3, 348–352. Schrand, A.M., Rahman, M.F., Hussain, S.M., Schlager, J.J., Smith, D.A., and Syed, A.F. (2010) Metal-based nanoparticles and their toxicity assessment. Wiley Interdiscip. Rev. Nanomed. Nanobiotechnol., 2, 544–568. Hajipour, M.J., Fromm, K.M., Akbar Ashkarran, A., Jimenez de Aberasturi, D., de Larramendi, I.R., Rojo, T., Serpooshan, V., Parak, W.J., and Mahmoudi, M. (2012) Antibacterial properties of nanoparticles. Trends Biotechnol., 30, 499–511. Foster, H.A., Ditta, I.B., Varghese, S., and Steele, A. (2011) Photocatalytic disinfection using titanium dioxide: spectrum and mechanism of antimicrobial activity. Appl. Microbiol. Biotechnol., 90, 1847–1868. Allahverdiyev, A.M., Abamor, E.S., Bagirova, M., and Rafailovich, M. (2011) Antimicrobial effects of TiO2 311. 312. 313. 314. 315. 316. 317. and Ag2 O nanoparticles against drug-resistant bacteria and leishmania parasites. Future Microbiol., 6, 933–940. Visai, L., De Nardo, L., Punta, C., Melone, L., Cigada, A., Imbriani, M., and Arciola, C.R. (2011) Titanium oxide antibacterial surfaces in biomedical devices. Int. J. Artif. Organs, 34, 929–946. Kelson, A.B., Carnevali, M., and Truong-Le, V. (2013) Gallium-based anti-infectives: targeting microbial iron-uptake mechanisms. Curr. Opin. Pharmacol., 13, 707–716. Wang, Q. and Webster, T.J. (2013) Introducing antibacterial properties to paper towels through the use of selenium nanoparticles. MRS Online Proc. Lib., 1498, 21–26. Tran, P.A. and Webster, T.J. (2013) Antimicrobial selenium nanoparticle coatings on polymeric medical devices. Nanotechnology, 24, 155101. Dutta, R.K., Nenavathu, B.P., and Talukdar, S. (2014) Anomalous antibacterial activity and dye degradation by selenium doped ZnO nanoparticles. Colloids Surf. B Biointerfaces, 114, 218–224. Mauter, M.S. and Elimelech, M. (2008) Environmental applications of carbonbased nanomaterials. Environ. Sci. Technol., 42, 5843–5859. Kang, S., Pinault, M., Pfefferle, L.D., and Elimelech, M. (2007) Singlewalled carbon nanotubes exhibit strong antimicrobial activity. Langmuir, 23, 8670–8673. 219 9 Natural Products as Antimicrobial Agents – an Update Muhammad Saleem 9.1 Introduction In the late 1920s, Alexander Fleming accidently discovered an antibiotic penicillin from the fungus Penicillium notatum that completely killed the bacterium Staphylococcus aureus. Afterwards, several analogs of penicillin or other antibiotics were discovered from natural sources or were synthesized in chemistry laboratories. When natural or synthetic antibiotics became commercially available half a century ago, they were treated as miracle drugs. However, with the passage of time, the antibiotics lost their effectiveness as bacteria evolved resistance against them. Today, there is a variety of bacterial pathogens, which are resistant to most of the available antibiotics. Old antibiotics are now not as effective at killing the microbes as they were when first introduced. Moreover, since newer antibiotics are so similar to the older varieties, resistance in bacteria evolves very quickly. Therefore, to overcome this life-threatening problem, continuous research to discover new molecules with novel structural features is crucially important. Fortunately, pharmaceutical companies have already started to respond to this need and are focusing on natural products to develop new antibiotics. Through evolutionary pressure, Nature has guided the production of an immense diversity of organic molecules for a variety of biological purposes. These molecules were the basis of most early traditional medicines and have played an important role in drug discovery. Natural products continue to play an important role in the discovery and development of new pharmaceuticals, as clinically useful drugs, as starting materials to produce synthetic drugs, and or as lead compounds from which a total synthetic drug is designed [1]. The majority of new antibiotics were generated from natural products and/or from compounds derived from natural products. Unfortunately, a couple of decades back, natural product drug discovery programs declined as pharmaceutical companies shifted to using synthetic chemical libraries because of the business risk in the field of natural product drug development [2, 3]. Now, over the last decade, it has become clear that the popularity of synthetic drugs is decreasing because of their toxicity and undesirable side effects. Further, Novel Antimicrobial Agents and Strategies, First Edition. Edited by David A. Phoenix, Frederick Harris and Sarah R. Dennison. © 2015 Wiley-VCH Verlag GmbH & Co. KGaA. Published 2015 by Wiley-VCH Verlag GmbH & Co. KGaA. 220 9 Natural Products as Antimicrobial Agents – an Update the existing antimicrobial agents are losing their effectiveness as pathogens evolve resistance against them. On the other hand, the new drugs only rarely reach the market. Moreover, microbial pathogens can acquire drug resistance in a multitude of ways, so getting around the resistance problem is not a straightforward matter. To address these issues, pharmaceutical companies have revived efforts to develop new antibiotics from natural sources. Mishra and Tiwari [4] have recently published a minireview on natural products under clinical trials including a number of natural and semi-synthetic antimicrobial agents. The discovery and commercial uses of streptomycin, gentamicin, omegamycin griseofulvin (Likuden M®), the antibacterial terpenoid fusidic acid (Fucidine®), semi-synthetic or synthetic penicillins and cephalosporins, ergotamine (ErgoKranit®) and chloramphenicol [5, 6], and many under clinical trial such as antibacterial ceftaroline acetate (PPI-0903, TAK-599, 31) [7] have motivated researchers and pharmaceutical industries to focus on natural sources to develop new antimicrobial agents. Antibacterial natural products played an important role in life-saving medicines during the twentieth century; besides, they played a pivotal role in the growth of biological chemistry as a discipline [8]. Several thousands of antimicrobial agents have so far been discovered from many natural sources but only fewer have been developed into a drug. The aim of writing this chapter on natural antimicrobial agents is to list the natural molecules as future antimicrobial candidates and to explore the diverse and indigenous sources to get more effective and less toxic antimicrobial chemicals [9]. This chapter covers the literature between 2000 and 2012. 9.2 Antimicrobial Natural Products from Plants 9.2.1 Antimicrobial Alkaloids from Plants Probably the first unidentified alkaloid was narcotine isolated from opium in 1803, and the first identified medicinally important alkaloid morphine opened a new research area, which resulted in the discovery of strychnine, emetine, brucine, piperine, caffeine, quinine, colchicine, and coniine. Probably, coniine was the first alkaloid, which, after identification, was synthesized [10]. However, modern techniques have now eased the isolation and identification of more complex alkaloids with potential biological activities. A steroidal alkaloid solanopubamine (3β-amino-5α, 22αH, 25βH-solanidan23β-ol, 1), has recently been reported from Solanum schimperianum in significant yield. Its structure was established by IR, positive electron impact mass spectrometry (ESI-MS), and 1D and 2D NMR techniques, whereas -3β-NH2 and -23β-OH groups were identified through methylation and acetylation. Compound 1 showed good antifungal activity only against Candida albicans and Candida 9.2 Antimicrobial Natural Products from Plants tenuis with minimum inhibitory concentration (MIC) of 12.5 μg ml−1 [11]. Another antibacterial alkaloid (−)-latifolian A (2), isolated from the leaves of Chinese vine Gnetum montanum, inhibited the growth of Pseudomonas aeruginosa with an inhibitory concentration (IC)50 value of 9.8 μM (MIC = 35 μM) [12]. These observations revealed that the selective and potential action of compounds 1 and 2 makes the strongest candidates for the development of antimicrobial agents. HO OH H2N HO N HO N OH 1 OH 2 OH Benzo[c]phenanthridine-type alkaloids (3–6) 8-hydroxydihydrosanguinarine (hhS), isolated from aerial parts of Chelidonium majus Linn., inhibited the growth of clinical strains of methicillin-resistant Staphylococcus aureus (MRSA) with MICs/MBCs (minimal bactericidal concentrations) ranging from 0.49 to 15.63/1.95 to 62.50 μg ml−1 . The potent anti-MRSA activity of these compounds is encouraging for the development of new antibiotics; however, a study on the toxicity of these compounds is required [13]. O O N R2O OR1 R3 CH3 3: R1 R2 = CH2, R3 = OH 4: R1 = R2 = CH3, R3 = OH 5: R1 R2 = CH2, R3 = H 6: R1 = R2 = CH3, R3 = H Ileabethoxazole (7), a perhydroacenaphthene-type diterpene alkaloid containing the uncommon benzoxazole moiety, was isolated from a marine plant Pseudopterogorgia elisabethae. This compound showed 92% inhibition of Mycobacterium tuberculosis (H37 Rv) at the concentration range of 128 to 64 μg ml−1 [14]. The secondary metabolites from the roots of Piper sarmentosum, brachyamide B (8) and sarmentosine (9) exhibited antifungal activity against C. albicans with IC50 values 41.82 and 32.82, (μg ml−1 ) respectively [15]. Alkaloid 10, isolated from the culture extract of Janibacter limosus, at 30 μg/paper disk, showed moderate activity against Bacillus subtilis (12 mm zone of inhibition), Streptomyces viridochromogenes Tü 57 (19 mm zone of inhibition), and S. aureus (15 mm zone of inhibition) [16]. 221 222 9 Natural Products as Antimicrobial Agents – an Update O O N O H O N 7 8 HO HO H O O H N O N H OH O 9 10 Oliva, et al. [17] evaluated some alkaloids from Rutaceous plants for their activities against plant pathogenic fungi. Of the tested metabolites, 11 and 12 inhibited the growth of Colletotrichum acutatum by 50 and 57%, respectively, at 300 μM. Compounds 11–14 were observed to be moderately active on Colletotrichum fragariae but 12 exhibited the most potent activity against Colletotrichum gloeosporioides, with 67.7% inhibition at 100 μM. Compound 13 showed 50% inhibition at 300 μM, whereas at 300 μM, 11 and 14 were moderately active against Fusarium oxysporum. Compounds 12 and 15 showed activity against Botrytis cinerea at 300 μM, but only compound 12 had high activity at 30 μM. Compounds 12 and 15 exhibited 100% inhibition of Phomopsis obscurans at a concentration of 30 μM. These data suggest that the alkaloids are important to the Rutaceous plant in defense against plant pathogens and these kinds of natural products can be potential leads for natural product-based fungicides for use against plant pathogens of economic significance in the horticultural industry. Canthin-6-one (16) and 5-methoxycanthin-6-one (17), the secondary metabolites present in the stem barks of Zanthoxylum chiloperone var. angustifolium, have been identified as antifungal compounds. Compound 16 and its hydroxyl derivative [(8-hydroxy-canthin-6-one (18)] were also isolated from Allium neapolitanum [18]. Compound 16 exhibited a broad spectrum of activities against Aspergillus fumigatus, Aspergillus niger, Aspergillus terreus, C. albicans, Candida tropicalis, Candida glabrata, Cryptococcus neoformans, Geotrichum candidum, Saccharomyces cerevisiae, Trichosporon beigelii, Trichosporon cutaneum, and Trichophyton mentagrophytes var. interdigitale with MIC values between 5.3 and 46 μM l−1 . 5-Methoxy-canthin-6-one (17) was active only against T. mentagrophytes var. interdigitale with a MIC value of 12.3 μM l−1 [19]. Indole-derived alkaloids 16 and 18 were also very active against a panel of fast-growing Mycobacterium species with MICs 8–32 and 8–64 μg ml−1 against multidrug-resistant (MDR) and methicillin-resistant strains of S. aureus. Methyl1H-pyrimidine-2,4-dione (19) isolated from the flowers of Alangium salviifolium showed significant antibacterial activities against a number of Gram-positive and Gram-negative pathogens. The MIC is reported to be within 64–128 μg ml−1 [20]. 9.2 O N H 11 Antimicrobial Natural Products from Plants OMe O N 8 O MeO O MeO N 4 12 O 13 O O O N N O N H O 4 14 O O R 16 R = H 17 R = OMe 15 O N H N N O N OH O 18 N CH3 19 9.2.2 Antimicrobial Alkaloids from Microbial Sources The presence of many microbial metabolites in the pharmaceutical market indicates the potential of microorganisms as valuable sources of lead drugs – for example, the antibiotic polyketide griseofulvin (Likuden M), the antibacterial terpenoid fusidic acid (Fucidine), semisynthetic or synthetic penicillins and cephalosporins, chloramphenicol as well as ergot alkaloids such as ergotamine (Ergo-Kranit) [5]. N-methyl-1-hydroxyphenazine (20) was isolated from the culture extract of Pseudomonas. This compound was found to be bacteriostatic at 0.5 mg l−1 against Vibrio harveyi [21]. V. harveyi has been reported as the most important aquaculture pathogen with multiple antibiotic resistance, causing mass mortalities in shrimp/prawn hatcheries. However, in vitro tests suggest that 20 was a potential inhibitor that possesses toxicity in Penaeus monodon hemocyte culture and the IC50 value was found to be 1.4 ± 0.31 mg l−1 [21]. O− O N N N CH3 N CH3 20 Phenazine antibiotics are synthesized by a number of bacteria from diverse genera including Streptomyces, Pseudomonas, Pelagiobacter, and Vibrio [22–24]. 223 224 9 Natural Products as Antimicrobial Agents – an Update These microbes produce a range of phenazine compounds that differ widely in antibiotic properties, according to the nature and position of side groups attached to a phenazine nucleus [25]. For example, D-alanylgriseoluteic acid (21) is a potent antimicrobial phenazine compound produced by Pantoea agglomerans (Erwinia herbicola) Eh1087 and was isolated from the culture supernatant. Its structure was determined by modern NMR techniques [26]. Susceptibility tests against a range of microbes indicated that 21 exhibited a broad spectrum of antimicrobial activity, particularly against Gram-positive pathogens, including : many pneumococcal and MDR isolates with an MIC range of 0.06–0.75 μg ml−1 . It was further established that 21 induced the save our soul (SOS) response in Escherichia coli and slightly increased the frequency of GC-AT transition mutations. The potency and broad spectrum of 21 activity suggest that it may warrant further investigation and in future could have an application as a topical agent [27]. A novel antifungal compound YM-215343 (22) was isolated from the culture of Phoma sp. QN04621, which showed close relation to apiosporamide and fischerin. YM-215343 (22) inhibited the growth of pathogenic fungi C. albicans, C. neoformans, and A. fumigatus with MIC values of 2–16 μg ml−1 [28]. However, this compound has also been reported to be cytotoxic. O OMe OH O OH O OH H N O N O ⊕ H3N H N H O 22 O 21 Me Ajudazols A (23) and B (24) are the constituents of Chondromyces crocatus, which were reported to possess antimicrobial activity in an agar diffusion assay. With a concentration of 40 μg/disc in 20 μl of methanol, 24 inhibited growth of the fungi B. cinerea (10 mm), Trichoderma koningii (21 mm), Gibberella fujikuroi (17 mm), and Ustilago maydis (13 mm). It was weakly active against a few Grampositive bacteria with the MIC for Micrococcus luteus being 12.5 μg ml−1 . Ajudazol A (23) showed only minor activity against a few fungi and Gram-positive bacteria when compared with its analog 24 [29]. This difference revealed that the olefinic function close to the oxazole ring in 24 might play an important role in exhibiting antimicrobial activity. O N OH O O HO O O N CH3 23 9.2 Antimicrobial Natural Products from Plants O N OH O N O HO O CH2 24 O The fungus Bionectra byssicola F120 is reported to produce epidithiodioxopiperazines, bionectins A (25), B (26), C (27), and verticillin D (28). Compounds 25, 26, and 28 inhibited the growth of S. aureus including MRSA and quinoloneresistant Staphylococcus aureus (QRSA), with MIC values of 10–30 μg ml−1 , whereas 27 was nearly inactive [30]. Structural differences revealed that compounds 25, 26, and 28 have a disulfide bridge in their dioxopiperazine ring, while 27 contains a dioxopiperazine ring with two methylsulfanyl groups. Mostly, this class of compounds such as the verticillins, the leptosins, and Sch52900 are known to have antibacterial, nematocidial, antifungal, and antitumor activities [31–34]. The comparison revealed that the antibacterial activity of the epidithiodioxopiperazines is mediated in part by the disulfide bridge in the epidithiodioxopiperazine moiety. H N H N O OH OH N N H H SS N O O N N H H O HO SCH3 O N SCH3 R CH(OH)CH3 O N S H S N N OH N N H H S S N O 25 R = H 26 R = —CH(OH)CH3 O CH(OH)CH3 27 28 9.2.3 Antimicrobial Alkaloids from Marine Sources Terrestrial natural sources have been in the focus in the search for new drug candidates, although nearly 70% of the earth’s surface is covered by oceans [35]. The isolation of valuable amounts of prostaglandins from the gorgonian Plexaura homomalla by Weinheimer and Spraggnis is considered as the starting point of the discovery of drugs from marine sources [35] and as a result, new discoveries have been increasingly reported from marine sources in the area of antibiotic development. Two diketopiperazine rodriguesines, A (29) and B (30) as a mixture of homologs, were isolated from a marine invertebrate of the Genus Didemnum, which could be identified by analysis of spectroscopic data including MS/MS 225 226 9 Natural Products as Antimicrobial Agents – an Update experiments. Interestingly, the mixture of 29 and 30 proved to be potentially active (MIC = 4.3–125.0 μg ml−1 ) against antibiotic-resistant strains S. aureus, E. coli, Enterococcus faecalis, Streptococcus sanguinis, Streptococcus sobrinus, and C. albicans. These pathogens are all associated with mucobuccal diseases. The mixture was found be most active against P. aeruginosa P1 with MIC value of 4.3 μg ml−1 . Notable is that this mixture of 29 and 30 did not show any cytotoxicity [36]. On the basis of the reported findings, these compounds can be potential candidates to treat mucobuccal diseases. The mixture of aqabamycin E (31 and 32) and aqabamycin F (33) was isolated from Vibrio species isolated from the surface of the soft coral Sinularia polydactyla. These maleimide derivatives exhibited antibacterial activity against B. subtilis, M. luteus, E. coli, and Proteus vulgaris with MIC values ranging between 3.15 and 25 μg ml−1 [37]. R2 O R1 O N HN R3 N H n NHR R4 N NO2 O 29: n = 1, R = H 30: n = 2, R = H N H O 31: R1 = NO2, R2 = OH, R3, R4 = H 32: R1 = R2 = R3 = OH, R4 = NO2 33: R1 = R4 = NO2, R2 = R3 = OH 9.3 Antimicrobial Natural Products Bearing an Acetylene Function Acetylenic function is not very common in nature; however, a few reports have been found on antimicrobial natural products bearing acetylenic function, which are mostly from fungal sources. The antifungal and antimicrobial properties of fatty acids have been known for centuries. Survey of the previous pharmaceutical market revealed that unsaturated fatty acids with olefin and/or acetylene functions are, in general, more potent against fungal pathogens [38]. The representative unsaturated fatty acid with a single double bond at C-10, undecylenic acid (UDA), is still on the market as a cost-effective antifungal agent and the active ingredient of many topical over-the-counter antifungal preparations [39]. Interestingly, 6-acetylenic acids (34–38) purified by reversed-phase high performance liquid chromatography (HPLC) were identified as potential antimicrobial natural products. Their structures were established by liquid chromatography-mass spectrometry (LC-MS), NMR, and HPLC-ESI-MS analyses. Compound 34 inhibited the growth of test pathogens with an MIC of 4.3–31.0 μM, 35 showed an MIC of 4.4–29.3 μM, and 36 was active with an MIC of 2.1–5.6 μM, whereas 37 exhibited an MIC of 0.7–3.3 μM. Among these isolates, compound 38 was not active. Compounds 39 and 40 also showed nonsignificant activity. Compound 37 was the most active, in particular against the 9.3 Antimicrobial Natural Products Bearing an Acetylene Function 227 dermatophytes T. mentagrophytes and Trichophyton rubrum and the opportunistic pathogens C. albicans and A. fumigatus with MICs comparable to several control drugs [40]. In vitro toxicity testing against mammalian cell lines indicated that none of the isolates was toxic at concentrations up to 32 μM. Taking into account the low in vitro and in vivo toxicities and significant antifungal potencies, these 6acetylenic acids (34–40) may be excellent leads for further preclinical studies [40]. O O OH 34 OH 35 O O OH 36 OH 37 O O OH 38 H2 C H2 C 40 O H2 C OH 39 OH Phomallenic acids A–C (41–43) with acetylenic functions, isolated from a leaf litter fungus Phoma sp., exhibited MIC of 7.8 and 3.9 μg ml−1 , respectively, against wild-type S. aureus. Phomallenic acid C (42), an analog with the longest chain, exhibited the best overall activity, and was superior to cerulenin (44) and thiolactomycin (45), the two most studied and commonly used FabF inhibitors [41]. In vitro antifungal testing demonstrated that the antifungal activity of the acetylenic acids is associated with their chain lengths and position of triple bonds [40]. Another non-acidic natural acetylenic compound (46) is obtained from a sterile dark ectotrophic fungus isolated from the roots of an Australian native grass, Neurachne alopecuroidea. Compound 46 totally inhibited the growth of Phytophthora cinnamomi, Rhizoctonia solani, Pythium irregulare, and Alternaria alternata at 0.98, 7.81, and 15.63 μg ml−1 , respectively [42]. H H C H OH H OH O 41 O 42 OH O H NH2 O H C O OH 43 44 CH3 HO S 45 O O H O OH 46 O 228 9 Natural Products as Antimicrobial Agents – an Update 9.4 Antimicrobial Carbohydrates Protection of foods from microbial spoilage using salt (salting by usually sodium chloride) or sugar (corning by usually sucrose) has ancient roots. Some modern synthetic preservatives have become controversial because of their allergic effects. Every manufacturer adds preservative to the food during processing. The purpose of all of these chemicals is either to kill microbes or to act as antioxidants or both [43]. Natural products have the advantage over other chemicals because of their low side effects. Among them, sugars are known for their antimicrobial properties and one potential example is natural honey. Honey has been reported to have wound healing and antimicrobial properties, which is partially attributed to the carbohydrate contents in honey [44]. Sugars have also been reported to be used for wound treatment because of their antimicrobial properties. Many natural sources including plants contain carbohydrates as their active constituents and bear antimicrobial properties. For example, partially acetylated oligorhamnoside derivatives 47–49 were isolated by capillary-scale NMR probe and LR-/high resolution electron spray ionizationmass spectrometry (HRESIMS) spectroscopic methods from Cleistopholis patens. These compounds exhibit significant in vitro antibacterial activity against the Gram-positive bacteria MRSA ATCC 33591 and S. aureus 78-13607A with MICs of ≤16 μg ml−1 [45]. O CH2(CH2)10CH3 O O AcO O HO O OH O O AcO OH O O R1O O CH2(CH2)10CH3 O O R4O R3O OR2 OH OH O AcO OAc O HO HO OAc 48 47 R1 = R3 =Ac, R2 = R4 = H 49 R1 = R4 = Ac, R2 = R3 = H 9.5 Antimicrobial Natural Chromenes Chromene (benzopyran) is one of the privileged medicinal pharmacophores, which appears as an important structural component in natural compounds and has generated great attention because of its interesting biological activity. It is a heterocyclic ring system consisting of a benzene ring fused to a pyran ring. Chromene constitutes the basic backbone of various types of polyphenols and 9.6 Antimicrobial Natural Coumarins is widely found in natural alkaloids, tocopherols, flavonoids, and anthocyanins [46]. It is known that certain natural and synthetic chromene derivatives possess important biological activities including antimicrobial action [47–50]. Despite the fact that this class of natural products is very important, only a few reports have been published in recent literature concerning their roles as antimicrobial agents. However, a review the literature over the last two decades revealed that many of these compounds from natural sources are reported to possess antimicrobial activity [51]. 4H-chromene, uvafzlelin (50) isolated from the stem part of Uvaria ufielii, shows broad spectrum antimicrobial activity against Gram-positive and acid-fast bacteria [51d]. 5-Hydroxy-8-(30-methyl-20-butenyl)-2,2,7-trimethyl-2H-1chromene-6-carboxylic acid (51) and methyl-5-hydroxy-2,2,7-trimethyl-2H-1chromene-6-carboxylate (52) were isolated from the leaves of Peperomia serpens. In a bioautographic microbial assay against Cladosporium cladosporioides and Cladosporium sphaerospermum, 51 showed a detection limit of 10.0 μg, whereas 52 exhibited a limit of 20.0 μg. These results showed the antifungal potential of these compounds [52]. O O HO O O O OH MeO HO O O O 50 OH O O 51 52 9.6 Antimicrobial Natural Coumarins Coumarins (2H-1-benzopyran-2-one) constitute a large class of phenolic substances which occur in plants and are made of fused benzene and α-pyrone rings [53]. More than 1300 coumarins have been isolated from plants, bacterial, and fungal sources [54]. The biological activity of coumarins varies according to their substitution patterns on the main nucleus. For example, substituted4-(1-piperazinyl) coumarins showed anti-platelet aggregation activity [55] and 8-substituted-7-geranyloxycoumarin derivatives (specially the 8-methoxy and 8-acetoxy derivative) exhibited anti-inflammatory activity [56], whereas 8-substituted-7-methoxycoumarins were found to be anticancer agents [57]. Over the last few years, many antimicrobial coumarins have also been reported from various natural sources. 9.6.1 Antimicrobial Coumarins from Plants Chakthong et al. [58] isolated several coumarins from the green fruits of Aegle marmelos and evaluated their antimicrobial potential. Only compounds 53–55 229 230 9 Natural Products as Antimicrobial Agents – an Update inhibited the growth of R. solani NPRC750, Rigidoporus microporus PR720, and Sclerotium oryzae NPRC760 with an MIC/MFC (minimum fungicidal concentration) in the range of 7.8/7.8 to 31.5/31.5 μg ml−1 . Compound 56 was active only against E. faecalis TISTR459 with an MIC of 18.75 μg ml−1 . The structure activity relationships of other coumarins included in this reference [58] are generally poorly understood. O O MeO O O HO OHC MeO O O 53 O HO O O O HO O 55 54 O 56 The fruits of Angelica lucida produced imperatorin (57), isoimperatorin (58), heraclenol (59), oxypeucedanin hydrate (60), and heraclenin (61). These coumarins were studied for their antimicrobial activity against six Gram-positive and -negative bacteria, two oral pathogens, and three human pathogenic fungi [59]. The tested compounds were inactive against the three assayed Candida species, whereas they generally inhibited the growth of all assayed bacterial strains with MIC values ranging between 0.012 and 0.85 mg ml−1 . Compounds 57 and 58 showed the best activity with MIC values of 0.012 and 0.70 mg ml−1 . Schinkovitz et al. [60] reported that the presence of an isoprenyl unit attached to the carbocyclic ring favors their antimicrobial activities. Other similar results revealed that the antibacterial potential can be attributed to the coumarin ring. Since the natural products are known to exert their effects by inhibition of bacterial nucleic acid synthesis [61] and the activity of furanocoumarins is increased owing to the addition of a prenyl group to the main skeleton, the antibacterial potential could be attributed to the increased lipophilicity of the molecule, facilitating its passage though the thick bacterial membrane to its target [62]. HO O O O O O 57 O O 58 O O O O O O O O OH HO OH 59 O O 60 O O O O 61 Aegelinol (62) and agasyllin (63), isolated from the roots of Ferulago campestris, showed antibacterial activity against nine ATCC clinically isolated Gram-positive and Gram-negative bacterial strains [63]. At concentrations ranging between 16 and 125 μg ml−1 both coumarins showed a significant antibacterial effect against S. aureus, Salmonella typhi, Enterobacter cloacae, and Enterobacter aerogenes 9.6 Antimicrobial Natural Coumarins (MIC = 16 and 32 μg ml−1 , respectively. Antibacterial activity was also found against Helicobacter pylori: a dose-dependent inhibition was observed between 5 and 25 μg ml−1 . The growth inhibition by these two compounds is interesting because the Gram-negative H. pylori is a microaerophilic-shaped bacterium that is free living in the mucous layer of the human stomach. This bacterium spreads worldwide, with a frequency ranging from 25% in the developed to 90% in the developing areas. Infection from this bacterium leads to different clinical disorders including chronic gastritis, peptic ulcer, and gastric adenocarcinoma [64]. HO O O O 62 O O O O 63 Hydroxycoumarin scopoletin (64) isolated from the seed kernels of Melia azedarach L. showed a strong antifungal synergistic effect against Fusarium verticillioides. Although compound 64 exhibited weak activity (MIC of 1.5 mg ml−1 ) in the microbroth dilution method, when it was combined with vanillin (65), 4-hydroxy-3-methoxycinnamaldehyde (66), and (±) pinoresinol (67), it boosted the antifungal effect of these compounds, even showing a complete inhibition in the growth of the pathogen when 64 was added at a concentration of up to 5% of its MIC value [65]. Two dihydroxylated coumarins, 7,8-dihydroxy-6-methoxycoumarin (68) and 7,8-dihydroxycoumarin (69), the secondary metabolites of Mexican tarragon (Tagetes lucida Cv.), showed anti-E. coli and anti-Vibrio cholerae activity. Compound 68 is quantitatively more active than 69, and the MICs of compounds 68 and 69 against V. cholerae (Tor: strain CDC-V12) were 25 and 200 μg ml−1 , respectively, and against E. coli, they were 250 and 450 μg ml−1 , respectively [66]. This data indicated that the additional methoxyl group in 68 might be playing an important role in antibacterial activity. Compounds 70 and 71 inhibited the mycelial growth of Fusarium solani with IC50 values of 27.7 and 125 μM, respectively, whereas 71 and 72 showed high activity against B. cinerea at 300 μM. At a concentration of 30 μM, 70 and 71 inhibited P. obscurans growth by 80% after 120 h of exposure [17]. Khatune et al. [67] have reported psoralidin (73), bakuchicin (74), psoralin (75), and angelicin (76), isolated from the seeds of Psoralea corylifolia, which were found to exhibit significant antibacterial activities against a number of Grampositive and Gram-negative bacteria. At concentrations of 200 and 400 μg/disc, all substances exhibited 9–27 mm zone of inhibition against Gram-positive pathogens, whereas against Gram-negative bacteria, at the same concentration, they showed 9–23 mm zone of inhibition. 231 232 9 Natural Products as Antimicrobial Agents – an Update O H O MeO H HO O OMe MeO MeO MeO O OH OH 65 64 OH O O HO 67 66 MeO OMe HO O O HO OH O OH 68 O O O O O 69 70 O O O MeO O OMe 71 72 OH O O O HO O O O O O O O O O 73 74 75 76 9.6.1.1 Antimicrobial Coumarins from Bacteria Two antifungal coumarins, 5,7-dimethoxy-4-p-methoxylphenylcoumarin (77) and 5,7-dimethoxy-4-phenylcoumarin (78), were isolated from the culture extract of Streptomyces aureofaciens CMUAc130. Both the compounds were purified by silica gel-column chromatography and were identified by NMR and mass-spectral data. Compounds 77 and 78 inhibited the growth of phytopathogenic fungi with MICs values 120 and 150 μg ml−1 , respectively [68]. R 77: R = OCH3 OCH3 H3CO O 78: R = H O 9.7 Antimicrobial Flavonoids Flavonoids are amongst the biggest classes of known secondary metabolites and are distributed in various plant families. They protect the plants from UV radiation and other environmental stress; thus, prominent antioxidant properties are 9.7 Antimicrobial Flavonoids 233 associated with them. Flavonoids have been found in vitro to be effective antimicrobial agents against a wide array of microorganisms [69]. Common flavonoids or flavonoid glycosides such as luteolin, quercetin, apigenin, kaempferol, isorhamnetin, acacetin, tamarixetin, chrysin, and galangin [70], quercetin-3-O-rutinoside, kaempferol-3-O-rutinoside, and isorhamnetin-3-O-rutinoside [69] are known to possess antimicrobial properties. Not only natural but synthetic flavonoids are also reported to exhibit antimicrobial activities [71]. 9.7.1 Antimicrobial Flavonoids from Plants Two flavonoids, 5,7-dihydroxy-4′ ,6,8-trimethoxyflavone (79) and 5,6-dihydroxy4′ ,7,8-trimethoxyflavone (80), isolated from Limnophila heterophylla Benth. and Limnophila indica (Linn.) Druce, respectively, exhibited moderate but broad-spectrum antimicrobial activity against B. subtilis, S. aureus, E. coli, Salmonella typhimurium, Alternaria solani, and C. albicans [72]. It is stated that the compounds probably acted either on the cell wall integrity or on the process of energy metabolism to halt the microbial growth. This report indicates that these compounds can be used as food preservatives and as possible therapeutics against microbial infections. Anticancer prenylated flavonoids, propolin C (81), propolin D (82), propolin G (83), and propolin H (84), were identified as the constituents of propolis, a natural product from the beehive traditionally used in folk medicine for its antimicrobial properties. These compounds exhibited anti-MRSA activity against S. aureus with MIC values ranging between 8 and 32 mg l−1 [73]. OH OH OMe OMe HO OMe HO MeO OH O 79 80 81 OH OH OH OH O OH O 82 O OH O OH O HO HO O MeO O OMe HO O OH O 83 OH HO O OH O 84 234 9 Natural Products as Antimicrobial Agents – an Update Dihydrokaempferol (85) and 8-C-glucopyranosylapigenin (86) isolated from the extract of Trilepisium madagascariense exhibited antimicrobial activity against Providencia smartii, P. aeruginosa, Klebsiella pneumoniae, S. aureus, S. typhi, E. coli, and C. albicans. Varying MIC values are reported between 8 and 32 μg ml−1 . However, many other flavonoids were also evaluated for antimicrobial potential and possessed moderate to low activity [74]. Luteolin (87), a common phytochemical, was isolated from the leaf of Struchium sparganophora (Linn) Ktze. This compound inhibited the growth of the Grampositive organism S. aureus and the Gram-negative organism Klebsiella aerogenes with MIC values ranging from 100 to 6.25 μg ml−1 [75]. OH O OH HO HO OH OH O HO O HO OH HO O OH OH OH O OH O 85 OH O 87 86 J. Y. Lee [76] studied the antimicrobial potential of 3,6-dihydroxyflavone (88) and the chalcone-derived compound 3-(4-hydroxyphenyl)-1-(2,4,6-trihydroxyphenyl)propan-1-one (89). Owing to a high binding affinity the two compounds are reported to be potent inhibitors of β-ketoacyl-acyl carrier protein synthase III (KAS III). In particular, these compounds displayed excellent antimicrobial effect against S. aureus and MRSA in the range of 16–32 μM. HO O OH OH OH HO O 88 OH O 89 Two flavonols, lavandulylated flavanones (2R 3R)-8-lavandulyl-2′ -methoxy5,7,4′ -trihydroxy-flavanonol (90) and 8-lavandulyl-5,7,4′ -trihydroxyflavonol (91), were identified as the constituents of Sophora flavescens. Both the compounds exhibited significant antibacterial activities against S. aureus and B. subtilis that equaled that of chloramphenicol. Each compound was tested at a dose of 0.2 ml of 100 μg ml−1 and exhibited a zone of inhibition in the rage of 16–20 mm [77]. Amentoflavone (92), another flavonoid, derived from Selaginella tamariscina, exhibited potent inhibitory activity against the fungal pathogens C. albicans (MIC = 5.0 μg ml−1 ), S. cerevisiae (MIC 5.0 = μg ml−1 ), and T. beigelii (MIC = 5.0–10.0 μg ml−1 ), indicating its broad-spectrum antibiotic potential [78]. 9.7 Antimicrobial Flavonoids 235 OH OH CH2 HO O OH O HO O O OH HO OH O OH CH2 HO O OH OH OH O OH O 91 92 90 The oxidized products of quercetin 2-(3,4-dihydroxyphenyl)-4,6-dihydroxy-2methoxybenzofuran-3-one (93) and 3-(quercetin-8-yl)-2,3-epoxyflavanone (94) were isolated from the water extract of onion (Allium cepa) skin. Compound 93 selectively inhibited (100 μg ml−1 , zone inhibition 12–15 mm) the growth of Gram-negative bacteria, primarily H. pylori strains and was inactive against other tested Gram-positive pathogens. This information suggested that compound 93 has some specific mechanism of action against H. pylori. Compound 94 showed comparatively the highest activity (100 μg ml−1 , zone inhibition 15–18 mm) against MRSA strains and also high activity against H. pylori strains. In addition, 94 increased the antibacterial effect against both strains of MRSA in the presence of oxacillin, suggesting that this compound has a synergistic growth inhibitory effect with the β-lactam against the antibiotic-resistant bacteria [79]. OH OH OH HO OH HO O OH OH O OMe O 94 93 HO O OH O OH O OH OH 95 O O O OH O OH O OH O OH OH HO HO O O OH O HO O O HO O OH OCH3 O HO O H OH OH O 96 OH OH HO HO 97 98 Morin-3-O-α-L-lyxopyranoside (95) and morin-3-O-α-L-arabopyranoside (96) were identified as metabolites of the leaves of guava (Psidium guajava L.). The structures of these compounds were established on the basis of chemical and spectroscopic evidence. The MIC of 95 and 96 was 200 μg ml−1 for each 236 9 Natural Products as Antimicrobial Agents – an Update against Salmonella enteritidis, and 250 and 300 μg ml−1 against Bacillus cereus, respectively [80]. Donnell et al. [81] identified homoisoflavanone (97) as 3-(4′ -methoxybenzyl)7,8-methylenedioxy-chroman-4-one, which was found to be an active agent against a fast-growing mycobacteria. It exhibited MIC values ranging from 16 to 256 μg ml−1 . Kaemferol (98), another very common phytochemical, has been reported as an antimicrobial. In an antibacterial test, it inhibited the growth of two Gram-negative and four Gram-positive pathogens with an MIC of 2.4 μg ml−1 and showed activity against Candida glabrata (MIC = 4.8–9.7 μg ml−1 ) [82]. Apigenin (99) and luteolin (100) from Scutellaria barbata D. Don are also common phytochemicals. Apigenin (99) potentially inhibited (MIC = 3.9– 15.6 μg ml−1 ) the growth of 20 strains of MRSA, whereas luteolin (100) exhibited a moderate activity (MIC = 62.5–125 μg ml−1 ) against the tested pathogens [83]. Flavone glycoside (101) purified from the leaves of Vitex negundo is also known as an antimicrobial agent. Compound 101 showed promising activity against T. mentagrophytes and C. neoformans with MIC values of 6.25 μg ml−1 as compared to the standard antifungal drug fluconazole having MIC of 2.0 μg ml−1 [84]. Di-benzyloxy flavone (102) from Helichrysum gymnocomum was characterized by NMR and MS. It afforded high activity against C. neoformans ATCC 90112 with an MIC value of 7.8 μg ml−1 [85]. Laburnetin (103) isolated from the methanolic extract of Ficus chlamydocarpa exhibited potent inhibitory activity against Mycobacterium smegmatis and M. tuberculosis with MIC values of 0.61 and 4.88 μg ml−1 , respectively [86]. The efficacy of flavonoids against various pathogens can be attributed to cell-wall permeability and the porins in the outer membrane present in microorganisms. It appears that the compounds may block the charges of amino acids in porins [87]. Further, a keen comparison of the above-discussed properties revealed that the flavonoids having free hydroxyl groups at C-5 and C-7 in ring A are more active and are also supported by their synthetic analogs [88]. O OH OH OH HO HO HO OMe O O OH HO O O HO O OH O OH O 99 OH O 101 100 HO O O O O 102 O OH OH O 103 OH OH 9.8 Antimicrobial Iridoids 237 9.8 Antimicrobial Iridoids Iridoids are widely distributed in dicotyledonous plant families such as Apocynaceae, Scrophulariaceae, Diervillaceae, Lamiaceae, Loganiaceae, and Rubiaceae. These natural products are associated with a wide range of health benefits. They provide support against a broad range of physical, chemical, or biological stressors without exhibiting any toxicity. These compounds possess anticancer [89], antiinflammatory [90], and anti-aging [91] activities. They are also known for their other potential biological activities, and recent developments revealed that they also possess antimicrobial properties [92]. 9.8.1 Antimicrobial Iridoids from Plants Two iridoids (104 and 105) isolated from the roots of Patrinia rupestris (Pall.) were identified as potential antibacterial drug candidates. They were evaluated to exhibit strong antibacterial activities (inhibition zone ranging from 13 to 20 mm at a concentration of 100 μg ml−1 ) against E. coli and S. aureus, respectively [93]. A study of the chemistry and antibacterial activity of Scrophularia deserti also led to the isolation of ajugoside (106) and scropolioside B (107) as antibacterial agents. These compounds moderately inhibited the growth of multidrug-resistant Staphylococcus aureus (MDRSA) and MRSA and a panel of rapidly growing mycobacteria (Mycobacterium fortuitum, Mycobacterium phlei, Mycobacterium aurum, and M. smegmatis) with MIC values ranging from 32 to 128 μg ml−1 [94]. OR HO O HO ClH2C O O OR 104 R = COCH2(CH3)2 OR O O O HO O OR 105 O 107 106 O O OH OH HO OH OH HO O O HO ClH2C O O OH OH RO O O O O O O OH Two iridoid glycosides (108 and 109) purified from alcoholic extract of leaves of V. negundo were characterized by 1D, 2D NMR and fast atomic bombardmentmass spectrometry (FABMS) techniques. Compound 108 inhibited the growth of C. neoformans and T. mentagrophytes exhibiting an MIC of 12.5 μg ml−1 , whereas 109 displayed promising activity against T. mentagrophytes and C. neoformans with an MIC of 6.25 μg ml−1 [84]. 238 9 Natural Products as Antimicrobial Agents – an Update H HO COOH H O O O H HO O O O OH O HO HO H HO O O OH OH 108 OH OH O 109 HO 9.9 Antimicrobial Lignans Lignans are a class of phytochemicals produced by biological oxidative dimerization of two phenylpropanoid units [95]. In addition to their normal biological roles, lignans also possess significant pharmacological activities, including antitumor, anti-inflammatory, immunosuppressive, cardiovascular, antioxidant, and antiviral actions [96]. 