Download Contribution of neuronal sodium channels to the cardiac fast sodium

Cardiovascular Research 65 (2005) 117 – 127
www.elsevier.com/locate/cardiores
Contribution of neuronal sodium channels to the cardiac fast sodium
current I Na is greater in dog heart Purkinje fibers than in ventricles
V. Haufea, J.M. Cordeirob, T. Zimmera, Y.S. Wub, S. Schiccitanob, K. Benndorf a, R. Dumaineb,*
a
Friedrich Schiller University Jena, Institute of Physiology II, Teichgraben 8, 07740 Jena, Germany
b
Masonic Medical Research Laboratory, 2150 Bleecker Street Utica NY 13501, USA
Received 19 May 2004; received in revised form 29 August 2004; accepted 31 August 2004
Available online 25 September 2004
Time for primary review 26 days
Abstract
Objective: To determine the presence and the potential contribution of neuronal sodium channels to dog cardiac function.
Methods: We used a combination of electrophysiological (patch clamp), RT-PCR, biochemical and immunohistochemical techniques to
identify and localize neuronal Na+ channels in dog heart and determine their potential contribution to the fast sodium current.
Results: In all cardiac tissues investigated, Nav1.1, Nav1.2 and Nav1.3 transcripts were detected. In immunoblots, we found Nav1.1 and
Nav1.2 proteins in the ventricle (V) and in Purkinje fibers (PF). Nav1.3 immunoblots suggested strong proteolytic activity against this isoform
in the heart. Nav1.6 was not found in any of the tissues tested. Confocal immunofluorescence on cardiac myocytes showed that Nav1.1 was
predominantly localized at the intercalated disks in V and PF and around the nucleus (V). Nav1.2 was only present at the Z lines (V).
Consistent with the immunoblot data, an intense but diffuse intracellular staining was observed for Nav1.3. Nav1.6 fluorescence staining was
faint and diffuse. Surprisingly, immunoblots indicated the presence of two Navh2 variants: a 42-kDa protein that co-localized with Nav1.2 at
the Z lines in V and a 34-kDa protein that co-localized with Nav1.1 at the intercalated disks in PF. In agreement with the biochemical data,
electrophysiological results suggest that neuronal sodium channels generate 10F5% and 22F5% of the peak sodium current in dog ventricle
and Purkinje fibers, respectively.
Conclusions: Our results suggest that neuronal NaChs are more abundant in Purkinje fibers than in ventricles, and this suggests a role for
them in cardiac conduction.
D 2004 European Society of Cardiology. Published by Elsevier B.V. All rights reserved.
Keywords: Ion channels; Gene expression; Purkinje fibers; Na-channel
1. Introduction
Contraction of the heart is initiated when action
potentials (AP) from the atria converge towards the
atrioventricular (AV) node and travels down the HIS
bundles to the Purkinje fibers (PF) to spread the electrical
impulse to the ventricles (V) [1]. In PF and V, voltagedependent Na+ channels (NaV) generate the sodium current
(I Na) responsible for the AP upstroke.
NaVs a-subunit consists of four domains each containing
six transmembrane segments [2–4], associated to accessory
* Corresponding author. Tel.: +315 735 2217; fax: +315 735 5648.
E-mail address: [email protected] (R. Dumaine).
h-subunits [5]. The cardiac-specific a-subunit Nav1.5 is
resistant to blockade by tetrodotoxin (TTX) and saxitoxin
(STX) [6–8] and is believed to generate the bulk of I Na.
Early evidences hint at the presence of TTX sensitive
neuronal Na+ channels (nNavs) in the heart. Coraboeuf et al.
[9] showed that low concentrations of TTX shortened the
AP of PF and slowed their beating rate. Renaud et al. [10]
identified TTX sensitive receptors in rat hearts. In the 1990s,
nNaVs mRNA and proteins were detected in rat and mouse
heart [11–15].
Metabolic stress enhances nNaVs activity and brain cells
excitability [16]. Cardiac NaVs on the contrary are inhibited
by hypoxia and ischemia [16]. These opposite responses
suggest that nNaVs contribution to cardiac electrophysiol-
0008-6363/$ - see front matter D 2004 European Society of Cardiology. Published by Elsevier B.V. All rights reserved.
doi:10.1016/j.cardiores.2004.08.017
118
V. Haufe et al. / Cardiovascular Research 65 (2005) 117–127
Table 1
Primer pairs used for competitive RT-PCR
No.