9.9.1 Antimicrobial Lignans from Plants Heyneanol A (110) was obtained from the root extract of Vitis sp. (grape vines) and was identified as an antibacterial agent against Gram-positive pathogens. Using the disc diffusion method, the compound 110 exhibited an MIC value of 2.0 μg ml−1 toward MRSA and a value of 2.0–4.0 μg ml−1 for Enterococcus faecium, S. aureus, Streptococcus agalactiae, and Streptococcus pyogenes [97]. OH O OH HO HO HO O OH OH HO 110 O OH Another lignin (+)-lyoniresinol-3α-O-β-D-glucopyranoside (111) was identified as the constituent of the root bark of Lycium chinense Miller. This compound exhibited potent antimicrobial activity against antibiotic-resistant bacterial strains, such as MRSA (MIC 2.5–5.0 μg ml−1 ), and human pathogenic fungi such as C. albicans (MIC 5.0 μg ml−1 ), S. cerevisiae (MIC = 5.0 μg ml−1 ), and 9.9 Antimicrobial Lignans T. beigelii (MIC = 10.0 μg ml−1 ), without having any hemolytic effect on human erythrocytes. In particular, compound 111 induced the accumulation of intracellular trehalose on C. albicans as stress response to the drug, and disrupted the dimorphic transition that forms the pseudohyphae caused by pathogenesis. This indicates that (+)-lyoniresinol-3-α-O-β-D-glucopyranoside (111) has an excellent potential as a lead compound for the development of antibiotic agents [98]. A resveratrol trimer with an ortho-quinone nucleus, hopeanolin (112), was isolated from the stem bark of Hopea exalata. Compound 112 demonstrated antifungal activity in the MIC range of 0.1–22.5 μg ml−1 against Alternaria altenata (22.5 μg ml−1 ), A. solani (1.56 μg ml−1 ), Colletotrichum lagenarium (10.6 μg ml−1 ), F. oxysporum f. sp. Vasinfectum (6.22 μg ml−1 ), Pyricularia oryzae (0.10 μg ml−1 ), and Valsa mali (1.55 μg ml−1 ). These results revealed the broad-spectrum antifungal properties of the compound and made it a potential antimicrobial drug candidate [99]. The hexahydroxydiphenoyl ester vescalagin (113) was isolated from Lythrum salicaria as the active principal of the antibacterial activity. Minimal inhibitory and bactericidal concentration (MIC and MBC; 0.062–0.125 and 0.50–1.0 mg ml−1 , respectively) were observed in the isolated compounds [100]. HO MeO O OH HO O HO OH OH O OMe OH H HO H H HO MeO H O O OMe O OH O 111 HO 112 HO OH HO OH OH HO O O O O H O O O O HO OH OH O OH O OH HO OH OH HO 113 OH H OH 239 240 9 Natural Products as Antimicrobial Agents – an Update 9.10 Antimicrobial Phenolics Other Than Flavonoids and Lignans Antimicrobial activity of plant phenolics has been intensively studied, and, in addition to controlling invasion and growth of plant pathogens, their activity against human pathogens has been investigated to characterize and develop new healthy food ingredients, medical compounds, and pharmaceuticals [101–103]. 9.10.1 Antimicrobial Phenolics from Plants The leaves of Piper regnellii produced eupomatenoid-3 (114), eupomatenoid-5 (115), eupomatenoid-6 (116), and conocarpan (117). The compounds 115 and 116 showed good activity against S. aureus with an MIC of 3.12 and 1.56 μg ml−1 , respectively. Both compounds demonstrated an MIC of 3.12 μg ml−1 against B. subtilis, while 117 was potentially active against S. aureus and B. subtilis with an MIC of 6.25 μg ml−1 [104]. Eupomatenoid-5 (115) showed strong activity on T. rubrum with an MIC value of 6.2 μg ml−1 . The results showed that the plant could be explored for possible antifungal agents and provide preliminary scientific validation for its traditional medicinal use [105]. The low or absence of activity of 118–120 and structural comparison of 114–120 and their activity levels revealed that phenolic functions (free hydroxyl group on benzene ring) are important for the compound to be antimicrobial as was observed in the case of flavonoids. O R1 O R O O 114 O R 115: R OH, R1 = OMe 116: R = OH, R1 = H 118: R = OMe, R1 = H 119: R = OMe, R1 = OMe 117: R = OH 120: R = OMe Other antimicrobial phenolics include pterocarpans – erybraedin B (121), erybraedin A (122), phaseollin (123), erythrabyssin II (124), erystagallin A (125), erythrabissin-1 (126), and erycristagallin (127) – isolated from the stems of Erythrina subumbrans (Leguminosae). Their structures were identified by means of spectroscopy. Compounds 122 and 124 exhibited the highest degree of activity against Streptococcus strains with an MIC range of 0.78–1.56 μg ml−1 , whereas compound 127 was found to be potent against Staphylococcus strains, including drug-resistant strains (MRSA and vancomycin-resistant Staphylococcus aureus (VRSA)), with an MIC range of 0.39–1.56 μg ml−1 . Compounds 122, 124, 125, 9.10 Antimicrobial Phenolics Other Than Flavonoids and Lignans 241 and 127 potentially inhibited the growth of several strains of Streptococcus and Staphylococcus and were found to be more active than the standard antibiotics vancomycin and oxacillin [106]. In addition, 127 showed the highest level of activity against all VRSA strains tested, with an MIC range of 0.39–1.56 μg ml−1 . These compounds may prove to be potent phytochemical agents for antibacterial activity, especially against the MRSA and VRSA strains [106]. Structure–activity relationship analysis of these compounds revealed that the dimethylallyl units and higher phenolic characteristic play an important role in activity, and this could be the reason that compounds 121 and 123 are nearly inactive. HO O HO H H O H O 125 O OH 124 O HO O HO OH O 123 122 O H O OH O 121 HO H O H H H H O HO O HO O OH OMe H O 126 O OMe 127 Kanzonols are well-known phytophenolics possessing antimicrobial activities [107]; for example, kanzonol C (128) is known for its high biological activities. Compound 128 and its analogs, isobavachalcone (129), stipulin (130), 4-hydroxylonchocarpin (131) isolated from the extract of the twigs of Dorstenia barteri and characterized spectroscopically showed broad-spectrum inhibitory activities against Gram-positive and Gram-negative bacteria and fungi. Compound 129 was highly active against E. cloacae, Streptococcus faecalis, S. aureus, Bacillus stearothermophilus, C. albicans and C. glabrata (MIC = 0.3 μg ml−1 ), Enterobacter aerogenes, Morganella morganii, Shigella flexneri, B. cereus, Bacillus megaterium and B. subtilis (MIC = 0.6 μg ml−1 ), Proteus mirabilis, P. vulgaris, Microsporum audorium, and T. rubrum (MIC = 1.2 μg ml−1 ), whereas compound 131 inhibited growth of E. cloacae, M. morganii, B. megaterium and B. stearothermophilus (MIC = 1.2 μg ml−1 ), E. aerogenes, S. flexneri, S. faecalis, S. aureus, B. cereus, B. subtilis, C. albicans, C. glabrata, and T. rubrum (MIC = 4.9 μg ml−1 ) and M. audorium (MIC = 9.8 μg ml−1 ). Phenolic 128 showed comparatively moderate activity against E. aerogenes, E. cloacae, M. morganii, S. flexneri, S. faecalis, B. megaterium, B. stearothermophilus, C. albicans and C. glabrata (MIC, OH 242 9 Natural Products as Antimicrobial Agents – an Update 4.9 μg ml−1 ), P. mirabilis, P. vulgaris, B. cereus, B. subtilis, and M. audorium (MIC = 9.8 μg ml−1 ). Although the structure–activity relationship has not been discussed for these compounds, another compound 130 from the same source was found to be inactive. The only structural difference between these compounds is the position of the isoprene unit, which is the same in 128 and 129 but different in 130. This difference in structure and activities revealed that the position of the isoprene unit on the phenyl nucleus is important for such a compound to be antimicrobial [107]. Curcumin (132), a similar type of compound, has been reported to induce filamentation in B. subtilis, suggesting that it inhibits bacterial cytokinesis. Further, 132 strongly inhibited the formation of the cytokinetic Z-ring in B [108]. On the basis of these facts, the site of action of kanzonols was predicted but further study on these antimicrobials is needed to confirm findings. O HO HO O OH HO HO 128 OH HO HO HO O O O OH HO OMe OMe 131 OH 130 129 O HO O 132 Structural similarities and antimicrobial activity levels were observed in acylphloroglucinol (133) and its analog, 2-methyl-1-[2,4,6-trihydroxy-3-(2hydroxy-3-methyl-3-butenyl)phenyl]-1-propanone (134) isolated from H. gymnocomum, and characterized by NMR and mass spectroscopic means. Compound 133 displayed high activity against C. neoformans ATCC 90112 with an MIC value of 7.8 μg ml−1 , while 134 inhibited the growth of S. aureus ATCC 12600 (MIC = 6.8 μg ml−1 ), E. faecalis ATCC 29212, S. aureus (methicillin and gentamycin resistant) ATCC 33592 and B. cereus ATCC 11778 (MIC = 7.8 μg ml−1 ), and Staphylococcus epidermidis ATCC 2223 (MIC = 9.8 μg ml−1 ) [85]. Other phytochemicals, grandinol (135) and jensenone (136) and their synthetic analog (137), also showed high antimicrobial activities. The comparative data revealed that phloroglucinols possess various bioactivities and their acyl-derivatives possess antimicrobial activities; therefore, they can be good candidates for further clinical studies to develop new antimicrobial drugs [109]. 9.10 OH Antimicrobial Phenolics Other Than Flavonoids and Lignans OH OH O H OH HO OH HO HO O OH O 133 OH O 134 O HO 135 O H OH OHC OH O H OH HO OH OH O 136 137 The stem bark of Irvingia gabonensis contains 3,3′ ,4′ -tri-O-methylellagic acid (138) and 3,4-di-O-methylellagic acid (139). The lowest MIC value (9.76 μg ml−1 ) of 138 and 139 was observed against E. coli, P. vulgaris, and B. subtilis, while 139 exhibited high activity against P. aeruginosa (MIC = 4.8 μg ml−1 ) [110]. Again, compounds with more phenolic character such as 139 are more active. O OMe O 138: R = CH3 RO OMe O HO 139: R = H O Psoracorylifols A–E (140–144) were isolated from a well-known traditional Chinese medicine, the seeds of P. corylifolia. The structures of compounds 140–144, including their absolute configurations, were established on the basis of spectral methods and biogenetic deduction. The structure of 140 was confirmed by single-crystal X-ray diffraction. Psoracorylifols D and E (143 and 144) represent a novel carbon skeleton. These tested compounds showed significant inhibitory activity against two strains of H. pylori (SS1 and ATCC 43504) at the level of MICs of 12.5–25 μg ml−1 . It is remarkable that psoracorylifols A–E (140–144) are 5–10 times stronger than the standard drug metronidazole, which is a critical ingredient for combination therapies of H. pylori infection, and particularly, against H. pylori ATCC 43504. Therefore, such compounds or their derivatives can be potential substitutes for the present antibacterial drugs [111]. 243 244 9 Natural Products as Antimicrobial Agents – an Update The phenylpropyl benzoates (145–147) isolated from Croton hutchinsonianus were found to exhibit antifungal activity against C. albicans (IC50 = 11.41, 7.05, 5.36, respectively) [112]. Methyl gallate (148) and protocatechuic acid (149) from Sebastiania brasiliensis were identified as the growth inhibitors of B. subtilis, M. luteus, S. aureus, P. aeruginosa, E. coli, C. albicans, Mucor sp., and A. niger, both with an MIC of 128 μg ml−1 [113]. H OH H H O HO H H O HO O HO HO O O 140 H H H 141 H HO O O H O 144 143 142 O H H O R1 HO OH HO R2 O OMe HO OH HO OH OH 148 149 145: R1= R2 = OMe 146: R1 = OMe, R2 = OH 147: R1 = R2 = H 9.10.2 Antimicrobial Phenolics from Microbial Sources 2-Hydroxy-5-(3-methylbut-2-enyl)benzaldehyde (150) and 2-hepta-1,5-dienyl3,6-dihydroxy-5-(3-methylbut-2-enyl) benzaldehyde (151) are constituents of a marine-derived Streptomyces atrovirens isolated from the rhizosphere of the marine seaweed Undaria pinnatifida. Both the compounds inhibited the growth of Gram-positive (Lactococcus garvieae, Streptococcus iniae, and Streptococcus parauberis) and Gram-negative (Edwardsiella tarda, Vibrio anguillarum, and V. harveyi) pathogens with MIC values of 15–128 μg ml−1 [114]. 2,3-Dihydroxy-5-(hydroxymethyl) benzaldehyde (152), 4-(4-hydroxyphenoxy) butan-2-one (153), and acetic acid-2-hydroxy-6-(3-oxo-butyl)-phenyl ester (154) are known as the secondary metabolites of Streptomyces sp. TK-VL_333. In an antimicrobial assay, it was discovered that the pathogenic Gram-positive bacteria tested, S. aureus and Staphylococcus epidermidis, were highly sensitive to these metabolites. However, against a large panel of bacteria, yeast, and filamentous fungi, all the metabolites exhibited inhibitory activity with MIC values ranging between 15 and 50 μg ml−1 . It has been reported that most of the benzaldehyde derivatives having active hydroxyl groups show antimicrobial activity [114]; however, their mode of action has not yet been reported. 9.10 Antimicrobial Phenolics Other Than Flavonoids and Lignans HO HO OH HO HO CHO CHO 150 CHO 152 151 O O O O OH O 154 153 Petit et al. [115] have isolated methyl-6-acetyl-4-methoxy-5,7,8-trihydroxynaphthalene-2-carboxylate (155) from the culture extract of a Penicillium sp. In an antimicrobial assay, compound 155 exhibited promising activity against C. albicans with an MIC value of 32 μg ml−1 , and against Listeria monocytogenes and B. cereus with an MIC value of 64 μg ml−1 . Sophisticated NMR techniques helped characterize the isolates of mushroom Merulius incarnatus as 5-alkylresorcinols (156–161). Compound 157 is the first 5-alkylresorcinol derivative that contains a trans–cis conjugated double bond system. Compounds 156–161 were found to inhibit (MRSA) with IC50 values of 2.5, 15, 9.5, 8.0, 5.0, and 6.5 μg ml−1 , respectively [116]. HO 156 OH HO 157 OH OMe OH O MeO OH O HO 158 OH OH 155 HO 159 HO OH 160 OH HO 161 OH 245 246 9 Natural Products as Antimicrobial Agents – an Update The culture extract of an endophytic fungus yielded 1-(2-hydroxy-6methoxyphenyl)butan-1-one (162) and 1-(2,6-dihydroxyphenyl)butan-1-one (163) as the growth inhibitor of the Gram-positive bacterium B. megaterium, the fungi Microbotryum violaceum, and Septoria tritici at a concentration of 0.25 mg/paper disc [117]. Sorbicillin analogs (164 and 165) are the constituents of a fungicolous isolate of the genus Phaeoacremonium (NRRL 32148). Compound 164 displayed potent activity in disc diffusion assays against Aspergillus flavus (40-mm diameter clear zone at 48 h) and moderate activity against F. verticillioides (18-mm zone of partial clearing at 48 h; 200 μg/disk in each case), while compound 165 showed similar activity against F. verticillioides (18-mm zone of partial clearing at 48 h), but slightly weaker activity against A. flavus (18-mm zone of reduced sporulation at 48 h) [118]. CHO OH OMe OH O OH O 162 CH2OH OMe O 163 OMe OH O 164 OH 165 9.10.3 Antimicrobial Phenolics from Marine Source Plaza et al. [119] identified chrysophaentins A (116), D–F (167–169), and H (170) from the marine chrysophyte alga Chrysophaeum taylori as antimicrobial agents. These compounds were active against the drug-susceptible bacteria Staphylococcus aureus (SA) and E. faecium, and drug-resistant strains MRSA and vancomycin-resistant Enterococcus faecium (VREF). Disc diffusion assays showed that these compounds inhibited the growth of all tested strains at loads ranging from 2 to 25 μg/disk. Chrysophaentin A (166) was found to be the most potent HO OH HO R2 OH HO OH O OH Cl Cl Cl Cl O OH OH Cl HO Cl Cl HO HO HO R O O R1 Cl HO HO HO OH 166: R1 = R2 = Cl 167: R1 = R2 = Br O Cl Cl OH OH 168 169: R = H 170: R = Br 9.11 Antimicrobial Polypeptides antibiotic with MIC50 values of 1.8 ± 0.6, 1.5 ± 0.7, and 1.3 ± 0.4 μg ml−1 against SA, MRSA, and MDRSA, respectively; and 3.8 ± 1.9 and 2.9 ± 0.8 μg ml−1 toward E. faecium and VREF. Chrysophaentins F (169) and H (170) were the next most potent compounds with MIC50 values of 4–6 μg ml−1 toward S. aureus and MRSA, and ∼9.5 μg ml−1 against VREF. Structure–activity analysis revealed that hydroxyl group and bromine atom are important for antimicrobial action. 9.11 Antimicrobial Polypeptides Polypeptides are well known for their pharmaceutical uses including antimicrobial properties. They are well known to be used as antimicrobial agents, for example, in pharmaceutical applications, as well as for preservation, cleaning, and disinfection of various surfaces, objects, and substances. The polypeptides may in particular be used to treat textiles or laundry, for example, in detergents, for reducing microbes on textile or laundry, and for odor reduction by reducing microbial growth [120]. Mostly, the polypeptides are of microbial origin and several polypeptides are discovered in recent years as new antimicrobial agents. The culture of Beauveria sp. FKI-1366 yielded beauvericins A (171), D (172), E (173), and F (174), which were evaluated for their antifungal potential. Although these compounds were inactive against the tested pathogens, interestingly, they potentiated miconazole activity against wild C. albicans and fluconazole-resistant C. albicans. Beauvericins D (172) and E (173) decreased the IC50 value of miconazole against fluconazole-resistant C. albicans from 1.3 μM to 0.25 and 0.31 μM, respectively [121]. R3 R2 R1 O R1 R2 R3 171: CH(CH3)CH2CH3 CH3 CH2C6H5 172: CH(CH3)2 H CH2C6H5 173: CH(CH3)2 H CH2CH(CH3)2 174: CH2CH(CH3)2 CH3 CH2C6H5 O N O O N O O O O N O GE 23077 factors A1 (175), A2 (176), B1 (177), and B2 (178) are novel antibiotics isolated from fermentation broths of an Actinomadura sp. strain. GE23077 antibiotics are cyclic peptides, which as a complex, inhibited E. coli and B. subtilis RNA polymerase at concentrations of 0.02 μg ml−1 . An E. coli rifampicin-resistant RNA polymerase was also inhibited at similar concentrations (IC50 = 0.04 μg ml−1 ). The individual GE23077 factors (175–178) inhibited E. coli RNA polymerase, showing IC50 values of 0.15, 0.035, 0.1, and 0.02 μg ml−1 , respectively, whereas E. coli DNA polymerase was not inhibited even at high antibiotic concentrations (IC50 > 1000 μg ml−1 ) [122]. 247 248 9 Natural Products as Antimicrobial Agents – an Update OH H N O OH H2N HN O HO HN O OH O O O 175, 176: R = HN O H N N H HO OH HN O O 177, 178: R = O O HN R Tripropeptins (TPPs) A–E and Z (179–183 and 184) were purified from culture of Lysobacter sp; All the isolates exhibited potent antibacterial activities (MIC of 0.39–12.5 μg ml−1 ) against a wide range of pathogens. Particularly, TPP C (181) and TPP D (182) showed excellent activities against Gram-positive bacteria including both MRSA and vancomycin-resistant Enterococcus (VRE) [123]. The antimicrobial activities of these TPPs is correlated with the length of fatty acyl side chains, indicating that the longer the side chain the more active the TPP. The antimicrobial activities of TPPC (181), TPPD (182), and TPPE (183) against clinically isolated S. aureus strains, both methicillin-susceptible Staphylococcus aureus (MSSA) and MRSA, were favorable compared with the currently available antimicrobial agents such as vancomycin, meropenem, and so on. Although antimicrobial activity of TPPs (179–184) is correlated with the length of the fatty acyl side chain, it was proved that the acyl side chain plays an important role in antimicrobial activities not only of TPPs (179–184) but also of other lipopeptides, such as echinocandin micafungin group [124], daptomycin group (LY146032 and A21978Cs) [125], polymyxins, and octapeptins [126]. Comparison of antimicrobial activities between TPPs (179–184) and the TPP-like lipopeptides [127, 128] suggested that the C-13 fatty acyl chain seems to be the best one for antimicrobial activity [129]. OH O NH H2N N H N NH H O O H 180: R = (CH2)8CH(CH3)CH3 NH O R O NH O HO HO2C 179: R = (CH2)7CH(CH3)CH3 N H N O HO O O H N O 182: R = (CH2)10CH(CH3)CH3 OH N H OH 181: R = (CH2)9CH(CH3)CH3 CO2H 183: R = (CH2)11CH(CH3)CH3 184: R = (CH2)6CH(CH3)CH3 Hassallidin B (185), a member of a broad-spectrum antifungal class of compounds, was isolated from cyanobacterium Hassallia sp. [130]. Hassallidin A (186) [131] is the first identified member and compound 185 is the second member of this class. Antifungal tests against 10 species of Candida showed that the MICs of 185 were similar to those of 186, ranging from 8.0 to 16.0 μg ml−1 , and the given data in the literature suggested that 185 does not result in a different 9.12 Antimicrobial Polyketides mode of action compared to hassallidin A (186). The additional carbohydrate moiety does not play a decisive role in the antifungal mode of action. However, owing to the additional hydrophilic unit, hassallidin B (185) showed better water solubility. Within the drug design feature, the biosynthetic modification could be important for improved bioavailability through enhanced water solubility, keeping the broad spectrum of antifungal activity. So, hassallidin B (185) can be regarded as an excellent source for the development of new antifungal drugs. OH HO HO H N HN O O O N H O O H2N O HO H N N O OH O HO O N H O O O NH OH O NH2 HN O O OH O HO HO O HO HO HO H N 185 H N O O HO H N O N H O O O O N H O NH N H O N OO CH2OH O OH NH2 HN O H2N OH O O 186 OH HO HO 9.12 Antimicrobial Polyketides Polyketides are a group of secondary metabolites, exhibiting remarkable diversity in terms of both their structure and function. Polyketide natural products are known to possess a wealth of pharmacologically important activities, including antimicrobial properties. A wide range of biological activities associated with polyketides makes them economically, clinically, and industrially the most sought after molecules. The importance of this class of natural products is also reflected by the presence of several molecules of this class in current pharmaceutical market. For example, erythromycin A, a broad-spectrum antibiotic, rapamycin, rifamycin, lovastatin, and many oxytetracyclines are a few more of the thousands of polyketides discovered so far [132]. 249 250 9 Natural Products as Antimicrobial Agents – an Update OH O O OMe NMe2 O OH HO HO O OH O O O O O N O HO O OH OMe Erythromycin A (antibacterial) O O O MeO O OH OH O OMe O OH OH OH O NH O O Rapamycin (immunosuppressant) O O O Rifamycin B (antituberculosis) O HO O O O H Lovastatin (anticholesterol) Owing to the biosynthetic modes in different organisms, polyketides are divided into several subclasses, of which the most common are macrolides, quninones, and tetracylines. 9.12.1 Antimicrobial Polyketides as Macrolides Since the discovery of erythromycin, macrolides have been an important class of antibiotics. The term macrolide is used to describe drugs with a macrocyclic lactone ring of 12 or more carbons [133]. This class of natural products includes a variety of bioactive agents, including antibiotics, antifungal drugs, prokinetics, and immunosuppressants. Owing to their excellent tissue penetration ability, 14-, 15-, and 16-membered macrolides are a widely used family of antibiotics. This class of natural antibiotics has proved effective against Gram-positive cocci and atypical pathogens [134]. Macrolides are best known as the bacterial constituents as a number of these compounds have been identified from bacterial sources and evaluated for their activities [135]. Two 10-membered macrolides, phomolides A (187) and B (188), were purified from the culture of Phomopsis sp. hzla01-1. Their structures were identified with the help of 1D and 2D NMR spectroscopic analyses. Compounds 187 and 188 showed significant antimicrobial activities against E. coli CMCC44103, C. albicans AS2.538, and S. cerevisiae ATCC9763 with MICs of 5–10 μg ml−1 . On the other hand, these compounds showed significant cytotoxicity against the HeLa cell line at 10 μg ml−1 [136]. A relatively larger macrolide, the 24-membered ring lactone macrolactin N (189), was isolated 9.12 Antimicrobial Polyketides 251 from a culture broth of B. subtilis. Macrolactin N (189) inhibited S. aureus peptide deformylase with an IC50 value of 7.5 μM [137]. Another cytotoxic tetraene macrolide CE-108 (190), produced by Streptomyces diastaticus 108, was tested for its antimicrobial potential. The macrolide tetraene CE-108 (190) exhibited potent antimicrobial properties against C. albicans (MIC = 32 μg ml−1 ), Candida krusei (MIC = 32 μg ml−1 ), C. neoformans (MIC = 16 μg ml−1 ), A. niger (MIC = 8 μg ml−1 ), Aspergillus candidus (MIC = 8 μg ml−1 ), F. oxysporum (MIC = 8 μg ml−1 ), Microsporum canis (MIC = 16 μg ml−1 ), Microsporum gypseum (MIC = 8 μg ml−1 ), T. mentagrophytes (MIC = 8 μg ml−1 ), T. rubrum (MIC = 16 μg ml−1 ), and Trichophyton tonsurans (MIC = 16 μg ml−1 ). This compound can be a good candidate to develop a broad-spectrum antifungal drug [138]. OH O O HO O O O O OH HO O HO O O 187 188 O O OH O O O OH NH2 OH 189 Novel tartrolons 191 and 192 produced by symbiotic cellulose-degrading bacteria in shipworm gills inhibited B. subtilis in disc diffusion assays. The novel boronated tartrolons 192 exhibited significant antibacterial activity against P. aeruginosa (MIC = 0.31 μg ml−1 ) in addition to methicillin-sensitive and MRSA (MIC = 0.08–1.0 μg ml−1 ). Compound 192 also killed the marine organism V. anguillarum. The MIC value of compound 192 against B. subtilis was determined to be 1.0 μg ml−1 [139]. OH O O O OH O OH HO HO O O OH O O O O O 191 O O B O Na O + O O O OH O OH 192 O OH O 190 252 9 Natural Products as Antimicrobial Agents – an Update 9.12.2 Antimicrobial Polyketides as Quinones and Xanthones The natural sources containing quinones as their chemical constituents afford many biological activities including antimicrobial properties. A survey of the literature revealed that natural quinones and xanthones are well known for their bactericidal properties [140, 141] and are discovered from plant as well as microbial sources. Xanthones are a unique class of phytochemicals and are related to phytoalexins bearing MRSA inhibitory properties. Their biological evaluation revealed that these compounds have less side effects and low tendency to acquire resistance compared with conventional antibiotics and synthetic antibacterial agents [142]. 9.12.2.1 Antimicrobial Quinones and Xanthones from Plants Chromatographic purification of a methanolic extract from the root bark of Newbouldia laevis yielded chrysoeriol (193), which offered broad-spectrum in vitro antimicrobial activity against 4 Gram-positive and 10 Gram-negative bacterial species as well as 3 Candida species, and the observed MIC values varied from 1.2 to 9.76 μg ml−1 [143]. The same plant also contains 2-acetylfuro-1,4-naphthoquinone (194), 2-hydroxy-3-methoxy-9,10-dioxo-9,10dihydroanthracene-1-carbaldehyde (195), and lapachol (196). Compounds 194–196 also exhibited broad-spectrum in vitro antimicrobial activity against 6 Gram-positive and 12 Gram-negative bacterial species as well as Candida strains. The MIC values reported varied from 0.076 to 9.76 μg ml−1 [143]. All these compounds were purified by chromatographic techniques and were characterized by NMR methods and after further studies can be good leads for antimicrobial drug development. O O HO O OMe O O O O O O 193 194 OH OH O 195 CHO O 196 Kuete et al. [82] identified antimicrobial quinones (197–201) from the extract of Vismia laurentii De Wild. Quinones 197–201 are active against Gramnegative bacteria and two Candida species with different efficacy. Compound 197 inhibits the growth of S. faecalis and M. morganii (MIC = 4.8 μg ml−1 ), and P. aeruginosa and S. flexneri (MIC of 2.4 = μg ml−1 ); 198 showed an MIC of 4.8 μg ml−1 against M. morganii and S. faecalis, and 2.4 μg ml−1 against P. aeruginosa, S. flexneri, B. subtilis, C. albicans, and C. glabrata; 199 was only active against Gram-positive and fungal pathogens with an MIC of 2.4 μg ml−1 9.12 Antimicrobial Polyketides (B. megaterium, B. subtilis, and C. albicans, and C. glabrata). Compound 200 exhibited an MIC of 4.8 μg ml−1 against P. aeruginosa, S. flexneri, and B. subtilis and 9.7 μg ml−1 against M. morganii, whereas compound 201 was highly active against B. subtilis with an MIC value of 1.2 μg ml−1 . It further showed a significant growth inhibition (MIC = 4.8 μg ml−1 ) of Shigella dysenteriae, S. faecalis, and B. stearothermophilus, while exhibiting an MIC of 2.4 μg ml−1 against B. cereus. The same compound extended moderate activity (MIC = 19.5 μg ml−1 ) against M. morganii, P. vulgaris, and S. aureus. OH O OH OH O OMe OMe O O 198 197 OH O OH O OH OH O O 199 OH OH O OH OMe OMe OH O 200 OMe O OH 201 Omicron-naphthoquinone, 9-methyl-3-(4-methyl-3-pentenyl)-2,3-dihydronaphtho[1,8-bc]pyran-7,8-dione (202) is a constituent of Australian plant Eremophila serrulata and was isolated by silica gel column chromatography and characterized by 1 and 2D NMR techniques coupled with MS. Compound 202 has been reported as an antibacterial natural product that exhibited antimicrobial activity against S. aureus ATCC 25923 and Streptococcus pneumoniae ATCC 49619, and S. pyogenes ATCC 10389 with an MIC of 7.8 μg ml−1 [144]. O O O H 202 Diospyros lycioides, a plant commonly known as muthala, yielded bioactive quinone glycosides, diospyrosides A (203), B (204), C (205), and D (206) along with juglone (207) and 7-methyljuglone (208) and were evaluated as growth inhibitors of oral cariogenic bacteria (Streptococcus mutans and Streptococcus 253 254 9 Natural Products as Antimicrobial Agents – an Update sanguis) and periodontal pathogens (Porphyromonas gingivalis and Prevotella intermedia) at an MIC ranging from 0.019 to 1.25 mg ml−1 . Juglone (207) exhibited the strongest inhibitory activity (0.019–0.078 mg ml−1 ) among these compounds. This is in accordance with the fact that tannin-like compounds afford antibacterial activities [145]. O OH OH O O OH OH OH O β Glc β 6 Xyl β 4 Xyl 203 O O β Glc β 6 Xyl 204 O OH OH O β Glc β 6 Xyl 205 O O O HO Xyl β 6 Glc β O OH O OH O OH 206 207 208 3,4-Dihydroxy-1-methoxy-anthraquinone-2-carboxaldehyde (209) and damnacanthal (210) were identified from the aerial parts of Saprosma fragrans as antifungal compounds with MIC values of 12.5 μg ml−1 against T. mentagrophytes and 25 μg ml−1 against Sporothrix schenckii, 1.56 μg ml−1 against T. mentagrophytes and 6.25 μg ml−1 against S. schenckii, respectively [146]. The study of the chemical constituents of the roots of N. laevis (Bignoniaceae) resulted in the isolation and characterization of a naphthoquinone–anthraquinone coupled pigment named newbouldiaquinone A (211). Its antimicrobial activity against a wide range of microorganisms was 13- and 24-fold more potent than the standard antibiotics nystatin and gentamycin against C. glabrata and E. aerogenes. It exhibited very pronounced activities against Gram-negative bacteria with the MIC ranging between 0.31 and 9.76 μg ml−1 . Its antifungal activity was also important, with C. glabrata being the most sensitive yeast [147]. The above-discussed results revealed that both kinds of quinones exhibit antimicrobial properties with variable efficacy. The activity difference may lie in 9.12 Antimicrobial Polyketides the substituent present at various positions on the benzene ring and may also lie in the solubility difference. O O O OMe O OMe O O OH OH O O H H O O OH 209 HO 211 210 O O O HO O 212 7-Epiclusianone (212), identified from the antimicrobial extract of Rheedia brasiliensis fruit, showed high antibacterial activity at low concentrations (MIC, 1.25–2.5 μg ml−1 ) against S. mutans. This potential may lead to the use of 212 as a new agent to control S. mutans biofilms; however, more studies are needed to further elucidate the mechanisms of action [148]. Tetraoxygenated xanthones, mangostanin (213) and α-mangostin (214), were isolated from the fruits of Garcinia cowa. Compound 213 inhibited the growth of the penicillin-sensitive strain ATCC 25923 and methicillin-resistant strain MRSA SK1 S. aureus with MIC values of 4.0 μg ml−1 . Compound 214 was only moderately active against both strains of S. aureus with an MIC value of 8.0 μg ml−1 [149]. O O OH HO O 213 OH MeO MeO O HO O 214 OH 255 256 9 Natural Products as Antimicrobial Agents – an Update O O OH OH O HO O O OH OH OH 215 216 O O OH OH 217: R = O HO HO O O OH OH OH 218: R = R 219 Boonsri et al. [150] isolated formoxanthone A (215), formoxanthone C (216), macluraxanthone (217), xanthone V1 (218), and gerontoxanthone I (219) as potential antibiotics from the roots of Cratoxylum formosum. Compound 215 inhibited the growth of B. substilis (MIC = 18.7 μg ml−1 ) and S. aureus (MIC = 37.5 μg ml−1 ), whereas other compounds were more active against B. substilis (MIC = 4.6 μg ml−1 ), S. aureus (MIC = 2.3 and 4.6 μg ml−1 , respectively), S. faecalis (MIC = 18.7 and 2.3 μg ml−1 , respectively), and S. typhi (MIC = 4.6 and 9.3 μg ml−1 , respectively). However, all these compounds were also found to be cytotoxic; therefore, further studies are needed before considering these metabolites as drug candidates. Xanthones 220 and 221 have been reported from the extract of V. laurentii De Wild. Compound 220 showed potential inhibition of B. subtilis and C. glabrata with an MIC value of 1.2 μg ml−1 , whereas 221 was highly active against B. stearothermophilus and B. subtilis (MIC of 4.8 μg ml−1 ) [82]. O O OH O OH O O O OH OH HO OH 220 221 9.12.2.2 Antimicrobial Quinones from Bacteria Screening of microbial extracts using antisense-sensitized rpsD S. aureus strain led to the isolation of pleosporone (222), with modest antibacterial activities exhibiting an MIC ranging from 1.0 to 64.0 μg ml−1 . This compound showed the highest sensitivity for S. pneumoniae and Haemophilus influenzae, and exhibited MICs of 4.0 and 1.0 μg ml−1 , respectively. Pleosporone (222) showed greater inhibition of S. aureus RNA synthesis (IC50 = 1.3 μg ml−1 ) over DNA (IC50 = 8.4 μg ml−1 ) and protein synthesis (IC50 = 15.4 μg ml−1 ). These results 9.12 Antimicrobial Polyketides 257 suggest that this compound has another unknown mode of action in addition to the weak interaction with RPSD protein [151]. The antifungal substances produced by Streptomyces strain AcH 505 were identified as the antibiotics WS-5995 B (223) and C (224). WS-5995 B (223) completely blocked mycelial growth at a concentration of 60 μM and caused a cell stress-related gene expression response in Amanita muscaria. Characterization of these compounds provides the foundation for molecular analysis of the fungus–bacterium interaction in the ectomycorrhizal symbiosis between fly agaric and spruce [152]. The bacterial metabolites bisanthraquinone (225 and 225), isolated from streptomycete sp. associated with the tropical tunicate Ecteinascidia turbinata, potently inhibited the growth of MRSA (IC50 = 0.15 μM), but were >10-fold less effective against VREF (VRE, IC50 = 2.0 μM) [153] The structures of these compounds were elucidated by the combination of various spectroscopic techniques. Anthracycline antibiotics mutactimycin PR (226) and C (227) were isolated from a soil isolate Saccharothrix sp. These compounds showed an antibiotic activity against certain Gram-positive bacteria in vitro [154]. OH O OH O OH OH OH H3CO O OH O O O OH OH OH R CO2H HO OR O OH O O O OH HO OMe OH O O O 222 R 222: R = H 224: R = H 223: R = OH 225: R = OH O 226: R = HO OH OH 227: R = CH3 9.12.2.3 Antimicrobial Quinones and Xanthones from Fungi Polyketides 228–233 were isolated from the culture extract of a marine-derived fungus Nigrospora sp. MA75. These compounds were evaluated for their antibacterial activity and compound 233 exhibited the growth of MRSA, E. coli, P. aeruginosa, Pseudomonas fluorescens, and S. epidermidis with MIC values of 8.0, 4.0, 4.0, 0.5, and 0.5 μg ml−1 , respectively. The compound was rather more active than the standard antibiotic ampicillin. Compound 232 is also reported as a broad-spectrum antibiotic that strongly inhibited MRSA, E. coli, P. aeruginosa, and P. fluorescens with MIC values of 0.5, 2, 0.5, and 0.5 μg ml−1 , respectively. Compound 229 showed significant inhibition of MRSA and E. coli (MIC = 2.0 and 0.5 μg ml−1 , respectively), while its analog, 230, only showed activity against E. coli with an MIC value of 4.0 μg ml−1 . Structure–activity relationship analysis revealed that the OH group at C(4) might be important for the activity against 258 9 Natural Products as Antimicrobial Agents – an Update MRSA [155]. Compound 228 showed moderate activity against V. mali and Stemphylium solani, both with MIC values of 16 μg ml−1 . Griseofulvin (228) is an antifungal antibiotic and is used for the treatment of mycotic diseases of human, OH OMe O OMe MeO OH H OH O OH O O MeO OH O Cl H OH 229: R = OH 230: R = H 228 231 HO OH O OH O HO H MeO OH OMe OH O HO R O H O OH O 232 233 veterinary, and plant systems [156]. However, other members of the griseofulvin family have been reported to exhibit much weaker or no antifungal activities [157] suggesting that the activity of 228 is related to both its planar structure and spatial configuration. The endophytic fungus Microdiplodia sp. produced several xanthone derivatives (234–239). All these compounds possess weak antibacterial activity against Legionella pneumophila Corby, E. coli K12, and B. megaterium. In addition, compounds 235, 237, and 238 also exhibited antifungal activity against the fungus M. violaceum [158]. OH O R OH OH O OH 234: R = Me 235: R = CH2OH OH O OH H HO O O CO2Me OMe 237 OH O OH O OH 238 OH OH O O 236 OH O O O 239 O 9.12 Antimicrobial Polyketides An unidentified endophytic fungus of the Pleosporales group isolated from Anthillis vulneraria L. (Fabaceae) produced pleosporone (240) and phaeosphenone (241). The compounds were isolated by silica gel and Sephadex LH-20 chromatography followed by reversed-phase HPLC, and the structure was determined by NMR and MS means. In a two-plate whole-cell differential sensitivity screening assay using an antisense-sensitized S. aureus strain [159, 160], 240 exhibited significant sensitivity for S. pneumoniae and H. influenzae, and exhibited MICs of 4.0 and 1.0 μg ml−1 , respectively, and 8.0 and 16 μg ml−1 for B. subtilis and E. coli [151]. Compound 241 showed broad-spectrum antibacterial activity against Gram-positive bacteria, exhibiting MIC values ranging from 8 to 64 μg ml−1 . It showed the highest sensitivity for S. pneumoniae (MIC = 8 μg ml−1 ) and inhibited the growth of C. albicans with an MIC of 8.0 μg ml−1 , whereas 241 showed a modest selectivity for the inhibition of RNA synthesis over DNA and protein synthesis in S. aureus [161]. Ribosomal protein S4 (RPSD), a part of the ribosomal small subunit, is one of the proteins that is a part of the ribosomal machinery and is a potential new target for the discovery of antibacterial agents. Therefore, these compounds can also be a good lead to future antibacterial drug development. Another endophytic fungus Chloridium sp. produces a highly functionalized naphthoquinone, javanicin (242). This compound exhibits strong antibacterial activity against P. fluorescens, P. aeruginosa (MIC = 2.0 μg ml−1 ), R. solani, and Verticillium dahliae (MIC = 10 μg ml−1 ), and antifungal activity against Cercospora arachidicola (MIC = 5.0 μg ml−1 ) [162]. Li et al. [163] isolated a polyketide, asperflavin ribofuranoside (243), from the marine-derived fungus Microsporum. In an antibacterial evaluation assay, the isolate showed moderate activity against the MRSA and MDRSA with an MIC value of 50 μg ml−1 . Decaspirones A–E (244–248), related to the palmarumycins class of compounds, were isolated from cultures of the freshwater aquatic fungal species Decaisnella thyridioides. In a standard antibacterial disc assay, all the compounds 244–248 showed significant activity against B. subtilis (ATCC 6051) when tested at 50 μg/disc, showing inhibition zones of 39, 19, 34, 30, and 30 mm, respectively. Compounds 244, 246, and 247 were active against S. aureus (ATCC 29213), causing zones of inhibition of 41, 28, and 30 mm, respectively, at 100 μg/disc. Compounds 244, 247, and 248 also showed activity against C. albicans (ATCC 14053) at 100 μg/disk, affording inhibition zones of 30, 13, and 17 mm, respectively, while compounds 245 and 246 were inactive in this assay. Compounds 244 and 246 were evaluated for activity against A. flavus (NRRL 6541) and F. verticillioides (NRRL 25457). Assays at 200 μg/disk indicated that both of them have significant activity against A. flavus (inhibition zones of 20 and 15 mm, respectively) and F. verticillioides (inhibition zones of 20 and 26 mm, respectively). Upon further evaluation, compound 244 displayed MIC values of approximately 10 and 5 μg ml−1 against A. flavus and F. verticillioides, respectively [164]. 259 260 9 Natural Products as Antimicrobial Agents – an Update OH O OH O OH H OH OH HO O OH Me O O 241 O OMe OH O H OH 243: R = -D=ribofuranose O O O OH O 242 HO OR1 H RO OH MeO OH O 240 O OH O OR2 244: R1 = H, R2 = H 245: R1 = H, R2 = OAc 246: R1 = OAc, R2 = H OH OAc H O H H O 247 OH O H O OH OH 248 Chrysoqueen (249) and chrysolandol (250) were identified as metabolites from the culture broth of Chrysosporium queenslandicum. Both compounds are new members of the naphthoquinone-type altersolanol family of antibiotics, which are also known as products of fungi. Compounds 249 and 250 showed selective activity against Gram-positive bacteria such as M. luteus IFM 2066 (MIC = 33 μg ml−1 ) and B. subtilis bacterial strain passport (PCI) 219 (MIC = 33 μg ml−1 ) [165]. HO OH HO O OMe HO O O OH O O 249 HO OH OH HO OH O OH OMe 250 Protein synthesis is one of the best antibacterial targets that has led to the development of a number of highly successful clinical drugs. In addition to 9.12 Antimicrobial Polyketides providing a source of stable free radicals, quinones are known to complex irreversibly with nucleophilic amino acids in proteins [166], often leading to inactivation of the protein and loss of function. For that reason, the potential range of quinone antimicrobial effects is great. Probable targets in the microbial cell are surface-exposed adhesins, cell wall polypeptides, and membrane-bound enzymes. Quinones may also render substrates unavailable to the microorganism. The above-discussed results revealed that quinones exhibit antimicrobial properties with variable efficacy. The difference may lie in the substituent present at various positions on the benzene ring and also in the solubility differences. 9.12.3 Antimicrobial Fatty Acids and Other polyketides Fatty acids are biosynthetically derived through the polyketide biosynthetic pathway and several are known to possess antimicrobial activity. A survey of the literature reveals that unsaturated and hydroxy fatty acids show better antibacterial activities [167]. Marine Bacillus sp., culture yielded unsaturated fatty acids or esters: ieodomycins A–D (251–254), which exhibited antimicrobial activities against B. subtilis (KCTC 1021), E. coli (KCTC 1923), and S. cerevisiae (KCTC 7913) OH OH OH O OMe O 251 252 OH OH O OH O OH OH 253 O 254 with MIC values of 32–64 μg ml−1 , except against the yeast S. cerevisiae, with an MIC of 256 μg ml−1 [168]. Despite extensive study on the mode of action of these compounds, the precise mechanism for the antimicrobial activity remains unclear; however, it is suggested that the antimicrobial activity of unsaturated fatty acids is related to the inhibition of bacterial fatty acid synthesis [169]. 261 262 9 Natural Products as Antimicrobial Agents – an Update Bicyclic lactones, glabramycins A–C (255–257), were discovered from a Neosartorya glabra strain using the antisense technique. Compound 257 inhibited the growth of S. aureus with an MIC value of 16 μg ml−1 and exhibited a similar inhibitory activity against B. subtilis, but showed low activity against E. faecalis (MIC = 432 μg ml−1 ). This compound exhibited potent activity against S. pneumoniae with an MIC value of 2.0 μg ml−1 . Glabramycins A (255) and B (256) showed weak activity against these tested organisms. All these compounds were identified as selective inhibitors as they were inactive against Gram-negative bacteria or fungi C. albicans. A study on the mode of action of these compounds revealed that these compounds may inhibit the synthesis of RNA [170]. O HO OH O O O O H O O O 256 OH H O O 255 OH H O OH O O H 257 Using the antisense technique, Singh et al. [171] discovered novel polyketidederived molecules lucensimycins A–G (258–263) from the culture extracts of Streptomyces lucensis. In an rpsD antisense two-plate assay, compound 260 inhibited the growth of S. aureus exhibiting a zone of clearance of 12 mm at a concentration of 0.5 μg ml−1 . Compound 258 and 261 also showed similar activity. All of the compounds were also tested for antibacterial activity in standard National Laboratory Standard Institute (NLSI) protocol. Lucensimycin E (261) potently inhibited the growth of S. aureus Smith strain with an MIC value of 32 μg ml−1 . Further, it showed better sensitivity for S. pneumoniae CL 2883 and killed the pathogen with an MIC value of 8.0 μg ml−1 . Lucensimycin D (260) did not inhibit S. aureus growth at 250 μg ml−1 in this assay. In addition, the investigators tested the activity of these compounds at higher concentrations on agar plates impregnated with S. aureus Ep167. In this assay, compounds 258, 262, and 263 showed better activities than 260 and 261, whereas compound 259 was the least active. 9.13 Antimicrobial Steroids 263 O HO O O O O H AcO O H O O O H OH H AcO O OH H 258 259 H OH H OH HN O O HO O O O O O O H AcO O O O H O OH H AcO 260 OH H OH OH HO HO OH O N H AcO O H N HN OH H O O O H O O OH H AcO H O O H S O OH OH H N O OH S OH O O OH OH O O O 261 HO HO O H OH H OH HO HO S H H S N H O O O OH H 263 H OH 262 H OH 9.13 Antimicrobial Steroids Steroids are an important class of secondary metabolites, exhibiting diverse biological activities. In addition to their role as hormones, they also showed other pharmaceutical functions including antimicrobial properties. For example, diethylstilbestrol exhibited a degree of bactericidal action on Gram-positive bacteria. Reiss [172, 173] reported the inhibitory effects of methyl testosterone and deoxycorticosterone on the growth of Trichophyton purpureum and Trichophyton 264 9 Natural Products as Antimicrobial Agents – an Update gypseum in cultures and a certain curative effect on experimental infection in castrated rabbits. 9.13.1 Antimicrobial Steroids from Plants The antibacterial 5′ ,7′ -dimethyl-6′ -hydroxy-3′ -phenyl-3α-amineβ-yne sitosterol (264) has been reported as a constituent of leaves of Datura metel Linn. Compound 264 weakly inhibited the growth of S. aureus, P. aeruginosa, P. mirabilis, S. typhi, B. subtilis, and K. pneumonia but could not inhibit E. coli with MIC values ranging between 12.5 and 25 mg ml−1 [174]. H N HO H O 264 Aginoside (265) and (25R)-5α-spirostan-3β,6β-diol-3-O-{β-D-glucopyranosyl(1 → 2)-O-[β-D-xylopyranosyl-(1 → 3)]-O-β-D-glucopyranosyl-(1 → 4)- β-D-galactopyranoside} (266) isolated from the flowers of Allium leucanthum exhibited antifungal activity against seven Candida strains with an MFC ranging from 6.25 to 12.5 μg ml−1 [175]. However, further studies are required to identify this compound as a potent anti-Candida drug. Another steroidal saponin CAY-1 (267) from Capsicum frutescens showed antifungal activity and is reported to be active against 16 different fungal strains, including Candida spp. and A. fumigatus with the MIC ranging from 4.0 to 16 μg ml−1 , and was especially active against C. neoformans exhibiting 90% inhibition at 1.0 μg ml−1 . No significant cytotoxicity was demonstrated when 267 was tested against 55 mammalian cell lines at up to 100 μg ml−1 . Importantly, CAY-1 (267) appears to act by disrupting the membrane integrity of fungal cells [176]. This nontoxic compound can be an important source for the development of antimicrobial agents. A common phytochemical β-sitosterol-3-O-β-D-glucopyranoside (268) affords broad-spectrum in vitro antimicrobial activity against three Gram-positive and nine Gram-negative bacterial species as well as three Candida species. The MIC values observed varied from 0.61 to 9.76 μg ml−1 [143]. The mechanism of action of steroids is not much clear; however, it is suggested that their antimicrobial properties might be due to their ability to disrupt membrane integrity. 9.13 OH O O OH O R2O HO O O O HO H R1 H O H OH OH H R1 H 265: OH β-D-Xyl 266: H β-D-Xyl H OH HO HO H OH OH HO O HO HO OH O H H OH O HO O OH OH OH OH O H O O O O O O H HO O R2 O HO HO 265 OH HO HO Antimicrobial Steroids OH 267 HO HO O OH O 268 Similarly to other steroidal saponins, tigogenin-3-O-β-D-xylopyranosyl (1 → 2)[β-D-xylopyranosyl (1 → 3)]-β-D-glucopyranosyl (1 → 4)-[α-L-rhamnopyranosyl (1 → 2)]-β-D-galactopyranoside (TTS-12, 269) and tigogenin-3-O-β-D-glucopyranosyl (1 → 2)-[β-D-xylopyranosyl (1 → 3)]-β-D-glucopyranosyl (1 → 4)-β-Dgalactopyranoside (TTS-15, 270) of Tribulus terrestris L. also showed in vivo activity against C. albicans with MIC80 of 10 and 2.3 μg ml−1 respectively. Both the compounds also inhibited C. neoformans with an MIC80 of 1.7 and 6.7 μg ml−1 respectively. Phase contrast microscopy and transmission electron microscopy revealed that these compounds kill the fungi by weakening the virulence of C. albicans and by destroying the cell membrane [177]. Other steroidal saponins atropurosides B (271) and F (272), and dioscin (273) from the rhizomes of Smilacina atropurpurea were found to be antimicrobial with fungicidal activity against C. albicans, C. glabrata, C. neoformans, and A. fumigatus with MFCs ≤20 μg ml−1 , while dioscin (273) was selectively active against C. albicans and C. glabrata (MFC ≤ 5.0 μg ml−1 ). Unlike other saponins, these compounds were also found to be cytotoxic, and it appears that the antifungal activity of these steroidal saponins correlates with their cytotoxicity against mammalian cells [178]. Some low polar sterols stigmast-5-ene-3-β-7-α-diol (274) and stigmast-5-ene3-β-7α, 20-𝛜-triol (275), which are also common steroids and are isolated from various plant sources, exhibited moderate antibacterial activities against E. coli (zone of inhibition 14.1 and 14.0 mm, respectively), S. aureus (zone of inhibition 266 9 Natural Products as Antimicrobial Agents – an Update 13.20 and 13.24 mm, respectively), and P. aeruginosa (zone of inhibition 13.4 and 14.0 mm, respectively) [179]. O O O OR O H HO H R1 H HO Glu HO O 271 = R Xyl(2-1)Rha, R1 = OH RO ^ 2 ^ 269: R = A D gal 4 A D glu A D xyl Gal O 3 2 ^ A L rha ^ A D xyl O H HO H H H HO ^ 4 270: R = A D gal ^ 2 A D glu A D glu 272: R = Gal, R1 = H 3 ^ A D xyl R2 O H O H H H H HO HO 274: R1 = H R1 OH R2 = H OH 273:R Glc[(2-1)Rha](4-1)Rha 275: R1 = R2 = OH 9.13.2 Steroids from Fungi Similarly to plants, a variety of fungi also produce steroids, but very few have been reported to possess antimicrobial activities. Ergokonin A (276) is a metabolite of an endophytic fungus from Trichoderma longibrachiatum, which has been reported to possess broad-spectrum antifungal activity against many Candida sp., S. cerevisiae and most of the filamentous fungi and the activity was comparable with that of amphotericin B [180]. It is notable that the above discussed steroidal saponins and compound 276 are active against Candida species, which may offer a wide area of research to the pharmacologists to study these compounds. 9.14 Antimicrobial Terpenoids HO2C HO O O S O O H OH O NH2 O 276 9.14 Antimicrobial Terpenoids Terpenoids are a class of secondary metabolites made of isoprene units, and essential oils are composed of a mixture of mono and sesquiterpenoids, in addition to other low molecular weight compounds. More than 60% of essential oil derivatives have been reported as inhibitors of fungi and bacteria [181]. These facts reveal the antimicrobial potential of this important class of compounds. 9.14.1 Antimicrobial Terpenoids from Plants Paeonia suffruticosa root bark furnished three monoterpene glycosides, 6-Oanillyoxypaeoniflorin (277), mudanpioside-H (278), and galloyl-oxypaeoniflorin (279), isolated from the root bark of P. suffruticosa showed moderate antibacterial activity with MIC values in the range of 100–500 μg ml−1 against 18 human and animal pathogens [182]. A sesquiterpene named xanthorrhizol (280), isolated from the Curcuma xanthorrhiza Roxb, has been identified as an antibacterial agent. The MIC values against B. cereus, Clostridium perfringens, Listeria monocytogenes, S. aureus, S. Typhimurium, and Vibrio parahaemolyticus are reported to be 8.0–16.0 μg ml−1 . Xanthorrhizol (280) maintained its antibacterial activity after thermal treatments (121 ∘ C, 15 min) under various pH ranges (pH 3.0, 7.0, and 11.0). These results strongly suggest that 280 confers strong antibacterial activity with thermal and pH stability, and can be effectively used as a natural preservative to prevent the growth of food-borne pathogens [183]. Three linear sesquiterpene lactones, anthecotulide (281), hydroxyanthecotulide (282), acetoxyanthecotulide (283), and taraxast-20(30)en-3β-ol (284), are known as the secondary metabolites of Anthemis auriculata. The in vitro activity of compounds 281–284 against E. coli, P. mirabilis, Agrobacterium tumefaciens, P. aeruginosa, Pseudomonas tolaasii, S. enteritidis, S. aureus, M. luteus, Sarcina lutea, and B. cereus with MIC values ranging between 29 and 202 μM has been reported [184]. 267 268 9 Natural Products as Antimicrobial Agents – an Update O HO R1 O HO O O O OH O O O OH O OH R2 OH O O OH 281 280 277: R1 = OMe, R2 = H 278: R1 = H, R2 = H 279: R1 = OH, R2 = OH O H OH H H O O H O O O 282 H OAc HO H 283 284 Eudesmanes carissone (285), dehydrocarissone (286), and carindone (287), obtained from the wood of Carissa lanceolata R.Br. (Apocynaceae), showed weak antibacterial activity against S. aureus, E. coli, and P. aeruginosa with an MIC of <0.5 mg ml−1 [185]. HO O O O OH OH 285 O 286 OH O O 287 The leaves and bark of Pleodendron costaricense produced cinnamodial (288) and cinnamosmolide (289), mukaadial (290), and a drimane-type sesquiterpene, parritadial (291). Antifungal evaluation tests revealed that 288 exhibited high activity against A. alternata (MIC = 3.9 μg ml−1 ), C. albicans azole-resistant strain D10, and Wangiella dermatitides (MIC = 15.6 μg ml−1 ). Compound 289 showed less potent antifungal activities than 288 but was more effective against the C. albicans azole-resistant strain CN1A (MIC = 23.4 μg ml−1 ) and Pseudallescheria boydii (MIC = 78.1 μg ml−1 ). A combination of the dialdehyde sesquiterpenes with dillapiol showed a synergistic antifungal effect with 288 and an additive effect with 290 and 291 [186]. Conventional chromatographic techniques and bioassay-guided fractionation of the extract of Vernonia colorata (Compositae) resulted in the isolation of sesquiterpene lactones – vernolide (292), 11β,13-dihydrovernolide (293), and 9.14 Antimicrobial Terpenoids 269 vernodalin (294). The isolates afforded moderate antibacterial activity with an MIC of 0.1 to 0.5 μg ml−1 against Gram-positive bacteria [187]. A group of cariogenic bacteria are responsible for dental caries, one of the main oral human diseases [188]. The organisms responsible such as Streptococcus and Lactobacillus species produce a biofilm on the tooth surface called dental plaque. S. mutans is considered one of the main cariogenic microorganisms, since it is responsible for the beginning of the caries process. Other aerobic bacteria such as E. faecalis, Lactobacillus casei, Streptococcus mitis, S. sanguinis, S. sobrinus, and Streptococcus salivarius are also important in the later formation of the dental biofilm [189]. To kill these pathogens, natural products have also been identified as potential candidates [189, 190]. For example, the activity of bafoudiosbulbins A (295) and B (296), isolated from the tubers of Dioscorea bulbifera L. var sativa, was compared with the potential of chloramphenicol and amoxicillin. Both the compounds moderately inhibit the growth of P. aeruginosa, S. typhi, Salmonella paratyphi A, and S. paratyphi [191]. HO H R1 O O R3 O O O O H 290: R1 = OH, R2 = OH, R3 = H OAc O 289 292 291: R1 = OH, R2 = OAc, R3 = OAc(β) O H O H O 294 O O HH O O CH3 295 H HO O OH O 293 H O H O H O O OH O O O O O O O OH O R2 288: R1 = OH, R2 = OAc, R3 = H O O O H H O O O O H O 296 The kaurane diterpenes, ent-kaur-16(17)-en-19-oic acid (297) isolated from Aspilia foliacea showed potent activities with MIC values of 10.0 μg ml−1 against oral pathogens S. sobrinus, S. mutans, S. mitis, S. sanguinis, and L. casei [190a, 192, 193]; therefore, compound 297 can be a lead to the development of anti-plaque drugs. Glycoside of 297, 18-β-L-3′ ,5′ -diacetoxyarabinofuranosyl-ent-kaur-16ene (298) isolated from Sagittaria pygmaea also inhibited the growth of oral pathogens, S. mutans ATCC 25 175 and Actinomyces viscosus ATCC 27 044, with an MIC value of 15.6 μg ml−1 [194]. (−)-Copalic acid (299) isolated from the resin of Copaifera langsddorffii was also reported to exhibit potent activity (MIC ranging between 2.0 and 6.0 μg ml−1 ) against the main microorganisms responsible for dental caries, S. salivarius, S. 270 9 Natural Products as Antimicrobial Agents – an Update sobrinus, S. mutans, S. mitis, S. sanguinis, and L. casei. However, other analogs of this compound were either weakly active or inactive [195]. The mechanism of action of these compounds has not yet been reported; however, Urzúa et al. [196] have suggested that these metabolites promote bacterial lysis and disruption of the cell membrane [196]. CO2H H CO2H 297 O 298 H O R R = 3′,5′-diacetoxyarabinofuranoyl 299 Other terpenoids of pimarane type-skeleton have also been reported to possess anti-plaque activity. For example, ent-pimara diterpenoids (300–302, 304) isolated from Viguiera arenaria Baker and the sodium salt of compound 300 (305) were evaluated in vitro against S. salivarius, S. sobrinus, S. mutans, S. mitis, S. sanguinis, and L. casei. All the compounds were potentially active, exhibiting MIC values ranging from 2 to 8 μg ml−1 [190b]. A labdane diterpenoid, 6α-malonyloxymanoyl oxide (306), isolated from the aerial parts of Stemodia foliosa, inhibited the growth of S. aureus, B. cereus, B. subtilis, M. smegmatis, and M. phlei with an MIC of 7.0–15.0 μg ml−1 [197]. The diterpenoid hardwickiic acid (307) obtained from the stem bark of I. gabonensis exhibited potent inhibition against five Gram-negative and four Gram-positive bacteria with the MIC values of 1.22–4.8 μg ml−1 , with the lowest reported against Neisseria gonorrhoeae [110]. O O H OH R2 H R1 300: R1 = CO2H, R2 = H 301: R1 = CH3, R2 = OH, 302: R1 = CH3, R2 = OCOCH3 303: R1 = CH2OH, R2 = OH 305: R1 = CO2Na, R2 = H H CH2OH H O O 304 O OH 306 CO2H 307 3,4-Epoxyclerodan-13E-en-15-oic acid (308), 5R,8R-(2-oxokolavenic acid) (309) and 3,4-dihydroxyclerodan-13Z-en-15-oic acid (310) were identified as the constituents of fruit pulp of Detarium microcarpum. Compound 309 slightly inhibited the growth of plant pathogenic fungus Cladosporium cucumerinum at 100 μg, while compounds 308 and 310 were moderate inhibitors at 10 μg [198]. The ent-clerodane-type diterpenoids, 311 and 312, were extracted from the 9.14 Antimicrobial Terpenoids 271 aerial parts of Pulicaria wightiana. Both the compounds moderately inhibit the growth of Gram-positive organisms B. subtilis, Bacillus sphaericus, and S. aureus. However, they were found to be less active against the Gram-negative organisms K. aerogenes and Chromobacterium violaceum, revealing their selectivity [199]. The ent-rosane diterpenoids, sagittines A–E (313–317), isolated from Sagittaria sagittifolia, were evaluated against S. mutans ATCC 25175 and Actinomyces naeslundii ATCC 12104 and were found active with MIC values between 62.5 and 125 μg ml−1 . Compound 317 was active against only A. naeslundii ATCC 12104, with an MIC value of 62.5 μg ml−1 [200]. O O OH H H OH O OH H O O 308 309 H HO HO 310 O X H H H ROH2C HOOC MeO O H H OH 311: X = O 312: X = H2 313 314: R = arabinofuranosyl 315: R = 5′-acetoxyarabinofuranosyl 316: R = 2′-acetoxyarabinofurnaosyl 317: R = 2′,5′-diacetoxyarabinofurnaosyl Wellsow et al. [201] investigated Plectranthus saccatus for its antimicrobial secondary metabolites and isolated coleon A (318) from Plectranthus puberulentus, and coleon U (319) and coleon U quinine (320) from lactone Plectranthus forsteri. These compounds were assayed for their antimicrobial activities and the results showed that compound 318 was moderately active against B. subtilis and Pseudomonas syringae. Compound 319 was found to be more potent against these two tested organisms with MICs of 3.13 and 6.25 μg ml−1 , respectively. Compound 320 exhibited moderate activity against the Gram-positive pathogen B. subtilis but it was more potent against the Gram-negative bacterium P. syringae. Ferruginol (321), 12-methoxy-6α,11-dihydroxyabieta-8,11,13-triene (322), cryptojaponol (323), 6α-hydroxysugiol (324), Sugiol (325), 7-hydroxy-11,14dioxo-8,12-abietadiene (326), isopimarol (327), and isopimaric acid (328) were obtained from the bark of Cryptomeria japonica. The antifungal activities of these diterpenes were evaluated against the phytopathogenic fungi A. alternata, P. oryzae, R. solani, and F. oxysporum. Compounds 321–328 showed moderate antifungal activity (4–85% inhibition at 100 μg/culture) [202]. Chiisanogenin (329) was isolated from the leaves of Acanthopanax senticosus as a broad 272 9 Natural Products as Antimicrobial Agents – an Update spectrum antibacterial drug. It showed moderate antibacterial activity against Gram-positive and Gram-negative bacteria, the MIC being in the range of 50–100 μg ml−1 [203]. HO O O OH O OH O O O OH O 318 R3 R2 OH OH H O OH OH 319 320 R1 321: R1 = H, R2 = H, R3 = OH 322: R1 = OH, R2 = OH, R3 = OMe R1 R1 O O H H O O R1 H 323: R1 = H, R2 = OH, R3 = OMe 324: R1 = OH, R2 = H, R3 = OH 325: R1 = H, R2 = H, R3 = OH H O R H HO COOH H OH 327: R = CH2OH 328: R = COOH 326 329 15-β-Isovaleryloxy-ent-kaur-16(17)-en-19-oic acid (330), along with 297, isolated from A. foliacea, showed activity against oral pathogens S. sobrinus, S. mutans, S. mitis, S. sanguinis, and L. casei with an MIC value of 100 μg ml−1 [190a]. The antibacterial activity of casbane diterpene (331), a macromonocyclic isolated from Croton nepetaefolius, showed antibacterial activity against Streptococcus oralis with an MIC value of 62.5 μg ml−1 , whereas this compound weakly inhibited the growth of S. mutans, S. salivarius, S. sobrinus, S. mitis, and S. sanguinis with MIC ranging between 125 and 500 μg ml−1 . These results revealed that compound 331 can also be a candidate for the development of a natural treatment against oral pathogens for dental biofilms [204]. H H OH O CO2H O H O H OH 330 331 Antimicrobial activities have also been described for pentacyclic triterpenes, such as oleananes, ursanes [205], friedelanes [206], and lupanes [207]. It is speculated that the mechanism of action of triterpenes is due to a disruption in the microorganism’s cellular membrane [205, 207]. 9.14 Antimicrobial Terpenoids 273 9.14.2 Antimicrobial Terpenoids from Microbial Sources Anti-plaque agents have not only been isolated from plants, but microbial sources are also utilized to get important anticariogenic. natural products. For example, ent-8(14),15-pimaradien-19-ol (332) was produced by fungal biotransformation. This compound displayed very promising antibiotic activity with MIC values (ranging from 1.5 to 4.0 μg ml−1 ) against S. salivarius, S. sobrinus, S. mutans, S. mitis, S. sanguinis, and L. casei [208]. However, other biotransformed products (333–335) were relatively less active, indicating the importance of the endocyclic double bond and alcoholic group in such skeleton. Other microbial-transformed products of the antibacterial diterpene sclareol (336), (6α)-6,18-dihydroxysclareol (337), (1β)-1-hydroxysclareol (338), and (12S)-12-hydroxysclareol (339) were found to exhibit increased antibacterial activities when compared with the precursor 336. Compound 338 was found to be more active against B. subtilis than sclareol proper (14- vs 12-mm inhibition zone, respectively). Compounds 337 and 339 were found to be approximately as active against B. subtilis as sclareol (336), with inhibition zones of 12 and 10 mm, respectively [209]. A fusidane triterpene, 16-deacetoxy-7-β-hydroxy-fusidic acid (340), was isolated from the culture of mitosporic fungus Acremonium crotocinigenum. This compound was tested against a panel of MDR and MRSA strains and showed MIC values of 16 μg ml−1 , which, although occasionally more active than erythromycin and norfloxacin, was significantly less potent than the fusidic acid comparator [210]. H HOH2C H CO2H H CO2H 332 333 O H CO2H 334 335 HO R2 HO HO R1 H HO H H H OH 338: R1 = OH, R2 = H 336 337 H HO OH OH OH H H 339: R1 = H, R2 = OH HO H OH 340 CO2H 274 9 Natural Products as Antimicrobial Agents – an Update Fridelin (341) is known as the constituent of V. laurentii De Wild and is reported to possess a broad-spectrum antimicrobial character against six Gram-negative, four Gram-positive, and two fungal strains with an MIC of 2.4–9.7 μg ml−1 [82]. Besides the above terpenoids, sordarins are another group of natural products that are distributed mostly across the filamentous fungi, and are also well known for their antimicrobial properties [211]. OH O O H OMe OH H OHC O 341 CO2H Sordarin 9.14.3 Antimicrobial Terpenoids from Marine Sources Laurencia majuscula Harvey collected from two locations in the waters of Sabah, Malaysia, produced two major halogenated compounds: elatol (342) and iso-obtusol (343). At a concentration of 30 μg/paper disk 342 inhibited six species of bacteria with significant antibacterial activities (zone of inhibition ranging from 7 to 30 mm) against S. epidermidis, K. pneumonia, and Salmonella sp., while 343 exhibited antibacterial activity against four bacterial species with significant activity (zone of inhibition ranging from 7 to 24 mm) against K. pneumonia and Salmonella sp. [212]. Compounds laurinterol acetate (344), laurinterol (345), debromolaurinterol acetate (346), and debromolaurinterol (347) isolated from the sea hare, Aplysia kurodai, exhibited antibacterial activity against S. aureus with the zone of inhibition between 7 and 16 mm at a concentration of 12.5–50 μg/paper disc [213]. Another diterpene, xeniolides I (348), isolated from the Kenyan soft coral Xenia novaebrittanniae, possesses antibacterial activity at a concentration of 1.25 μg ml−1 [214]. O HO HO Br Br R1 OR2 Br Cl Cl 342 343 344: R1 = Br: R2 = Ac 345: R1 = Br: R2 = H 346:R1 = H: R2 = Ac 347: R1 = R2 = H H O OH OH O O H 348 9.15 Miscellaneous Antimicrobial Compounds 9.15 Miscellaneous Antimicrobial Compounds 9.15.1 Miscellaneous Antimicrobial Natural Products from Plants Beilschmiedic acid derivatives (349–358) have been reported from the leaves of a Beilschmiedia gabonese. Compounds 350–357 have been reported to possess antibacterial activity against MRSA with MIC values in the range of 10–13 μg ml−1 . Despite their important antibacterial activities, these compounds may not be good antibiotic candidates for being cytotoxic in nature [215]. 349: R1 = α−OH, R2 = 350: R1 = β−OH, R2 = 351: R1 = H, R2 = OH H R1 352: R1 = α−OH, R2 = O H HO 353: R1 = α−OH, R2 = H H H H 354: R1 = α−OH, R2 = R2 355: R1 = α−OH, R2 = 356: R1 = α−OH, R2 = O O O 357: R1 = β−OH, R2 = 358: R1 = α−OH, R2 = Three antifungal compounds pseudodillapiol (359), eupomatenoid-6 (360), and conocarpan (361) were isolated from the aerial parts of Piper abutiloides. These compounds exhibited different potencies against the fungal species C. albicans, Candida parapsilosis, C. krusei, C. glabrata, C. tropicalis, C. neoformans, and S. schenckii with the strongest effect (0.3 μg/spot) being observed for compound 360 against C. glabrata. These compounds were further declared as non-cytotoxic in nature. 275 276 9 Natural Products as Antimicrobial Agents – an Update Icariside B6 (362) was purified from the leaves of Acer truncatum as an antiB. cereus and anti-M. luteus agent. At a concentration of 24 μg/disk in standard Petri-plate assays, the compound exhibited inhibitory zone sizes of 14 and 17 mm, respectively [216]. Sedanolide (363) obtained from Apium a graveolens seed was identified as the inhibitor of C. albicans and C. parapsilosis at a concentration of 100 μg ml−1 [217]. Botcinins B (364), D (365), and E (366), and 3-O-deacetyl-2epi-botcinin A (367) and botcinin E (368) isolated from B. cinerea were evaluated for their antifungal activities. Compounds 366, 367, and 368 showed weak antifungal activity, all with MICs of 100 μM, against Magnaporthe grisea. Botcinins B (364) and D (365) are reported to exhibit better activity (both with MIC 12.5 μM) [218]. O O O OMe O HO OMe HO 359 360 361 O O H R1 O HO O OH OH 362 R4 O R2 O HO O O O OR3 364: R1 = CH3, R2 = H, R3 = Ac, R4 = (CH2)2CH3 366: R1 = CH3, R2 = H, R3 = H, R4 = CH3 367: R1 = H, R2 = CH3, R3 = H, R4 = CH3 O 363 OH O O HO OH H O O O O HO O 365 O OH O 368 The cytotoxic compound aculeatin D (369) is reported as a minor constituent from the rhizomes of Amomum aculeatum, which showed remarkable activity against two Plasmodium falciparum (MIC of 0.42 μg ml−1 ) strains, as well as against Trypanosoma brucei rhodesiense (MIC of 0.20 μg ml−1 ) and Trypanosoma cruzi (MIC of 0.49 μg ml−1 ). In an antibacterial assay against B. cereus (MIC of 16 μg ml−1 ), E. coli (MIC of 16 μg ml−1 ), and S. epidermidis (MIC of 8 μg ml−1 ) the compound showed moderate to strong activity [219]. Carneic acids A (370) and B (371) were isolated as major constituents of the stromata of Hypoxylon carneum. Their chemical structures were elucidated by a combination of spectroscopic methods and by the preparation of derivatives. An X-ray crystal structure of the 9.15 Miscellaneous Antimicrobial Compounds 277 dinitrobenzoate of carneic acid B methyl ester (372) helped in the determination of its absolute structure. Carneic acids (370 and 371) showed activity against filamentous fungi Mucor hiemalis, Penicillium griseofulvum, Stachybotrys chartarum, and Trichoderma harzianum (MIC = 12.0–50 μg ml−1 ), and the yeast Yarrowia lipolytica (MIC = 25 μg ml−1 ). B. subtilis was about equally affected (MIC = 50 μg ml−1 ) by rubiginosin A (373), 1,1′ -binaphthalene-4,4′ -5,5′ -terol (BNT) (374) [220]. O COOR1 O 370: R1 = H; R2 = H; H OH O R2 * 372: R1 = Me; R2 = R3 = p-NO2-C6H4-COO- H OR3 10 369 R3 = H 371: R1 = H; R2 = OH; R3 = H HO HO OH HO OH O OH H OAc O HO O O 374 373 Two more cytotoxic compounds, 2,4-dihydroxy-6-[(10E,30E)-penta-10,30dienyl]-benzaldehyde (375) and periconicin B (376), were isolated from the leaves of Xylopia aromatica, a native plant of the Brazilian Cerrado. Both the compounds were evaluated against C. sphaerospermum and C. cladosporioides using direct bioautography and 375 exhibited strong antifungal activity against both fungi, showing a detection limit of 1.0 μg, comparable to nystatin (used as positive control). Compound 376 showed a relatively weak detection limit of 25.0 μg [221]. The phytochemical analysis of the aerial parts of Salsola tetrandra gave two moderate antimicrobial agents, taxiphyllin (377) and S-(−)trans-N-feruloyloctopamine (378), which displayed mild antibacterial activity (MIC = 200 μg ml−1 ) against S. aureus, whereas compound 377 showed the highest activity (MIC = 0.96 μM) in the Artemia salina bioassay [222]. O H O H HO H OH O 375 OH Glu O OMe CN OH H HO OH 376 377 HO OH H N O 378 278 9 Natural Products as Antimicrobial Agents – an Update The ethanolic extract of Trichodesma indicum (Linn.) comprises several fatty acids and their derivatives including n-decanyl laurate (379), n-tetradecanyl laurate (380), n-nonacosanyl palmitate (381), stigmast-5-en-3β-ol-21(24)-olide (382), n-pentacos-9-one (383), n-dotriacont-9-one-13-ene (384), stigmast-5-en3β-ol-23-one (385), and lanast-5-en-3β-D-glucopyranosyl-21-(24)-olide (386). Most of the fatty acids displayed inhibitory activity against S. aureus, B. subtilis, and C. albicans with varying MIC values (2.4–20.6 μg ml−1 ) [223]. Fatty acids have been identified to afford antimicrobial properties and a few are already in the market. O O O O 8 6 8 10 379 O O 25 381 380 O 12 12 4 O O 383 HO 4 14 382 O 384 O O O HO 385 HO 386 9.15.2 Miscellaneous Antimicrobials from Bacteria A non-proteinogenic amino acid L-furanomycin [2S,2′ R,5′ S)-2-amino-2(5′ methyl-2′ ,5′ -dihydrofuran-2′ -yl)acetic acid (387)] has been identified as the constituent of culture extract of P. fluorescens SBW25 [224]. Compound 387 has also been reported from the cultures of Streptomyces threomyceticus ATCC 15795 [225]. This compound potentially inhibited the growth of several bacterial strains, including a number of plant pathogenic microbes. 9.15 Miscellaneous Antimicrobial Compounds 279 H O O OH NH2 387 OMe O MeO OMe HO O O H H O O OMe R O O HO O O O O HO HN O MeO O H HO H O HO O H H O H O O HN O O O H OMe NH2 H O HO O H O HO 388: R = NH2 389: R = NO2 O O 390 Culture extracts of Actinomycetes strain, designated as MS100061 yielded lobophorins A (388), B (389), and G (390). These compounds inhibited the growth of Mycobacterium bovis bacillus calmette-guérin (BCG) with MIC values of 1.56, 1.56, and 0.78 μg ml−1 , respectively, and M. tuberculosis H37Rv with MIC values of 32, 32, and 16 μg ml−1 , respectively. Further, these compounds exhibited MIC values against B. subtilis as 3.12, 12.5, and 1.56 μg ml−1 , respectively. These compounds can be potential candidates for antibiotic development [226]. Synoxazolidinone A (391) and B (392), the constituents of Synoicum pulmonaria, displayed MIC values against the Gram-positive bacteria S. aureus and MRSA at a concentration of 10 μg ml−1 . Synoxazolidinone A (391) inhibited the growth of the Gram-positive bacterium Corynebacterium glutamicum with an MIC value of 12.5 μg ml−1 , whereas the growth of fungus S. cerevisiae was inhibited by an MIC value of 6.25 μg ml−1 . Compound 392 displayed relatively low potential (MIC of 30 μg ml−1 ) against MRSA. This lowered activity may suggest that the chlorine atom is important for biological activity [227]. 280 9 Natural Products as Antimicrobial Agents – an Update HN HN NH2 Cl H H O NH Br MeO Br O NH2 NH NH Br H O MeO NH Br O 392 391 9.15.3 Miscellaneous Antimicrobials from Fungi A derivative of benzofuran (393) was purified from the culture of Phomopsis sp. hzla01-1 and was characterized by 1D and 2D NMR spectroscopic analyses. Compounds 393 showed significant antimicrobial activities against E. coli CMCC44103, C. albicans AS2.538, and S. cerevisiae ATCC9763 with MICs of 5–10 μg ml−1 and showed the strongest activity against B. subtilis CMCC63501 with an MIC value of 1.25 μg ml−1 . None of the three compounds showed significant cytotoxicity against the HeLa cell line at 10 μg ml−1 [136]. O OH O 393 The compounds rotiorinols A (394), C (395), (−)-rotiorin (396), and rubrorotiorin (397) were isolated from the fungus Chaetomium cupreum CC3003. The absolute configuration of 394 was determined by the modified Mosher’s method along with an X-ray analysis of its acetate derivative, as well as by chemical transformation. Compounds 394–397 exhibited antifungal activity against C. albicans with IC50 values of 10.5, 16.7, 24.3, and 0.6 μg ml−1 , respectively [228]. O O O O O OH OH O O O OH 395 394 Cl O O O O O O O O 396 O O 397 9.15 Miscellaneous Antimicrobial Compounds Two cyclopentenones VM 4798-1a (398) and VM 4798-1b (399) were obtained as a 3 : 1 inseparable mixture from fermentations of Dasyscyphus sp. A47-98. The structures were elucidated by NMR techniques. The cytotoxic mixture of these two isomers showed weak antibacterial and antifungal properties with MIC of 50–100 μg ml−1 [229]. Cultures of the freshwater aquatic fungus Helicodendron giganteum afforded heliconols A (400), which contains an unusual reduced furanocyclopentane unit. The structure of this metabolite was assigned by analysis of 1D and 2D NMR data. The absolute configuration of heliconol A (400) was assigned by single-crystal Xray crystallographic analysis of its dibromobenzoate derivative. This compound inhibits the growth of A. flavus and F. verticillioides at 200 μg/disk affording a 15mm diameter zone of partial clearing after 48 h. Heliconol A (400) also exhibited activity against C. albicans, S. aureus, and B. subtilis with clear inhibition zones measuring 18, 23, and 35 mm diameter, respectively, after 48 h at 100 μg/paper disc [230]. Ascopyrone P (401), the secondary metabolite of the fungi Anthracobia melaloma, Plicaria anthracina, Plicaria Leiocarpa, and Peziza petersi, was evaluated for its antibacterial properties. At a level of 2000 mg l−1 , 401 demonstrated growth inhibitory activity against a broad range of Gram-positive and Gram-negative bacteria. This study suggests its possible application in food preservation, to control the growth of Gram-negative and Gram-positive bacteria in raw and cooked foods [231]. Phenylacetic acid (402) and sodium phenylacetate (403) were isolated from Streptomyces humidus strain S5-55. Both the compounds completely inhibited the growth of Pythium ultimum, Phytophthora capsici, R. solani, S. cerevisiae, and P. syringae pv. syringae at concentrations ranging between 10 and 50 μg ml−1 . The two compounds were as effective as the commercial fungicide metalaxyl in inhibiting spore germination and hyphal growth of P. capsici [232]. Lavermicocca et al. [233] also obtained compound 402 from Sourdough Lactobacillus plantarum Strain 21B and found it to be active against A. niger, A. flavus, Eurotium rubrum, Eurotium repens, Endomyces fibuliger, Penicillium corylophilum, Penicillium roqueforti, and Monilia sitophila at a concentration of 50 mg ml−1 . O O CO2Me OH Cl HO HO Cl Cl 398 Cl CO2Me OH OH O OH 400 399 O ONa OH HO O 401 O O OH 402 403 281 282 9 Natural Products as Antimicrobial Agents – an Update 9.16 Platensimycin Family as Antibacterial Natural Products Platensimycin (404) is a novel broad-spectrum Gram-positive antibacterial natural product isolated from the cultures of Streptomyces platensis [234]. This unique substance was discovered by target-based whole-cell screening strategy using antisense differential sensitivity assay and was purified using Amberchrome, Sephadex LH-20, and reversed-phase HPLC. The structure was elucidated by 2D NMR methods and confirmed by X-ray crystallographic analysis of a bromo derivative. It inhibits the growth of bacterial pathogens S. aureus and E. coli. It is the molecule of interest because of its modern mode of action. It inhibits bacterial growth by selectively inhibiting the condensing enzyme FabF of the fatty acid synthesis pathway, with IC50 values of 48 and 160 nM. This compound inhibits phospholipid synthesis (IC50 = 0.1 μg ml−1 ) and exhibits MIC values of 0.1–1 μg ml−1 against MRSA. Mechanistically, a novel mode of action that involves specific binding with the acyl enzyme intermediate of the key condensing enzyme FabF is involved in its activity. Therefore, because of its unique mode of action, it can be a potential candidate for antibacterial drug development [235]. After the discovery of platencimycin (404), a variety of its analogs have been isolated or synthesized to develop new antibiotics [234]. Platencin (405), isoplatensimycin (406), platensimycin A1 (407) and its methyl ester (408), and platensimycin B1 –B3 (409–411) are discovered from bacterial sources possessing antibiotic properties. These antibiotics attract much attention because of their novel mode of action against MDR bacterial strains. Not only the naturally occurring molecules but also their synthetic analogs, such as carbaplatensimycin (412), adamantaplatensimycins (413), oxazinidinyl platensimycin (414), platencin A1 (415), (−)-nor-platencin (416), homoplatensimide (417), and platensimide, are under study [234]. It is concluded that hundreds of natural products isolated from various natural sources belonging to several classes of secondary metabolites exhibit antimicrobial properties. A yearwise review of the literature revealed that little work has been done on antimicrobial natural products; however, it is increasing day by day. Although substantial work has been published during this decade, it still seems insufficient because of the rapid appearance of antibiotic-resistant strains. In the past, most of the antimicrobials were derived from microorganisms; still microorganisms together with plants can be good sources of new antimicrobials [236]. Compounds of different classes have been observed to exhibit variable antimicrobial activities such as the polypeptides that have been identified as potential antimicrobial agents. Quinones are the other group of secondary metabolites affording potential activities. The reason may lie in the fact that besides providing a source of stable free radicals, quinones are known to complex irreversibly with nucleophilic amino acids in proteins, resulting in loss of protein function [166]. For that reason, the potential range of quinone antimicrobial effects is great. 9.16 OH O HO2C OH Platensimycin Family as Antibacterial Natural Products OH O O N H HO2C OH O N H O 404 RO 405 OH O O H2N O OH O OH OH O HO OH O O O N H O HN O 409 OH O O HO N OH H O OH 410 OH O O H2N N H O N H O O 407: = R = H 408: = R = Me CO2H 406 OH O N H OH H N O O O OH O 283 O OH N N H OH O O O HO2C OH HO N H O O 411 412 H N 413 414 OH CO2H O O O HO2C H2N O O HO HO2C O N H N H O N H O O 415 416 417 O O 284 9 Natural Products as Antimicrobial Agents – an Update On the other hand, the possible toxic effects of quinones obtained from natural sources must be thoroughly examined before bringing the new isolates into practice. Terpenoids is another group of natural products that is identified as a candidate for antimicrobial drug development. Besides the above three groups, some diverse and unusual structures isolated from natural sources may also be the future potential candidates. For example, platensimycin (404) was identified from S. platensis as a novel broad-spectrum Gram-positive antibiotic. These facts and figures demand that maximum natural sources be explored using advanced and sophisticated techniques for purification and characterization. The use of modern techniques in future may result in the isolation of more potential antimicrobial drug candidates. References 1. Soejarto, D.D. and Farnsworth, N.R. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. (1989) Perspect. Biol. Med., 32, 244–256. Li, J.W.H. and Vederas, J.C. (2009) Science, 325, 161–165. Koehn, F.E. and Carter, G.T. (2005) Nat. Rev. Drug Discovery, 4, 206–220. Mishra, B.B. and Tiwari, V.K. (2011) Eur. J. Med. Chem., 46, 4769–4807. Hamilton-Miller, J.M.T. (2008) Int. J. Antimicrob. Agents, 31, 189–192. Butler, M.S. (2008) Nat. Prod. Rep., 25, 475–516. (a) Kobayashi, R., Konomi, M., Hasegawa, K., Morozumi, M., Sunakawa, K., and Ubukata, K. (2005) Antimicrob. Agents Chemother., 49, 889–894; (b) Thomson, K.S. and Moland, E.S. (2004) J. Antimicrob. Chemother., 54, 557–562. Khosla, C. (2010) J. Biol. Chem., 285, 27499–27531. Behal, V. (2001) Folia Microbiol., 46, 363–370. Omulokoli, E.B.K. and Chhabra, S.C. (1997) J. Ethnopharmacol., 56, 133–137. Al-Rehaily, A.J., Ahmad, M.S., Mustafa, J., Al-Oqail, M.M., Hassan, W.H., Khan, S.I., and Khan, I.A. (2013) J. Saudi Chem. Soc., 17, 67–76. Martin, F., Grkovic, T., Sykes, M.L., Shelper, T., Avery, V.M., Camp, D., Quinn, R.J., and Davis, R.A. (2011) J. Nat. Prod., 74, 2425–2430. 13. Zuo, G.Y., Meng, F.Y., 14. 15. 16. 17. 18. 19. 20. 21. 22. Hao, X.Y., Zhang, Y.L., Wang, G.C., and Xu, G.L. (2008) J. Pharm. Pharm. Sci., 11, 90–94. Ileana, I.R., Abimael, D.R., Yuehong, W., and Scott, F.G. (2006) Tetrahedron Lett., 47, 3229–3232. Pitayya, T., Photchana, P., Yupa, P., and Walter, C.T. (2006) Chem. Pharm. Bull., 54, 149–151. Asolkar, R.N., Schroder, D., Heckmann, R., Lang, S., Wagner-Dobler, I., and Laatsch, H. (2004) J. Antibiot., 57, 17–23. Oliva, O.A., Kumudini, M.M., David, E.W., Dewayne, H., Amber, L.H., Giovanni, A., and Stephen, O.D. (2003) J. Agric. Food Chem., 51, 890–896. O’Donnell, G. and Gibbons, S. (2007) Phytother. Res., 21, 653–657. Céline, T., Jean-Charles, G., Philippe, D., Christophe, F., Reynald, H., Maria-Elena, F., Antonieta, R.A., and Alain, F. (2003) Phytother. Res., 17, 678–680. Anjum, A., Ekramul Haque, M., Mukhlesur Rahman, M., and Sarker, S.D. (2002) Fitoterapia, 73, 526–528. Preetha, R., Jose, S., Prathapan, S., Vijayan, K.K., Jayaprakash, N.S., Philip, R., and Singh, I.S.B. (2010) Aquacult. Res., 41, 1452–1461. Sato, A., Takahashi, S., Ogita, T., Sugano, M., and Kodama, K. (1995) Annu. Rep. Sankyo Res. Lab., 47, 1–58. References 23. Turner, J.M. and Messenger, A.J. (1986) 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. Adv. Microb. Physiol., 27, 211–275. Kerr, J.R. (2000) Infect. Dis. Rev., 2, 184–194. (a) Maul, C., Sattler, I., Zerlin, M., Hinze, C., Koch, C., Maier, A., Grabley, S., and Thierick, R. (1999) J. Antibiot., 52, 1124–1134; (b) Yagishita, K. (1960) J. Antibiot., Ser. A, 13, 83. Giddens, S.R., Feng, Y., and Mahanty, H.K. (2002) Mol. Microbiol., 45, 769–783. Giddens, S.R. and Bean, D.C. (2007) Int. J. Antimicrob. Agents, 29, 93–97. Shibazaki, M., Taniguchi, M., Yokoi, T., Nagai, K., Watanabe, M., Suzuki, K., and Yamamoto, T. (2004) J. Antibiot., 57, 379–382. Kunze, B., Jansen, R., Hofle, G., and Reichenbach, H.A. (2004) J. Antibiot., 57, 151–155. Zheng, C., Kim, C.-J., Bae, K.S., Kim, Y.-H., and Kim, W.-G. (2006) J. Nat. Prod., 69, 1816–1819. Takahashi, C., Numata, A., Ito, Y., Matsumura, E., Araki, H., Iwaki, H., and Kushida, K. (1994) J. Chem. Soc., Perkin Trans. 1, 1859–1864. Dong, J.-Y., He, H.-P., Shen, Y.-M., and Zhang, K.-Q. (2005) J. Nat. Prod., 68, 1510–1513. Joshi, B.K., Gloer, J.B., and Wicklow, D.T. (1999) J. Nat. Prod., 62, 730–733. Yamada, T., Iwamoto, C., Yamagaki, N., Yamanouchi, T., Minoura, K., Yamori, T., Uehara, Y., Andoh, T., Umemura, K., and Numata, A. (2002) Tetrahedron, 58, 479–487. Proksch, P., Edrada, R.A., and Ebel, R. (2002) Appl. Microbiol. Biotechnol., 59 (2-3), 125–134. Kossuga, M.H., Lira, S.P., McHugh, S., Torres, Y.R., Lima, B.A., Gonçalves, R., Veloso, K., Ferreira, A.G., Rocha, R.M., and Berlinck, R.G.S. (2009) J. Braz. Chem. Soc., 20, 704–711. Al-Zereini, W., Yao, C.B.F.F., Laatsch, H., and Anke, H. (2010) J. Antibiot., 63, 297–301. Gershon, H. and Shanks, L. (1978) Can. J. Microbiol., 24, 593–597. 39. Jurenka, S.J. (2002) Altern. Med. Rev., 7, 68–70. 40. Li, X.C., Jacob, M.R., Khan, S.I., 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. Ashfaq, M.K., Babu, K.S., Agarwal, A.K., Elsohly, H.N., Manly, S.P., and Clark, A.M. (2008) Antimicrob. Agents Chemother., 52, 2442–2448. Ondeyka, J.G., Zink, D.L., Young, K., Painter, R., Kodali, S., Galgoci, A., Collado, J., Tormo, J.R., Basilio, A., Vicente, F., Wang, J., and Singh, S.B. (2006) J. Nat. Prod., 69, 377–380. Kim, H.-J., Vinale, F., Ghisalberti, E.L., Worth, C.M., Sivasithamparam, K., Skelton, B.W., and White, A.H. (2006) Phytochemistry, 67, 2277–2280. Demizu, S., Kajiyama, K., Takahashi, K., Hiraga, Y., Yamamoto, S., Tamura, Y., Okada, K., and Kinoshita, T. (1988) Chem. Pharm. Bull., 36, 3474–3479. Basson, N.J. and Grobler, S.R. (2008) BMC Complement. Altern. Med., 8, 41. Hu, J.-F., Garo, E., Hough, G.W., Goering, M.G., O’Neil-Johnson, M., and Eldridge, G.R. (2006) J. Nat. Prod., 69, 585–590. Ren, Q., Siau, W.-Y., Du, Z., Zhang, K., and Wang, J. (2011) Chem. Eur. J., 17, 7781–7785. Chetan, B.S., Nimesh, M.S., Manish, P.P., and Ranjan, G.P. (2012) J. Serb. Chem. Soc., 77, 1–17. Suresh, T., Arunima, V., Atin, K., Sandeep, G., Prarthana, V.R., and Ganesh, R.K. (2010) Acta Pol. Pharm., 67, 423–427. Khafagy, M.M., El-Wahas, A.H.F.A., Eid, F.A., and El-Agrody, A.M. (2002) Farmaco, 57, 715–722. Nicolaou, K.C., Pfefferkorn, J.A., Roecker, A.J., Cao, G.Q., Barluenga, S., and Mitchell, H.J. (2000) J. Am. Chem. Soc., 122, 9939–9953. (a) Thomas, N. and Zachariah, S.M. (2013) Asian J. Pharm. Clin. Res., 6, 11–15; (b) Willem, A.L., Lindani, N.E., Samuel, K., Garreth, L.M., Simon, S.M., and Charles, B.K. (2005) Tetrahedron, 61, 9996–10006; (c) Hester, L.V., Wei, Z., Tore, H., Floris, P.J.T., and Karl, A.J. (2003) Org. Biomol. Chem., 1, 1953–1958; (d) Charles, D.H., Babajide, O.O., Donna, V.E., David, M., 285 286 9 Natural Products as Antimicrobial Agents – an Update 52. 53. 54. 55. 56. 57. 58. 59. 60. 61. 62. 63. and Jon, C. (1980) J. Am. Chem. Soc., 102, 7365–7367; (e) Victorine, F., Augustin, E.N., Tanee, F., Beibam, L.S., and Bernard, B. (1998) J. Nat. Prod., 61, 380–383; (f ) Jean, W., Tanee, F.Z., François, T., Francine, L., and Michel, K. (1995) J. Nat. Prod., 58, 105–108; (g) Turner, C.E. and Elsohly, M.A. (1981) J. Clin. Pharmacol., 21, 283–291. Kitamura, R.O.S., Romo, P., Young, M.C.M., Kato, M.J., and Lago, J.H.G. (2006) Phytochemistry, 67, 2398–2402. Aoyama, Y., Katayama, T., Yamamoto, M., Tanaka, H., and Kon, K. (1992) J. Antibiot., 45, 875–878. Iranshahi, M., Askari, M., Sahebkar, A., and Hadjipavlou-Litina, D. (2009) DARU J. Pharm. Sci., 17, 99–103. Braccio, M.D., Grossi, G., Roma, G., Signorello, M.G., and Leoncini, G. (2004) Eur. J. Med. Chem., 39, 397–409. Curini, M., Epifano, F., Maltese, F., Marcotullio, M.C., Tubaro, A., Altinier, G., Gonzales, S.P., and Rodriguez, J. (2004) Bioorg. Med. Chem. Lett., 14, 2241–2243. Ito, C., Itoigawa, M., Furukuda, H., Tokuda, H., Okuda, Y., Mukainaka, T., Okuda, M., and Nishino, H. (1999) Cancer Lett., 138, 87–92. Chakthong, S., Weaaryee, P., Puangphet, P., Mahabusarakam, W., Plodpai, P., Voravuthikunchai, S.P., and Kanjana-Opas, A. (2012) Phytochemistry, 75, 108–113. Widelski, J., Popova, M., Graikou, K., Glowniak, K., and Chinou, I. (2009) Molecules, 14, 2729–2734. Schinkovitz, A., Gibbons, S., Stavri, M., Cocksedge, M.J., Bucar, F., and Ostruthin, F. (2003) Planta Med., 69, 369–371. Rosselli, S., Maggio, A., Bellone, G., Formisano, C., Basile, A., Cicala, C., Alfieri, A., Mascolo, N., and Bruno, M. (2007) Planta Med., 72, 116–120. Stavri, M. and Gibbons, S. (2005) Phytother. Res., 19, 938–941. Basile, A., Sorbo, S., Spadaro, V., Bruno, M., Maggio, A., Faraone, N., 64. 65. 66. 67. 68. 69. 70. 71. 72. 73. 74. 75. 76. and Rosselli, S. (2009) Molecules, 14, 939–952. Zarrilli, R., Ricci, V., and Romano, M. (1999) Cell Microbiol., 1, 93–99. Carpinella, M.C., Ferrayoli, C.G., and Palacios, S.M. (2005) J. Agric. Food Chem., 53, 2922–2927. Spedes, C.E., Avila, J.G., Martýńez, A.S., Serrato, B., Mugica, J.C.C.N., and Garciglia, R.S. (2006) J. Agric. Food Chem., 54, 3521–3527. Khatune, N.A., Islam, M.E., Haque, M.E., Khondkar, P., and Rahman, M.M. (2004) Fitoterapia, 75, 228–230. Taechowisan, T., Lu, C., Shen, Y., and Lumyong, S. (2005) Microbiology, 151, 1691–1695. (a) Cushnie, T. and Lamb, A. (2005) Int. J. Antimicrob. Agents, 26, 343–356; (b) Zhou, M., Luo, H., Li, Z., Wu, F., Huang, C., Ding, Z., and Li, R. (2012) Comb. Chem. High Throughput Screening, 15, 306–315; (c) Nenaah, G. (2013) World J. Microbiol. Biotechnol., 29, 1255–1262. Candiracci, M., Citterio, B., Diamantini, G., Blasa, M., Accorsi, A., and Piatti, E. (2011) Int. J. Food Prop., 14, 799–808. Fowler, Z.L., Shah, K., Panepinto, J.C., Jacobs, A., and Koffas, M.A.G. (2011) PLoS One, 6, e25681. Brahmachari, G., Mandal, N.C., Jash, S.K., Roy, R., Mandal, L.C., Mukhopadhyay, A., Behera, B., Majhi, S., Mondal, A., and Gangopadhyay, A. (2011) Chem. Biodivers., 8, 1139–1151. Raghukumar, R., Vali, L., Watson, D., Fearnley, J., and Seidel, V. (2010) Phytother. Res., 24, 1181–1187. Ango, P.Y., Kapche, D.W.F.G., Kuete, V., Ngadjui, B.T., Bezabih, M., and Abegaz, B.M. (2012) Phytochem. Lett., 5, 524–528. Kasim, L.S., Ferro, V.A., Odukoya, O.A., Drummond, A., Ukpo, G.E., Seidel, V., Gray, A.I., and Waigh, R. (2011) J. Microbiol. Antimicrob., 3, 13–17. Lee, J.–.Y., Jeong, K.-W., Shin, S., Lee, J.-U., and Kim, Y. (2009) Bioorg. Med. Chem., 17, 5408–5413. References 77. Cao, M.A., Sun, X.B., Zhaou, P.H., and 78. 79. 80. 81. 82. 83. 84. 85. 86. 87. 88. 89. Yuan, C.S. (2006) Chin. Chem. Lett., 17, 1048–1050. Jung, H.J., Sung, W.S., Yeo, S.-H., Kim, H.S., Lee, I.-S., Woo, E.-R., and Lee, D.G. (2006) Arch. Pharm. Res., 29, 746–751. Ramos, F.A., Takaishi, Y., Shirotori, M., Kawaguchi, Y., Tsuchiya, K., Shibata, H., Higuti, T., Tadokoro, T., and Takeuchi, M. (2006) J. Agric. Food Chem., 54, 3551–3557. Hidetoshi, A. and Gen-ichi, D. (2002) Biosci. Biotechnol., Biochem., 66, 1727–1730. Donnell, G.O., Bucar, F., and Gibbons, S. (2006) Phytochemistry, 67, 178–182. Kuete, V., Nguemeving, J.R., Beng, V.P., Azebaze, A.G., Etoa, F.X., Meyer, M., Bodo, B., and Nkengfack, A.E. (2007) J. Ethnopharmacol., 109, 372–379. Sato, Y., Suzaki, S., Nishikawa, T., Kihara, M., Shibata, H., and Higuti, T. (2000) J. Ethnopharmacol., 72, 483–488. Sathiamoorthy, B., Gupta, P., Kumar, M., Chaturvedi, A.K., Shukla, P.K., and Maurya, R. (2007) Bioorg. Med. Chem. Lett., 17, 239–242. Drewes, S.E. and van Vuuren, S.F. (2008) Phytochemistry, 69, 1745–1749. Kuete, V., Ngameni, B., Simo, C.C., Tankeu, P.K., Ngadjui, B.T., Meyer, J.I., Lall, N., and Kuiate, J.R. (2008) J. Ethnopharmacol., 120, 17–24. Alvarez, M.A., Debattista, N.B., and Pappano, N.B. (2008) Folia Microbiol., 53, 23–28. Sherif, B., Abdel, G., Louise, W., Zidan, H.Z., Hussein, M.A., Keevil, C.W., and Richard, C.D.B. (2008) Bioorg. Med. Chem. Lett., 18, 518–522. (a) Masuda, M., Itoh, K., Murata, K., Naruto, S., Uwaya, A., Isami, F., and Matsuda, H. (2012) Biol. Pharm. Bull., 35, 78–83; (b) Akihisa, T., Seino, K., Kaneko, E., Watanabe, K., Tochizawa, S., Fukatsu, M., Banno, N., Metori, K., and Kimura, Y. (2010) J. Oleo Sci., 59, 49–57; (c) Masuda, M., Murata, K., Naruto, S., Uwaya, A., Isami, F., and Matsuda, H. (2012) 90. 91. 92. 93. 94. 95. 96. 97. 98. Biol. Pharm. Bull., 35, 210–215; (d) Saracoglu, I. and Harput, U.S. (2012) Phytother. Res., 26, 148–152; (e) Saracoglu, I., Oztunca, F.H., Nagatsu, A., and Harput, U.S. (2011) Pharm. Biol., 49, 1150–1157. Háznagy-Radnai, E., Balogh, A., Czigle, S., Máthé, I., Hohmann, J., and Blazsó, G. (2012) Phytother. Res., 26, 505–509. Masuda, M., Murata, K., Fukuhama, A., Naruto, S., Fujita, T., Uwaya, A., Isami, F., and Matsuda, H. (2009) J. Nat. Med., 63, 267–273. Tundis, R., Loizzo, M.R., Menichini, F., Statti, G.A., and Menichini, F. (2008) Mini Rev. Med. Chem., 8, 399–420. Yang, X.P., Yuan, C.S., and Jia, Z.J. (2006) Chin. Chem. Lett., 17, 337–340. Stavri, M., Mathew, K.T., and Gibbons, S. (2006) Phytochemistry, 67, 1530–1533. Saleem, M., Kim, H.J., Ali, M.S., and Lee, Y.S. (2005) Nat. Prod. Rep., 22, 696–716. (a) Hirano, T., Gotoh, M., and Oka, K. (1994) Life Sci., 55, 1061; (b) Thompson, L.U., Seidl, M.M., Rickard, S.E., Orcheson, L.J., and Fong, H.H.S. (1996) Nutr. Cancer, 26, 159–165; (c) Kangas, L., Saarinen, N., Mutanen, M., Ahotupa, M., Hirsinummi, R., Unkila, M., Perala, M., Soininen, P., Laatikainen, R., Korte, H., and Santti, R. (2002) Eur. J. Cancer Prev., 11, S48; (d) Lu, H. and Liu, G.T. (1992) Planta Med., 58, 311–313; (e) Ghisalberti, E.L. (1997) Phytomedicine, 4, 151–166. (f ) Kitts, D.D., Yuan, Y.V., Wijewickreme, A.N., and Thompson, L.U. (1999) Mol. Cell. Biochem., 202, 91–100; (g) Yamauchi, S., Ina, T., Kirikihira, T., and Masuda, T. (2004) Biosci. Biotechnol., Biochem., 68, 183–192; (h) Charlton, J.L. (1998) J. Nat. Prod., 61, 1447–1451. Peng, S.C., Cheng, C.Y., Sheu, F., and Su, C.H. (2008) J. Appl. Microbiol., 105, 485–491. Lee, D.G., Jung, H.J., and Woo, E.R. (2005) Arch. Pharm. Res., 28, 1031–1036. 287 288 9 Natural Products as Antimicrobial Agents – an Update 99. Ge, H.M., Huang, B., Tan, S.H., 100. 101. 102. 103. 104. 105. 106. 107. 108. 109. 110. 111. 112. Shi, D.H., Song, Y.C., and Tan, R.X. (2006) J. Nat. Prod., 69, 1800–1802. Becker, H., Scher, J.M., Speakman, J.-B., and Zapp, J. (2005) Fitoterapia, 76, 580–584. Puupponen-Pimiä, R., Nohynek, L., Alakomi, H.L., and Oksman-Caldentey, K.M. (2005) Appl. Microbiol. Biotechnol., 67, 8–18. Cavanagh, H.M.A., Hipwell, M., and Wilkinson, J.M. (2003) J. Med. Food, 6, 57–61. Chung, K.M., Wong, T.Y., Wei, C.I., Huang, Y.W., and Lin, Y. (1998) Crit. Rev. Food Sci. Nutr., 38, 421–464. Pessini, G.L., Dias Filho, B.P., Nakamura, C.V., and Cortez, D.A.G. (2003) Mem. Inst. Oswaldo Cruz, Rio de Janeiro, 98, 1115–1120. Koroishi, A.M., Foss, S.R., Cortez, D.A., Ueda-Nakamura, T., Nakamura, C.V., and Dias Filho, B.P. (2008) J. Ethnopharmacol., 117, 270–277. Rukachaisirikul, T., Innok, P., Aroonrerk, N., Boonamnuaylap, W., Limrangsun, S., Boonyon, C., Woonjina, U., and Suksamrarn, A. (2007) J. Ethnopharmacol., 110, 171–175. Mbaveng, A.T., Ngameni, B., Kuete, V., Simo, I.K., Ambassa, P., Roy, R., Bezabih, M., Etoa, F.X., Ngadjui, B.T., Abegaz, B.M., Meyer, J.I., Lall, N., and Beng, V.P. (2008) J. Ethnopharmacol., 116, 483–489. Rai, D., Singh, J.K., Roy, N., and Panda, D. (2008) Biochem. J., 410, 147–155. Bharate, S.B., Khan, S.I., Yunus, N.A., Chauthe, S.K., Jacob, M.R., Tekwani, B.L., Khan, I.A., and Singh, I.P. (2007) Bioorg. Med. Chem., 15, 87–96. Kuete, V., Wabo, G.F., Ngameni, B., Mbaveng, A.T., Metuno, R., Etoa, F.X., Ngadjui, B.T., Beng, V.P., Meyer, J.I., and Lall, N. (2007) J. Ethnopharmacol., 114, 54–60. Yin, S., Fan, C.-Q., Dong, L., and Yue, J.-M. (2006) Tetrahedron, 62, 2569–2575. Thikomkulchai, S.A., Prawat, H., Thasana, N., Ruangrungsi, N., and 113. 114. 115. 116. 117. 118. 119. 120. 121. 122. 123. 124. 125. 126. Ruchirawat, S. (2006) Chem. Pharm. Bull., 54, 262–264. Penna, C., Marino, S., Vivot, E., Cruan∼es, M.C., de Mun∼oz, J.D., Cruan∼es, J., Ferraro, G., Gutkind, G., and Martino, V. (2001) J. Ethnopharmacol., 77, 37–40. Cho, J.Y. and Kim, M.S. (2012) Fish Sci., 78, 1065–1073. Petit, P., Lucas, E.M.F., Abreu, L.M., Pfenning, L.H., and Takahashi, J.A. (2009) Electron. J. Biotechnol., 12, SP 1–9. Jin, W. and Zjawiony, J.K. (2006) J. Nat. Prod., 69, 704–706. Dai, J., Krohn, K., Flörke, U., Draeger, S., Schulz, B., Kiss-Szikszai, A., Antus, S., Kurtán, T., and Ree, T.V. (2006) Eur. J. Org. Chem., 2006, 3498–3506. Reátegui, R.F., Wicklow, D.T., and Gloer, J.B. (2006) J. Nat. Prod., 69, 113–117. Plaza, A., Keffer, J.L., Bifulco, G., Lloyd, J.R., and Bewley, C.A. (2010) J. Am. Chem. Soc., 132, 9069–9077. Debbie, Y. and Erik, G. (2007) Use of polypeptides having antimicrobial activity. US Patent IPC8 Class AA61K3816FI, US USPC Class: 514 12, New York. Fukuda, T., Arai, M., Yamaguchi, Y., Masuma, R., Tomoda, H., and Omura, S. (2004) J. Antibiot., 57, 110–116. Ciciliato, I., Corti, E., Sarubbi, E., Stefanelli, S., Gastaldo, L., Montanini, N., Kurz, M., Losi, D., Marinelli, F., and Selva, E. (2004) J. Antibiot., 57, 210–217. Hashizume, H., Igarashi, M., Hattori, S., Hori, M., Hamada, M., and Takeuchi, T. (2001) J. Antibiot., 54, 1054–1059. Hino, M., Fujie, A., Iwamoto, T., Hori, Y., Hashimoto, M., Tsurumi, Y., Sakamoto, K., Takase, S., and Hashimoto, S. (2001) J. Ind. Microbiol. Biotechnol., 27, 157–162. Jeremy, H.L. and Lea, E.J.A. (1986) Biochim. Biophys. Acta, 859, 219–226. Daniel, R.S., Rosenthal, K.S., and Swanson, P.E. (1977) Annu. Rev. Biochem., 46, 723–763. References 127. Shoji, J., Hinoo, H., Katayama, T., 128. 129. 130. 131. 132. 133. 134. 135. 136. 137. 138. 139. 140. Matsumoto, K., Tanimoto, T., Hattori, T., Higashiyama, I., Miwa, H., Motokawa, K., and Yoshida, T. (1992) J. Antibiot., 45, 817–823. Shoji, J., Hinoo, H., Katayama, T., Nakagawa, Y., Ikenishi, Y., Iwatani, K., and Yoshida, T. (1992) J. Antibiot., 45, 824–831. Hashizume, H., Hattori, S., Igarashi, M., and Akamatsu, Y. (2004) J. Antibiot., 57, 394–399. Neuhof, T., Schmieder, P., Seibold, M., Preussel, K., and von Dohren, H. (2006) Bioorg. Med. Chem. Lett., 16, 4220–4222. Neuhof, T., Schmieder, P., Preussel, K., Dieckmann, R., Pham, H., Bartl, F., and von Dohren, H. (2005) J. Nat. Prod., 68, 695–700. (a) Khosla, C., Gokhale, R.S., Jacobsen, J.R., and Cane, D.E. (1999) Annu. Rev. Biochem., 68, 219–253; (b) Cox, R.J. (2000) Annu. Rep. Prog. Chem. Sect. B, 96, 231–258. Mazzei, T., Mini, E., Novelli, A., and Perti, P. (1993) J. Antimicrob. Chemother., 31, 1–9. Bearden, D.T. and Rodvold, K.A. (1999) Infect. Med., 16, 480A–484A. (a) Jaruchoktaweechai, C. (2000) J. Nat. Prod., 63, 984–986; (b) Nagao, T. (2001) J. Antibiot., 54, 333–339. Du, X., Lu, C., Li, Y., Zheng, Z., Su, W., and Shen, Y. (2008) J. Antibiot., 61, 250–253. Yoo, J.-S., Zheng, C.-J., Lee, S., Kwak, J.-H., and Kim, W.-G. (2006) Bioorg. Med. Chem. Lett., 16, 4889–4892. Perez-zuniga, F.J., Seco, E.M., Cuesta, T., Degenhardt, F., Rohr, J., Vallin, C., Iznaga, Y., Perez, E.M., Gonzalez, L., and Malpartida, F. (2004) J. Antibiot., 57, 197–204. Elshahawi, S.I., Trindade-Silva, A.E., Hanora, A., Han, A.W., Flores, M.S., Vizzoni, V., Schrago, C.G., Soares, C.A., Concepcion, G.P., Distel, D.L., Schmidt, E.W., and Haygood, M.G. (2013) Proc. Natl. Acad. Sci. U.S.A. Plus, 110, E295–E304. Malkina, N.D. et al. (1994) J. Antibiot., 47, 342–348. 141. Omura, S., Iwai, Y., Hinotozawa, K., 142. 143. 144. 145. 146. 147. 148. 149. 150. 151. 152. 153. Tanaka, H., Takahashi, Y., and Nakagawa, A. (1982) J. Antibiot., 35, 1425–1429. Townsend, D.E., Ashdown, N., Bolton, S., Bradley, J., Duckworth, G., Moorhouse, E., and Grubb, W.B. (1987) J. Hosp. Infect., 9, 60–71. Kuete, V., Eyong, K.O., Folefoc, G.N., Beng, V.P., Hussain, H., Krohn, K., and Nkengfack, A.E. (2007) Pharmazie, 62, 552–556. Ndi, C.P., Semple, S.J., Griesser, H.J., Pyke, S.M., and Barton, M.D. (2007) Phytochemistry, 68, 2684–2690. Cai, L., Wei, G.-X., Van, B.P., and der Wu, C.D. (2000) J. Agric. Food Chem., 48, 909–914. Singh, D.N., Verma, N., Raghuwanshi, S., Shukla, P.K., and Kulshreshtha, D.K. (2006) Bioorg. Med. Chem. Lett., 16, 4512–4514. Eyong, K.O., Folefoc, G.N., Kuete, V., Beng, V.P., Krohn, K., Hussain, H., Nkengfack, A.E., Saeftel, M., Sarite, S.R., and Hoerauf, A. (2006) Phytochemistry, 67, 605–609. Almeida, L.S., Murata, R.M., Yatsuda, R., Dos Santos, M.H., Nagem, T.J., Alencar, S.M., Koo, H., and Rosalen, P.L. (2008) Phytomedicine, 15, 886–891. Panthong, K., Pongcharoen, W., Phongpaichit, S., and Walter, C.T. (2006) Phytochemistry, 67, 999–1004. Boonsri, S., Karalai, C., Ponglimanont, C., Kanjana-opas, A., and Chantrapromma, K. (2006) Phytochemistry, 67, 723–727. Zhang, C., Ondeyka, J.G., Zink, D.L., Basilio, A., Vicente, F., Collado, J., Platas, G., Huber, J., Dorso, K., Motyl, M., Byrne, K., and Singh, S.B. (2009) Bioorg. Med. Chem., 17, 2162–2166. Riedlinger, J., Schrey, S.D., Tarkka, M.T., Hampp, R., Kapur, M., and Fiedler, H.-P. (2006) Appl. Environ. Microbiol., 72, 3550–3557. Socha, A.M., Garcia, D., Sheffer, R., and Rowley, D.C. (2006) J. Nat. Prod., 69, 1070–1073. 289 290 9 Natural Products as Antimicrobial Agents – an Update 154. Zitouni, A., Boudjella, H., Mathieu, F., 155. 156. 157. 158. 159. 160. 161. 162. 163. 164. 165. Sabaou, N., and Lebrihi, A. (2004) J. Antibiot., 57, 367–372. Shang, Z., Li, X.-M., Li, C.-S., and Wang, B.-G. (2012) Chem. Biodivers., 9, 1338–1348. Venkata Dasu, V. and Panda, T. (1999) Bioprocess Biosyst. Eng., 21, 489. (a) Mustafa, A. (1974) Benzofurans, Chemistry of Heterocyclic Compounds, 1st edn, Vol. 29, John Wiley & Sons, Inc, New York, p. 420; (b) Rahman, A. (2005) Studies in Natural Products Chemistry: Bioactive Natural Products (Part L), 1st edn, Vol. 32, Gulf Professional Publishing, p. 478. Siddiqui, I.N., Zahoor, A., Hussain, H., Ahmed, I., Ahmad, V.U., Padula, D., Draeger, S., Schulz, B., Meier, K., Steinert, M., Kurt, T., Florke, U., Pescitelli, G., and Krohn, K. (2011) J. Nat. Prod., 74, 365–373. Young, K., Jayasuriya, H., Ondeyka, J.G., Herath, K., Zhang, C., Kodali, S., Galgoci, A., Painter, R., Brown-Driver, V., Yamamoto, R., Silver, L.L., Zheng, Y., Ventura, J.I., Sigmund, J., Ha, S., Basilio, A., Vicente, F., Tormo, J.R., Pelaez, F., Youngman, P., Cully, D., Barrett, J.F., Schmatz, D., Singh, S.B., and Wang, J. (2006) Antimicrob. Agents Chemother., 50, 519–526. Singh, S.B., Phillips, J.W., and Wang, J. (2007) Curr. Opin. Drug Discovery Dev., 10, 160–166. Zhang, C., Ondeyka, J.G., Zink, D.L., Basilio, A., Vicente, F., Collado, J., Platas, G., Huber, J., Dorso, K., Motyl, M., Byrne, K., and Singh, S.B. (2008) J. Nat. Prod., 71, 1304–1317. Kharwar, R.N., Verma, V.C., Kumar, A., Gond, S.K., Harper, J.K., Hess, W.M., Lobkovosky, E., Ma, C., Ren, Y., and Strobel, G.A. (2009) Curr. Microbiol., 58, 233–238. Li, Y., Li, X., Lee, U., Kang, J.S., Choi, H.D., and Son, B.W. (2006) Chem. Pharm. Bull., 54, 882–883. Jiao, P., Swenson, D.C., Gloer, J.B., Campbell, J., and Shearer, C.A. (2006) J. Nat. Prod., 69, 1667–1671. Ivanova, V.B., Hoshino, Y., Yazawa, K., Ando, A., Mikami, Y., Zaki, S.M., 166. 167. 168. 169. 170. 171. 172. 173. 174. 175. 176. 177. 178. and Udo, G. (2002) J. Antibiot., 55, 914–918. Stern, J.L., Hagerman, A.E., Steinberg, P.D., and Mason, P.K. (1996) J. Chem. Ecol., 22, 1887–1899. (a) Shin, S.Y., Bajpai, V.K., Kim, H.R., and Kang, S.C. (2007) Int. J. Food Microbiol., 11, 3233–3236; (b) Mundt, S., Kreitlow, S., and Jansen, R. (2003) J. Appl. Phycol., 15, 263–267; (c) Ouattara, B., Simard, R.E., Holley, R.A., Piette, G.J.P., and Begin, A. (1997) Int. J. Food Microbiol., 37, 155–162. Mondol, M.A.M., Kim, J.H., Lee, M.A., Tareq, F.S., Lee, H.-S., Lee, Y.-J., and Shin, H.J. (2011) J. Nat. Prod., 74, 1606–1612. Zheng, C.J., Yoo, J.-S., Lee, T.-G., Cho, H.-Y., Kim, Y.-H., and Kim, W.G. (2005) FEBS Lett., 579, 5157–5162. Jayasuriy, H., Zink, D.L., Basilio, A., Vicente, F., Collado, J., Bills, G., Goldman, M.L., Motyl, M., Huber, J., Dezeny, G., Byrne, K., and Singh, S.B. (2009) J. Antibiot., 62, 265–269. Singh, S.B., Zink, D.L., Dorso, K., Motyl, M., Salazar, O., Basilio, A., Vicente, F., Byrne, K.M., Ha, S., and Genilloud, O. (2009) J. Nat. Prod., 72, 345–352. Reiss, F. (1947) J. Invest. Dermatol., 8, 245–250. Reiss, F. (1947) J. Invest. Dermatol., 8, 251–253. Okwu, D.E. and Igara, E.C. (2009) Afr. J. Pharm. Pharmacol., 3, 277–281. Mskhiladze, L., Kutchukhidze, J., Chincharadze, D., Delmas, F., Elias, R., and Favel, A. (2008) Georgian Med. News, 154, 39–43. Renault, S., De Lucca, A.J., Boue, S., Bland, J.M., Vigo, C.B., and Selitrennikoff, C.P. (2003) Med. Mycol., 41, 75–81. Zhang, J.-D., Xu, Z., Cao, Y.-B., Chen, H.-S., Yan, L., An, M.-M., Gao, P.-H., Wang, Y., Jia, X.-M., and Jiang, Y.-Y. (2006) J. Ethnopharmacol., 103, 76–84. Zhang, Y., Li, H.-Z., Zhan, Y.-J., Jacob, M.R., Khan, S.I., Li, X.-C., and Yang, C.-R. (2006) Steroids, 71, 712–719. References 179. Zhao, C.-C., Shao, J.-H., Li, X., Xu, J., 180. 181. 182. 183. 184. 185. 186. 187. 188. 189. 190. and Zhang, P. (2005) Arch. Pharm. Res., 28, 1147–1151. Vicente, M.F., Cabello, A., Platas, G., Basilio, A., DõÂez, M.T., Dreikorn, S., Giacobbe, R.A., Onishi, J.C., Meinz, M., Kurtz, M.B., Rosenbach, M., Thompson, J., Abruzzo, G., Flattery, A., Kong, L., Tsipouras, A., Wilson, K.E., and PelaÂez, F. (2001) J. Appl. Microbiol., 91, 806–813. Chaurasia, S.C. and Vyas, K.K. (1977) J. Res. Indian Med., Yoga Homeopathy, 1977, 24–26. An, R.-B., Kim, H.-C., Lee, S.-H., Jeong, G.-S., Sohn, D.-H., Park, H., Kwon, D.-Y., Lee, J.H., and Kim, Y.-C. (2006) Arch. Pharm. Res., 29, 815–820. Lee, L.Y., Shim, J.S., Rukayadi, Y., and Hwang, J.K. (2008) J. Food Prot., 71, 1926–1930. Theodori, R., Karioti, A., Rancić, A., and Skaltsa, H. (2006) J. Nat. Prod., 69, 662–664. Berry, Y., Jamie, J.F., and Bremner, J.B. (2000) Phytochemistry, 55, 403–406. Amiguet, V.T., Petit, P., Ta, C.A., Nun∼ez, R., Sańchez-Vindas, P., Alvarez, L.P., Smith, M.L., Arnason, J.T., and Durst, T. (2006) J. Nat. Prod., 69, 1005–1009. Rabe, T., Mullholland, D., and van Staden, J. (2002) J. Ethnopharmacol., 80, 91–94. More, G., Tshikalange, T.E., Lall, N., Botha, F., and Meyer, J.J.M. (2008) J. Ethnopharmacol., 119, 473–477. Chung, J.Y., Choo, J.H., Lee, M.H., and Hwang, J.K. (2006) Phytomedicine, 13, 261–266. (a) Ambrosio, S.R., Furtado, N.A.J.C., De Oliveira, D.C.R., Da Costa, F.B., Martins, C.H.G., De Carvalho, T.C., Porto, T.S., and Veneziani, R.C.S. (2008) Z. Naturforsch., C, 63, 326–330; (b) Porto, T.S., Rangel, R., Furtado, N.A.J.C., De Carvalho, T.C., Martins, C.H.G., Veneziani, R.C.S., Da Costa, F.B., Vinholis, A.H.C., Cunha, W.R., Heleno, V.C.G., and Ambrosio, S.R. (2009) Molecules, 14, 191–199; (c) Koo, H., Rosalen, P.L., Cury, J.A., Park, Y.K., and Bowen, W.H. (2002) Antimicrob. Agents Chemother., 191. 192. 193. 194. 195. 196. 197. 198. 199. 200. 201. 202. 46, 1302–1309; (d) Tomczyk, M., Pleszczynska, M., and Wiater, A. (2010) Molecules, 15, 4639–4651. Teponno, R.B., Tapondjou, A.L., Gatsing, D., Djoukeng, J.D., Abou-Mansour, E., Tabacchi, R., Tane, P., Stoekli-Evans, H., and Lontsi, D. (2006) Phytochemistry, 67, 1957–1963. Ghisalberti, E.L. (1997) Fitoterapia, 68, 303–325. Slimestad, R., Marston, A., Mavi, S., and Hostettmann, K. (1995) Planta Med., 61, 562–563. Shi, Y., Yu, B., Williams, I.D., Sung, H.H., Zhang, Q., Liang, J.Y., Ip, N.Y., and Min, Z.D. (2007) Planta Med., 73, 84–90. Souza, A.B., Martins, C.H.G., Souza, M.G.M., Furtado, N.A.J.C., Heleno, V.C.G., de Sousa, J.P.B., Rocha, E.M.P., Bastos, J.K., Cunha, W.R., Veneziani, R.C.S., and Ambrósio, S.R. (2011) Phytother. Res., 25, 215–220. Urzúa, A., Rezende, M.C., Mascayano, C., and Vásques, L. (2008) Molecules, 13, 882–891. da Silva, L.L., Nascimento, M.S., Cavalheiro, A.J., Silva, D.H., Castro-Gamboa, I., Furlan, M., and Bolzani, V.S. (2008) J. Nat. Prod., 71, 1291–1293. Cavin, A.-L., Hay, A.-E., Marston, A., Stoeckli-Evans, H., Scopelliti, R., Diallo, D., and Hostettmann, K. (2006) J. Nat. Prod., 69, 768–773. Das, B., Ramu, R., Venkateswarlu, K., Rao, Y.K., Reddy, M.R., Ramakrishna, K.V.S., Harakishore, K., and Murty, U.S. (2006) Chem. Biodivers., 175–179. Liu, X.-T., Pan, Q., Shi, Y., Williams, I.D., Sung, H.H.-Y., Zhang, Q., Liang, J.-Y., Ip, N.Y., and Min, Z.-D. (2006) J. Nat. Prod., 69, 255–260. Wellsow, J., Grayer, R.J., Veitch, N.C., Kokubun, T., Lelli, R., Kite, G.C., and Simmonds, M.S.J. (2006) Phytochemistry, 67, 1818–1825. Kofujita, H., Fujino, Y., Ota, M., and Takahashi, K. (2006) Holzforschung, 60, 20–23. 291 292 9 Natural Products as Antimicrobial Agents – an Update 203. Lee, S., Shin, D.-S., Oh, K.-B., and 204. 205. 206. 207. 208. 209. 210. 211. 212. 213. 214. 215. Shin, K.H. (2003) Arch. Pharm. Res., 26, 40–42. Cardoso Sá, N., Cavalcante, T.T.A., Araujo, A.X., dos Santos, H.S., Albuquerque, M.R.J.R., Bandeira, P.N., da Cunha, R.M.S., Cavada, B.S., and Teixeira, E.H. (2012) Arch. Oral Biol., 57, 550–555. Saleem, M., Nazir, M., Ali, M.S., Hussain, H., Lee, Y.S., Riaz, N., and Jabbar, A. (2010) Nat. Prod. Rep., 27, 238–254. Chiozem, D.D., Trinh-Van-Dufat, H., Wansi, J.D., Djama, C.M., Fannang, V.S., Seguin, E., Tillequin, F., and Wandji, J. (2009) Chem. Pharm. Bull., 57, 1119–1122. Awanchiri, S.S., Trinh-Van-Dufat, H., Shirri, J.C., Dongfack, M.D.J., Nguenang, G.M., Boutefnouchet, S., Fomum, Z.T., Seguin, E., Verite, P., Tillequin, F., and Wandji, J. (2009) Phytochemistry, 70, 419–522. Severiano, M.E., Simao, M.R., Porto, T.S., Martins, C.H.G., Veneziani, R.C.S., Furtado, N.A.J.C., Arakawa, N.S., Said, S., de Oliveira, D.C.R., Cunha, W.R., Gregorio, L.E., and Ambrosio, S.R. (2010) Molecules, 15, 8553–8566. Choudhary, M.I., Siddiqui, Z.A., Hussain, S., and Rahman, A. (2006) Chem. Biodivers., 3, 54–61. Evans, L., Hedger, J.N., Brayford, D., Stavri, M., Smith, E., O’Donnell, G., Gray, A., Grith, G.W., and Gibbons, S. (2006) Phytochemistry, 67, 2110–2114. Vicente, F., Basilio, A., Platas, G., Collado, J., Bills, G.F., Del Val, A.G., Martin, J., Tormo, J., Harris, G.H., Zink, D.L., Justice, M., Kahn, J.N., and Pelaez, F. (2009) Mycol. Res., 113, 754–770. Vairappan, C.S. (2003) Biomol. Eng., 20, 255–259. Tsukamoto, S., Yamashita, Y., and Ohta, T. (2005) Mar. Drugs, 3, 22–28. Bishara, A., Rudi, A., Goldberg, I., Benayahu, Y., and Kashman, Y. (2006) Tetrahedron, 62, 12092–12097. Williams, R.B., Martin, S.M., Hu, J.-F., Norman, V.L., Goering, M.G., Loss, S., O’Neil-Johnson, M., Eldridge, G.R., and 216. 217. 218. 219. 220. 221. 222. 223. 224. 225. 226. 227. 228. 229. Starks, C.M. (2012) J. Nat. Prod., 75, 1319–1325. Dong, L.-P., Liu, H.-Y., Nia, W., Li, J.-Z., and Chen, C.-X. (2006) Chem. Biodivers., 3, 791–798. Momin, R.A. and Nair, M.G. (2001) J. Agric. Food Chem., 49, 142–145. Tani, H., Koshino, H., Sakuno, E., Cutler, H.G., and Nakajima, H. (2006) J. Nat. Prod., 69, 722–725. Heilmann, J., Brun, R., Mayr, S., Rali, T., and Sticher, O. (2001) Phytochemistry, 57, 1281–1285. Quang, D.N., Stadler, M., Fournier, J., and Asakawa, Y. (2006) J. Nat. Prod., 69, 1198–1202. Teles, H.L., Sordi, R., Silva, G.H., Castro-Gamboa, I., Bolzani, V.d.S., Pfenning, L.H., de Abreu, L.M., Costa-Neto, C.M., Young, M.C.M., and Araujo, A.R. (2006) Phytochemistry, 67, 2686–2690. Oueslati, M.H., Jannet, H.B., Mighri, Z., Chriaa, J., and Abreu, P.M. (2006) J. Nat. Prod., 69, 1366–1369. Perianayagam, J.B., Sharma, S.K., Pillai, K.K., Pandurangan, A., and Kesavan, D. (2012) J. Ethnopharmacol., 142, 283–286. Trippe, K., McPhail, K., Armstrong, D., Azevedo, M., and Banowetz, G. (2013) BMC Microbiol., 13, 111. Katagiri, K., Tori, K., Kimura, Y., Yoshida, T., Nagasaki, T., and Minato, H. (1967) J. Med. Chem., 10, 1149–1154. Chen, C., Wang, J., Guo, H., Hou, W., Yang, N., Ren, B., Liu, M., Dai, H., Liu, X., Song, F., and Zhang, L. (2013) Appl. Microbiol. Biotechnol., 97, 3885–3892. Tadesse, M., Strom, M.B., Svenson, J., Jaspars, M., Milne, B.F., Torfoss, V., Andersen, J.H., Hansen, E., Stensvag, K., and Haug, T. (2010) Org. Lett., 12, 4752–4755. Kanokmedhakul, S., Kanokmedhakul, K., Nasomjai, P., Louangsysouphanh, S., Soytong, K., Isobe, M., Kongsaeree, P., Prabpai, S., and Suksamrarnr, A. (2006) J. Nat. Prod., 69, 891–895. Mierau, V., Sterner, O., and Anke, T. (2004) J. Antibiot., 57, 311–315. References 230. Mudur, S.V., Swenson, D.C., Gloer, J.B., 234. Saleem, M., Hussain, H., Ahmed, I., Campbell, J., and Shearer, C.A. (2006) Org. Lett., 8, 3191–3194. 231. Thomas, L.V., Yu, S., Ingram, R.E., Refdahl, C., Elsser, D., and Delves-Broughton, J. (2002) J. Appl. Microbiol., 93, 697–705. 232. Hwang, B.K., Lim, S.W., Kim, B.S., Lee, J.Y., and Moon, S.S. (2001) Appl. Environ. Micobiol., 67, 3739–3745. 233. Lavermicocca, P., Valerio, F., Evidente, A., Lazzaroni, S., Corsetti, A., and Gobbetti, M. (2000) Appl. Environ. Micobiol., 66, 4084–4090. van Ree, T., and Krohn, K. (2011) Nat. Prod. Rep., 28, 1534–1579. 235. Singh, S.B., Jayasuriya, H., Ondeyka, J.G., Herath, K.B., Zhang, C., Zink, D.L., Tsou, N.N., Ball, R.G., Basilio, A., Genilloud, O., Diez, M.T., Vicente, F., Pelaez, F., Young, K., and Wang, J. (2006) J. Am. Chem. Soc., 128, 11916–11920. 236. Cragg, G.M., Newman, D.J., and Snader, K.M. (1997) Nat. Prod. Drug Discovery Dev., 60, 52–60. 293 295 10 Photodynamic Antimicrobial Chemotherapy David A. Phoenix, Sarah R. Dennison, and Frederick Harris 10.1 Introduction Infectious diseases remain the leading cause of mortality on a global scale, primarily because of the emergence of microbial pathogens with multiple-drug resistance (MDR) [1–5], and are increasingly being recognized as life-threatening, public health issues in countries across the world [6–10], including the United Kingdom [11]. This situation has led to a series of recommendations by the World Health Organization [12], and based on these recommendations, a number of strategies to minimize the threat posed by MDR pathogens have been developed [13] such as stewardship programs and infection control regimes [14–19]. However, while these strategies may contain and reduce this threat, its ongoing nature necessitates an urgent search for new antimicrobial agents with novel mechanisms of action to supplement the generally dwindling supply of conventional antimicrobial drugs currently available [20, 21]. In response, there have been concerted attempts to develop such agents, as so well described in the other chapters of this book, along with renewed interest in strategies such as photodynamic antimicrobial chemotherapy (PACT) that have fallen into relative disuse [22, 23]. PACT is a minimally invasive modality that involves the utilization of photosensitizers (PSs), which are molecules that can be selectively taken up by microbes and activated by subsequent exposure to visible light to eradicate the host microbe via the generation of reactive cytotoxic oxygen products [24]. Introduced in the 1930s, PACT was relinquished in favor of antibiotic therapy around the middle of the last century [25], but given the current dearth of antimicrobials [20, 21], this modality has re-emerged to become a strong, potential alternative or adjunct therapy for the treatment of infections that are difficult to treat with conventional drugs and regimes [24, 26–29]. This modality involves the selective targeting of microbes by molecules such as methylene blue (MB), which is a heteroaromatic, photoactive dye (Figure 10.1) [30, 31], and the archetypical PS used in PACT [30, 32–39]. In addition to these PACT regimes, an alternate form of this therapy is that in which 5-aminolevulinic acid (ALA; Figure 10.1) is selectively targeted at microbes Novel Antimicrobial Agents and Strategies, First Edition. Edited by David A. Phoenix, Frederick Harris and Sarah R. Dennison. © 2015 Wiley-VCH Verlag GmbH & Co. KGaA. Published 2015 by Wiley-VCH Verlag GmbH & Co. KGaA. 296 10 Photodynamic Antimicrobial Chemotherapy N H3C S N CH3 + CH 3 N CI− CH3 NH (a) N O HN N OH H2N O (b) (c) O Figure 10.1 The structures of PS used in PACT. This figure shows the structures of: (a) methylene blue (MB), (b) 5-aminolevulinic acid (ALA), and (c) protoporphyrin IX (PPIX). The core structure of MB is a planar tricyclic heteroaromatic ring system [31, 41] while that of PPIX is a planar molecule with four conjugated pyrrole rings [41, 42]. These macrocyclic molecules possess π-electron OH O OH systems that allow for long-lived triplet or states and thereby the ability of the parent PS to act as a PACT agent [31, 41, 42]. ALA (c) is effectively the substrate for the production of PPIX in the heme biosynthetic pathway, which underpins the ability of PACT based on the introduction of exogenous ALA to induce antimicrobial phototoxicity, as depicted in Figure 10.2 [29]. 3 PS* to induce the accumulation of protoporphyrin IX (PPIX), a macrocyclic, photoactive molecule (Figure 10.1) capable of serving as an endogenous PS within these microbes [23, 29, 38, 40]. In this chapter, we give an overview of mainstream PACT using MB as a major example and focus on recent progress in the development of PACT based on ALA, which is increasingly gaining recognition as a major future antimicrobial modality in the clinical and biotechnical arenas. 10.2 The Administration and Photoactivation of PS The ability of ALA administration to initiate a photodynamic response derives from the fact that this molecule is synthesized as the first intermediate in the heme biosynthetic pathway, which is highly conserved across organisms and is well characterized in non-plant eukaryotes and non-phototrophic bacteria (Figure 10.2a), [43, 44]. The heme biosynthetic pathways of these two groups of organisms differ only in their initial step of ALA synthesis (Figure 10.2b) and in both cases, this synthesis is regulated by negative feedback from heme levels (Figure 10.2a). The last step of these pathways involves the incorporation of Fe2+ into PPIX to form nonphotodynamically active heme, which is catalyzed by the enzyme ferrochelatase and is the rate-limiting step of the biosynthetic route [45, 46]. It is this limited capacity of ferrochelatase to transform PPIX to heme that underlies the ability of ALA to induce the cell death of microbes directly [47, 48]. It was found that by the addition of exogenous ALA to target cells, the feedback inhibition of ALA synthesis in the heme biosynthetic pathway was bypassed, which led to the accumulation 10.2 ALA synthesis The Administration and Photoactivation of PS Negative feedback regulation δ -Aminolevulinic acid (ALA) ALA dehydratase Porphobilinogen (PBG) PBG deaminase Hydroxymethylbilane Uroporphyrinogen synthase Uroporphyrinogen Uroporphyrinogen decarboxylase Coproporphyrinogen III Coproporphyrinogen oxidase Protoporphyrinogen IX Protoporphyrinogen oxidase Protoporphyrin IX (PPIX) Ferrochelatase Protoheme (HEME) (a) (1) Glutamyl-tRNAGlu Gluatamate-1semialdehyde (GSA) GSA transaminase Glutamyl-tRNA reductase (2) (b) ALA Glycine + succinyl-CoA ALA δ -Aminolevulinate synthase Figure 10.2 Panel (a) shows the heme biosynthetic pathway, which is highly conserved across organisms except for the initial step of ALA synthesis. In prokaryotes, glutamate-1-semialdehyde transferase catalyzes the formation of ALA from glutamate1-semialdehyde (b(1)) while in non-plant eukaryotes, ALA-synthetase is used to catalyze the production of ALA from glycine and succinyl CoA (b(2)). The introduction of exogenous ALA into the heme biosynthetic pathway bypasses its negative feedback regulation step and promotes the production of protoporphyrin IX, a potent PS represented in Figure 10.1. (This figure was adapted from Ref. [29].) 297 298 10 Photodynamic Antimicrobial Chemotherapy of photodynamically active PPIX and other porphyrin intermediates. Subsequent irradiation by light led to the activation of these endogenous PS, which then served as in situ photodynamic agents and inactivated the host cell [49]. These observations inspired the use of photodynamic therapy based on ALA for the diagnosis and treatment of a variety of conditions [38, 50, 51], including cancers [52–55] and inflammatory diseases of the skin [56–58]. It was first suggested by Kennedy et al. [59] that this form of photodynamic therapy may also serve as an antimicrobial strategy [59]. It is therapeutically desirable that PS used for PACT application have strong absorption in the red region of the visible spectrum as biological molecules show minimal adsorption of light in this region, thus generally allowing deeper light penetration into human tissues [41, 60, 61]. PPIX [62], MB [30], and most other PS involved in PACT application are generally activated by red light in the range of 630–700 nm [63] and a variety of light sources, including lamps, light-emitting diodes, intense light pulse systems, and lasers, have been used for this purpose [23, 56, 58, 61, 64–69], primarily for the inactivation of bacteria [70], fungi [71], viruses [38], and parasites [34, 72]. However, light with wavelengths between 630 and 700 nm is only able to effectively penetrate tissue up to depths of 3 mm [61, 67], which generally limits PACT to topical application and to accessible areas of the body such as the skin, nails, oral cavity, and lower female reproductive tract [38, 56, 73]. In response, there have been numerous investigations into optimizing the topical administration of MB and ALA through the production of functionalized derivatives and the design of improved delivery methods for these compounds [29, 30, 74, 75]. A comprehensive discussion of these investigations is beyond the scope of this chapter, but as examples derivatives of ALA such as its methyl and hexyl esters have been prepared, which possess higher lipophilicity than the parent drug and exhibit improved skin penetration, resulting in elevated levels of PPIX production and microbial death [76–81]. To improve the topical localization of ALA and its derivatives in PACT, a variety of factors that influence the efficacy of this administrative route have been recently investigated [82–87] and led to the development of a number of novel delivery methods, including sprays [88], microemulsions [89, 90], liposomal encapsulation [91], micro-needle arrays [92, 93], cream formulations with penetration enhancers [86, 94, 95], and pressuresensitive, bioadhesive patches [86, 91, 94–97]. Innovative strategies have also been reported for optimizing the topical administration of MB and its derivatives [69, 73, 75, 98–101] such as the use of the nebulized PS in conjunction with fiber-optic light delivery to treat infection in the lungs of cystic fibrosis patients [102] and the use of MB-loaded liposomes [91, 103] and microspheres [104] to specifically target the pilosebaceous units, which play a major role in the pathogenesis of the skin disorder, acne vulgaris [105]. More recently, liposomal MB has also been used to develop a version of PACT that eliminates the requirement for external irradiation by encapsulating a chemiluminescent light source with the dye [106, 107]. Termed chemiluminescence photodynamic antimicrobial therapy, this methodology showed activity against MDR bacterial pathogens that was comparable to that 10.2 The Administration and Photoactivation of PS of PACT and it was suggested that it has the potential to treat deep-seated microbial infections that may be inaccessible to PACT [106, 108, 109]. It is generally perceived that PS have some selectivity for microbial cells over healthy mammalian host cells although it is recognized these molecules are effective in killing both cell types [38, 73, 110]. In part, this selectivity derives from the topical administration of PACT PS as compared to systemic delivery in that they come directly into contact with the microbes instead of being delivered via the capillaries and coming into contact with host cells first [111]. A major contributor to the selectivity of MB and most other PS for microbes derives from the fact that most of these molecules are designed to possess cationic structures, thereby allowing them to rapidly bind bacterial membranes, which are anionic, in preference to those of healthy human cells, which are zwitterionic [32, 40, 106]. This difference in membrane binding affinity effectively means that PS are only slowly taken up by host cells using the process of endocytosis as compared to the uptake mechanisms of bacterial cells, thus giving these molecules temporal selectivity for microbes [111, 112]. It is generally accepted that the electrostatic binding of MB to bacterial membranes facilitates self-promoted pathways of cell uptake where metal ions involved in stabilizing membrane structure are displaced by the dye to induce the formation of membrane lesions and the internalization of MB [113, 114]. In contrast, MB appears to be taken up by fungal cells by crossing the cytoplasmic membrane of these organisms via mechanisms involving specific molecular transporters of the major facilitator superfamily [115]. The selectivity of ALA for microbial cells over healthy host cells is manifested as a more pronounced accumulation of PPIX in these former cells and appears to be based on a preference for cells with high rates of metabolic activity [29] such as bacterial cells [116] and virally infected cells [117, 118]. Similarly to MB, specific molecular transporters appear to facilitate the internalization of ALA into target cells [29], including those of bacteria [119–121], fungi [122–124], and some parasites [72], although the uptake of ALA by host cells appears to mediate the inactivation of other parasites and viruses [29]. A number of physical, pharmacokinetic, and photochemical properties are desirable for PS used in PACT and a review of these properties is generally beyond the scope of this chapter, but they are summarized in Table 10.1. The primary photo-physical processes involved in PACT are similar for MB [30, 32, 114, 125], PPIX [126–128], and the vast majority of PS used in this form of chemotherapy [24, 61, 129], and a schematic representation of the main steps involved in these processes is shown in Figure 10.1. In the first step, a PS has a stable electronic configuration in the singlet ground state with the most energetic electrons in the highest occupied molecular orbital (1 PS0 ). The PS then absorbs a photon of light (hv) with wavelength 𝜆 that ideally lies within the therapeutic window of 600–900 nm (Table 10.1). Having absorbed a photon of light, the PS undergoes an electronic transition, which promotes an electron from the singlet state to the lowest unoccupied molecular orbital, causing the PS to reach the short-lived excited singlet state (1 PS* ) [24, 129]. In this state, the PS may rapidly lose energy by electronic decay (fluorescence) or physical processes (internal 299 300 10 Photodynamic Antimicrobial Chemotherapy Table 10.1 Desirable characteristics for PS involved in PACT. 1 2 3 4 5 6 7 8 9 10 11 12 Available in pure form of known chemical composition Synthesizable from available precursors and easily reproduced High chemical stability High singlet oxygen quantum yield (ΦΔ). For example, ΦΔ for MB = 1 [32] Natural fluorescence Low photobleaching Low dark toxicity: not harmful to the target tissue until treatment light application Strong maximal absorption (𝜆max ) in the window 600–900 nm, where tissue is more transparent. For example, 𝜆max for MB = 656 nm [32] High extinction coefficient (𝜀max ) of circa 50 000–100 000 M−1 cm−1 . For example, for MB, 𝜀max = 95 000 [32] Stable and soluble in the body’s tissue fluids and easily delivered Preferential uptake in target tissue Excreted from the body upon completion of treatment This table was compiled from Refs. [32, 60, 61]. conversion to heat) and thus return to the singlet ground state, 1 PS0 . However, if 1 PS* is relatively stable, the PS may also undergo an electronic rearrangement in which the spin of the excited electron is reversed (intersystem crossing) to give the excited triplet state (3 PS* ). At this stage, the PS may again undergo electronic decay (phosphorescence) back to the singlet ground state, 1 PS0 . However, although 3 PS* is less energetic than 1 PS* , it has a relatively longer lifetime – many microseconds as compared to a few nanoseconds [24, 129], allowing 3 PS* to pass its excitational energy onto other biomolecules by either of two processes, which are defined as type I and type II mechanisms and both facilitate photodynamic action [24, 61] (Figure 10.3). Type I mechanisms involve direct interaction between 3 PS* and a nearby biomolecule, which acts as a reductant. Hydrogen abstraction or electron transfer between 3 PS* and this biomolecule yields free radicals, which can then initiate further redox reactions leading to cellular damage. In contrast, type II mechanisms involve energy transfer via the collision of 3 PS* with molecular oxygen, which yields the ground state PS and singlet oxygen, 1 O2 . When formed in situ within a cellular environment, singlet oxygen is highly cytotoxic owing to its strong oxidizing activity. Moreover, it has a long lifetime in relation to other reactive oxygen species (ROS) and may diffuse from its site of generation before reacting with a biomolecule, again leading to further reactions and cellular damage [24, 61, 129]. Nonetheless, given a sufficiently populated triplet state and the availability of oxygen, a PS has the potential to inflict damage on a variety of biomolecules via either or both of these mechanisms (Table 10.2) [29, 32, 132–135]. In general, this photodamage (Table 10.2) can include the loss of membrane functions induced by the peroxidation of membrane cholesterol [136, 137] and lipids [138, 139], the inactivation of essential enzymes and loss of membrane protein function owing to bimolecular cross-linking reactions 10.3 Applications of PACT Based on MB O2 Singlet state 1PS Intersystem crossing O 2− e− ∗ Fluorescence Type I ∗ Triplet state Type II 1 O2 1PS0 2 O 3 Ph os ph ore sce nc e hν 3PS Ground state Figure 10.3 This figure shows a schematic representation of the possible photochemical/photophysical steps involved in the photosensitization of a PACT agent. A photosensitizer in its ground state, PS, absorbs a photon of light (hv) and undergoes an electronic transition, which promotes an electron to the excited singlet state, 1 PS* . The electron can then lose energy by fluorescence or can undergo an electronic rearrangement to achieve intersystem crossing to a longlived triplet state, 3 PS* . An electron in the 3 PS* state can lose its excitational energy by phosphorescence or pass it onto other molecules by type 1 and type II mechanisms, which can then lead to the local production of reactive oxygen species such as singlet oxygen (Type II) or superoxide (Type I) that are cytotoxic to microbial and other target cells [24, 61, 129]. More recently, the activation of PS through two-photon processes has been described, which offers several advantages over the single photon process presented above although a discussion of these processes is beyond the scope of this chapter [61, 130, 131]. (This figure was adapted from Ref. [38]. Reproduced with permission. Copyright © 2011 Wiley-Liss, Inc.). [140–143], and mutagenetic effects resulting from RNA and DNA modification [144, 145]. A particularly important example of such DNA modification is the oxidation of guanosine to produce 8-oxo-7,8-dihydroguanosine (8-oxodG), which is a major product of type II photo-attack on cellular nucleic acids and is often used as an in vivo biomarker of such attack [125, 146, 147]. 10.3 Applications of PACT Based on MB PACT based on MB is considered to be generally safe for human application [31, 148, 149] and the technique is probably best known for its anticancer activity 301 302 10 Photodynamic Antimicrobial Chemotherapy Table 10.2 Reaction products from Type I and Type II mechanisms in PACT. Biological target Type I Type II Amino acids Tyrosine (phenol coupling), phenylalinine (hydroxylation), tryptophan (N-formylkynurenine) Cross-linking, carbonylation Radical chain reactions 5-Carboxamido-5-formamido2-iminohydantoin 5- and 6-Hydroperoxides Histidine (oxygen addition), tryptophan (oxygen addition) cystine (disulfide), methionine (sulfoxide) Cross-linking, proteolysis Lipid hydroperoxides 8-Oxo-7,8-dihydroguanosine Proteins Lipids Nucleic acids Cholesterol 7-Hydroperoxides This table was compiled from Refs. [24, 32]. [31, 32, 41, 150–152] although it is an often forgotten fact that MB was the first synthetic antimicrobial compound to be reported, when in the 1890s the dye successfully treated plasmodium infection in humans [149, 153, 154]. Since this time, the photodynamic antimicrobial activities of MB and its derivatives have been widely investigated [31, 32, 39, 155–158] and the dye has been shown to have activity against bacteria [28, 39, 159–165], viruses [145, 166–170], fungi [33, 40, 115, 171–174], and parasites [72, 175–177]. On the basis of this broad spectrum activity, PACT based on MB and its derivatives have been developed for a multitude of clinical and biotechnical uses [5, 28, 32, 40, 72, 125, 162, 178, 179] and are well-established antimicrobials for disinfection in dentistry [180–182] and in the decontamination of blood [170, 183, 184]. Donated blood is fractionated into red blood cell concentrate, platelet concentrate, and plasma, and the transfusion of blood components is an invaluable part of modern medicine [185] although a major problem is the presence of pathogens in donated blood, which can lead to transfusion-transmitted disease [186]. In response, MB and other phenothiaziniums have been shown to be efficacious blood decontaminants with activity against a variety of major pathogens found in blood fractions, particularly viruses [30, 167, 184, 185, 187–191]. For example, the human immunodeficiency virus and hepatitis viruses are major contaminants of blood fractions [186] and MB is able to photo-inactivate both these organisms and other viruses via attack on a number of sites, including nucleic acids, internal proteins, or lipids, along with the envelope and core proteins [145, 166–170, 187]. Currently, MB-mediated techniques are widely employed by European transfusion services in the viral photo-decontamination of blood products [167, 184, 187] with a major example provided by the Theraflex-MB system, which is primarily used for the inactivation of viruses in blood plasma [192, 193]. In the case of dentistry, oral infections are a major problem and MB has been used to treat a number of these infections [180–182, 194–198], including lichen planus [198], caries [199] and in particular, periodontal diseases such as gingivalis and periodontitis, which are associated with the accumulation of plaque biofilms 10.4 The Applications of PACT Based on ALA [200, 201]. The major etiological agents associated with periodontal diseases include Porphyromonas gingivalis, Aggregatibacter actinomycetemcomitans, and Fusobacterium nucleatum [201] and it has been recently shown that PACT based on MB and other phenothiaziniums is able to kill a variety of these periopathogens [181, 202]. Clinical trials have also shown that when this methodology was used by patients with chronic periodontitis to complement traditional therapies, the treated individuals experienced significant improvements in the alleviation of this disorder [202–207]. On the basis of these results, PACT based on MB was developed and marketed as ‘PeriowaveTM ’ for the treatment of periodontal diseases and led to the view that photo-disinfection would play a major role in periodontal therapy [208, 209]. 10.4 The Applications of PACT Based on ALA Similarly to MB, PACT based ALA is generally regarded as safe for use on humans [29, 210] and the technique is commonly associated with anticancer activity [52, 54]. In contrast to MB, PACT based on ALA is far less well established as a mainstream PACT modality although known to have broad spectrum activity against bacteria viruses, fungi, and parasites [29, 38, 40, 51, 71, 87, 145, 211–215]. However, since the antimicrobial use of ALA based PACT was first suggested by Kennedy et al. [59], it has become clear that this technique kills microbes via mechanisms other than through direct uptake and the induction of PPIX as described for bacteria [216, 217], fungi [71, 218], and some parasites [219, 220]. Some microbes have no capacity for PPIX production [29, 118, 221] and it is now known that the uptake of ALA and PPIX production by host cells induces an immune response that mediates the inactivation of a number of parasites [221–224] and viruses [214, 225]. In yet other cases, ALA-mediated production of PPIX by host cells appears to inactivate viruses via either the induction of a host cell response such as apoptosis and necrosis [226, 227] or direct photodynamic attack on viral particles [29, 228]. On the basis of this activity, PACT based on ALA has been developed for a wide variety of applications [29, 38, 40, 51, 41, 71, 87, 145, 211–215, 229] but two of the major emerging uses of this technique are decontamination in the food industry [29, 212] and anti-infective action in the area of dermatology [29, 51, 57, 221, 230, 231]. 10.4.1 Food Decontamination Using PACT Based on ALA The use of PACT based on ALA for food-related applications has appeal because ALA is colorless and odorless and thus the use of the technique does not involve strongly colored agents that could compromise the appearance and taste of food [212]. In response, there has been recent research into using PACT based on ALA to inactivate bacterial pathogens that contaminate food [232]. Major examples of 303 304 10 Photodynamic Antimicrobial Chemotherapy these pathogens include Listeria monocytogenes, whose infections are primarily associated with raw foods and lead to listeriosis in humans [233] and Salmonella enterica, which often infects cattle and poultry, thereby causing salmonellosis in humans [234]. Recently, in vitro studies showed that both S. enterica and L. monocytogenes accumulated PPIX in response to ALA uptake with subsequent irradiation by light inducing their photo-inactivation [232, 235, 236]. Both organisms have since been shown to be inactivated by PACT based on ALA and theoretical analysis of the survival curves of L. monocytogenes and S. enterica after this treatment led to the production of mathematical models, which were able to predict the optimal combinations of ALA concentration, incubation time, and light irradiation period for eradication of these organisms [237]. Most recently, both organisms were shown to be eradicated not only by PACT based on ALA but also by PACT based on the exogenous PS, chlorophyllin, although showing differing susceptibilities. Using theoretical analysis similar to that used by the latter authors, combinations of ALA and chlorophyllin were determined, which allowed synergistic PACT action based on the two PS and led to enhanced killing of these pathogens [238]. Another major food pathogen is Bacillus cereus, which is a soilborne, Gram-positive bacterium that is able to contaminate a range of fresh vegetables, berries, and cereals, causing illnesses through the production of emetic and diarrheal enterotoxins [239]. In vitro studies showed that ALA uptake led to the accumulation of PPIX in cells of the organism with subsequent light activation of the PS inducing cell death [240]. In several studies, theoretical analysis of the survival curves of B. cereus after treatment with PACT based on ALA led to mathematical models, which were able to predict the optimal conditions for eradication of the organism using this technique [237, 241]. It has also been shown that PACT based on ALA is effective against spores of B. cereus [240] and biofilms of L. monocytogenes [232]. The adhesion of bacterial spores and biofilms to food packaging surfaces is a major contamination problem, as in these forms, bacteria are highly resistant to the action of established decontamination procedures [242–244]. Most recently, the ability of PACT based on ALA to inactivate a range of microfungi such as Penicillium spp., Aspergillus spp. and Rhizopus spp., which are known to contaminate wheat, was investigated, and in general, it was found that at low ALA levels, the technique was highly effective against these organisms although susceptibility varied between species [245]. The photodynamic mechanisms underlying this antifungal activity were not further investigated but it was found that the application of ALA at low levels stimulated the growth of wheat seedlings and roots. It is well established that ALA can promote plant growth [246–249] and it was suggested that PACT based on ALA may have the potential for development as a seed decontamination technology that has no apparent harmful effects on the food matrices [245]. Currently, the fungal contamination of seeds for use in the food industry is becoming a serious threat to human health and there is an urgent need for novel approaches to the problem [250–252]. Taken with the fact that ALA appears to have no detrimental effects on food quality it was suggested that PACT based on ALA [245] may be developed as a technique 10.4 The Applications of PACT Based on ALA for the general microbial decontamination of both foodstuffs and their associated processing packaging and surfaces [212, 232]. 10.4.2 Dermatology Using PACT Based on ALA Dermatology focuses on the diagnosis of skin diseases and disorders, including skin cancers and other skin growths along with a variety of conditions associated with microbial infections [253], many of which have the potential for treatment by PACT based on ALA (Tables 10.1–10.3) [29, 51, 57, 221, 230, 231]. The technique has been shown to have efficacy against some bacterial skin infections (Table 10.1) [29, 40, 87] as in the case of several recent studies, which demonstrated that when ALA was applied either as a cream [254, 255] or a bioadhesive patch [256], the technique was effective against Lichen sclerosus, which is a chronic inflammatory skin disease of the anogenital region that has been associated with Borrelia burgdorferi [257–259]. PACT based on ALA has also been shown to have efficacy against chronic folliculitis [260], which is believed to be caused by infection due Table 10.3 Bacteria and associated conditions susceptible to PACT based on ALA. Gram-positive bacteria Bacillus cereus [232, 241], including strains with MDR [116] Enterococcus faecalis with MDR [116] Listeria monocytogenes [232, 236] Staphylococcus aureus [283–285], including methicillin-resistant Staphylococcus aureus (MRSA) and other strains with MDR [81, 116, 286] Staphylococcus epidermidis [287], including strains with MDR [116] Streptococcus faecalis with MDR [116] Mycobacterium marinum [288, 289] Mycobacterium smegmatis [290] Mycobacterium phlei [290] Gram-negative bacteria Acinetobacter baumannii with MDR [116] Aeromonas hydrophila with MDR [116] Escherichia coli [81, 285], including strains with MDR [81, 116] Helicobacter pylori [291] Propionibacterium acnes [275–277, 292] Pseudomonas aeruginosa [293], including strains with MDR [81] Salmonella enterica [232, 235] Bacterial infections Acne vulgaris associated with P. acnes [262, 272–274, 281, 294–296] Chronic folliculitis associated with P. acnes, S. aureus, and some Gram-negative bacteria [260] Gastritis and gastroduodenal ulceration associated with H. pylori infection [291] Lichen sclerosus associated with Borrelia burgdorferi [254–256] Skin lesions associated with M. marinum [288, 289] 305 306 10 Photodynamic Antimicrobial Chemotherapy to organisms such as Propionibacterium acnes and Staphylococcus aureus after long-term administration of antibiotics [261]. However, a major focus of research on the use of PACT based on ALA is the treatment of various types of acne [87, 262–266] and most recently, the technique has been patented in this capacity for both ALA and a number of its derivatives [27, 267, 268]. This skin condition is also associated with P. acnes, which normally inhabits human sebaceous glands, and is a chronic disease of the pilosebaceous unit in which excessive hormonally induced sebum production is followed by abnormal desquamation of follicular corneocytes. The resulting mixture of cells and sebum leads to blockage of the sebaceous duct and proliferation of P. acnes with subsequent release of chemotactic factors by the organism generating an inflammatory response [269–271]. Several earlier studies investigated the ability of PACT based on ALA to treat acne lesions and reported sustained clinical improvement following the treatment [272, 273]. Subsequent results from a major clinical study suggested that the treatment of acne vulgaris by the technique may involve a number of mechanisms, including the killing of P. acnes, the reduction of follicular obstruction, and the selective damaging of pilosebaceous units, thereby removing blockages from the sebaceous duct [274]. A number of later studies reported findings that strongly support these mechanisms, including the ability of P. acnes to inherently accumulate high levels of PPIX, which are further elevated after ALA uptake with subsequent illumination, leading to death of the organism [275–280] although other studies have questioned the role of P. acnes in acne [73, 281, 282]. Currently, PACT based on ALA is not used as a frontline treatment for acne and is rather employed as alternative treatment for individuals who are recalcitrant to conventional therapies and for those for whom these therapies have been unsuccessful, although use of the technique to treat this condition is predicted to increase [29, 87]. Over recent years, a major focus of research into dermatological potential of PACT based on ALA has been directed toward viral skin infections (Table 10.2) [29, 118, 297, 294], particularly those with human papillomavirus (HPV) as the causative agent [117]. HPV is a DNA virus of the Papovaviridae family, which causes acanthomas of the skin and adjacent mucous membranes in humans, commonly in the form of warts or verrucae [117, 298]. Recent clinical studies have shown that PACT based on ALA can efficiently treat common warts as well as other HPV infections [118, 214, 299], including periungual warts, which are associated with nailbeds [300–302], and anogenital warts (Condylomata acuminate), which is one of the most common sexually transmitted diseases [214, 303–307]. A number of HPV genotypes are known to infect the genital epithelium and to be associated with cervical and vulval premalignant lesions [308]. A recent clinical study used HPV viral genotyping to identify patients with such lesions and when treated with ALA-based photodynamic therapy (PDT), follow-up examinations showed that 80% were HPV negative. It was suggested that this strategy may provide a system for the early detection and treatment of women at risk from HPV-related cervical dysplasia [309]. This suggestion has been confirmed by a number of clinical studies that have shown that ALA-based PDT is highly effective in treating these lesions and eradicating the HPV infection [217, 310–314]. 10.4 The Applications of PACT Based on ALA Given that creams and solutions are not the most suitable drug delivery systems for moist, irregular areas such as the lower female genital tract, an adhesive patch for topical delivery of ALA to these bodily regions was recently developed and was found to successfully treat HPV-related vulval dysplasia [225, 315]. ALAbased PDT appears to be of particular use to the HIV-positive community, which has a high susceptibility to HPV infections [316–318]. It has been shown that PACT based on ALA is successful in treating giant warts (Buschke–Loewenstein tumor) in AIDS patients [319] and clinical trials have shown the technique to be effective against epidermodysplasia verruciformis [320–324], which is strongly associated with HIV-infected individuals [325, 326] and other groups that exhibit abnormal susceptibility to HPV [327]. Most recently, it has been shown that PACT based on ALA used in combination with immunotherapy is able to treat several HPV-mediated conditions that are associated with the HIV community [328, 329], including vulval intraepithelial neoplasia [217] and Bowenoid papulosis, which is a premalignant condition affecting the anogenital area [330, 331] (Table 10.4). PACT based on ALA has also been shown to be effective against eukaryotic microbes associated with skin diseases such as parasites of the Leishmania genus (Table 10.3)[40, 221, 222], including L. tropica [338] and L. major [339–343], thus providing a potential treatment for cutaneous leishmaniasis [40, 57, 72, 221, 222, 343]. Leishmania spp. are among those parasites that are unable to synthesize PPIX owing to the absence in their genome of genes that code for enzymes in the heme biosynthetic pathway and it has been proposed that PACT based on ALA kills these organisms through host cell-mediated effects, which act by inducing a systemic immune response [222–224]. Most recently, genetically modified mutants of the Leishmania genus have been produced in which the ability to code for enzymes in the heme biosynthetic pathway has been restored. These mutants are able to produce PPIX and other endogenous PS and when delivered in vaccines and activated by PACT based on ALA, show the potential to treat leishmaniasis [344–346] as recently demonstrated using animal models [347]. The most prevalent dermatological use of PACT based on ALA against eukaryotic microbes has been in the treatment of yeast and fungal skin infections Table 10.4 Viruses and associated conditions susceptible to PACT based on ALA. Human immunodeficiency virus (HIV) and associated giant warts or Buschke–Lowenstein tumor [319] Herpes simplex virus and associated infections [228, 319, 332, 333], including lip lesions [334] Human papillomavirus (HPV) and associated common warts or verruca vulgaris [117, 118, 299] HPV and associated anogenital warts or condylomata acuminate [335, 336] HPV and associated periungual warts [300] HPV associated cervical and vulval lesions [217, 311–313] HPV and associated epidermodysplasia verruciformis [320, 321] Molluscum contagiosum virus and associated molluscum contagiosum [337] 307 308 10 Photodynamic Antimicrobial Chemotherapy [29, 38, 40, 211–213] (Table 10.3). With regard to yeasts the technique was recently shown to have efficacy against recalcitrant Malassezia (Pityrosporum) folliculitis, which is localized predominantly on the back and chest and due to invasion of the hair follicle by Malassezia furfur and other species of the genus [348, 349]. PACT based on ALA has also been shown to efficiently treat pityriasis versicolor (Tinea versicolor, tinea flava, and dermatomycosis furfuracea) [350], which is a condition characterized by a rash on the trunk and proximal extremities and is primarily caused by Malassezia globosa [351]. The technique also showed the potential to treat candidiasis when it was demonstrated that the technique was able to inactivate Candida albicans [352] while more recent studies suggested that this potential could be enhanced by the supplementary use of cofactors such as inducers and conventional antifungal agents [218]. More recently, clinical trials showed that the technique was efficacious in treating vulvovaginal candidiasis [353] and based on these observations, it has been suggested that the technique has the potential to treat oral candidiasis [354]. This condition is a particular problem for individuals with HIV/AIDS whose immuno-compromised state makes them highly susceptible to infection by Candida spp., which can lead to disorders such as oral thrush and oesophageal candidiasis [355] (Table 10.5). In relation to fungal infections (Table 10.3), PACT based on ALA was found to show limited efficacy in the treatment of tinea cruris [361, 368], which is an infection of the groin caused by Trichophyton rubrum [369, 370] and tinea unguium (onychomycosis) [362], which is an infection of the nails that can be caused by T. rubrum and Trichophyton interdigitale [370, 371]. In contrast, other studies have shown that PACT based on ALA is able to efficiently treat tinea unguium with a very high cure rate [363, 364] and, in response, a bioadhesive patch able to deliver ALA for the treatment for onychomycosis was developed. However, ALA showed no significant penetration of human nails or porcine hooves although it was suggested that modifications to the technique may lead to treatment for onychomycosis [365, 368]. PACT based on ALA has also been investigated for the treatment of tinea pedis (interdigital mycosis) [366], which is a foot infection mainly due to fungi of the Trichophyton genus [368, 370], These organisms were found to accumulate PPIX in response to the addition of exogenous ALA and after the application of PACT, some patients experienced remission from infection, although recurrences were observed [366]. Similar results for the treatment of tinea pedis by PACT based on ALA were reported in a more recent study [367]. 10.5 Future Prospects PACT based on both MB and ALA has use in the biotechnical arena exemplified here by blood disinfection and decontamination in the food industry. These techniques also find strong application in the medical arena, illustrated here by dentistry and dermatology. PACT based on MB is generally regarded as an established antimicrobial strategy although use of the technique is rapidly 10.5 Future Prospects Table 10.5 Eukaryotic microbes and associated conditions susceptible to PACT based on ALA. Parasites Plasmodium falciparum [219] Leishmania tropica and associated leishmaniasis [222, 338] Leishmania major and associated leishmaniasis [222–224, 339, 340, 343] Yeasts Saccharomyces cerevisiae [356, 357] Candida guilliermondii [356, 357] Malassezia furfur and associated Malassezia (Pityrosporum) folliculitis [348] Malassezia globosa and associated pityriasis versicolor [350] Candida albicans and associated candidiasis [218, 352] Fungi Trichophyton rubrum [358–360] T. rubrum and associated tinea cruris [361], tinea unguium [362–365], and tinea pedis [366, 367] Trichophyton interdigitale and associated tinea cruris [358, 365] Trichophyton dermatophytes and associated tinea pedis [366] Penicillium spp. [245] Aspergillus spp. [245] Rhizopus spp. [245] Mucor spp. [245] Acremonium spp. [245] Fusarium spp. [245] Alternaria spp. [245] Mycelia sterilia [245] expanding as witnessed by the diversity of its applications [5, 28, 32, 71, 72, 125, 162, 170, 178–182]. Similarly, PACT based on ALA shows great diversity in its applications [29, 38, 40, 51, 57, 41, 71, 87, 145, 211–215, 221, 229–231] although, currently, the technique is not generally regarded as a mainstream application of PACT but rather as a standby modality [215, 372, 373]. However, as evidenced by this chapter, the levels of interest and research into the use of PACT based on ALA as an antimicrobial strategy are rapidly growing and as research improves the understanding, operation, and efficacy of the technique, it seems destined to become a mainstream modality [29]. For example, complete sequencing of the genome of P. acnes has greatly illuminated the pathophysiology of acne while techniques have been developed to selectively accumulate ALA in the sebaceous glands when treating the disorder [87]. Taken overall, this chapter clearly shows that PACT and particularly that form of the modality based on ALA, is an antimicrobial strategy of not only the present but more importantly perhaps, also of the future. 309 310 10 Photodynamic Antimicrobial Chemotherapy References 1. Wise, R. (2011) The urgent need for 2. 3. 4. 5. 6. 7. 8. 9. new antibacterial agents. J. Antimicrob. Chemother., 66, 1939–1940. Livermore, D.M. (2011) Discovery research: the scientific challenge of finding new antibiotics. J. Antimicrob. Chemother., 66, 1941–1944. Finch, R. (2011) Regulatory opportunities to encourage technology solutions to antibacterial drug resistance. J. Antimicrob. Chemother., 66, 1945–1947. White, A.R. (2011) Effective antibacterials: at what cost? The economics of antibacterial resistance and its control. J. Antimicrob. Chemother., 66, 1948–1953. Wainwright, M. (2012) Photodynamic medicine and infection control. J. Antimicrob. Chemother., 67, 787–788. Boucher, H.W., Talbot, G.H., Bradley, J.S., Edwards, J.E. Jr., Gilbert, D., Rice, L.B., Scheld, M., Spellberg, B., and Bartlett, J. (2009) Bad bugs, no drugs: no ESKAPE! An update from the infectious diseases society of America. Clin. Infect. Dis., 48, 1–12. Berger, R.E. (2011) Emergence of a new antibiotic resistance mechanism in India, Pakistan, and the UK: a molecular, biological, and epidemiological study editorial comment. J. Urol., 185, 154–154. Guidos, R.J., Spellberg, B., Blaser, M., Boucher, H.W., Bradley, J.S., Eisenstein, B.I., Gerding, D., Lynfield, R., Reller, L.B., Rex, J., Schwartz, D., Septimus, E., Tenover, F.C., Gilbert, D.N., and IDSA (2011) Combating antimicrobial resistance: policy recommendations to save lives. Clin. Infect. Dis., 52, S397–S428. Spellberg, B., Blaser, M., Guidos, R.J., Boucher, H.W., Bradley, J.S., Eisenstein, B.I., Gerding, D., Lynfield, R., Reller, L.B., Rex, J., Schwartz, D., Septimus, E., Tenover, F.C., Gilbert, D.N., and Infectious Diseases Society of America (2011) Combating antimicrobial resistance: policy recommendations to save lives. Clin. Infect. Dis., 52 (Suppl. 5), S397–S428. 10. Cole, J. (2012) Antimicrobial resistance, 11. 12. 13. 14. 15. 16. 17. 18. 19. infection control and planning for pandemics: the importance of knowledge transfer in healthcare resilience and emergency planning. J. Bus. Contin. Emer. Plan., 6, 122–135. Department of Health (2013) The UK Five Year Antimicrobial Resistance Strategy 2013–2018 (ed. D.O. Health), HMSO, London, pp. 1–43. The World Health Organization (2012) The Evolving Threat of Antimicrobial Resistance – Options for Action, World Health Orginaziation, Geneva. Lee, C.-R., Cho, I.H., Jeong, B.C., and Lee, S.H. (2013) Strategies to minimize antibiotic resistance. Int. J. Environ. Res. Public Health, 10, 4274–4305. Piacenti, F.J. and Leuthner, K.D. (2013) Antimicrobial stewardship and clostridium difficile-associated diarrhea. J. Pharm. Pract., 26, 506–513. Moro, M.L. and Gagliotti, C. (2013) Antimicrobial resistance and stewardship in long-term care settings. Future Microbiol., 8, 1011–1025. Bogan, C. and Marchaim, D. (2013) The role of antimicrobial stewardship in curbing carbapenem resistance. Future Microbiol., 8, 979–991. Cairns, K.A., Jenney, A.W.J., Abbott, I.J., Skinner, M.J., Doyle, J.S., Dooley, M., and Cheng, A.C. (2013) Prescribing trends before and after implementation of an antimicrobial stewardship program. Med. J. Aust., 198, 262–266. Chandrasiri, P., Elwitigala, J.P., Nanayakkara, G., Chandrasiri, S., Patabendige, G., Karunanayaka, L., Perera, J., Somaratne, P., and Jayathilleke, K. (2013) A multi centre laboratory study of Gram negative bacterial blood stream infections in Sri Lanka. Ceylon Med. J., 58, 56–61. Lesprit, P., Landelle, C., and Brun-Buisson, C. (2013) Clinical impact of unsolicited post-prescription antibiotic review in surgical and medical wards: a randomized controlled trial. Clin. Microbiol. Infect., 19, E91–E97. References 20. Pucci, M.J. and Bush, K. (2013) Inves- 21. 22. 23. 24. 25. 26. 27. 28. tigational antimicrobial agents of 2013. Clin. Microbiol. Rev., 26, 792–821. Alvan, G., Edlund, C., and Heddini, A. (2011) The global need for effective antibiotics-a summary of plenary presentations. Drug Resist. Updat., 14, 70–76. Maisch, T. (2007) Revitalized strategies against multi-resistant bacteria: antimicrobial photodynamic therapy and bacteriophage therapy. Anti-Infective Agents Med. Chem., 6, 145–150. Almeida, A., Cunha, A., Gomes, N.C.M., Alves, E., Costa, L., and Faustino, M.A.F. (2009) Phage therapy and photodynamic therapy: low environmental impact approaches to inactivate microorganisms in fish farming plants. Mar. Drugs, 7, 268–313. Vatansever, F., de Melo, W.C.M.A., Avci, P., Vecchio, D., Sadasivam, M., Gupta, A., Chandran, R., Karimi, M., Parizotto, N.A., Yin, R., Tegos, G.P., and Hamblin, M.R. (2013) Antimicrobial strategies centered around reactive oxygen species – bactericidal antibiotics, photodynamic therapy, and beyond. FEMS Microbiol. Rev., 37, 955–989. Hamblin, M.R. and Hasan, T. (2004) Photodynamic therapy: a new antimicrobial approach to infectious disease? Photochem. Photobiol. Sci., 3, 436–450. de Melo, W.C.M.A., Avci, P., de Oliveira, M.N., Gupta, A., Vecchio, D., Sadasivam, M., Chandran, R., Huang, Y.-Y., Yin, R., Perussi, L.R., Tegos, G.P., Perussi, J.R., Dai, T., and Hamblin, M.R. (2013) Photodynamic inactivation of biofilm: taking a lightly colored approach to stubborn infection. Expert Rev. Anti Infect. Ther., 11, 669–693. Nitzan, Y. and Nisnevitch, M. (2013) Special features of gram-positive bacterial eradication by photosensitizers. Recent Pat. Antiinfect. Drug Discov., 8, 88–99. Sperandio, F.F., Huang, Y.-Y., and Hamblin, M.R. (2013) Antimicrobial photodynamic therapy to kill Gramnegative bacteria. Recent Pat. Antiinfect. Drug Discov., 8, 108–120. 29. Harris, F. and Pierpoint, L. (2012) 30. 31. 32. 33. 34. 35. 36. Photodynamic therapy based on 5aminolevulinic acid and its use as an antimicrobial agent. Med. Res. Rev., 32, 1292–1327. Wainwright, M. (2011) Photodynamic Inactivation of Microbial Pathogens: Medical and Environmental Applications, The Royal Society of Chemistry, pp. 19–43. Tardivo, J.P., Del Giglio, A., de Oliveira, C.S., Gabrielli, D.S., Junqueira, H.C., Tada, D.B., Severino, D., Turchiello, R.d.F., and Baptista, M.S. (2005) Methylene blue in photodynamic therapy: from basic mechanisms to clinical applications. Photodiagnosis Photodyn. Ther., 2, 175–191. Harris, F., Chatfield, L.K., and Phoenix, D.A. (2005) Phenothiazinium based photosensitisers – photodynamic agents with a multiplicity of cellular targets and clinical applications. Curr. Drug Targets, 6, 615–627. Rodrigues, G.B., Dias-Baruffi, M., Holman, N., Wainwright, M., and Braga, G.U.L. (2013) In vitro photodynamic inactivation of Candida species and mouse fibroblasts with phenothiazinium photosensitisers and red light. Photodiagnosis Photodyn. Ther., 10, 141–149. Rodrigues, G.B., Ferreira, L.K.S., Wainwright, M., and Braga, G.U.L. (2012) Susceptibilities of the dermatophytes Trichophyton mentagrophytes and T. rubrum microconidia to photodynamic antimicrobial chemotherapy with novel phenothiazinium photosensitizers and red light. J. Photochem. Photobiol., B, 116, 89–94. Wainwright, M., Brandt, S.D., Smith, A., Styles, A., Meegan, K., and Loughran, C. (2010) Phenothiazinium photosensitisers VII: novel substituted asymmetric N-benzylphenothiaziniums as photoantimicrobial agents. J. Photochem. Photobiol., B, 99, 74–77. Wainwright, M., Meegan, K., and Loughran, C. (2011) Phenothiazinium photosensitisers IX. Tetra- and pentacyclic derivatives as photoantimicrobial agent. Dyes Pigm., 91, 1–5. 311 312 10 Photodynamic Antimicrobial Chemotherapy 37. Wainwright, M., Smalley, H., Scully, 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. O., and Lotfipour, E. (2012) Comparative photodynamic evaluation of new phenothiazinium derivatives against propionibacterium acnes. Photochem. Photobiol., 88, 523–526. Kharkwal, G.B., Sharma, S.K., Huang, Y.-Y., Dai, T., and Hamblin, M.R. (2011) Photodynamic therapy for infections: clinical applications. Lasers Surg. Med., 43, 755–767. Phoenix, D.A. and Harris, F. (2003) Phenothiazinium-based photosensitizers: antibacterials of the future? Trends Mol. Med., 9, 283–285. Dai, T., Huang, Y.-Y., and Hamblin, M.R. (2009) Photodynamic therapy for localized infections-State of the art. Photodiagnosis Photodyn. Ther., 6, 170–188. Ormond, A.B. and Freeman, H.S. (2013) Dye sensitizers for photodynamic therapy. Materials, 6, 817–840. Sternberg, E. and Dolphin, D. (1996) Pyrrolic photosensitizers. Curr. Med. Chem., 3, 239–272. Ajioka, R.S., Phillips, J.D., and Kushner, J.P. (2006) Biosynthesis of heme in mammals. Biochim. Biophys. Acta, 1763, 723–736. Schobert, M. and Jahn, D. (2002) Regulation of heme biosynthesis in non-phototrophic bacteria. J. Mol. Microbiol. Biotechnol., 4, 287–294. Heinemann, I.U., Jahn, M., and Jahn, D. (2008) The biochemistry of heme biosynthesis. Arch. Biochem. Biophys., 474, 238–251. O’Brian, M.R. (2009) Heme Biosynthesis. Fukuda, H., Casas, A., and Batlle, A. (2005) Aminolevulinic acid: from its unique biological function to its star role in photodynamic therapy. Int. J. Biochem. Cell Biol., 37, 272–276. Batlle, A.M. (1993) Porphyrins, porphyrias, cancer and photodynamic therapy – a model for carcinogenesis. J. Photochem. Photobiol. B, 20, 5–22. Kennedy, J.C. (2006) in Photodynamic Therapy with ALA (eds R. Pottier, B. Krammer, R. Baumgartner, and H. Stepp), Royal Society of Chemistry, Cambridge, pp. 1–15. 50. Zakhary, K. and Ellis, D.A.F. (2005) 51. 52. 53. 54. 55. 56. 57. 58. 59. Applications of aminolevulinic acidbased photodynamic therapy in cosmetic facial plastic practices. Facial Plast. Surg., 21, 110–116. Darlenski, R. and Fluhr, J.W. (2013) Photodynamic therapy in dermatology: past, present, and future. J. Biomed. Opt., 18, 061208. Nokes, B., Apel, M., Jones, C., Brown, G., and Lang, J.E. (2013) Aminolevulinic acid (ALA): photodynamic detection and potential therapeutic applications. J. Surg. Res., 181, 262–271. Ishizuka, M., Abe, F., Sano, Y., Takahashi, K., Inoue, K., Nakajima, M., Kohda, T., Komatsu, N., Ogura, S.-i., and Tanaka, T. (2011) Novel development of 5-aminolevurinic acid (ALA) in cancer diagnoses and therapy. Int. Immunopharmacol., 11, 358–365. Wachowska, M., Muchowicz, A., Firczuk, M., Gabrysiak, M., Winiarska, M., Wanczyk, M., Bojarczuk, K., and Golab, J. (2011) Aminolevulinic acid (ALA) as a prodrug in photodynamic therapy of cancer. Molecules, 16, 4140–4164. Gaal, M., Kui, R., Hunyadi, Z., Kemeny, L., and Gyulai, R. (2012) Fluorescence diagnosis of non-melanoma skin cancer. Orv. Hetil., 153, 1334–1340. Babilas, P., Schreml, S., Landthaler, M., and Szeimies, R.-M. (2010) Photodynamic therapy in dermatology: state-of-the-art. Photodermatol. Photoimmunol. Photomed., 26, 118–132. Morton, C.A., Szeimies, R.M., Sidoroff, A., and Braathen, L.R. (2013) European guidelines for topical photodynamic therapy part 2: emerging indications – field cancerization, photorejuvenation and inflammatory/infective dermatoses. J. Eur. Acad. Dermatol. Venereol., 27, 672–679. Kim, R.H. and Armstrong, A.W. (2011) Current state of acne treatment: highlighting lasers, photodynamic therapy, and chemical peels. Dermatol. Online J., 17, 2. Kennedy, J.C., Pottier, R.H., and Pross, D.C. (1990) Photodynamic therapy with endogenous protoporphyrin IX: basic References 60. 61. 62. 63. 64. 65. 66. 67. 68. 69. principles and present clinical experience. J. Photochem. Photobiol. B, 6, 143–148. Pushpan, S.K., Venkatraman, S., Anand, V.G., Sankar, J., Parmeswaran, D., Ganesan, S., and Chandrashekar, T.K. (2002) Porphyrins in photodynamic therapy: a search for ideal photosensitizers. Curr. Med. Chem., 2, 187–207. Wilson, B.C. and Patterson, M.S. (2008) The physics, biophysics and technology of photodynamic therapy. Phys. Med. Biol., 53, R61–R109. Calzavara-Pinton, P.G., Rossi, M.T., and Ortel, B. (2011) in Photodynamic Inactivation of Microbial Pathogens: Medical and Environmental Applications (eds M.R. Hamblin and G. Jori), Royal Society for Chemistry, Cambridge, pp. 361–375. Ryskova, L., Buchta, V., and Slezak, R. (2010) Photodynamic antimicrobial therapy. Centr. Eur. J. Biol., 5, 400–406. Donnelly, R.F., Cassidy, C.M., and Tunney, M.M. (2011) in Photodynamic Inactivation of Microbial Pathogens: Medical and Environmental Applications (eds M.R. Hamblin and G. Jori), Royal Society for Chemistry, Cambridge, pp. 185–216. Boucher, D. (2011) The tools of PDT: light sources and devices. Can they help in getting better therapeutic results?. AIP Conf. Proc., 1364, 73–86, http://dx.doi.org/10.1063/1.3626915 (accessed 11 July 2014). Mang, T.S. (2004) Lasers and light sources for PDT: past, present and future. Photodiagnosis Photodyn. Ther., 1, 43–48. Issa, M.C.A. and Manela-Azulay, M. (2010) Terapia fotodinâmica: revisão da literatura e documentação iconográfica. An. Bras. Dermatol., 85, 501–511. Allemann, I.B., Goldberg, D.J., Allemann, I.B., and Goldberg, D.J. (2011) Basics in Dermatological Laser Applications. Wainwright, M. (2009) Photosensitisers in Biomedicine, Wiley-Blackwell, Chichester. 70. Calin, M. and Parasca, S.V. (2009) Light 71. 72. 73. 74. 75. 76. 77. 78. 79. sources for photodynamic inactivation of bacteria. Lasers Med. Sci., 24, 453–460. Calzavara-Pinton, P., Rossi, M.T., Sala, R., and Venturini, M. (2012) Photodynamic antifungal chemotherapy†. Photochem. Photobiol., 88, 512–522. Baptista, M.S. and Wainwright, M. (2011) Photodynamic antimicrobial chemotherapy (PACT) for the treatment of malaria, leishmaniasis and trypanosomiasis. Braz. J. Med. Biol. Res., 44, 1–10. Cassidy, C.M., Tunney, M.M., McCarron, P.A., and Donnelly, R.F. (2009) Drug delivery strategies for photodynamic antimicrobial chemotherapy: from benchtop to clinical practice. J. Photochem. Photobiol., B, 95, 71–80. Zhang, L.W., Fang, Y.P., and Fang, J.Y. (2011) Enhancement techniques for improving 5-aminolevulinic acid delivery through the skin. Dermatol. Sin., 29, 1–7. Felgentrager, A., Maisch, T., Dobler, D., and Spath, A. (2013) Hydrogen bond acceptors and additional cationic charges in methylene blue derivatives: photophysics and antimicrobial efficiency. Biomed. Res. Int., 2013, 482167. Fukuda, H., Casas, A., and Batlle, A. (2006) Use of ALA and ALA derivatives for optimizing ALA-based photodynamic therapy: a review of our experience. J. Environ. Pathol. Toxicol. Oncol., 25, 127–143. Lopez, R.F., Lange, N., Guy, R., and Bentley, M.V. (2004) Photodynamic therapy of skin cancer: controlled drug delivery of 5-ALA and its esters. Adv. Drug Deliv. Rev., 56, 77–94. Giuntini, F., Bourre, L., MacRobert, A.J., Wilson, M., and Eggleston, I.M. (2009) Improved peptide prodrugs of 5-ALA for PDT: rationalization of cellular accumulation and protoporphyrin IX production by direct determination of cellular prodrug uptake and prodrug metabolization. J. Med. Chem., 52, 4026–4037. Bourre, L., Giuntini, F., Eggleston, I.M., Wilson, M., and MacRobert, A.J. (2009) 313 314 10 80. 81. 82. 83. 84. 85. 86. Photodynamic Antimicrobial Chemotherapy Protoporphyrin IX enhancement by 5aminolaevulinic acid peptide derivatives and the effect of RNA silencing on intracellular metabolism. Br. J. Cancer, 100, 723–731. Vallinayagam, R., Schmitt, F., Barge, J., Wagnieres, G., Wenger, V., Neier, R., and Juillerat-Jeanneret, L. (2008) Glycoside esters of 5-aminolevulinic acid for photodynamic therapy of cancer. Bioconjug. Chem., 19, 821–839. Fotinos, N., Convert, M., Piffaretti, J.-C., Gurny, R., and Lange, N. (2008) Effects on gram-negative and gram-positive bacteria mediated by 5-aminolevulinic acid and 5-aminolevulinic acid derivatives. Antimicrob. Agents Chemother., 52, 1366–1373. Gerritsen, M.J.P., Smits, T., Kleinpenning, M.M., van de Kerkhof, P.C.M., and van Erp, P.E.J. (2009) Pretreatment to enhance protoporphyrin IX accumulation in photodynamic therapy. Dermatology, 218, 193–202. Juzeniene, A., Juzenas, P., Kaalhus, O., Iani, V., and Moan, J. (2002) Temperature effect on accumulation of protoporphyrin IX after topical application of 5-aminolevulinic acid and its methylester and hexylester derivatives in normal mouse skin. Photochem. Photobiol., 76, 452–456. Ramstad, S., Le Anh-Vu, N., and Johnsson, A. (2006) The temperature dependence of porphyrin production in Propionibacterium acnes after incubation with 5-aminolevulinic acid (ALA) and its methyl ester (m-ALA). Photochem. Photobiol. Sci., 5, 66–72. Yang, J.B., Chen, A.C.H., Wu, Q.H., Jiang, S., Liu, X.M., Xiong, L.Y., and Xia, Y.M. (2010) The influence of temperature on 5-aminolevulinic acid-based photodynamic reaction in keratinocytes in vitro. Photodermatol. Photoimmunol. Photomed., 26, 83–88. Donnelly, R.F., McCarron, P.A., and Woolfson, A.D. (2005) Drug delivery of aminolevulinic acid from topical formulations intended for photodynamic therapy. Photochem. Photobiol., 81, 750–767. 87. Hsieh, M.-F. and Chen, C.-H. (2012) 88. 89. 90. 91. 92. 93. 94. 95. Review: delivery of pharmaceutical agents to treat acne vulgaris: current status and perspectives. J. Med. Biol. Eng., 32, 215–223. de Leeuw, J., van der Beek, N., Bjerring, P., and Neumann, H.A.M. (2010) Photodynamic therapy of acne vulgaris using 5-aminolevulinic acid 0.5% liposomal spray and intense pulsed light in combination with topical keratolytic agents. J. Eur. Acad. Dermatol. Venereol., 24, 460–469. de Campos Araújo, L.M.P., Thomazine, J.A., and Lopez, R.F.V. (2010) Development of microemulsions to topically deliver 5-aminolevulinic acid in photodynamic therapy. Eur. J. Pharm. Biopharm., 75, 48–55. Winkler, A. and Müller-Goymann, C.C. (2005) The influence of topical formulations on the permeation of 5-aminolevulinic acid and its n-butyl ester through excised human stratum corneum. Eur. J. Pharm. Biopharm., 60, 427–437. Dragicevic-Curic, N. and Fahr, A. (2012) Liposomes in topical photodynamic therapy. Expert Opin. Drug Deliv., 9, 1015–1032. Donnelly, R.F., Morrow, D.I.J., McCarron, P.A., Woolfson, A.D., Morrissey, A., Juzenas, P., Juzeniene, A., Iani, V., McCarthy, H.O., and Moan, J. (2008) Microneedle-mediated intradermal delivery of 5-aminolevulinic acid: Potential for enhanced topical photodynamic therapy. J. Control. Release, 129, 154–162. Donnelly, R.F., Singh, T.R.R., Tunney, M.M., Morrow, D.I.J., McCarron, P.A., O’Mahony, C., and Woolfson, A.D. (2009) Microneedle arrays allow lower microbial penetration than hypodermic needles in vitro. Pharm. Res., 26, 2513–2522. Morrow, D.I.J. and Donnelly, R.F. (2009) Novel drug delivery strategies for porphyrins and porphyrin precursors. Paper Presented at the Photodynamic Therapy: Back to the Future, Seattle, WA. Morrow, D.I.J., Garland, M.J., McCarron, P.A., Woolfson, A.D., and References 96. 97. 98. 99. 100. 101. 102. 103. Donnelly, R.F. (2007) Innovative drug delivery strategies for topical photodynamic therapy using porphyrin precursors. J. Environ. Pathol. Toxicol. Oncol., 26, 105–116. Morrow, D.I.J., McCarron, P.A., Woolfson, A.D., Juzenas, P., Juzeniene, A., Iani, V., Moan, J., and Donnelly, R.F. (2010) Novel patch-based systems for the localised delivery of ALA-esters. J. Photochem. Photobiol., B, 101, 59–69. Donnelly, R.F., McCarron, P.A., Morrow, D.I.J., and Woolfson, A.D. (2013) Fast-drying multi-laminate bioadhesive films for transdermal and topical drug delivery. Drug Dev. Ind. Pharm., 39, 1818–1831. Donnelly, R.F., McCarron, P.A., and Woolfson, D. (2009) Drug delivery systems for photodynamic therapy. Recent Pat. Drug Deliv. Formul., 3, 1–7. Fallows, S.J., Garland, M.J., Cassidy, C.M., Tunney, M.M., Singh, T.R.R., and Donnelly, R.F. (2012) Electricallyresponsive anti-adherent hydrogels for photodynamic antimicrobial chemotherapy. J. Photochem. Photobiol., B, 114, 61–72. Donnelly, R.F., Cassidy, C.M., Loughlin, R.G., Brown, A., Tunney, M.M., Jenkins, M.G., and McCarron, P.A. (2009) Delivery of Methylene blue and meso-tetra (N-methyl-4-pyridyl) porphine tetra tosylate from crosslinked poly(vinyl alcohol) hydrogels: a potential means of photodynamic therapy of infected wounds. J. Photochem. Photobiol., B, 96, 223–231. Ali, M.H.M., Hashem, M.M., Zaher, A., Korraa, S., Hamouda, F., Ali, C.M., and Al-Saad, K.A. (2013) Photodynamic therapy for hair removal. QSci. Connect, 16, 1–10. Cassidy, C.M., Tunney, M.M., Magee, N.D., Elborn, J.S., Bell, S., Singh, T.R.R., and Donnelly, R.F. (2011) Drug and light delivery strategies for photodynamic antimicrobial chemotherapy (PACT) of pulmonary pathogens: a pilot study. Photodiagnosis Photodyn. Ther., 8, 1–6. Fadel, M., Salah, M., Samy, N., and Soliman, M. (2009) Liposomal methylene blue hydrogel for selective 104. 105. 106. 107. 108. 109. 110. 111. 112. photodynamic therapy of acne vulgaris. J. Drugs Dermatol., 8, 983–990. Mordon, S., Sumian, C., and Devoisselle, J.M. (2003) Site-specific methylene blue delivery to pilosebaceous structures using highly porous nylon microspheres: an experimental evaluation. Lasers Surg. Med., 33, 119–125. Well, D. (2013) Acne vulgaris: a review of causes and treatment options. Nurse Pract., 38, 22–31; quiz 32. Nakonechny, F., Nisnevitch, M., Nitzan, Y., and Firer, M.A. (2011) New techniques in antimicrobial photodynamic therapy: scope of application and overcoming drug resistance in nosocomial infections, in Science Against Microbial Pathogens: Communicating Current Research and Technological Advances, Formatex Research Center Publisher, Spain. Nitzan, Y. and Pechatnikov, I. (2011) in Photodynamic Inactivation of Microbial Pathogens – Medical and Environmental Applications (eds M.R. Hamblin and G. Jori), Royal Society of Chemistry Publishing, pp. 45–67. Nakonechny, F., Firer, M.A., Nitzan, Y., and Nisnevitch, M. (2010) Intracellular antimicrobial photodynamic therapy: a novel technique for efficient eradication of pathogenic bacteria. Photochem. Photobiol., 86, 1350–1355. Nisnevitch, M., Nakonechny, F., Firer, M., and Nitzan, Y. (2009) Photodynamic antimicrobial chemotherapy with photosensitizers in liposomes under external and chemiluminescent excitation. FEBS J., 276, 332–332. Garland, M.J., Cassidy, C.M., Woolfson, D., and Donnelly, R.F. (2009) Designing photosensitizers for photodynamic therapy: strategies, challenges and promising developments. Future Med. Chem., 1, 667–691. Demidova, T.N. and Hamblin, M.R. (2004) Photodynamic therapy targeted to pathogens. Int. J. Immunopathol. Pharmacol., 17, 245–254. Sharma, S.K., Dai, T., Kharkwal, G.B., Huang, Y.-Y., Huang, L., De Arce, V.J.B., Tegos, G.P., and Hamblin, M.R. (2011) 315 316 10 113. 114. 115. 116. 117. 118. 119. 120. 121. 122. Photodynamic Antimicrobial Chemotherapy Drug discovery of antimicrobial photosensitizers using animal models. Curr. Pharm. Des., 17, 1303–1319. George, S., Hamblin, M.R., and Kishen, A. (2009) Uptake pathways of anionic and cationic photosensitizers into bacteria. Photochem. Photobiol. Sci., 8, 788–795. Wainwright, M. and Crossley, K.B. (2002) Methylene blue – a therapeutic dye for all seasons? J. Chemother., 14, 431–443. Prates, R.A., Kato, I.T., Ribeiro, M.S., Tegos, G.P., and Hamblin, M.R. (2011) Influence of multidrug efflux systems on methylene blue-mediated photodynamic inactivation of Candida albicans. J. Antimicrob. Chemother., 66, 1525–1532. Nitzan, Y., Salmon-Divon, M., Shporen, E., and Malik, Z. (2004) ALA induced photodynamic effects on gram positive and negative bacteria. Photochem. Photobiol. Sci., 3, 430–435. Szeimies, R.-M. (2003) Photodynamic therapy for human papilloma virusrelated diseases in dermatology. Med. Laser Appl., 18, 107–116. Rossi, R., Bruscino, N., Ricceri, F., Grazzini, M., Dindelli, M., and Lotti, T. (2009) Photodynamic treatment for viral infections of the skin. G. Ital. Dermatol. Venereol., 144, 79–83. Verkamp, E., Backman, V.M., Bjornsson, J.M., Soll, D., and Eggertsson, G. (1993) The periplasmic dipeptide permease system transports 5-aminolevulinic acid in escherichiacoli. J. Bacteriol., 175, 1452–1456. Elliott, T. (1993) Transport of 5aminolevulinic acid by the dipeptide permease in salmonella-typhimurium. J. Bacteriol., 175, 325–331. King, N.D. and Obrian, M.R. (1997) Identification of the lrp gene in Bradyrhizobium japonicum and its role in regulation of delta-aminolevulinic acid uptake. J. Bacteriol., 179, 1828–1831. Bermudez Moretti, M., Perullini, A.M., Batlle, A., and Correa Garcia, S. (2005) Expression of the UGA4 gene encoding the delta-aminolevulinic and gamma-aminobutyric acids permease in 123. 124. 125. 126. 127. 128. 129. 130. 131. Saccharomyces cerevisiae is controlled by amino acid-sensing systems. Arch. Microbiol., 184, 137–140. Bermudez Moretti, M., Correa Garcia, S., and Batlle, A. (2000) Porphyrin biosynthesis intermediates are not regulating delta-aminolevulinic acid transport in Saccharomyces cerevisiae. Biochem. Biophys. Res. Commun., 272, 946–950. Moretti, M.B., Batlle, A., and Garcia, S.C. (2001) UGA4 gene encoding the gamma-aminobutyric acid permease in Saccharomyces cerevisiae is an acidexpressed gene. Int. J. Biochem. Cell Biol., 33, 1202–1207. Phoenix, D.A. and Harris, F. (2010) in Froniters in Anti-infective Drug Discovery (eds A. Rahman and M.I. Choudhary), Benthams, London, pp. 17–48. Krammer, B., Malik, Z., Pottier, R., and Stepp, H. (2006) in Photodynamic Therapy with ALA: A Clinical Handbook (eds R. Pottier, B. Krammer, H. Stepp, R. Baumgartner, and H. Stepp), Royal Society of Chemistry, Cambridge, pp. 15–77. Liu, B.C., Farrell, T.J., and Patterson, M.S. (2010) A dynamic model for ALAPDT of skin: simulation of temporal and spatial distributions of groundstate oxygen, photosensitizer and singlet oxygen. Phys. Med. Biol., 55, 5913–5932. Arnaut, L.G. (2011) in Advances in Inorganic Chemistry, Inorganic Photochemistry, Vol. 63 (eds R. VanEldik and G. Stochel), Elsevier Academic Press Inc., San Diego, CA, pp. 187–233. Denis, T.G.S., Dai, T.H., Izikson, L., Astrakas, C., Anderson, R.R., Hamblin, M.R., and Tegos, G.P. (2011) All you need is light antimicrobial photoinactivation as an evolving and emerging discovery strategy against infectious disease. Virulence, 2, 509–520. Pawlicki, M., Collins, H.A., Denning, R.G., and Anderson, H.L. (2009) Twophoton absorption and the design of two-photon dyes. Angew. Chem. Int. Ed., 48, 3244–3266. Ogawa, K. and Kobuke, Y. (2013) Two-photon photodynamic therapy by References 132. 133. 134. 135. 136. 137. 138. 139. 140. 141. 142. 143. water-soluble self-assembled conjugated porphyrins. Biomed. Res. Int., 2013, 125658–125658. Kozinska, A., Oles, T., and Sarna, T. (2012) Photoactivation and detection of photoexcited molecules and photochemical products. Isr. J. Chem., 52, 745–756. Ortel, B., Shea, C.R., and Calzavara-Pinton, P. (2009) Molecular mechanisms of photodynamic therapy. Front. Biosci., 14, 4157–4172. Auten, R.L. and Davis, J.M. (2009) Oxygen toxicity and reactive oxygen species: the devil is in the details. Pediatr. Res., 66, 121–127. Imlay, J.A. (2003) Pathways of oxidative damage. Annu. Rev. Microbiol., 57, 395–418. Kerdous, R., Heuvingh, J., and Bonneau, S. (2011) Photo-dynamic induction of oxidative stress within cholesterolcontaining membranes: shape transitions and permeabilization. Biochim. Biophys. Acta, 1808, 2965–2972. Yoda, T., Vestergaard, M.C., Akazawa-Ogawa, Y., Yoshida, Y., Hamada, T., and Takagi, M. (2010) Dynamic response of a cholesterolcontaining model membrane to oxidative stress. Chem. Lett., 39, 1273–1274. Girotti, A.W. (2001) Photosensitized oxidation of membrane lipids: reaction pathways, cytotoxic effects, and cytoprotective mechanisms. J. Photochem. Photobiol., B, 63, 103–113. Girotti, A.W. and Kriska, T. (2004) Role of lipid hydroperoxides in photooxidative stress signaling. Antioxid. Redox Signal., 6, 301–310. Davies, M.J. (2003) Singlet oxygenmediated damage to proteins and its consequences. Biochem. Biophys. Res. Commun., 305, 761–770. Davies, M.J. (2005) The oxidative environment and protein damage. Biochim. Biophys. Acta, 1703, 93–109. Davies, M.J. (2004) Reactive species formed on proteins exposed to singlet oxygen. Photochem. Photobiol. Sci., 3, 17–25. Barelli, S., Canellini, G., Thadikkaran, L., Crettaz, D., Quadroni, M., Rossier, 144. 145. 146. 147. 148. 149. 150. 151. 152. J.S., Tissot, J.D., and Lion, N. (2008) Oxidation of proteins: Basic principles and perspectives for blood proteomics. Proteomics Clin. Appl., 2, 142–157. Agnez-Lima, L.F., Melo, J.T.A., Silva, A.E., Oliveira, A.H.S., Timoteo, A.R.S., Lima-Bessa, K.M., Martinez, G.R., Medeiros, M.H.G., Di Mascio, P., Galhardo, R.S., and Menck, C.F.M. (2012) DNA damage by singlet oxygen and cellular protective mechanisms. Mutation Res. Rev. Mutation Res., 751, 15–28. Costa, L., Faustino, M.A.F., Neves, M.G.P.M.S., Cunha, A., and Almeida, A. (2012) Photodynamic inactivation of mammalian viruses and bacteriophages. Viruses-Basel, 4, 1034–1074. Loft, S., Danielsen, P., Løhr, M., Jantzen, K., Hemmingsen, J.G., Roursgaard, M., Karotki, D.G., and Møller, P. (2012) Urinary excretion of 8-oxo-7,8-dihydroguanine as biomarker of oxidative damage to DNA. Arch. Biochem. Biophys., 518, 142–150. Phoenix, D.A. and Harris, F. (2006) Light activated compounds as antimicrobial agents – patently obvious? Recent Pat. Antiinfect. Drug Discov., 1, 181–199. Ginimuge, P.R. and Jyothi, S.D. (2010) Methylene blue: revisited. J. Anaesthesiology, Clin. Pharmacol., 26, 517–520. Miclescu, A. and Wiklund, L. (2010) Methylene blue, an old drug with new indications? Rom. J. Anaesthesia Intensive Care, 17, 35–41. Fayter, D., Corbett, M., Heirs, M., Fox, D., and Eastwood, A. (2010) A systematic review of photodynamic therapy in the treatment of pre-cancerous skin conditions, Barrett’s oesophagus and cancers of the biliary tract, brain, head and neck, lung, oesophagus and skin. Health Technol. Assess., 14, 1–288. Rice, L., Wainwright, M., and Phoenix, D.A. (2000) Phenothiazine photosensitizers. III. Activity of methylene blue derivatives against pigmented melanoma cell lines. J. Chemother., 12, 94–104. Wainwright, M., Phoenix, D.A., Burrow, S.M., and Waring, J. (1999) Cytotoxicity 317 318 10 153. 154. 155. 156. 157. 158. 159. 160. 161. Photodynamic Antimicrobial Chemotherapy and adjuvant activity of cationic photosensitizers in a multidrug resistant cell line. J. Chemother., 11, 61–68. Schirmer, R.H., Adler, H., Pickhardt, M., and Mandelkow, E. (2011) Lest we forget you – methylene blue … . Neurobiol. Aging, 32, 2325. Ohlow, M.J. and Moosmann, B. (2011) Foundation review: phenothiazine: the seven lives of pharmacology’s first lead structure. Drug Discov. Today, 16, 119–131. Wainwright, M. (2001) Acridine – a neglected antibacterial chromophore. J. Antimicrob. Chemother., 47, 1–13. Wainwright, M. (2003) The use of dyes in modern biomedicine. Biotech. Histochem., 78, 147–155. Wainwright, M., Phoenix, D.A., Marland, J., Wareing, D.R.A., and Bolton, F.J. (1997) In-vitro photobactericidal activity of aminoacridines. J. Antimicrob. Chemother., 40, 587–589. Wainwright, M., Phoenix, D.A., Marland, J., Wareing, D.R.A., and Bolton, F.J. (1998) A comparison of the bactericidal and photobactericidal activities of aminoacridines and bis(aminoacridines). Lett. Appl. Microbiol., 26, 404–406. Nagata, J.Y., Hioka, N., Kimura, E., Batistela, V.R., Suga Terada, R.S., Graciano, A.X., Baesso, M.L., and Hayacibara, M.F. (2012) Antibacterial photodynamic therapy for dental caries: evaluation of the photosensitizers used and light source properties. Photodiagnosis Photodyn. Ther., 9, 122–131. Hasegawa, H., Sato, S., Kawauchi, S., Saitoh, D., Shinomiya, N., Ashida, H., and Terakawa, M. (2012) Control of burn wound sepsis in rats by methylene blue-mediated photodynamic treatment, in Optical Methods for Tumor Treatment and Detection: Mechanisms and Techniques in Photodynamic Therapy Xxi (eds D.H. Kessel and T. Hasan), SPIE-International Society for Optical Engineering, Bellingham. Perni, S., Prokopovich, P., Pratten, J., Parkin, I.P., and Wilson, M. (2011) Nanoparticles: their potential use 162. 163. 164. 165. 166. 167. 168. 169. 170. 171. in antibacterial photodynamic therapy. Photochem. Photobiol. Sci., 10, 712–720. Sun, G. and Hong, K.H. (2013) Photoinduced antimicrobial and decontaminating agents: recent progresses in polymer and textile applications. Text. Res. J., 83, 532–542. Garcez, A.S., Nunez, S.C., Azambuja, N. Jr., Fregnani, E.R., Rodriguez, H.M.H., Hamblin, M.R., Suzuki, H., and Ribeiro, M.S. (2013) Effects of photodynamic therapy on gram-positive and gram-negative bacterial biofilms by bioluminescence imaging and scanning electron microscopic analysis. Photomed. Laser Surg., 31, 519–525. Biel, M.A., Pedigo, L., Gibbs, A., and Loebel, N. (2013) Photodynamic therapy of antibiotic-resistant biofilms in a maxillary sinus model. Int. Forum Allergy Rhinology, 3, 468–473. Haidaris, C.G., Foster, T.H., Waldman, D.L., Mathes, E.J., McNamara, J., and Curran, T. (2013) Effective photodynamic therapy against microbial populations in human deep tissue abscess aspirates. Lasers Surg. Med., 45, 509–516. Nims, R.W. and Plavsic, M. (2013) Polyomavirus inactivation – a review. Biologicals, 41, 63–70. McClaskey, J., Xu, M., Snyder, E.L., and Tormey, C.A. (2009) Clinical trials for pathogen reduction in transfusion medicine: a review. Transfus. Apher. Sci., 41, 217–225. Pelletier, J.P.R., Transue, S., and Snyder, E.L. (2006) Pathogen inactivation techniques. Best Pract. Res. Clin. Haematol., 19, 205–242. Floyd, R.A., Schneider, J.E., and Dittmer, D.R. (2004) Methylene blue photoinactivation of RNA viruses. Antiviral Res., 61, 141–151. Sobral, P.M., Barros, A.E.d.L., Gomes, A.M.A.S., and do Bonfim, C.V. (2012) Viral inactivation in hemotherapy: systematic review on inactivators with action on nucleic acids. Rev. Bras. Hematol. Hemoter., 34, 231–235. Kato, I.T., Prates, R.A., Sabino, C.P., Fuchs, B.B., Tegos, G.P., Mylonakis, E., Hamblin, M.R., and Ribeiro, M.S. References 172. 173. 174. 175. 176. 177. 178. 179. 180. (2013) Antimicrobial photodynamic inactivation inhibits candida albicans virulence factors and reduces in vivo pathogenicity. Antimicrob. Agents Chemother., 57, 445–451. Lyon, J.P., Moreira, L.M., Dutra de Carvalho, V.S., dos Santos, F.V., de Lima, C.J., and de Resende, M.A. (2013) In vitro photodynamic therapy against foncecaea pedrosoi and cladophialophora carrionii. Mycoses, 56, 157–161. Lyon, J.P., Rezende, R.R., Rabelo, M.P., de Lima, C.J., and Moreira, L.M. (2013) Synergic effect of photodynamic therapy with methylene blue and surfactants in the inhibition of Candida albicans. Mycopathologia, 175, 159–164. Mehra, T., Borelli, C., Braunsdorf, C., Mailaender-Sanchez, D., Koeberle, M., and Schaller, M. (2013) Efficacy of antifungal PACT therapy. Mycoses, 56, 13–13. Goyal, M., Alam, A., and Bandyopadhyay, U. (2012) Redox regulation in malaria: current concepts and pharmacotherapeutic implications. Curr. Med. Chem., 19, 1475–1503. Krafts, K., Hempelmann, E., and Skorska-Stania, A. (2012) From methylene blue to chloroquine: a brief review of the development of an antimalarial therapy. Parasitol. Res., 111, 1–6. Wainwright, M. and Amaral, L. (2005) Review: the phenothiazinium chromophore and the evolution of antimalarial drugs. Trop. Med. Int. Health, 10, 501–511. Wainwright, M. (2004) Photoantimicrobials – a PACT against resistance and infection. Drugs Future, 29, 85–93. Wainwright, M., Smalley, H., and Flint, C. (2011) The use of photosensitisers in acne treatment. J. Photochem. Photobiol., B, 105, 1–5. Gursoy, H., Ozcakir-Tomruk, C., Tanalp, J., and Yilmaz, S. (2013) Photodynamic therapy in dentistry: a literature review. Clin. Oral Investig., 17, 1113–1125. 181. Rajesh, S., Koshi, E., Philip, K., and 182. 183. 184. 185. 186. 187. 188. 189. 190. 191. 192. Mohan, A. (2011) Antimicrobial photodynamic therapy: an overview. J. Indian Soc. Periodontology, 15, 323–327. Deepak, D., Urmi, D., and Neeraj, D. (2012) Photodynamic therapy: a view through light. J. Orofacial Res., 2, 82–86. Sandler, S.G. (2010) The status of pathogen-reduced plasma. Transfus. Apher. Sci., 43, 393–399. Seltsam, A. and Müller, T.H. (2013) Update on the use of pathogen-reduced human plasma and platelet concentrates. Br. J. Haematol., 162, 442–454. Wainwright, M., Mohr, H., and Walker, W.H. (2007) Phenothiazinium derivatives for pathogen inactivation in blood products. J. Photochem. Photobiol., B, 86, 45–58. Allain, J.P., Bianco, C., Blajchman, M.A., Brecher, M.E., Busch, M., Leiby, D., Lin, L., and Stramer, S. (2005) Protecting the blood supply from emerging pathogens: the role of pathogen inactivation. Transfus. Med. Rev., 19, 110–126. Wainwright, M. (2004) Photoinactivation of viruses. Photochem. Photobiol. Sci., 3, 406–411. Wainwright, M. and Baptista, M.S. (2011) The application of photosensitisers to tropical pathogens in the blood supply. Photodiagnosis Photodyn. Ther., 8, 240–248. Wainwright, M. (2002) The emerging chemistry of blood product disinfection. Chem. Soc. Rev., 31, 128–136. Wainwright, M. (2002) Pathogen inactivation in blood products. Curr. Med. Chem., 9, 127–143. Wainwright, M., Phoenix, D.A., Smillie, T.E., and Wareing, D.R.A. (2001) Phenothiaziniums as putative photobactericidal agents for red blood cell concentrates. J. Chemother., 13, 503–509. Steinmann, E., Gravemann, U., Friesland, M., Doerrbecker, J., Mueller, T.H., Pietschmann, T., and Seltsam, A. (2013) Two pathogen reduction technologiesmethylene blue plus light and shortwave ultraviolet lighteffectively 319 320 10 193. 194. 195. 196. 197. 198. 199. 200. 201. 202. Photodynamic Antimicrobial Chemotherapy inactivate hepatitis C virus in blood products. Transfusion, 53, 1010–1018. Seghatchian, J. and Tolksdorf, F. (2012) Characteristics of the THERAFLEX UV-Platelets pathogen inactivation system – an update. Transfus. Apher. Sci., 46, 221–229. Mohammadi, Z., Palazzi, F., Giardino, L., and Shalavi, S. (2013) Microbial biofilms in endodontic infections: an update review. Biomed. J., 36, 59–70. Javed, F. and Romanos, G.E. (2013) Does photodynamic therapy enhance standard antibacterial therapy in dentistry? Photomed. Laser Surg., 31, 512–518. Oruba, Z., Chomyszyn-Gajewska, M., and Macyk, W. (2012) Application of the photodynamic therapy in medicine and dentistry: literature review on photodynamic and antimicrobial photodynamic therapy. BIODEVICES 2012 – Proceedings of the International Conference on Biomedical Electronics and Devices 2012, pp. 190-195. Vlahova, A.P., Kisov, C.K., Popova, E.V., Haydushka, I.A., and Mantareva, V.N. (2012) A new method for photodynamic disinfection of prosthetic constructions and impressions in prosthetic dentistry. Folia Med., 54, 51–57. Sudhakara, R.R., Ramya, K., Ramesh, T., Subbarayudu, G., Sai, M.N., and Sai, K.C.H. (2012) Photodynamic therapy in oral diseases. Int. J. Biol. Med. Res., 3, 1875–1883. Guglielmi, C.d.A.B., Simionato, M.R.L., Ramalho, K.M., Imparato, J.C.P., Pinheiro, S.L., and Luz, M.A.A.C. (2011) Clinical use of photodynamic antimicrobial chemotherapy for the treatment of deep carious lesions. J. Biomed. Opt., 16, 088003–088003-7. Pratten, J., Benhamou, V., and Street, C. (2011) Antimicrobial Photodynamic Therapy (aPDT) for Oral Infections. Dumetriscu, A.L. (2010) Etiology and Pathogenesis of Peridontal Disease, Springer-Verlag, Berlin. Street, C.N., Andersen, R., and Loebel, N.G. (2009) Periowave (TM) demonstrates bactericidal activity against 203. 204. 205. 206. 207. 208. 209. 210. periopathogens and leads to improved clinical outcomes in the treatment of adult periodontitis, in Optical Methods for Tumor Treatment and Detection: Mechanisms and Techniques in Photodynamic Therapy Xviii (ed. D.H. Kessel), SPIE-International Society for Optical Engineering, Bellingham. Andersen, R., Loebel, N., Hammond, D., and Wilson, M. (2007) Treatment of periodontal disease by photodisinfection compared to scaling and root planing. J. Clin. Dent., 18, 34–38. Andersen, R.C., Loebel, N.G., and Andersen, D.M. (2009) Meta-analysis of 5 photodisinfection clinical trials for periodontitis, in 12th World Congress of the International Photodynamic Association: Photodynamic Therapy: Back to the Future (ed. D.H. Kessel), SPIE, Bellingham, WA. Andersen, R.C., Loebel, N.G., and Andersen, D.M. (2009) Photodynamic dosimetry in the treatment of periodontitis, in 12th World Congress of the International Photodynamic Association: Photodynamic Therapy: Back to the Future (ed. D.H. Kessel), SPIE, Bellingham, WA. Berakdar, M., Callaway, A., Eddin, M.F., Ross, A., and Willershausen, B. (2012) Comparison between scaling-rootplaning (SRP) and SRP/photodynamic therapy: six-month study. Head Face Med., 8, 12. Ge, L., Shu, R., Li, Y., Li, C., Luo, L., Song, Z., Xie, Y., and Liu, D. (2011) Adjunctive effect of photodynamic therapy to scaling and root planing in the treatment of chronic periodontitis. Photomed. Laser Surg., 29, 33–37. Benhamou, V. (2009) Photodisinfection: the future of periodontal therapy. Dent. Today, 28, 108–109. Parker, K. (2009) Photodynamic antimicrobial chemotherapy in the general dental practice. J. Laser Dent., 17, 131–138. Perez, M., Rodriguez, B., Shintani, T., Watanabe, K.S.M., and Harrigan, R. (2010) 5-Aminolevulinic Acid (5-ALA): analysis of preclinical and safety literature. Food Nutr. Sci., 4, 1009–1013. References 211. Sharma, S.K., Mroz, P., Dai, T.H., 212. 213. 214. 215. 216. 217. 218. 219. Huang, Y.Y., St Denis, T.G., and Hamblin, M.R. (2012) Photodynamic therapy for cancer and for infections: what is the difference? Isr. J. Chem., 52, 691–705. Luksiene, Z. and Brovko, L. (2013) Antibacterial photosensitization-based treatment for food safety. Food Eng. Rev., 5, 185–199. Smijs, T.G.M. and Pavel, S. (2011) The susceptibility of dermatophytes to photodynamic treatment with special focus on trichophyton rubrum. Photochem. Photobiol., 87, 2–13. Giomi, B., Mastrolorenzo, A., Tiradritti, L., and Zuccati, G. (2012) Off label treatments of genital warts: the role of photodynamic therapy. G. Ital. Dermatol. Venereol., 147, 467–474. Sakamoto, F.H., Lopes, J.D., and Anderson, R.R. (2010) Photodynamic therapy for acne vulgaris: a critical review from basics to clinical practice Part I. Acne vulgaris: when and why consider photodynamic therapy? J. Am. Acad. Dermatol., 63, 183–193. Dietel, W., Pottier, R., Pfister, W., Schleier, P., and Zinner, K. (2007) 5Aminolaevulinic acid (ALA) induced formation of different fluorescent porphyrins: a study of the biosynthesis of porphyrins by bacteria of the human digestive tract. J. Photochem. Photobiol., B, 86, 77–86. Hillemanns, P., Wang, X., Staehle, S., Michels, W., and Dannecker, C. (2006) Evaluation of different treatment modalities for vulvar intraepithelial neoplasia (VIN): CO2 laser vaporization, photodynamic therapy, excision and vulvectomy. Gynecol. Oncol., 100, 271–275. Oriel, S. and Nitzan, Y. (2010) Photoinactivation of Candida albicans by its own endogenous porphyrins. Curr. Microbiol., 60, 117–123. Smith, T.G. and Kain, K.C. (2004) Inactivation of plasmodium falciparum by photodynamic excitation of heme-cycle intermediates derived from deltaaminolevulinic acid. J. Infect. Dis., 190, 184–191. 220. Komatsuya, K., Hata, M., Balogun, E.O., 221. 222. 223. 224. 225. 226. 227. Hikosaka, K., Suzuki, S., Takahashi, K., Tanaka, T., Nakajima, M., Ogura, S.-I., Sato, S., and Kita, K. (2013) Synergy of ferrous ion on 5-aminolevulinic acid mediated growth inhibition of plasmodium falciparum. J. Biochem., 154, 501–504. Lee, Y. and Baron, E.D. (2011) Photodynamic therapy: current evidence and applications in dermatology. Semin. Cutan. Med. Surg., 30, 199–209. van der Snoek, E.M., Robinson, D.J., van Hellemond, J.J., and Neumann, H.A.M. (2008) A review of photodynamic therapy in cutaneous leishmaniasis. J. Eur. Acad. Dermatol. Venereol., 22, 918–922. Akilov, O.E., Kosaka, S., O’Riordan, K., and Hasan, T. (2007) Parasiticidal effect of delta-aminolevulinic acid-based photodynamic therapy for cutaneous leishmaniasis is indirect and mediated through the killing of the host cells. Exp. Dermatol., 16, 651–660. Kosaka, S., Akilov, O.E., O’Riordan, K., and Hasan, T. (2007) A mechanistic study of delta-aminolevulinic acid-based photodynamic therapy for cutaneous leishmaniasis. J. Invest. Dermatol., 127, 1546–1549. Zawislak, A., Donnelly, R.F., McCluggage, W.G., Price, J.H., McClelland, H.R., Woolfson, A.D., Dobbs, S., Maxwell, P., and McCarron, P.A. (2009) Clinical and immunohistochemical assessment of vulval intraepithelial neoplasia following photodynamic therapy using a novel bioadhesive patch-type system loaded with 5-aminolevulinic acid. Photodiagnosis Photodyn. Ther., 6, 28–40. Fabbrocini, G., Di Costanzo, M.P., Riccardo, A.M., Quarto, M., Colasanti, A., Roberti, G., and Monfrecola, G. (2001) Photodynamic therapy with topical [delta]-aminolaevulinic acid for the treatment of plantar warts. J. Photochem. Photobiol., B, 61, 30–34. Smucler, R. and Jatsova, E. (2005) Comparative study of aminolevulic acid photodynamic therapy plus pulsed dye laser versus pulsed dye laser alone in 321 322 10 228. 229. 230. 231. 232. 233. 234. 235. 236. Photodynamic Antimicrobial Chemotherapy treatment of viral warts. Photomed. Laser Surg., 23, 202–205. Ayala, F., Grimaldi, E., Perfetto, B., Donnarumma, M., De Filippis, A., Donnarumma, G., and Tufano, M.A. (2008) 5-aminolaevulinic acid and photodynamic therapy reduce HSV1 replication in HaCat cells through an apoptosis-independent mechanism. Photodermatol. Photoimmunol. Photomed., 24, 237–243. Li, X., Guo, H., Tian, Q.Z., Zheng, G., Hu, Y.C., Fu, Y., and Tan, H.L. (2013) Effects of 5-aminolevulinic acid-mediated photodynamic therapy on antibiotic-resistant staphylococcal biofilm: an in vitro study. J. Surg. Res., 184, 1013–1021. Taylor, E. and Brown, S. (2002) The advantages of aminolevulinic acid photodynamic therapy in dermatology. J. Dermatol. Treat., 13, s3–s11. Kostovic, K., Pastar, Z., Ceovic, R., Mokos, Z.B., Buzina, D.S., and Stanimirovic, A. (2012) Photodynamic therapy in dermatology: current treatments and implications. Coll. Anthropol., 36, 1477–1481. Luksiene, Z. and Zukauskas, A. (2009) Prospects of photosensitization in control of pathogenic and harmful micro-organisms. J. Appl. Microbiol., 107, 1415–1424. Warriner, K. and Namvar, A. (2009) What is the hysteria with Listeria? Trends Food Sci. Technol., 20, 245–254. Castillo, A.D.C., Martinez, L.H.P., and Apodaca, N.L.C. (2008) Salmonellosis and campylobacteriosis, the most prevalent zoonosis in the world. Veterinaria Mexico, 39, 81–90. Buchovec, I., Vaitonis, Z., and Luksiene, Z. (2009) Novel approach to control Salmonella enterica by modern biophotonic technology: photosensitization. J. Appl. Microbiol., 106, 748–754. Buchovec, I., Paskeviciute, E., and Luksiene, Z. (2010) Photosensitizationbased inactivation of food pathogen Listeria monocytogenes in vitro and on the surface of packaging material. J. Photochem. Photobiol. B, 99, 9–14. 237. Vaitonis, Z. and Luksiene, Z. (2010) 238. 239. 240. 241. 242. 243. 244. 245. 246. Led-based light sources for decontamination of food: modelling photosensitization-based inactivation of pathogenic bacteria. Lith. J. Phys., 50, 141–145. Luksiene, Z., Kokstaite, R., Katauskis, P., and Skakauskas, V. (2013) Novel approach to effective and uniform inactivation of gram-positive listeria monocytogenes and gram-negative salmonella enterica by photosensitization. Food Technol. Biotechnol., 51, 338–344. Stenfors Arnesen, L.P., Fagerlund, A., and Granum, P.E. (2008) From soil to gut: bacillus cereus and its food poisoning toxins. FEMS Microbiol. Rev., 32, 579–606. Luksiene, Z., Buchovec, I., and Paskeviciute, E. (2009) Inactivation of food pathogen Bacillus cereus by photosensitization in vitro and on the surface of packaging material. J. Appl. Microbiol., 107, 2037–2046. Marc, Y.L., Buchovec, I., George, S.M., Baranyi, J., and Luksiene, Z. (2009) Modelling the photosensitization-based inactivation of Bacillus cereus. J. Appl. Microbiol., 107, 1006–1011. Lemon, K.P., Earl, A.M., Vlamakis, H.C., Aguilar, C., and Kolter, R. (2008) Biofilm development with an emphasis on Bacillus subtilis. Bacterial Biofilms, 322, 1–16. Brooks, J.D. and Flint, S.H. (2008) Biofilms in the food industry: problems and potential solutions. Int. J. Food Sci. Technol., 43, 2163–2176. Gandhi, M. and Chikindas, M.L. (2007) Listeria: a foodborne pathogen that knows how to survive. Int. J. Food Microbiol., 113, 1–15. Luksiene, Z., Danilcenko, H., Taraseviciene, Z., Anusevicius, Z., Maroziene, A., and Nivinskas, H. (2007) New approach to the fungal decontamination of wheat used for wheat sprouts: effects of aminolevulinic acid. Int. J. Food Microbiol., 116, 153–158. Memon, S., Hou, X., Wang, L., and Li, Y. (2009) Promotive effect of 5aminolevulinic acid on chlorophyll, References 247. 248. 249. 250. 251. 252. 253. 254. 255. antioxidative enzymes and photosynthesis of Pakchoi (Brassica campestris ssp. chinensis var. communis Tsen et Lee). Acta Physiol. Plant., 31, 51–57. Korkmaz, A. and Korkmaz, Y. (2009) Promotion by 5-aminolevulenic acid of pepper seed germination and seedling emergence under low-temperature stress. Sci. Hortic., 119, 98–102. Zhang, W.F., Zhang, F., Raziuddin, R., Gong, H.J., Yang, Z.M., Lu, L., Ye, Q.F., and Zhou, W.J. (2008) Effects of 5-aminolevulinic acid on oilseed rape seedling growth under herbicide toxicity stress. J. Plant Growth Regul., 27, 159–169. Korkmaz, A., Korkmaz, Y., and Demirkiran, A.R. (2010) Enhancing chilling stress tolerance of pepper seedlings by exogenous application of 5-aminolevulinic acid. Environ. Exp. Bot., 67, 495–501. Yiannikouris, A. and Jouany, J.P. (2002) Mycotoxins in feeds and their fate in animals: a review. Anim. Res., 51, 81–99. Kumar, V., Basu, M.S., and Rajendran, T.P. (2008) Mycotoxin research and mycoflora in some commercially important agricultural commodities. Crop Prot., 27, 891–905. Reddy, K.R.N., Abbas, H.K., Abel, C.A., Shier, W.T., Oliveira, C.A.F., and Raghavender, C.R. (2009) Mycotoxin contamination of commercially important agricultural commodities. Toxin Rev., 28, 154–168. Burge, S. and Wallis, D. (2010) Oxford Handbook of Medical Dermatology, Oxford University Press, Oxford. Olejek, A., Kozak-Darmas, I., Kellas-Sleczka, S., Steplewska, K., Biniszkiewicz, T., Birkner, B., Jarek, A., Nowak, L., Stencel-Gabriel, K., and Sieron, A. (2009) Effectiveness of photodynamic therapy in the treatment of Lichen sclerosus: cell changes in immunohistochemistry. Neuroendocrinol. Lett., 30, 547–551. Sotiriou, E., Panagiotidou, D., and Ioannidis, D. (2008) An open trial of 5-aminolevulinic acid photodynamic therapy for vulvar lichen sclerosus. Eur. 256. 257. 258. 259. 260. 261. 262. 263. 264. 265. J. Obstet. Gynecol. Reprod. Biol., 141, 187–188. Zawislak, A.A., McCluggage, W.G., Donnelly, R.F., Maxwell, P., Price, J.H., Dobbs, S.P., McClelland, H.R., Woolfson, A.D., and McCarron, P.A. (2009) Response of vulval lichen sclerosus and squamous hyperplasia to photodynamic treatment using sustained topical delivery of aminolevulinic acid from a novel bioadhesive patch system. Photodermatol. Photoimmunol. Photomed., 25, 111–113. Eisendle, K. and Zelger, B. (2009) The expanding spectrum of cutaneous borreliosis. G. Ital. Dermatol. Venereol., 144, 157–171. Hillemanns, P., Untch, M., Prove, F., Baumgartner, R., Hillemanns, M., and Korell, M. (1999) Photodynamic therapy of vulvar lichen sclerosus with 5-aminolevulinic acid. Obstet. Gynecol., 93, 71–74. Gannon, M.J. and Brown, S.B. (1999) Photodynamic therapy and its applications in gynaecology. Br. J. Obstet. Gynaecol., 106, 1246–1254. Horn, M. and Wolf, P. (2007) Topical methyl aminolevulinate photodynamic therapy for the treatment of folliculitis. Photodermatol. Photoimmunol. Photomed., 23, 145–147. Bernard, P. (2008) Management of common bacterial infections of the skin. Curr. Opin. Infect. Dis., 21, 122–128. Taylor, M.N. and Gonzalez, M.L. (2009) The practicalities of photodynamic therapy in acne vulgaris. Br. J. Dermatol., 160, 1140–1148. Arshdeep, A. (2013) What’s new in the management of acne? Indian J. Dermatol. Venereol. Leprol., 79, 279–287. Rai, R. and Natarajan, K. (2013) Laser and light based treatments of acne. Indian J. Dermatol. Venereol. Leprol., 79, 300–309. Ma, L., Xiang, L.-H., Yu, B., Yin, R., Chen, L., Wu, Y., Tan, Z.-J., Liu, Y.-B., Tian, H.-Q., Li, H.-Z., Lin, T., Wang, X.-L., Li, Y.-H., Wang, W.-Z., Yang, H.L., and Lai, W. (2013) Low-dose topical 5-aminolevulinic acid photodynamic therapy in the treatment of different 323 324 10 266. 267. 268. 269. 270. 271. 272. 273. 274. Photodynamic Antimicrobial Chemotherapy severity of acne vulgaris. Photodiagnosis Photodyn. Ther., 10, 583–590. Yang, G.-L., Zhao, M., Wang, J.-M., He, C.-F., Luo, Y., Liu, H.-Y., Gao, J., Long, C.-Q., and Bai, J.-R. (2013) Short-term clinical effects of photodynamic therapy with topical 5-aminolevulinic acid for facial acne conglobata: an open, prospective, parallel-arm trial. Photodermatol. Photoimmunol. Photomed., 29, 233–238. Godal, A., Klaveness, J., and Morris, H. (2013) Treatment of acne using derivatives of 5-Aminolevulinic acid. US Patent 8,546,447 B2, Photocure ASA. Andersson, R.R. (2012) Topical aminolevulinic acid-photodynamic therapy for the treatment of acne vulgaris. US Patent 2012/0296263 A1, The General Hospital Corporation D/B/A Massachusetts General Hospital. Lomholt, H.B. and Kilian, M. (2008) Is acne caused by colonization with the “wrong” strain of Propionibacterium acnes? A review of the role of propionibacterium acnes in acne. Ugeskr. Laeger, 170, 1234–1237. Bhate, K. and Williams, H.C. (2013) Epidemiology of acne vulgaris. Br. J. Dermatol., 168, 474–485. Del Rosso, J.Q. and Kircik, L.H. (2013) The sequence of inflammation, relevant biomarkers, and the pathogenesis of acne vulgaris:what does recent research show and what does it mean to the clinician? J. Drugs Dermatol., 12, S109–S115. Itoh, Y., Ninomiya, Y., Tajima, S., and Ishibashi, A. (2001) Photodynamic therapy of acne vulgaris with topical delta-aminolaevulinic acid and incoherent light in Japanese patients. Br. J. Dermatol., 144, 575–579. Itoh, Y., Ninomiya, Y., Tajima, S., and Ishibashi, A. (2000) Photodynamic therapy for acne vulgaris with topical 5-aminolevulinic acid. Arch. Dermatol., 136, 1093–1095. Hongcharu, W., Taylor, C.R., Chang, Y.C., Aghassi, D., Suthamjariya, K., and Anderson, R.R. (2000) Topical ALA-photodynamic therapy for the 275. 276. 277. 278. 279. 280. 281. 282. 283. treatment of acne vulgaris. J. Invest. Dermatol., 115, 183–192. Ramberg, K., Melo, T.B., and Johnsson, A. (2004) In situ assessment of porphyrin photosensitizers in propionibacterium acnes. Z. Naturforsch. C, 59, 93–98. Ashkenazi, H., Malik, Z., Harth, Y., and Nitzan, Y. (2003) Eradication of propionibacterium acnes by its endogenic porphyrins after illumination with high intensity blue light. FEMS Immunol. Med. Microbiol., 35, 17–24. Fotinos, N., Mikulic, J., Convert, M., Campo, M.A., Piffaretti, J.C., Gurny, R., and Lange, N. (2009) 5-ALA derivative-mediated photoinactivation of propionibacterium acnes. J. Dermatol. Sci., 56, 212–214. Divaris, D.X.G., Kennedy, J.C., and Pottier, R.H. (1990) Phototoxic damage to sebaceous glands and hair-follicles of mice after systemic administration of 5-aminolevulinic acid correlates with localized protoporphyrin-Ix fluorescence. Am. J. Pathol., 136, 891–897. Sakamoto, F.H., Tannous, Z., Doukas, A.G., Farinelli, W.A., Smith, N.A., Zurakowski, D., and Anderson, R.R. (2009) Porphyrin distribution after topical aminolevulinic acid in a novel porcine model of sebaceous skin. Lasers Surg. Med., 41, 154–160. Kosaka, S., Kawana, S., Zouboulis, C.C., Hasan, T., and Ortel, B. (2006) Targeting of sebocytes by aminolevulinic acid-dependent photosensitization. Photochem. Photobiol., 82, 453–457. Pollock, B., Turner, D., Stringer, M.R., Bojar, R.A., Goulden, V., Stables, G.I., and Cunliffe, W.J. (2004) Topical aminolaevulinic acid-photodynamic therapy for the treatment of acne vulgaris: a study of clinical efficacy and mechanism of action. Br. J. Dermatol., 151, 616–622. Bryld, L.E. and Jemec, G.B.E. (2006) The bacterial flora of the skin surface following routine MAL-PDT. J. Dermatol. Treat., 17, 222–223. Bisland, S.K., Chien, C., Wilson, B.C., and Burch, S. (2006) Pre-clinical in vitro and in vivo studies to examine the References 284. 285. 286. 287. 288. 289. 290. 291. potential use of photodynamic therapy in the treatment of osteomyelitis. Photochem. Photobiol. Sci., 5, 31–38. Bisland, S.K., Chien, C., Wilson, B.C., and Burch, S. (2005) Pre-clinical in vitro and in vivo studies to examine the potential use of photodynamic therapy in the treatment of osteomyelitis. Opt. Methods Tumor Treat. Detect.: Mech. Techn. Photodyn. Ther. XIV , 5689, 26–38. Nitzan, Y. and Kauffman, M. (1999) Endogenous porphyrin production in bacteria by delta-aminolaevulinic acid and subsequent bacterial photoeradication. Lasers Med. Sci., 14, 269–277. Grinholc, M., Szramka, B., Olender, K., and Graczyk, A. (2007) Bactericidal effect of photodynamic therapy against methicillin-resistant Staphylococcus aureus strain with the use of various porphyrin photosensitizers. Acta Biochim. Pol., 54, 665–670. Karrer, S., Szeimies, R.M., Ernst, S., Abels, C., Baumler, W., and Landthaler, M. (1999) Photodynamic inactivation of staphylococci with 5-aminolaevulinic acid or photofrin. Lasers Med. Sci., 14, 54–61. Wiegell, S.R., Kongshoj, B., and Wulf, H.C. (2006) Mycobacterium marinum infection cured by photodynamic therapy. Arch. Dermatol., 142, 1241–1242. Rallis, E. and Koumantaki-Mathioudaki, E. (2007) Treatment of Mycobacterium marinum cutaneous infections. Expert Opin. Pharmacother., 8, 2965–2978. Bruce-Micah, R., Huettenberger, D., Freitag, L., Cullum, J., and Foth, H.J. (2009) Pharmacokinetic of ALA and hALA induced porphyrins in the models Mycobacterium phlei and Mycobacterium smegmatis. J. Photochem. Photobiol., B, 97, 1–7. Wilder-Smith, C.H., Wilder-Smith, P., Grosjean, P., van den Bergh, H., Woodtli, A., Monnier, P., Dorta, G., Meister, F., and Wagnieres, G. (2002) Photoeradication of helicobacter pylori using 5-aminolevulinic acid: preliminary human studies. Lasers Surg. Med., 31, 18–22. 292. Ramstad, S., Futsaether, C.M., and 293. 294. 295. 296. 297. 298. 299. 300. 301. 302. Johnsson, A. (1997) Porphyrin sensitization and intracellular calcium changes in the prokaryote Propionibacterium acnes. J. Photochem. Photobiol., B, 40, 141–148. Lee, C.F., Lee, C.J., Chen, C.T., and Huang, C.T. (2004) deltaAminolaevulinic acid mediated photodynamic antimicrobial chemotherapy on Pseudomonas aeruginosa planktonic and biofilm cultures. J. Photochem. Photobiol., B, 75, 21–25. Mitra, A. and Stables, G.I. (2006) Topical photodynamic therapy for non-cancerous skin conditions. Photodiagnosis Photodyn. Ther., 3, 116–127. Nestor, M.S. (2007) The use of photodynamic therapy for treatment of acne vulgaris. Dermatol. Clin., 25, 47–57. Taub, A.F. (2007) Procedural treatments for acne vulgaris. Dermatol. Surg., 33, 1005–1026. Buggiani, G., Troiano, M., Rossi, R., and Lotti, T. (2008) Photodynamic therapy: Off-label and alternative use in dermatological practice. Photodiagnosis Photodyn. Ther., 5, 134–138. Orth, G., Mahy, B.W.J., and van Regenmortel, M.H.V. (2008) Encyclopedia of Virology, Academic Press, Oxford, pp. 8–18. O’Riordan, K., Akilov, O.E., and Hasan, T. (2005) The potential for photodynamic therapy in the treatment of localized infections. Photodiagnosis Photodyn. Ther., 2, 247–262. Schroeter, C.A., Kaas, L., Waterval, J.J., Bos, P.M., and Neumann, H.A.M. (2007) Successful treatment of periungual warts using photodynamic therapy: a pilot study. J. Eur. Acad. Dermatol. Venereol., 21, 1170–1174. Yu, Y.E., Kuohung, V., Penrose, C., Shim, H., and Gilchrest, B.A. (2012) Letter: photodynamic therapy for treatment of hand warts. Dermatol. Surg., 38, 818–820. Yoo, K.H., Kim, B.J., and Kim, M.N. (2009) Enhanced efficacy of photodynamic therapy with methyl 5-aminolevulinic acid in recalcitrant periungual warts after ablative carbon 325 326 10 303. 304. 305. 306. 307. 308. 309. Photodynamic Antimicrobial Chemotherapy dioxide fractional laser: a pilot study. Dermatol. Surg., 35, 1927–1932. Liang, J., Lu, X.N., Tang, H., Zhang, Z., Fan, J., and Xu, J.H. (2009) Evaluation of photodynamic therapy using topical aminolevulinic acid hydrochloride in the treatment of condylomata acuminata: a comparative, randomized clinical trial. Photodermatol. Photoimmunol. Photomed., 25, 293–297. Li, X.L., Wang, X.X., Gu, J.Y., Ma, Y.E., Liu, Z.Y., and Shi, Y.L. (2013) Needlefree injection of 5-aminolevulinic acid in photodynamic therapy for the treatment of condylomata acuminata. Exp. Ther. Med., 6, 236–240. Lu, Y.-G., Yang, Y.-D., Wu, J.-J., Lei, X., Cheng, Q.-H., He, Y., and Yang, W. (2012) Treatment of perianal condyloma acuminate with topical ALA-PDT combined with curettage: outcome and safety. Photomed. Laser Surg., 30, 186–190. Ying, Z., Li, X., and Dang, H. (2013) 5-aminolevulinic acid-based photodynamic therapy for the treatment of condylomata acuminata in Chinese patients: a meta-analysis. Photodermatol. Photoimmunol. Photomed., 29, 149–159. Szeimies, R.-M., Schleyer, V., Moll, I., Stocker, M., Landthaler, M., and Karrer, S. (2009) Adjuvant photodynamic therapy does not prevent recurrence of condylomata acuminata after carbon dioxide laser ablation – a phase III, prospective, randomized, bicentric, double-blind study. Dermatol. Surg., 35, 757–764. Soergel, P., Loning, M., Staboulidou, I., Schippert, C., and Hillemanns, P. (2008) Photodynamic diagnosis and therapy in gynecology. J. Environ. Pathol. Toxicol. Oncol., 27, 307–320. Ekonjo, G.B., Saleh, Y., Kasiak, J., Gryboś, M., Teterycz, E., Korzeniewski, J., Siewiński, M., Da˛browski, A., and Małgorzata, S. (2006) In vivo application of 5-aminolevulinic acid in the treatment of papillomavirus infection in women with cervical lesions after detection and genotyping using PCR techniqueI. Int. J. Gynecol. Obstetrics, 6. 310. Wierrani, F., Kubin, A., Jindra, R., 311. 312. 313. 314. 315. 316. 317. Henry, M., Gharehbaghi, K., Grin, W., Soltz-Szotz, J., Alth, G., and Grunberger, W. (1999) 5-aminolevulinic acid-mediated photodynamic therapy of intraepithelial neoplasia and human papillomavirus of the uterine cervix – a new experimental approach. Cancer Detect. Prev., 23, 351–355. Yamaguchi, S., Tsuda, H., Takemori, M., Nakata, S., Nishimura, S., Kawamura, N., Hanioka, K., Inoue, T., and Nishimura, R. (2005) Photodynamic therapy for cervical intraepithelial neoplasia. Oncology, 69, 110–116. Soergel, P., Wang, X., Stepp, H., Hertel, H., and Hillemanns, P. (2008) Photodynamic therapy of cervical intraepithelial neoplasia with hexaminolevulinate. Lasers Surg. Med., 40, 611–615. Winters, U., Daayana, S., Lear, J.T., Tomlinson, A.E., Elkord, E., Stern, P.L., and Kitchener, H.C. (2008) Clinical and immunologic results of a phase II trial of sequential imiquimod and photodynamic therapy for vulval intraepithelial neoplasia. Clin. Cancer Res., 14, 5292–5299. Keefe, K.A., Tadir, Y., Tromberg, B., Berns, M., Osann, K., Hashad, R., and Monk, B.J. (2002) Photodynamic therapy of high-grade cervical intraepithelial neoplasia with 5-aminolevulinic acid. Lasers Surg. Med., 31, 289–293. McCarron, P.A., Donnelly, R.F., and Woolfson, A.D. (2008) Autoradiographic and scintillation analysis of 5-aminolevulinic acid permeation through epithelialised tissue: implications for topical photodynamic therapy of superficial gynaecological neoplasias. Pharm. Res., 25, 812–826. Gormley, R.H. and Kovarik, C.L. (2009) Dermatologic manifestations of HPV in HIV-infected individuals. Curr. HIV/AIDS Rep., 6, 130–138. Beachler, D.C. and D’Souza, G. (2013) Oral human papillomavirus infection and head and neck cancers in HIVinfected individuals. Curr. Opin. Oncol., 25, 503–510. References 318. Lissouba, P., Van de Perre, P., and 319. 320. 321. 322. 323. 324. 325. 326. 327. Auvert, B. (2013) Association of genital human papillomavirus infection with HIV acquisition: a systematic review and meta-analysis. Sex. Transm. Infect., 89, 350–356. Smetana, Z., Malik, Z., Orenstein, A., Mendelson, E., and BenHur, E. (1997) Treatment of viral infections with 5aminolevulinic acid and light. Lasers Surg. Med., 21, 351–358. Orth, G. (2008) Host defenses against human papillomaviruses: lessons from epidermodysplasia verruciformis. Curr. Top. Microbiol. Immunol., 321, 59–83. Szeimies, R.M., Landthaler, M., and Karrer, S. (2002) Non-oncologic indications for ALA-PDT. J. Dermatolog. Treat., 13 (Suppl. 1), S13–S18. Zampetti, A., Giurdanella, F., Manco, S., Linder, D., Gnarra, M., Guerriero, G., and Feliciani, C. (2013) Acquired epidermodysplasia verruciformis: a comprehensive review and a proposal for treatment. Dermatol. Surg., 39, 974–980. Karrer, S., Szeimies, R.M., Abels, C., Wlotzke, U., Stolz, W., and Landthaler, M. (1999) Epidermodysplasia verruciformis treated using topical 5-aminolaevulinic acid photodynamic therapy. Br. J. Dermatol., 140, 935–938. Sunohara, M., Ozawa, T., Morimoto, K., Harada, T., Ishii, M., and Fukai, K. (2012) Dye laser photodynamic therapy for Bowen’s disease in a patient with epidermodysplasia verruciformis. Osaka City Med. J., 58, 77–82. Berk, D.R., Bruckner, A.L., and Lu, D. (2009) Epidermodysplasia verruciform-like Lesions in an HIV patient. Dermatol. Online J., 15, 1. Rogers, H.D., Macgregor, J.L., Nord, K.M., Tyring, S., Rady, P., Engler, D.E., and Grossman, M.E. (2009) Acquired epidermodysplasia verruciformis. J. Am. Acad. Dermatol., 60, 315–320. Handisurya, A., Schellenbacher, C., and Kirnbauer, R. (2009) Diseases caused by human papillomaviruses (HPV). 328. 329. 330. 331. 332. 333. 334. J. Dtsch. Dermatol. Ges., 7, 453–466; quiz 466, 467. Wang, X.-L., Wang, H.-W., Yuan, K.-H., Li, F.-L., and Huang, Z. (2011) Combination of photodynamic therapy and immunomodulation for skin diseasesupdate of clinical aspects. Photochem. Photobiol. Sci., 10, 704–711. Wang, X.-L., Wang, H.-W., and Huang, Z. (2008) Combination of photodynamic therapy and immunotherapy - evolving role in dermatology. Proc. SPIE., 6857, 85704–85704, http://spie.org/Publications/Proceedings/ Paper/10.1117/12.760769 (accessed 11 July 2014). Wang, X.-L., Wang, H.-W., Guo, M.-X., and Huang, Z. (2007) Combination of immunotherapy and photodynamic therapy in the treatment of Bowenoid papulosis. Photodiagnosis Photodyn. Ther., 4, 88–93. Wang, X.-L., Wang, H.-W., and Guo, M.-X. (2007) Imiquimod immunotherapy and ALA photodynamic therapy combination for the treatment of genital bowenoid papulosis. Proc. SPIE., 6438, 43809–43809, http://spie.org/Publications/Proceedings/ Paper/10.1117/12.698774 (accessed 11 July 2014). Tao, J.-n., Duan, S.-m., and Li, J. (2007) Experimental studies on treatment of HSV infections with photodynamic therapy using 5-aminolevulinic acid. Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi, 21, 79–82. Kvacheva, Z.B., Lobanok, Y.S., Votyakov, V.I., Shukanova, N.A., Vorobey, A.V., Nikolayeva, S.N., and Titov, L.P. (2005) Photodynamic inhibition of infection caused by herpes simplex virus type 1 in the cultured cells, by using 5-aminolevulinic acidinduced porphyrins. Vopr. Virusol., 50, 44–47. Donnelly, R.F., McCarron, P.A., Ma, L.W., Juzenas, P., Iani, V., Woolfson, A.D., Zawislak, A.A., and Moan, J. (2006) Facilitated delivery of ALA to inaccessible regions via bioadhesive patch systems. J. Environ. Pathol. Toxicol. Oncol., 25, 389–402. 327 328 10 Photodynamic Antimicrobial Chemotherapy 335. Wang, X.-L., Wang, H.-W., Zhang, L.- 336. 337. 338. 339. 340. 341. 342. 343. L., Guo, M.-X., Su, L.-N., and Tao, J.-N. (2008) 5-aminolevulinic acid-mediated photodynamic diagnosis for condylomata acuminata. Zhonghua Pifuke Zazhi., 41, 296–300. Wang, X.L., Wang, H.W., Huang, Z., Stepp, H., Baumgartner, R., Dannecker, C., and Hillemanns, P. (2007) Study of protoporphyrin IX (PpIX) pharmacokinetics after topical application of 5-aminolevulinic acid in urethral condylomata acurninata. Photochem. Photobiol., 83, 1069–1073. Gold, M.H. and Moiin, A. (2007) Treatment of verrucae vulgaris and molluscum contagiosum with photodynamic therapy. Dermatol. Clin., 25, 75–80. Sohl, S., Kauer, F., Paasch, U., and Simon, J.C. (2007) Photodynamic treatment of cutaneous leishmaniasis. J. Dtsch. Dermatol. Ges., 5, 128–130. Asilian, A. and Davami, M. (2006) Comparison between the efficacy of photodynamic therapy and topical paromomycin in the treatment of Old World cutaneous leishmaniasis: a placebo-controlled, randomized clinical trial. Clin. Exp. Dermatol., 31, 634–637. Ghaffarifar, F., Jorjani, O., Mirshams, M., Miranbaygi, M.H., and Hosseini, Z.K. (2006) Photodynamic therapy as a new treatment of cutaneous leishmaniasis. East. Mediterr. Health J., 12, 902–908. Evangelou, G., Krasagakis, K., Giannikaki, E., Kruger-Krasagakis, S., and Tosca, A. (2011) Successful treatment of cutaneous leishmaniasis with intralesional aminolevulinic acid photodynamic therapy. Photodermatol. Photoimmunol. Photomed., 27, 254–256. Gardlo, K., Horska, Z., Enk, C.D., Rauch, L., Megahed, M., Ruzicka, T., and Fritsch, C. (2003) Treatment of cutaneous leishmaniasis by photodynamic therapy. J. Am. Acad. Dermatol., 48, 893–896. Enk, C.D., Fritsch, C., Jonas, F., Nasereddin, A., Ingber, A., Jaffe, C.L., and Ruzicka, T. (2003) Treatment of 344. 345. 346. 347. 348. 349. 350. cutaneous leishmaniasis with photodynamic therapy. Arch. Dermatol., 139, 432–434. Dutta, S., Furuyama, K., Sassa, S., and Chang, K.-P. (2008) Leishmania spp.: Delta-aminolevulinate-inducible neogenesis of porphyria by genetic complementation of incomplete heme biosynthesis pathway. Exp. Parasitol., 118, 629–636. Sah, J.F., Ito, H., Kolli, B.K., Peterson, D.A., Sassa, S., and Chang, K.-P. (2002) Genetic rescue of leishmania deficiency in porphyrin biosynthesis creates mutants suitable for analysis of cellular events in uroporphyria and for photodynamic therapy. J. Biol. Chem., 277, 14902–14909. Dutta, S., Chang, C., Kolli, B.K., Sassa, S., Yousef, M., Showe, M., Showe, L., and Chang, K.P. (2012) Deltaaminolevulinate-induced host-parasite porphyric disparity for selective photolysis of transgenic leishmania in the phagolysosomes of mononuclear phagocytes: a potential novel platform for vaccine delivery. Eukaryot. Cell, 11, 430–441. Kumari, S., Samant, M., Khare, P., Misra, P., Dutta, S., Kolli, B.K., Sharma, S., Chang, K.P., and Dube, A. (2009) Photodynamic vaccination of hamsters with inducible suicidal mutants of Leishmania amazonensis elicits immunity against visceral leishmaniasis. Eur. J. Immunol., 39, 178–191. Lee, J.W., Kim, B.J., and Kim, M.N. (2010) Photodynamic therapy: new treatment for recalcitrant malassezia folliculitis. Lasers Surg. Med., 42, 192–196. Lee, J.W., Lee, H.I., Kim, M.N., Kim, B.J., Chun, Y.-J., and Kim, D. (2011) Topical photodynamic therapy with methyl aminolevulinate may be an alternative therapeutic option for the recalcitrant Malassezia folliculitis. Int. J. Dermatol., 50, 488–490. Kim, Y.J. and Kim, Y.C. (2007) Successful treatment of pityriasis versicolor with 5-aminolevulinic acid photodynamic therapy. Arch. Dermatol., 143, 1218–1220. References 351. Crespo-Erchiga, V. and Florencio, V.D. 352. 353. 354. 355. 356. 357. 358. 359. 360. (2006) Malassezia yeasts and pityriasis versicollor. Curr. Opin. Infect. Dis., 19, 139–147. Monfrecola, G., Procaccini, E.M., Bevilacqua, A., Manco, A., Calabro, G., and Santoianni, P. (2004) In vitro effect of 5-aminolaevulinic acid plus visible light on Candida albicans. Photochem. Photobiol. Sci., 3, 419–422. Sukhih, G., Apolikhina, I., Aslanyan, K., Teterina, T., Ankirskaya, A., Vorozhtsov, G., and Kuzmin, S. (2011) Photodynamic Therapy – Alternative Method in Treatment of Vulvovaginal Candidiasis in Women, Medimond S R L, Bologna. Calzavara-Pinton, P.G. and Venturini, M. (2006) Photodynamic Therapy of Skin Infections, Medimond S R L, Bologna. Egusa, H., Soysa, N.S., Ellepola, A.N., Yatani, H., and Samaranayake, L.P. (2008) Oral candidosis in HIVinfected patients. Curr. HIV Res., 6, 485–499. Strakhovskaya, M.G., Shumarina, A.O., Fraikin, G.Y., and Rubin, A.B. (1999) Endogenous porphyrin accumulation and photosensitization in the yeast Saccharomyces cerevisiae in the presence of 2,2′ -dipyridyl. J. Photochem. Photobiol., B, 49, 18–22. Strakhovskaya, M.G., Shumarina, A.O., Fraikin, Y.G., and Rubin, A.B. (1998) Synthesis of protoporphyin IX induced by 5-aminolevulinic acid in yeast cells in the presence of 2,2-dipyridyl. Biochem. Moscow, 63, 859–863. Calzavara-Pinton, P.G., Venturini, M., and Sala, R. (2005) A comprehensive overview of photodynamic therapy in the treatment of superficial fungal infections of the skin. J. Photochem. Photobiol., B, 78, 1–6. Donnelly, R.F., McCarron, P.A., and Tunney, M.M. (2008) Antifungal photodynamic therapy. Microbiol. Res., 163, 1–12. Kamp, H., Tietz, H.J., Lutz, M., Piazena, H., Sowyrda, P., Lademann, J., and Blume-Peytavi, U. (2005) Antifungal effect of 5-aminolevulinic acid PDT 361. 362. 363. 364. 365. 366. 367. 368. in Trichophyton rubrum. Mycoses, 48, 101–107. Sotiriou, E., Panagiotidou, D., and Ioannides, D. (2009) 5-Aminolevulininic acid photodynamic therapy treatment for tinea cruris caused by Trichophyton rubrum: report of 10 cases. J. Eur. Acad. Dermatol. Venereol., 23, 341–342. Sotiriou, E., Koussidou-Ermonti, T., Chaidemenos, G., Apalla, Z., and Ioannides, D. (2010) Photodynamic therapy for distal and lateral subungual toenail onychomycosis caused by trichophyton rubrum: preliminary results of a single-centre open trial. Acta Derm. Venereol., 90, 216–217. Watanabe, D., Kawamura, C., Masuda, Y., Akita, Y., Tamada, Y., and Matsumoto, Y. (2008) Successful treatment of toenail onychomycosis with photodynamic therapy. Arch. Dermatol., 144, 19–21. Piraccini, B.M., Rech, G., and Tosti, A. (2008) Photodynamic therapy of onychomycosis caused by Trichophyton rubrum. J. Am. Acad. Dermatol., 59, S75–S76. Donnelly, R.F., McCarron, P.A., Lightowler, J.M., and Woolfson, A.D. (2005) Bioadhesive patch-based delivery of 5-aminolevulinic acid to the nail for photodynamic therapy of onychomycosis. J. Control. Release, 103, 381–392. Calzavara-Pinton, P.G., Venturini, M., Capezzera, R., Sala, R., and Zane, C. (2004) Photodynamic therapy of interdigital mycoses of the feet with topical application of 5-aminolevulinic acid. Photodermatol. Photoimmunol. Photomed., 20, 144–147. Sotiriou, E., Koussidou, T., Patsatsi, A., Apalla, Z., and Ioannides, D. (2009) 5-Aminolevulinic acid-photodynamic treatment for dermatophytic tinea pedis of interdigital type: a small clinical study. J. Eur. Acad. Dermatol. Venereol., 23, 203–204. Qiao, J., Li, R., Ding, Y., and Fang, H. (2010) Photodynamic therapy in the treatment of superficial mycoses: 329 330 10 Photodynamic Antimicrobial Chemotherapy an evidence-based evaluation. Mycopathologia, 170, 339–343. 369. Gupta, A.K., Chaudhry, M., and Elewski, B. (2003) Tinea corporis, tinea cruris, tinea nigra, and piedra. Dermatol. Clin., 21, 395–400. 370. Mendoza, N., Arora, A., Arias, C.A., Hernandez, C.A., Madkam, V., Tyring, S.K., Elias, J.A., Michael, R.M., and Michael, A.P. (2009) Clinical Mycology, 2nd edn, Churchill Livingstone, Edinburgh, pp. 509–523. 371. McCarthy, D.J. (2004) Origins of onychomycosis. Clin. Podiatr. Med. Surg., 21, 533–553. 372. Riddle, C.C., Terrell, S.N., Menser, M.B., Aires, D.J., and Schweiger, E.S. (2009) A review of Photodynamic Therapy (PDT) for the treatment of acne vulgaris. J. Drugs Dermatol., 8, 1010–1019. 373. Issa, M.C.A. and Manela-Azulay, M. (2010) Photodynamic therapy: a review of the literature and image documentation. An. Bras. Dermatol., 85, 501–511. 331 11 The Antimicrobial Effects of Ultrasound Frederick Harris, Sarah R. Dennison, and David A. Phoenix 11.1 Introduction Human interest in ultrasound has a long and international history [1–4] with the first detailed experiments performed in Italy by Spallanzani in the 1770s [5] indicating that non-audible sound might exist. In an attempt to explain the ability of bats to navigate flight in darkness, this author demonstrated that when blindfolded, these creatures could navigate but when their mouths were covered, they collided with obstacles [6]. These observations became known as Spallanzani’s bat problem and remained a scientific mystery until the middle of the twentieth century, when the use of a sonic detector by Donald and Griffin recorded directional ultrasound noises being emitted by bats in navigating flight [7]. In Switzerland in 1826, Colladon [8] discovered that sound traveled faster in water than in air by sounding a Church bell underwater and measuring the speed of the sound with a rear trumpet. This experimental system essentially formed the basis of modern transducers, and Colladon is generally regarded as the founder of ultrasonography [9]. Later that century, in the 1880s, Pierre Curie discovered that an electrical voltage could be produced by pressure on some types of crystals [10, 11], which are now better known as piezoelectric crystals and serve as the basis for modern ultrasound transducers that transform sound pressure into a measurable voltage [12]. However, the modern era of research into potential uses of ultrasound is generally taken to begin with work by Langevin in France [13] who in 1917 reported the death of fish near an ultrasound source during the development of sonar to detect submarines in the first World War [14]. A decade later in the United States, Woods and Loomis [15] studied the lethal effect of high-power ultrasound on a variety of organisms, including fish, frogs, and mice. Subsequent examination revealed intra-abdominal bleeding but with vibrations of lower intensity; tissue destruction was reduced. These latter authors are often credited as the first to report the biological effects of this form of radiation on living cells and tissues [16]. In Germany, in 1938, Ziess [17] studied the effects of ultrasound on the eye, which is usually taken to be the start of the field of ophthalmic ultrasonography [18]. Four years later in Austria, Dussik attempted to locate brain tumors and the Novel Antimicrobial Agents and Strategies, First Edition. Edited by David A. Phoenix, Frederick Harris and Sarah R. Dennison. © 2015 Wiley-VCH Verlag GmbH & Co. KGaA. Published 2015 by Wiley-VCH Verlag GmbH & Co. KGaA. 332 11 The Antimicrobial Effects of Ultrasound cerebral ventricles by measuring the transmission of ultrasound beams through the head [19, 20], which marks the start ultrasound use as a medical diagnostic tool [1]. In the same year in the United States, Lynn et al. [21] built and tested a high-power, focused, ultrasound transducer and produced lesions deep in bovine liver without damaging the surrounding tissue and on the basis of this work, these authors are generally recognized as the inventors of focused ultrasound therapy [22]. In 1944, Lynn and Putnam [23] proposed using ultrasound to destroy tissue, which led to a series of studies over the 1950s by Fry et al. [24–26] in the United States who investigated the effect of high-power ultrasound on the central nervous system in order to develop a modality for the noninvasive surgery of diseased tissue. Toward the end of the 1950s in the United States, these investigations led to clinical trials and the treatment of patients with Parkinson’s disease and other neurological conditions [27]. In a series of classic studies during the 1950s in Great Britain, Wild laid the foundations of ultrasonic tissue diagnosis with the publication of amplitude mode (A-mode) ultrasound investigations of surgical specimens of intestinal and breast malignancies, the development of a linear handheld brightness mode (B-mode) instrument and early descriptions of endoscopic (transrectal and transvaginal) A-mode scanning transducers in [20, 28]. In 1956, Burov and Andreevskaya [29, 30] in the USSR tested high-power ultrasound on tumors and reported an enhanced immunological effect, which led to the suggestion that this form of radiation had the potential for the treatment of cancer. Two years later in Scotland, having first realized the diagnostic potential of ultrasound in the Glasgow shipyards where it was to look for flaws in metallurgy, Donald [31] published “Investigation of Abdominal Masses by Pulsed Ultrasound” in the Lancet, which became one of the defining publications in the field of medical ultrasound [32]. This and other work paved the way for the use of diagnostic ultrasound in gynecology and this technique is now an important aid to diagnosing fetal progress during pregnancy [32, 33]. From these many pioneering studies, interest in ultrasound has expanded greatly and there has been extensive evaluation of its use for a variety of medical purposes, which currently, range from bone cutting to promoting drug delivery (Table 11.1). One aspect of ultrasound that has received far less attention than many of its other applications is the use of its antimicrobial activity (Table 11.1) and it is an often forgotten fact that some of the earliest experimental work on the biological effects of this radiation included studies on its ability to kill microorganisms [15, 48]. In this chapter, we review current research into the antimicrobial capability of ultrasound either alone or in combination with a variety of other antimicrobial strategies. 11.2 The Antimicrobial Activity of Ultrasound Alone The history of research into the antimicrobial capability of ultrasound can be considered as composed of three periods of which the first lasted until the early 1990s 11.2 The Antimicrobial Activity of Ultrasound Alone Table 11.1 Major therapeutic uses of ultrasound. Power level Application of ultrasound High or intermediate power Dentistry and surgery (scalpel and bone cutting) Synthesis of microcapsules for drug delivery Sonodynamic disinfection Separation technology Physiotherapy Destruction of blood clots Transdermal drug delivery (sonophoresis) Sonodynamic therapy (SDT) Sonodynamic antimicrobial chemotherapy (SACT) Sonodynamic antibiotic therapy High intensity focused ultrasound Improved cellular uptake of molecules (sonoporation) Diagnostic imaging Intermediate or low power Low power References [34] [35] [36] [37] [38] [39] [40] [41] [42] [43] [44] [45] [46] This table shows a range of therapeutic applications of high, intermediate, and low power ultrasound. This table was adapted from Ref. [47]. and was mainly concerned with the direct action of the radiation on microorganisms [49]. The first major investigation into this action is generally taken to be that of Wood and Loomis [15] who, in 1927, reported the destruction of the algal microorganism, Spirogyra, when subjected to high-power ultrasound. Similar observations were presented over the next few years for algae such as Euglena, Colpidium, Nitella, and Paramecium, along with bacteria, such as the luminescent Bacillus fischeri, now known as Aliivibrio fischeri [48, 50, 51]. As an example, in the case of Spirogyra, it was observed by Wood and Loomis [15] in 1927 that “Filaments of Spirogyra in suspension were torn to pieces and the cells ruptured” and later by Harvey [48] in 1930 that “ … Spirogyra, there is the break-up of the chlorophyll spirals with loss of turgor, the chlorophyll becoming diffuse in many cells”. It is now known that the exposure of Spirogyra to ultrasound induces the disruption of connections between the plasmalemma and the algal cell walls, which then leads to the loss of membrane integrity, the leakage of cytoplasmic contents, a decline in the chlorophyll content of cells and eventually, the collapse of the cell into a dense brown mass [52]. Since these earlier studies, it has been demonstrated that high-power ultrasound possesses efficacy in inactivating a range of microorganisms [53], including other algae [54, 55] and bacteria [55–62] along with protozoa [61, 63–65], fungi [55, 56, 66–70], and viruses [56, 61, 71–73]. 333 334 11 The Antimicrobial Effects of Ultrasound It is generally accepted that the major antimicrobial effects produced by the direct application of ultrasound are due to acoustic cavitation [49, 53], which occurs when the incident sonic wave meets a liquid medium and creates longitudinal waves characterized by regions of alternating compression and expansion [74, 75]. These regions of pressure change cause cavitation to occur and gas bubbles to form in the medium, which can have different consequences on microbial cells depending on the stability of these bubbles [76–78]. The cycles of low and high acoustic pressure in the incident acoustic wave cause the gas bubbles to expand and contract, which, in turn, creates shear flow around the oscillating bubbles [76, 77, 79, 80]. These bubbles have a larger surface area during the expansion cycle, which increases the diffusion of gas, causing the bubble to expand [74, 75]. Stable cavitation results when power levels are sufficiently low so that the bubbles do not collapse violently during their contraction cycle [77, 81]. However, at higher power levels, collapse (or transient) cavitation is produced, which can cause the oscillating bubbles to violently accelerate the fluid around them. During bubble collapse, the rapid condensation of gas molecules within bubbles occurs, reducing their radii to very small values at the end of the contraction cycle. Violent collisions between these condensed molecules and the sudden reversal in the motion of the bubble wall can create regions of very high pressure and temperature [74, 75]. This process is adiabatic and it has been estimated that, on a nanosecond time scale, the strength of gas compression in the process can induce temperatures of up to 15 000 K and pressures in excess of 1000 MPa [82, 83] although conditions nearer 5000 K and 250 MPa are those most frequently cited for collapse cavitation events [84]. These extreme conditions can generate high liquid shear force, shock waves, localized heating, and free radicals, all of which would appear to contribute to the antimicrobial effect of ultrasound by disrupting cellular, structural, and functional components of microbial cells [54, 85–88]. As described above, high-power ultrasound radiation has been shown to be able to inactivate a variety of microorganisms [53] and there has been some research into this ability in relation to controlling algae growth in ponds, lakes, and reservoirs, and eliminating biofilm formation by these microbes inside water treatment plants [89]. However, most research into the direct antimicrobial action of this radiation has centered on bacterial targets, including Gramnegative organisms, such as Escherichia coli, and Gram-positive bacteria, such as Staphylococcus aureus [49, 55–62, 90–96]. There have been two major foci of this research, of which, the first is biofilms and agglomerates of bacteria, which are also encountered in water treatment plants, exemplified by Pseudomonas aeruginosa and Bacillus subtilis, respectively [49, 54, 97, 98]. The second major focus of ultrasound-mediated antimicrobial research is bacterial biofilms found in the food industries, typically formed by Listeria monocytogenes and Salmonella typhimurium, respectively [86, 87, 91, 93, 99]. In combination, these studies have suggested that the occurrence of a sufficient number of collapse cavitation events can induce the antibacterial effects of ultrasound, which can be divided into a number of stages [60]: (i) Collapse cavitation induces forces due to surface 11.3 The Antimicrobial Activity of Assisted Ultrasound resonance in the bacterial cell along with pressures and pressure gradients resulting from the collapse of gas bubbles, which enter the bacterial solution on or near the bacterial cell wall. In combination, these events lead to bacterial cell damage through mechanical fatigue. (ii) Shear forces are induced within bacterial cells by microstreaming of their aqueous interiors, which is the unidirectional movement of fluids near the inner and outer membranes of bacteria that can alter their structure, function, and permeability. (iii) The high temperatures produced by collapse cavitation induce the pyrolysis or sonochemical degradation of water in the aqueous interior of bacterial cells. Free radicals such as H• and OH• are produced by this process, which then attack the chemical structure of the host organism’s cell wall and weaken it to the point of disintegration. (iv) Other products of this sonochemical degradation of water such as H2 O2 are known to be strong antibacterial agents and further contribute to the antimicrobial effect of ultrasound. (v) There is also evidence to suggest that H• radicals produced by the action of ultrasound are able to cause damage to bacterial DNA via the induction of breaks in the double strands of these molecules [60, 86, 100]. These acoustic cavitation events are also believed to contribute to the ability of ultrasound to inhibit and disrupt the formation of bacterial biofilms [101–103] by limiting both the motility of bacterial cells [104] and their ability to attach to surfaces [103, 105], which is vital to the construction of these sessile microbial communities [106, 107]. In addition, ultrasound can induce the detachment of bacterial cells already adhering to surfaces and kill cells within these communities via the lysis of their membranes [49]. The extracellular polymeric matrix and water channels are essential to the architectural stability and growth of these microbial communities [106, 107] and further enhancing the action of ultrasound against bacterial biofilms, this radiation is also able to induce the mechanical destruction of these structures [49]. 11.3 The Antimicrobial Activity of Assisted Ultrasound It has been established that for a variety of reasons, some microorganisms are relatively resistant to the action of high-power ultrasound alone as compared to other microbes, even between those that are closely related [108]. For example, it has been reported that Gram-negative, rod-shaped bacteria, such as P. aeruginosa, are more susceptible to the action of the radiation than Gram-positive, coccus-shaped bacteria, such as S. aureus [59, 94, 109]. It has been suggested that this difference in susceptibility is due, at least in part, to the differing characteristics of the bacterial cell wall possessed by these two bacterial classes [59, 93]. Essentially, most Grampositive bacteria contain a denser, stronger, and thicker layer of peptidoglycan in their cell wall, as compared to that of Gram-negative bacteria [110], which would appear to render the former organisms more resistant to the action of ultrasound than the latter organisms [59, 93]. It has also been found that spore-forming bacteria such as Bacillus spp. are more resistant to the action of ultrasound alone than 335 336 11 The Antimicrobial Effects of Ultrasound vegetative bacteria [85, 111]. In general, microorganisms with smaller cells, and therefore lower surface areas, are more resistant to the action of ultrasound alone, primarily because of their decreased vulnerability to the pressures produced by acoustic cavitation events as compared to larger microbial cells [112]. In response to these observations, there have been a number of attempts to couple the antimicrobial capability of other strategies to that of ultrasound, which have shown that in many cases, the killing of microbes is enhanced. 11.3.1 Synergistic Effects Numerous studies have shown that a synergistic antimicrobial effect can be achieved by the co-application of high-power ultrasound with other forms of energy [36, 93, 113, 114], primarily visible light [72], ultraviolet light [61, 115–117], pulsed electric fields [118, 119], hydrodynamic pressure (osmosonication) [120, 121], atmospheric pressure (manosonication) [122–125], heat (thermosonication) [125–128], and heat/pressure (manothermosonication) [125, 129]. These applications of high-power ultrasound are generally known as sonodynamic disinfection, and in most cases, the precise mechanisms by which the radiation and these other forms of energy synergize to produce their antimicrobial effects are unclear and vary [36]. However, acoustic cavitation events combined with the effects of these various energy forms, variously induce turbulence, shear stress, heating effects, electroporation, photon adsorption, and free radical production, resulting in damage to microbial membranes, proteins, and DNA, which appear to be significant factors in these antimicrobial mechanisms [36, 61, 72, 93, 113, 114, 120, 130]. For example, in the case of manosonication, it has been established that the synergy observed between ultrasound and pressure can be assigned to a number of different causes, including an increase in the rates of collapse cavitation and free radical production. However, it has also been established that these effects occur only up to a pressure maximum and it is therefore important to determine this critical pressure level to achieve the maximum synergetic antimicrobial effect of manosonication. Above this pressure, there is a decrease in antimicrobial efficacy, which is associated with a decrease of collapse cavitation phenomena, essentially because ultrasound waves are unable to overcome the combined cohesive forces of over-pressure and the cohesive force of molecules in the liquid medium [36, 125]. Sonodynamic disinfection also includes the antimicrobial effect of high-power ultrasound when synergized with a variety of chemicals and compounds [36, 53, 86, 131], including ozone (sonozonation) [132–134], plasma [135–137], chlorine dioxide [138–140], organic acids [139, 141, 142], chelating agents [143, 144], steam [130], naturally occurring antimicrobials, both endogenous [145] and exogenous [146–149], and enzymatic solutions [144, 150, 151]. Again, the detailed mechanisms by which ultrasound synergizes the action of these chemicals and other compounds to produce antimicrobial effects are unclear and vary. However, in many cases, it appears that acoustic cavitation events not 11.3 The Antimicrobial Activity of Assisted Ultrasound only kill microbes directly, as described above, but also induce the detachment of microbial cells from surfaces along with the mechanical disruption of these cells and their membranes, a process generally known as sonoporation. This action promotes the ability of chemicals and other compounds with antimicrobial activity to diffuse into microbial cells and biofilms, thereby enhancing their decontamination and disinfection efficacy [36, 53, 86, 130, 131, 133–136, 138–151]. For example, in the case of sonozonation, it has been suggested that the transfer of ozone into aqueous solution is enhanced by acoustic cavitation and increases the rate by which ozone penetrates into microorganisms. The formation of more active species, such as OH• radicals and nascent oxygen by the decomposition of ozone is accelerated by acoustic cavitation processes in aqueous solution. The oxidants thus formed can attack microbial cells, inducing the rupture of membranes and damage to intracellular structures, such as DNA, all of which contribute to a loss of cell viability [132, 133]. On the therapeutic front, the most researched antimicrobial effect of ultrasound is the co-application of the radiation with conventional antibiotics [49, 93], and particularly in relation to indwelling medical devices [43, 90]. This research is generally taken to have begun in 1994 with a seminal study [104], which is considered to mark the second period of research into the antimicrobial capability of ultrasound [49]. This study showed that low-power ultrasound was ineffective when applied alone against planktonic P. aeruginosa and E. coli [104]. However, when this low-power radiation was applied with gentamycin, an aminoglycoside antibiotic, this combination killed these organisms more efficiently than gentamycin alone [104]. Four years later, similar observations were reported for the action of a series of antibiotics, including other aminoglycosides along with tetracyclines and penicillins against both Gram-negative bacteria, such as Serratia marcescens, and Gram-positive organisms, such as Staphylococcus epidermidis [152]. This synergistic antimicrobial effect has since been shown for a variety of other antibiotics, including glycopeptides, lincomycins, macrolides, fluoroquinolones, sulfonamides, cephalosporins [59, 153–157], and most recently, host defense peptides [158], which are endogenous antibiotics produced across the eukaryotic kingdom [159]. In addition to planktonic bacteria, low-power ultrasound and antibiotics have also been shown to exhibit synergistic effects against sessile forms of these organisms [160–167]. For example, as compared to vancomycin alone, this antibiotic in combination with ultrasound has been shown to have increased efficacy against biofilms of E. coli, P. aeruginosa, S. aureus, and S. epidermidis, respectively, all of which are known to cause problematic infections on implanted medical devices [153, 166–168]. There have been a number of investigations into the mechanisms underpinning the synergistic effects of ultrasound and antibiotics, which have suggested that is primarily based on sonoporation [43, 101, 153, 166, 167]. In the case of planktonic bacteria, earlier studies suggested that low-power ultrasound induced stable cavitation events that led to changes in bacterial membranes, thereby allowing antibiotics to penetrate host cells more efficiently [104, 154]. A series of subsequent studies up to present times generally supported these findings and led to 337 338 11 The Antimicrobial Effects of Ultrasound the view that ultrasound induced lesions in the membranes of bacterial cells. However, these studies also showed that these lesions were sufficiently large to allow the internalization of antibiotics into bacterial cells to exert their antimicrobial action but did not induce significant levels of membrane damage [152, 163, 169–172]. In addition, other studies have suggested that damage to the bacterial cell wall and heat-mediated biochemical reactions within cells of these organisms can be induced by stable cavitation events and contribute to the synergistic antimicrobial effect of ultrasound and antibiotics [157, 173]. Stable cavitation events also appear to mediate the synergistic effects of ultrasound and antibiotics against bacterial biofilms [161, 163, 174], primarily by creating numerous pores in their extracellular matrix and thereby enhancing the ability of these molecules to diffuse through the biofilm and localize near resident bacteria [166, 175, 176]. However, it appear that this action can be enhanced by the ability of low-power ultrasound to stimulate microbial growth [79] – an effect that was first reported in 2003 and considered by some to mark the start of third historical period of research into the antimicrobial capability of the radiation [49]. Essentially, it appears that pores generated by low-power ultrasound also facilitate the transport of oxygen and nutrients into biofilms, with the result that its upper layers are killed and subsequently removed by the combined action of the radiation and antibiotics. As a consequence of this action, increased levels of nutrients are made available to underlying bacteria in the biofilm, which are normally dormant but under these conditions can become active in the presence of high concentrations of antibiotics. Taken in combination, these synergistic events significantly enhance the ability of ultrasound to eradicate sessile organisms as compared to the action of either antibiotics or the radiation when applied alone [79, 166, 167, 175, 177, 178]. 11.3.2 Sonosensitizers In what must be considered to herald the dawn of the fourth period of research into the antimicrobial potential of ultrasound, it was demonstrated in 2013 that the radiation possessed the ability to activate photosensitizers (PS) [42], confirming predictions made in 2009 [179]. As described in Chapter 10, PS are generally activated by light to facilitate the underlying mechanisms of cytotoxicity involved in photodynamic antimicrobial therapy (PACT) [180, 181], but it was found that ultrasound was able to induce antibacterial activity by Rose Bengal (RB) [42], which is an established PACT PS [182–184]. These investigations showed that in the presence of RB, the application of low-power ultrasound led to the highly efficient eradication of both Gram-positive bacteria, including S. aureus, and Gram-negative organisms, including E. coli [42]. An ability to kill E. coli was also demonstrated when low-power ultrasound was found to enhance the antibacterial efficacy of ciprofloxacin and levofloxacin [156], which are well-established antibiotics [185, 186] and have been shown to act as PS in photodynamic therapy, which is based on the anticancer capability of these molecules [187, 188]. These studies appear to be the first major experimental demonstration of what has been termed 11.3 The Antimicrobial Activity of Assisted Ultrasound sonodynamic antimicrobial chemotherapy (SACT) and it has been suggested that this modality could of medical importance with uses ranging from the sterilization of surgical instruments to the treatment of microbial infections [42, 179]. The mechanisms by which ultrasound-activated PS kill microbes are currently poorly understood [42, 156] although insight into these mechanisms can be gained from studies on the anticancer activities of these molecules where they are generally known as sonosensitizers (SSs) and the corresponding therapeutic modality as sonodynamic therapy (SDT) [189, 190]. On the basis of SDT studies, which also utilize low-power ultrasound, it is generally accepted that the activation of SS involves collapse cavitation within or near target cancer cells. However, it has been variously suggested that the mechanisms underpinning this activation of SS can include sonoporation, sonochemistry, and sonoluminescence [74, 75, 82, 83, 189–191]. Several studies have suggested that the anticancer activity of ultrasound and SS is essentially based on sonoporation and involves the mechanical ability of these molecules to permeate and destabilize the integrity of target cell membranes. The effect on these weakened membranes is able to synergize with stress induced in host cells by the shearing effect of ultrasound-mediated bubble pulsations with resulting cancer cell death [192, 193]. However, many studies have proposed that the damage inflicted in SDT involves the activation of SS to induce the production of reactive oxygen species (ROS) with cytotoxicity to cellular components such as membrane lipid [194], DNA [195, 196], and proteins [197–200] along with cancer cells [201–207] and other cell types [208–210]. Indeed, a recent study predicted that ROS production would be optimal in ultrasound-mediated bubble collapse temperatures and pressures of circa 5000 K and 250 MPa, which are the conditions most usually associated with collapse cavitation events [84]. One earlier study proposed that the anticancer activity of SDT resulted from the activation of SS via sonochemical reactions occurring either inside collapsing cavitation bubbles or in the heated gas–liquid interface. According to this study, the bubble interior may be considered to represent a micro-reactor in which SSderived free radicals are produced either by direct pyrolysis or via reactions with other radicals formed by the pyrolysis of water. These SS-derived free radicals, which are predominantly carbon-centered, then react with dissolved oxygen to form peroxyl and alkoxyl radicals, which are able to initiate damage to critical cellular sites (Figure 11.1) [211]. However, the most commonly proposed mechanism for the anticancer activity of SDT is the production of ROS through the direct electronic excitation of SS by sonoluminescence (Figure 11.2) [189, 190, 203], which are flashes of light that are produced during the course of bubble collapse in acoustic cavitation [74, 75]. Sonoluminescence can also be induced by some animals [212–214] and has been observed in some synergistic antimicrobial activities of ultrasound [36] but currently, the mechanism(s) underpinning the phenomenon are unknown with proposed explanations ranging from surface black body radiation to quantum vacuum radiation [215, 216]. Regardless of the mechanism underpinning sonoluminescence, it is generally accepted that the activation of 339 340 11 The Antimicrobial Effects of Ultrasound O2 Sonosensitizers H2 O ·H ·OH OO· Removal by scavengers Microbe H2O Collapsing cavitation bubble Figure 11.1 This figure represents the activation of sonosensitizers by sonochemistry in sonodynamic antimicrobial therapy. In this representation, a sonosensitizer undergoes pyrolysis inside collapsing cavitation bubbles or in the heated gas–liquid interface, forming free radical intermediates. These intermediates, which are predominantly carboncentered, react with dissolved O2 to form peroxyl radicals, capable of attacking critical cellular sites in microbial cells because of their ability to diffuse significant distances. In contrast, free radicals, which are also formed during cavitational collapse through the sonochemistry of water, are unable to cause significant cellular damage to microbes, because of their extremely high reactivity and hence short diffusion distances. (This figure was adapted from Ref. [211].) Excited state 3O En 2 erg Ground state of sonosensitizer y Triplet oxygen Sonoluminescent light 1 O2 Ultrasound irradiation Microbe O2 Singlet oxygen 1 1 O2 Microbubbles formed by acoustic cavitation Figure 11.2 This figure represents the activation of sonosensitizers by sonoluminescence in sonodynamic antimicrobial therapy. In this representation, a microbe is irradiated by low-power ultrasound, which induces collapse cavitation around the surface of the cell and produces sonoluminescent light. A sonosensitizer, which tends to attach to the surface of microbial cells, is exposed to the Sonosensitizer sonoluminescent light and becomes activated from its ground state into an excited state. As the activated sonosensitizer returns to the ground state, the energy released can generate reactive oxygen species, such as singlet oxygen, which mediate the photooxidation of cellular components, thereby inducing cell death. (This figure was adapted from Ref. [190].) 11.4 Future Prospects SS by this ultrasound-induced light source uses a photochemical pathway similar to that involved in the photodynamic activation of these molecules [179, 190, 201, 202]. As can be seen from Figure 11.2, the exposure of SS to sonoluminescent light promotes these molecules from their ground state to an electronically excited state and as the activated SS returns to its ground state, the energy released generates ROS, such as singlet oxygen and free radicals, which mediate the photo-oxidation of cellular components, thereby inducing cell death [190]. Support for the use of this mechanism in SACT would appear to be provided by a series of studies on sonocatalytic disinfection by TiO2, which suggested that this process was synergized by the sonoluminescent activation of the compound [217–221] as recently reported for other sonocatalysts [199]. TiO2 is known to serve as a photocatalytic disinfectant with a wide range of antimicrobial activity [222] and it was found that irradiation of the compound with ultrasound led to the ROS-mediated lysis of microbes such as E. coli and Legionella pneumophila accompanied by oxidative damage to DNA and membrane lipids [217–220]. Studies have shown that other sonocatalysts, including gold nanoparticles and Teraftal, a cobalt octacarboxyphthalocyanine, are activated by ultrasound to kill E. coli and other bacteria such as S. aureus although in these cases, the sonodynamic antimicrobial mechanisms utilized have not yet been elucidated [223, 224]. Indirect support for use of sonoluminescence in SACT was provided when it was observed that the activation of ciprofloxacin and levofloxacin by ultrasound led to the production of ROS, which were proposed to induce the lysis of E. coli cells along with oxidative damage to intracellular components of the organism [156]. The maximum emission intensity of sonoluminescence in water lies between 250 and 600 nm [225] and this emission range was found to correlate with the absorbance spectra of both ciprofloxacin (𝜆max at 276, 316, and 328 nm) [187] and levofloxacin (𝜆max at 288 and 331 nm) [188]. Similarly, the absorbance spectrum of RB (𝜆max ∼ 565 nm), shown above to be a potent SACT agent, was found to exhibit good overlap with the emission range of sonoluminescence [42]. However, no ultrasound-mediated antimicrobial activity was detected in corresponding experiments on Methylene Blue (MB), which is also an established PACT PS (Chapter 10) [226, 227], and the molecule showed no significant absorbance (𝜆max ∼ 655 nm) in the range 250 and 600 nm [42]. On the basis of these observations, it was suggested by the latter authors that the limited emission range observed for sonoluminescence may partly explain why MB and other molecules can function predominantly as either PS or SS while yet others can serve in both capacities [41, 190]. 11.4 Future Prospects In this chapter, it has been shown that ultrasound has an antimicrobial capacity in its own right, which is effective against a spectrum of microorganisms and finds application as a disinfection and decontamination agent in many areas, of which the food industry is a major example. Indeed, the radiation has been considered 341 342 11 The Antimicrobial Effects of Ultrasound a technology with high potential in this industry not only for its antimicrobial efficacy but also for reasons such as its eco-friendly properties, its ability to inactivate enzymes responsible for food deterioration, and that its use results in energy and cost savings [87]. Nonetheless, the use of ultrasound alone for antimicrobial disinfection and decontamination has a number of drawbacks and in particular, as shown in this chapter, a variety of microorganisms are relatively resistant to its action. Owing to this resistance, application of the radiation alone is often unable to decrease microbial loads sufficiently to meet existing legislation limits as in the case of the food industry [36]. In response, to increase the disinfection and decontamination efficacy of ultrasound, it has been used in conjunction with other antimicrobial strategies, including various energy forms, chemicals, and antimicrobials to elicit a synergistic inactivation of microorganisms. This use of assisted ultrasound is increasingly embracing emerging technologies and, as an example, the combined use of this radiation and plasma technology has recently been shown for the first time to exhibit a synergistic ability to inactivate bacteria and yeasts [136], which is a technology in the pipeline for use in the food industry [137]. The synergistic antimicrobial use of ultrasound has also been utilized in the therapeutic arena where the radiation has been used to enhance the action of antibiotics, particularly when directed against bacterial biofilms. Given the current dearth of novel conventional antibiotics [228], this use of assisted ultrasound has sought the use of new classes of antimicrobials, exemplified by the very recent demonstration that the radiation can synergize the antibacterial efficacy of host defense peptides [158], which are predicted to form the next generation of antibiotics [229]. In this study, it was shown that the application of ultrasound with defensins, which are endogenous human defense peptides, were active against biofilms formed by Staphylocci, which are a serious concern within the biomaterial community [158]. Moreover, it was also shown by this latter study that this synergistic antimicrobial strategy was effective against biofilms of methicillinresistant S. aureus [158], which gives it a major advantage over many conventional antibiotics, which are ineffective against multidrug-resistant bacteria [228]. This chapter has also shown what would appear to be a novel synergistic antimicrobial capability of ultrasound in its ability to induce the antibacterial activity of RB, which usually requires light activation to achieve this effect [42]. The precise mechanisms underlying this ultrasound-mediated ability are unclear but the most favored explanation appears to be the activation of the molecule by sonoluminescent light that has been generated by the radiation. However, other mechanisms based on sonoporation and sonochemistry may contribute to this effect, which could also indicate the direct involvement of ultrasound action in this effect and thereby the occurrence of a synergistic antimicrobial interaction between the radiation and activated RB. Regardless of the mechanisms underpinning the antibacterial activity of RB and ultrasound, the demonstration of this activity would appear to open an entirely new field of antimicrobial research mediated by the radiation as was recently envisaged [179]. Indeed, the potential of this field of research could be vast; there are numerous light-activated molecules that exhibit photoantimicrobial activity and could potentially be activated by ultrasound [180, 230]. References Moreover, although the use of light-activated molecules to treat microbial infections is gaining increasing acceptance, it is not a mainstream option because of the limited penetration of tissue by visible light and it is well established that significantly deeper tissue penetration can be achieved by ultrasound, which would clearly favor the use of SACT over PACT [179]. In summary, this chapter clearly shows that the antimicrobial use of ultrasound is a rapidly expanding and successful field, although in many cases, detailed descriptions of the mechanisms and processes involved in this use are largely unclear. Indeed, this chapter has also shown that at some power levels, ultrasound can stimulate the growth of bacteria, which could clearly be undesirable in some cases and emphasizes a general principle, which is the need for a holistic approach to the design of ultrasound-mediated strategies. For example, the design of such a strategy should include consideration of the nature of the target microbes, the parameters of the incident radiation, the effects of the microbial environment, and the microbial inactivation kinetics involved. However, with these lessons taken on board, the antimicrobial use of ultrasound would appear to have a bright and promising future – one could say quite ultrasonic in fact!! References 1. Tzabo, T.L. (2014) Diagnostic Ultra- 2. 3. 4. 5. 6. 7. 8. 9. sound Imaging: Inside Out, Academic Press, Oxford. Hunt, F.V. (1978) Origins in Acoustics: The Science of Sound from Antiquity to the Age of Newton, Books on Demand. Beyer, R.T. (1999) Sounds of Our Times: Two Hundred Years of Acoustics, Springer-Verlag, New York. Rossing, T. (2007) in Springer Handbook of Acoustics (ed. T.D. Rossing), Springer-Verlag, New York, pp. 9–24. Griffin, D.R. (2001) Return to the magic well: echolocation behavior of bats and responses of insect prey. Bioscience, 51, 555–556. Eisenberg, R. (1995) Radiology: An Illustrated History, Mosby, St. Louis, MO. Griffin, D.R. and Galambos, R. (1941) The sensory basis of obstacle avoidance by flying bats. J. Exp. Zool., 86, 481–506. Colladon, J.-D. and Sturm, J.C.F. (1827) Mémoire sur la Compression des liquides. Ann. Chim. Phys., 3, 27–38. Malumbres, M.P., Garrido, P.P., Calafate, C.T., and Gil, J.O. (2009) Encyclopedia of Information Science 10. 11. 12. 13. 14. 15. and Technology, 2nd edn, IGI Global, pp. 3859–3864. Curie, P. and Curie, J. (1881) Contractions et dilatations produites par des tensions électriques dans les cristaux hémiédres á faces inclinées. C.R. (France), 93, 1137–1140. Curie, P. and Curie, J. (1880) Développement, par pression, de l’électricité polaire dans les cristaux hémiédres á faces inclinées. C.R. (France), 91, 294–295. Amir, M. and Cobbold Richard, S.C. (2011) Development and application of piezoelectric materials for generation and detection. Ultrasound, 19, 187–196. Katzir, S. (2012) Who knew piezoelectricity? Rutherford and langevin on submarine detection and the invention of sonar. Notes Rec. R. Soc., 66, 141–157. Langevin, M.P. and Ishimoto, M. (1923) Utilization des phenomen‘es piezoelectrique pour la measure de l’intensit é des sons en valeur absolute. J. Physiol., 4, 539–540. Wood, R.W. and Loomis, A.L. (1927) The physical and biological effects of 343 344 11 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. The Antimicrobial Effects of Ultrasound high frequency sound waves of great intensity. Philos. Mag. Ser. VII, 4, 417–436. Graff, K.F. (1982) A History of Ultrasonics in Physical Acoustics, vol. XV, Academic Press, New York. Zeiss, E. (1938) Ueber Linsenveraenderungen an herausgenommenen Rinderlinsen durch Ultraschalleinwirkung. Graefes Arch Ophthalmol., 139, 301–322. Thijssen, J.M. (1993) The History of Ultrasound Techniques in Ophthalmology. Ultrasound Med. Biol., 19, 599–618. Dussik, K.T. (1942) Über die Möglichkeit, hochfrequente mechanische Schwingungen als diagnostisches Hilfsmittel zu verwerten. Z. Neurol. Psychiat., 174, 153–168. Thomas, A.M.K., Banergee, A.K., and Busch, U. (2005) Classic Papers in Modern Diagnostic Radiology, SpringerVerlag, Berlin. Lynn, J.G., Zwemer, R.L., Chick, A.J., and Miller, A.E. (1942) A new method for the generation and use of focused ultrasound in experimental biology. J. Gen. Physiol., 26, 179–193. Luigi, M. (2013) High intensity focused ultrasound, liver disease and bridging therapy. World J. Gastroenterol., 19, 7494–7499. Lynn, J.G. and Putnam, T.J. (1944) Histology of cerebral lesions produced by focused ultrasound. Am. J. Pathol., 20, 637–649. Fry, W.J., Mosberg, W.H. Jr., Barnard, J.W., and Fry, F.J. (1954) Production of focal destructive lesions in the central nervous system with ultrasound. J. Neurosurg., 11, 471–478. Wall, P.D., Fry, W.J., Stephens, R., Tucker, D., and Lettvin, J.Y. (1951) Changes produced in the central nervous system by ultrasound. Science (New York), 114, 686–687. Fry, W.J., Barnard, J.W., Fry, E.J., Krumins, R.F., and Brennan, J.F. (1955) Ultrasonic lesions in the mammalian central nervous system. Science (New York), 122, 517–518. Fry, F.J. (1958) Precision high intensity focusing ultrasonic machines 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. for surgery. Am. J. Phys. Med., 37, 152–156. Shampo, M.A. and Kyle, R.A. (1997) John Julian Wild—pioneer in ultrasonography. Mayo Clin. Proc., 72, 234. Burov, A.K. and Andreevskaya, G.D. (1956) Effect of high intensity supersonic oscillations on malignant tumours in animals and in man. Dokl. Akad. Nauk SSSR, 106, 445–458. Burov, V.A., Dmitrieva, N.P., and Rudenko, O.V. (2002) Nonlinear ultrasound: breakdown of microscopic biological structures and nonthermal impact on a malignant tumor. Dokl. Akad. Nauk, 383, 101–104. Donald, I., Macvicar, J., and Brown, T.G. (1958) Investigation of abdominal masses by pulsed ultrasound. Lancet, 1, 1188–1195. Nicolson, M. and Fleming, J.E.E. (2013) Imaging and Imagining the Fetus: The Development of Obstetric Ultrasound, Johns Hopkins University Press, Baltimore, MD. Griffiths, A., terHaar, G., Rivens, I., Giussani, D., and Lees, C. (2012) High-intensity focused ultrasound in obstetrics and gynecology: the birth of a new era of noninvasive surgery? Ultraschall Med. (Stuttgart: 1980), 33, E8–E15. Itro, A., Lupo, G., Carotenuto, A., Filipi, M., Cocozza, E., and Marra, A. (2012) Benefits of piezoelectric surgery in oral and maxillofacial surgery. Review of literature. Minerva Stomatol., 61, 213–224. Zhao, Y.-Z., Du, L.-N., Lu, C.-T., Jin, Y.-G., and Ge, S.-P. (2013) Potential and problems in ultrasound-responsive drug delivery systems. Int. J. Nanomed., 8, 1621–1633. Sango, D.M., Abela, D., McElhatton, A., and Valdramidis, V.P. (2014) Assisted ultrasound applications for the production of safe foods. J. Appl. Microbiol., 116, 1067–1083. Sarvazyan, A.P., Rudenko, O.V., and Nyborg, W.L. (2010) Biomedical applications of radiation force of ultrasound: historical roots and physical basis. Ultrasound Med. Biol., 36, 1379–1394. References 38. Watson, T. (2008) Ultrasound in con- 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. temporary physiotherapy practice. Ultrasonics, 48, 321–329. Bubulis, A., Adzerikho, I., Stepanenko, D., Minchenya, V., Valaika, M., Veikutis, V., Pranskunas, A., Unikas, R., and Morkunaite, K. (2012) Low frequency and high intensity ultrasound in vascular surgery: theory, instrumentation and possibilities of clinical application. J. Vibroeng., 14, 1833–1851. Park, D., Park, H., Seo, J., and Lee, S. (2014) Sonophoresis in transdermal drug deliverys. Ultrasonics, 54, 56–65. Shibaguchi, H., Tsuru, H., Kuroki, M., and Kuroki, M. (2011) Sonodynamic cancer therapy: a non-invasive and repeatable approach using low-intensity ultrasound with a sonosensitizer. Anticancer Res., 31, 2425–2429. Nakonechny, F., Nisnevitch, M., Nitzan, Y., and Nisnevitch, M. (2013) Sonodynamic excitation of rose bengal for eradication of Gram-positive and Gram-negative bacteria. BioMed Res. Int., 2013, 7. Yu, H., Chen, S., and Cao, P. (2012) Synergistic bactericidal effects and mechanisms of low intensity ultrasound and antibiotics against bacteria: a review. Ultrason. Sonochem., 19, 377–382. Shehata, I.A. (2012) Treatment with high intensity focused ultrasound: secrets revealed. Eur. J. Radiol., 81, 534–541. Geis, N.A., Katus, H.A., and Bekeredjian, R. (2012) Microbubbles as a vehicle for gene and drug delivery: current clinical implications and future perspectives. Curr. Pharm. Des., 18, 2166–2183. Azhari, H. (2012) Ultrasound: medical imaging and beyond (An Invited Review). Curr. Pharm. Biotechnol., 13, 2104–2116. Mason, T.J. (2011) Therapeutic ultrasound an overview. Ultrason. Sonochem., 18, 847–852. Harvey, E.N. (1930) Biological aspects of ultrasonic waves: a general survey. Biol. Bull., 59, 306–325. Erriu, M., Blus, C., Szmukler-Moncler, S., Buogo, S., 50. 51. 52. 53. 54. 55. 56. 57. 58. Levi, R., Barbato, G., Madonnaripa, D., Denotti, G., Piras, V., and Orrù, G. (2014) Microbial biofilm modulation by ultrasound: current concepts and controversies. Ultrason. Sonochem., 21, 15–22. Harvey, E.N. and Loomis, A.L. (1929) The destruction of luminous bacteria by high frequency sound waves. J. Bacteriol., 17, 373–376. Harvey, E.N. and Loomis, E.L. (1928) High frequency sound waves of small intensity and their biological effects. Nature, 121, 622–624. Center for Aquatic Plant Management (2003) Annual Summary Report, Reading. Alzamora, S., Guerrero, S., Schenk, M., Raffellini, S., and López-Malo, A. (2011) in Ultrasound Technologies for Food and Bioprocessing (eds H. Feng, G. Barbosa-Canovas, and J. Weiss), Springer, New York, pp. 321–343. Broekman, S., Pohlmann, O., Beardwood, E.S., and de Meulenaer, E.C. (2010) Ultrasonic treatment for microbiological control of water systems. Ultrason. Sonochem., 17, 1041–1048. Rapuntean, G., Fit, N., Nadas, G., Denes, A., and Cuc, C. (2005) Ultrasounds action on microorganisms in normal culture conditions. Buletinul USAMV-CN., 62, 281–285. Scherba, G., Weigel, R.M., and O’Brien, W.D. Jr., (1991) Quantitative assessment of the germicidal efficacy of ultrasonic energy. Appl. Environ. Microbiol., 57, 2079–2084. Declerck, P., Vanysacker, L., Hulsmans, A., Lambert, N., Liers, S., and Ollevier, F. (2010) Evaluation of power ultrasound for disinfection of both Legionella pneumophila and its environmental host Acanthamoeba castellanii. Water Res., 44, 703–710. Drakopoulou, S., Terzakis, S., Fountoulakis, M.S., Mantzavinos, D., and Manios, T. (2009) Ultrasoundinduced inactivation of Gram-negative and Gram-positive bacteria in secondary treated municipal wastewater. Ultrason. Sonochem., 16, 629–634. 345 346 11 The Antimicrobial Effects of Ultrasound 59. Maleki, A., Shahmoradi, B., Daraei, H., 60. 61. 62. 63. 64. 65. 66. and Kalantar, E. (2013) Assessment of ultrasound irradiation on inactivation of Gram negative and positive bacteria isolated from hospital in aqueous solution. J. Adv. Environ. Health Res., 1, 9–14. Joyce, E., Phull, S.S., Lorimer, J.P., and Mason, T.J. (2003) The development and evaluation of ultrasound for the treatment of bacterial suspensions. A study of frequency, power and sonication time on cultured Bacillus species. Ultrason. Sonochem., 10, 315–318. van der Walt, E. (2002) The effect of ultraviolet light, cavitational flow and ultrasound on protozoan cysts and oocysts, bacteriophages and Clostridium. WISA, 2002, Durban, 19, May 2002. Ahn, C.Y., Park, M.H., Joung, S.H., Kim, H.S., Jang, K.Y., and Oh, H.M. (2003) Growth inhibition of cyanobacteria by ultrasonic radiation: laboratory and enclosure studies. Environ. Sci. Technol., 37, 3031–3037. Nakanishi, M., Mukai, S., Kimata, I., Iseki, M., and Maeda, Y. (2001) Inactivation of cryptosporidium parvum oocysts in drinking water by highintensity ultrasonic waves. Paper presented at the Annual Conference of the American Water Works Association, Washington, DC. Ashokkumar, M., Vu, T., Grieser, F., Weerawardena, A., Anderson, N., Pilkington, N., and Dixon, D.R. (2003) Ultrasonic treatment of Cryptosporidium oocysts. Water Sci. Technol., 47, 173–177. Olvera, M., Eguia, A., Rodriguez, O., Chong, E., Pillai, S.D., and Ilangovan, K. (2008) Inactivation of Cryptosporidium parvum oocysts in water using ultrasonic treatment. Bioresour. Technol., 99, 2046–2049. Martin, J.F.G., Guillemet, L., Feng, C., and Sun, D.-W. (2013) Cell viability and proteins release during ultrasound-assisted yeast lysis of light lees in model wine. Food Chem., 141, 934–939. 67. Dehghani, M.H., Mahvi, A.H., Jahed, 68. 69. 70. 71. 72. 73. 74. 75. 76. 77. G.R., and Sheikhi, R. (2007) Investigation and evaluation of ultrasound reactor for reduction of fungi from sewage. J. Zhejiang Univ. Sci. B, 8, 493–497. Liu, D., Zeng, X.-A., Sun, D.-W., and Han, Z. (2013) Disruption and protein release by ultrasonication of yeast cells. Innovative Food Sci. Emerg. Technol., 18, 132–137. Kapturowska, A., Stolarzewicz, I., Chmielewska, I., and Bialecka-Florjanczyk, E. (2011) Ultrasounds – a tool to inactivate yeast and to extract intracellular protein. Zywn-Nauk Technol. JA, 18, 160–171. Iida, Y., Tuziuti, T., Yasui, K., Kozuka, T., and Towata, A. (2008) Protein release from yeast cells as an evaluation method of physical effects in ultrasonic field. Ultrason. Sonochem., 15, 995–1000. Su, X., Zivanovic, S., and D’Souza, D.H. (2010) Inactivation of human enteric virus surrogates by high-intensity ultrasound. Foodborne Pathog. Dis., 7, 1055–1061. Chrysikopoulos, C.V., Manariotis, I.D., and Syngouna, V.I. (2013) Virus inactivation by high frequency ultrasound in combination with visible light. Colloids Surf., B, 107, 174–179. Zuber, S., Butot, S., and Baert, L. (2013) in Foodborne Viruses and Prions and Their Significance for Public Health (eds F. Smulders, B. Nørrung, and H. Budka), Wageningen Academic, Wageningen, pp. 113–136. Leong, T., Ashokkumar, M., and Kentish, S. (2011) The fundamentals of power ultrasound – a review. Acoust. Aust., 39, 54–63. Rooze, J., Rebrov, E.V., Schouten, J.C., and Keurentjes, J.T.F. (2013) Dissolved gas and ultrasonic cavitation – a review. Ultrason. Sonochem., 20, 1–11. Baker, K.G., Robertson, V.J., and Duck, F.A. (2001) A review of therapeutic ultrasound: biophysical effects. Phys. Ther., 81, 1351–1358. Guzman, H.R., McNamara, A.J., Nguyen, D.X., and Prausnitz, M.R. (2003) Bioeffects caused by changes in References 78. 79. 80. 81. 82. 83. 84. 85. 86. 87. acoustic cavitation bubble density and cell concentration: a unified explanation based on cell-to-bubble ratio and blast radius. Ultrasound Med. Biol., 29, 1211–1222. ter Haar, G. (2007) Therapeutic applications of ultrasound. Prog. Biophys. Mol. Biol., 93, 111–129. Pitt, W.G. and Ross, S.A. (2003) Ultrasound increases the rate of bacterial cell growth. Biotechnol. Prog., 19, 1038–1044. Wu, J. and Nyborg, W.L. (2008) Ultrasound, cavitation bubbles and their interaction with cells. Adv. Drug Delivery Rev., 60, 1103–1116. Kodama, T., Tomita, Y., Koshiyama, K.-I., and Blomley, M.J.K. (2006) Transfection effect of microbubbles on cells in superposed ultrasound waves and behavior of cavitation bubble. Ultrasound Med. Biol., 32, 905–914. Suslick, K.S., Eddingsaas, N.C., Flannigan, D.J., Hopkins, S.D., and Xu, H. (2011) Extreme conditions during multibubble cavitation: sonoluminescence as a spectroscopic probe. Ultrason. Sonochem., 18, 842–846. Suslick, K.S. and Flannigan, D.J. (2008) Inside a collapsing bubble: sonoluminescence and the conditions during cavitation. Annu. Rev. Phys. Chem., 59, 659–683. Merouani, S., Hamdaoui, O., Rezgui, Y., and Guemini, M. (2014) Theoretical estimation of the temperature and pressure within collapsing acoustical bubbles. Ultrason. Sonochem., 21, 53–59. Butz, P. and Tauscher, B. (2002) Emerging technologies: chemical aspects. Food Res. Int., 35, 279–284. Bilek, S.E. and Turantas, F. (2013) Decontamination efficiency of high power ultrasound in the fruit and vegetable industry, a review. Int. J. Food Microbiol., 166, 155–162. Chemat, F., Huma, Z., and Khan, M.K. (2011) Applications of ultrasound in food technology: processing, preservation and extraction. Ultrason. Sonochem., 18, 813–835. 88. Fellows, P. (2000) Food Processing Tech- 89. 90. 91. 92. 93. 94. 95. 96. 97. nology: Principles and Practice, CRC Press, New York. Hutchinson, G. (2008) Sound water practices: ultrasonic technology controls algae and biofilm. Opflow, 34, 18–19. Dror, N., Mandel, M., Hazan, Z., and Lavie, G. (2009) Advances in microbial biofilm prevention on indwelling medical devices with emphasis on usage of acoustic energy. Sensors, 9, 2538–2554. Awad, T.S., Moharram, H.A., Shaltout, O.E., Asker, D., and Youssef, M.M. (2012) Applications of ultrasound in analysis, processing and quality control of food: a review. Food Res. Int., 48, 410–427. Gao, S., Lewis, G.D., Ashokkumar, M., and Hemar, Y. (2014) Inactivation of microorganisms by low-frequency high-power ultrasound: 1. Effect of growth phase and capsule properties of the bacteria. Ultrason. Sonochem., 21, 446–453. Piyasena, P., Mohareb, E., and McKellar, R.C. (2003) Inactivation of microbes using ultrasound: a review. Int. J. Food Microbiol., 87, 207–216. Monsen, T., Lovgren, E., Widerstrom, M., and Wallinder, L. (2009) In vitro effect of ultrasound on bacteria and suggested protocol for sonication and diagnosis of prosthetic infections. J. Clin. Microbiol., 47, 2496–2501. Venieri, D., Markogiannaki, E., Chatzisymeon, E., Diamadopoulos, E., and Mantzavinos, D. (2013) Inactivation of Bacillus anthracis in water by photocatalytic, photolytic and sonochemical treatment. Photochem. Photobiol. Sci., 12, 645–652. Conner-Kerr, T., Alston, G., Stovall, A., Vernon, T., Winter, D., Meixner, J., Grant, K., and Kute, T. (2010) The effects of low-frequency ultrasound (35 kHz) on methicillin-resistant staphylococcus aureus (MRSA) in vitro. Ostomy Wound Manage., 56, 32–43. Mason, T.J. (2007) Sonochemistry and the environment – providing a “green” link between chemistry, physics and engineering. Ultrason. Sonochem., 14, 476–483. 347 348 11 The Antimicrobial Effects of Ultrasound 98. Lambert, N., Rediers, H., Hulsmans, 99. 100. 101. 102. 103. 104. 105. 106. 107. A., Joris, K., Declerck, P., De Laedt, Y., and Liers, S. (2010) Evaluation of ultrasound technology for the disinfection of process water and the prevention of biofilm formation in a pilot plant. Water Sci. Technol., 61, 1089–1096. Mukhopadhyay, S. and Ramaswamy, R. (2012) Application of emerging technologies to control Salmonella in foods: a review. Food Res. Int., 45, 666–677. Winward, G.P. (2007) Disinfection of Grey Water, Cranfield. Dong, Y., Chen, S., Wang, Z., Peng, N., and Yu, J. (2013) Synergy of ultrasound microbubbles and vancomycin against Staphylococcus epidermidis biofilm. J. Antimicrob. Chemother., 68, 816–826. Xu, J., Bigelow, T.A., Halverson, L.J., Middendorf, J., and Rusk, B. (2012) Mechanical destruction of pseudomonas aeruginosa biofilms by ultrasound exposure. 11th International Symposium on Therapeutic Ultrasound (eds R., Muratore and E.E. Konofagou), pp. 463–468. Bigelow, T.A., Northagen, T., Hill, T.M., and Sailer, F.C. (2009) The destruction of Escherichia coli biofilms using high-intensity focused ultrasound. Ultrasound Med. Biol., 35, 1026–1031. Pitt, W.G., McBride, M.O., Lunceford, J.K., Roper, R.J., and Sagers, R.D. (1994) Ultrasonic enhancement of antibiotic action on Gram-negative bacteria. Antimicrob. Agents Chemother., 38, 2577–2582. Xu, J., Bigelow, T.A., Halverson, L.J., Middendorf, J.M., and Rusk, B. (2012) Minimization of treatment time for in vitro 1.1 MHz destruction of Pseudomonas aeruginosa biofilms by high-intensity focused ultrasound. Ultrasonics, 52, 668–675. Donlan, R.M. (2002) Biofilms: microbial life on surfaces. Emerg. Infect. Dis., 8, 881–890. Kostakioti, M., Hadjifrangiskou, M., and Hultgren, S.J. (2013) Bacterial biofilms: development, dispersal, and therapeutic strategies in the dawn of the postantibiotic era. Cold Spring Harbor Perspect. Med., 3, a010306. 108. Torley, P.J. and Bhandari, B.R. (2007) 109. 110. 111. 112. 113. 114. 115. 116. 117. in Handbook of Food Preservation (ed. M.S. Rahman), CRC Press, Boca Raton, FL, pp. 713–732. Villamiel, M. and De Jong, P. (2000) Inactivation of Pseudomonas fluorescens and Streptococcus thermophilus in Trypticase Soy Broth and total bacteria in milk by continuousflow ultrasonic treatment and conventional heating. J. Food Eng., 45, 171–179. Phoenix, D.A., Dennison, S.R., and Harris, F. (2013) Antimicrobial Peptides, Wiley-VCH Verlag GmbH & Co. KGaA, pp. 145–180. Silva, M.P., Pereira, C.A., Junqueira, J.C., and Jorge, A.O.C. (2013) Methods of destroying bacterial spores, in Microbial Pathogens and Strategies for Combating Them: Science, Technology and Education (ed. A. Méndez-Vilas), Formatex Research Center, www.formatex.org (accessed 07 April 2014). Ahmed, F.I.K. and Russell, C. (1975) Synergism between ultrasonic waves and hydrogen peroxide in the killing of micro-organisms. J. Appl. Bacteriol., 39, 31–41. Rastogi, N.K. (2011) Opportunities and challenges in application of ultrasound in food processing. Crit. Rev. Food Sci. Nutr., 51, 705–722. Demirdöven, A. and Baysal, T. (2008) The use of ultrasound and combined technologies in food preservation. Food Rev. Int., 25, 1–11. Naddeo, V., Landi, M., Belgiorno, V., and Napoli, R.M.A. (2009) Wastewater disinfection by combination of ultrasound and ultraviolet irradiation. J. Hazard. Mater., 168, 925–929. Char, C.D., Mitilinaki, E., Norma Guerrero, S., and Maris Alzamora, S. (2010) Use of high-intensity ultrasound and UV-C light to inactivate some microorganisms in fruit juices. Food Bioprocess Technol., 3, 797–803. Birmpa, A., Sfika, V., and Vantarakis, A. (2013) Ultraviolet light and Ultrasound as non-thermal treatments for the inactivation of microorganisms in References 118. 119. 120. 121. 122. 123. 124. 125. 126. fresh ready-to-eat foods. Int. J. Food Microbiol., 167, 96–102. Palgan, I., Munoz, A., Noci, F., Whyte, P., Morgan, D.J., Cronin, D.A., and Lyng, J.G. (2012) Effectiveness of combined Pulsed Electric Field (PEF) and Manothermosonication (MTS) for the control of Listeria innocua in a smoothie type beverage. Food Control, 25, 621–625. Huang, E., Mittal, G.S., and Griffiths, M.W. (2006) Inactivation of Salmonella enteritidis in liquid whole egg using combination treatments of pulsed electric field, high pressure and ultrasound. Biosystems Eng., 94, 403–413. Chapman, J.S., Ferguson, R., Consalo, C., and Bliss, T. (2013) Bacteriostatic effect of sequential hydrodynamic and ultrasound-induced stress. J. Appl. Microbiol., 114, 947–955. Wong, E., Vaillant-Barka, F., and Chaves-Olarte, E. (2012) Synergistic effect of sonication and high osmotic pressure enhances membrane damage and viability loss of Salmonella in orange juice. Food Res. Int., 45, 1072–1079. Alvarez, I., Manas, P., Virto, R., and Condon, S. (2006) Inactivation of Salmonella Senftenberg 775W by ultrasonic waves under pressure at different water activities. Int. J. Food Microbiol., 108, 218–225. Manas, P., Pagan, R., Raso, J., Sala, F.J., and Condon, S. (2000) Inactivation of Salmonella enteritidis, Salmonella Typhimurium, and Salmonella Senftenberg by ultrasonic waves under pressure. J. Food Prot., 63, 451–456. Manas, P., Pagan, R., and Raso, J. (2000) Predicting lethal effect of ultrasonic waves under pressure treatments on Listeria monocytogenes ATCC 15313 by power measurements. J. Food Sci., 65, 663–667. Condón, S., Mañas, P., and Cebrián, G. (2011) in Ultrasound Technologies for Food and Bioprocessing (eds H. Feng, G. Barbosa-Canovas, and J. Weiss), Springer, New York, pp. 287–319. Bermudez-Aguirre, D. and Barbosa-Canovas, G.V. (2012) Inactivation of Saccharomyces cerevisiae in 127. 128. 129. 130. 131. 132. 133. 134. 135. pineapple, grape and cranberry juices under pulsed and continuous thermosonication treatments. J. Food Eng., 108, 383–392. Herceg, Z., Jambrak, A.R., Lelas, V., and Thagard, S.M. (2012) The effect of high intensity ultrasound treatment on the amount of staphylococcus aureus and Escherichia coli in milk. Food Technol. Biotechnol., 50, 46–52. Wordon, B.A., Mortimer, B., and McMaster, L.D. (2012) Comparative real-time analysis of Saccharomyces cerevisiae cell viability, injury and death induced by ultrasound (20 kHz) and heat for the application of hurdle technology. Food Res. Int., 47, 134–139. Pagan, R., Manas, P., Alvarez, I., and Condon, S. (1999) Resistance of Listeria monocytogenes to ultrasonic waves under pressure at sublethal (manosonication) and lethal (manothermosonication) temperatures. Food Microbiol., 16, 139–148. Schultz, A.C., Uhrbrand, K., Norrung, B., and Dalsgaard, A. (2012) Inactivation of norovirus surrogates on surfaces and raspberries by steamultrasound treatment. J. Food Prot., 75, 376–381. Jyoti, K.K. and Pandit, A.B. (2003) Hybrid cavitation methods for water disinfection: simultaneous use of chemicals with cavitation. Ultrason. Sonochem., 10, 255–264. Dahi, E. (1976) Physicochemical aspects of disinfection of water by means of ultrasound and ozone. Water Res., 10, 677–684. Jyoti, K.K. and Pandit, A.B. (2004) Ozone and cavitation for water disinfection. Biochem. Eng. J., 18, 9–19. Gogate, P.R., Mededovic-Thagard, S., McGuire, D., Chapas, G., Blackmon, J., and Cathey, R. (2014) Hybrid reactor based on combined cavitation and ozonation: from concept to practical reality. Ultrason. Sonochem., 21, 590–598. Taran, V.S., Garkusha, I.E., Krasnyj, V.V., Lozina, A.S., Muratov, R.M., Shulaev, V.M., and Timoshenko, A.I. 349 350 11 136. 137. 138. 139. 140. 141. 142. 143. The Antimicrobial Effects of Ultrasound (2012) Recent developments of plasmabased technologies for medicine and industry. Nukleonika, 57, 277–282. Chen, C.W., Lee, H.M., Chen, S.H., Chen, H.L., and Chang, M.B. (2009) Ultrasound-assisted plasma: a novel technique for inactivation of aquatic microorganisms. Environ. Sci. Technol., 43, 4493–4497. Knorr, D., Froehling, A., Jaeger, H., Reineke, K., Schlueter, O., and Schoessler, K. (2011) Emerging technologies in food processing. Annu. Rev. Food Sci. Technol., 2, 203–235. Ayyildiz, O., Sanik, S., and Ileri, B. (2011) Effect of ultrasonic pretreatment on chlorine dioxide disinfection efficiency. Ultrason. Sonochem., 18, 683–688. Brilhante Sao Jose, J.F. and Dantas Vanetti, M.C. (2012) Effect of ultrasound and commercial sanitizers in removing natural contaminants and Salmonella enterica Typhimurium on cherry tomatoes. Food Control, 24, 95–99. Chen, Z. and Zhu, C. (2011) Combined effects of aqueous chlorine dioxide and ultrasonic treatments on postharvest storage quality of plum fruit (Prunus salicina L.). Postharvest Biol. Technol., 61, 117–123. Sagong, H.-G., Lee, S.-Y., Chang, P.S., Heu, S., Ryu, S., Choi, Y.-J., and Kang, D.-H. (2011) Combined effect of ultrasound and organic acids to reduce Escherichia coli O157:H7, Salmonella Typhimurium, and Listeria monocytogenes on organic fresh lettuce. Int. J. Food Microbiol., 145, 287–292. Zhou, B., Feng, H., and Luo, Y. (2009) Ultrasound enhanced sanitizer efficacy in reduction of Escherichia coli O157:H7 population on spinach leaves. J. Food Sci., 74, M308–M313. Oulahal, N., Martial-Gros, A., Bonneau, M., and Blum, L.J. (2004) Combined effect of chelating agents and ultrasound on biofilm removal from stainless steel surfaces. Application to “Escherichia coli milk” and “Staphylococcus aureus milk” biofilms. Biofilms, 1, 65–73. 144. Oulahal, N., Martial-Gros, A., Bonneau, 145. 146. 147. 148. 149. 150. 151. 152. 153. M., and Blum, L.J. (2007) Removal of meat biofilms from surfaces by ultrasounds combined with enzymes and/or a chelating agent. Innovative Food Sci. Emerg. Technol., 8, 192–196. Nazari, S.H. and Weiss, J. (2010) Evidence of antimicrobial activity of date fruits in combination with high intensity ultrasound. Afr. J. Microbiol. Res.,