Sequence (5Vto 3V) forward/reverse primer
Channel
Size (kb)
Target region
1
2
3
4
ACYTAYATWTTCATTCTGGAAATGCT/TTTCCCTTTGGCTTTTTCATCTTT
ACYTAYATWTTCATTCTGGAAATGCT/CTTTCCCTGATATCTTTCCCTTTGTC
AAAGAATTCAAGAAGTTTGGAGGTCAGGACAT/TGTWAAAACAGTCAGTTTGGCAT
AAGGGGATCCGCACACTGCTCT/TCCTCGCTCAGGGGCTC
Nav1.1
Nav1.2
Nav1.3
Nav1.x
2.20
2.20
1.65
0.45
DIII/S2-COOH
DIII/S2-COOH
III/IV loop-COOH
DIV/S4-COOH
Primer pairs 1 to 3 were used to isolate fragments of the neuronal isoforms. Primer pair No. 4 was applied to simultaneously amplify Nav1.1, Nav1.2, Nav1.3,
and Nav1.5 (Nav1.x; see Fig. 1A). W–A+T; Y–C+T; COOH-C-terminal region.
ogy may be linked to pathophysiological conditions. To test
such hypothesis, however, knowledge of nNaV isoforms
present in the heart of species close to humans is needed but
currently lacking. This study’s aim is to determine the
genetic makeup of cardiac I Na in dog PF and V.
Data regarding NaV isoforms expressed in the heart of
large mammal species closer to human seem at odds with
results obtained in rodents. Maier et al. [14] initially found
the neuronal subtypes: NaV1.1, NaV1.3, and NaV1.6 in the
T-tubules but could not detect the presence of NaV1.2 in
mouse myocytes and recently showed that NaV1.5 and the
NaVh2 subunit co-localize at the intercalar disks while
NaVh1 and NaVh3 co-localize with NaV1.1, NaV1.3 and
NaV1.6 [17]. In contrast, we could not detect Nav1.3 or
NaV1.6 proteins but found NaV1.2 in the plasma membrane
of canine myocytes. These discrepancies between dog, rat
[13] and mouse [14] suggest species-specific requirements
for nNaVs.
2. Methods
2.1. Competitive RT-PCR
Total RNA was isolated using the Total RNA Isolation
Kit (Ambion). Reverse transcription (RT) was performed
using Superscript II (Invitrogen) with an equimolar mix of
anchored oligonucleotides (dTAN, dTCN, dTGN). Reverse
Fig. 1. Relative mRNA content of Na+ channel isoforms in dog heart determined by competitive RT-PCR. (A) Simultaneous amplification of Nav1.1, Nav1.2,
Nav1.3, and Nav1.5 from reverse transcribed cDNA (right ventricle, RV) followed by Nav-specific restriction digest of the original PCR amplicon. Lanes 1:
undigested (0.45 kb); 2: BseDI digest (0.24 kb) for Nav1.1; 3: Eco47I (0.20 and 0.25 kb) for Nav1.2; 4: Alw44I (0.20 and 0.25 kb) for Nav1.3; 5: ClaI (0.30 and
0.15 kb) for Nav1.5; 6: Water contro1 (no cDNA). Intensity of each Nav-specific band was expressed as a fraction of the intensity of the undigested amplicon.
(B) Simultaneous amplification of Nav1.1, Nav1.2, and Nav1.3 using specific primer pairs and confirmation of the presence of each channel in RV by Navspecific restriction digest of the initial PCR amplicon (0.71 kb) in lane 1. Lanes 2: Nav1.1 (BseDI, 0.39 kb); 3: Nav1.2 (Eco47I, 0.35 kb and 0.29 kb); 4: Nav1.3
(Alw44I, 0.43 kb and 0.29 kb); 5: Water control. (C–E) Transcriptional levels of brain and cardiac Na+ channels mRNA calculated from relative band
intensities, as described in (A). (C) Relative intensity of pooled nNaVs (Nav1.1+Nav1.2+Nav1.3) and Nav1.5 digests expressed as percent of the intensity of the
undigested amplicon. SA: Sino-atrial node, AV: Atrio-ventricular node, HIS: His Bundle, RA, LA: Right, left atrium, PF: Purkinje fibers, RV, LV: right, left
ventricle. (D) Contribution of individual nNaVs as percent of the intensity of the pooled nNaV amplicon shown in (C). (E) Relative expression of nNaVs in dog
brain. Nav1.5 was undetectable in these samples. E: DNA ladder, bp: base pairs. DataFS.E.M. Number of samples: SA: 4; RA: 6; LA: 8; AV: 3; HIS: 5; PF: 7;
RV: 5; LV: 6.
V. Haufe et al. / Cardiovascular Research 65 (2005) 117–127
Table 2
Relative transcript levels of Na+ channels in different heart regions
Region
SA
RA
LA
AV
HIS
PF
RV
LV
Brain
Relative amplicon intensity in percent of total
NaV1.1
NaV1.2
NaV1.3
NaV1.5
1.5F1.0*
1.7F0.9*
3.1F1.1***
4.7F2.4
5.4F1.6**
13.0F3.9
4.7F2.1*
6.2F2.1*
41.8F6.8
0.8F0.5*
n.d.
1.6F0.7***
1.0F1.0*
1.8F0.8**
15.6F6.2
2.3F1.2**
1.8F0.7***
53.5F6.5
18.3F1.6
11.5F1.9
15.5F4.0*
10.0F1.2
9.0F1.1
6.0F1.7
9.0F1.7
8.3F2.0
4.8F0.3
79.4F2.3*
86.8F2.1*
79.8F3.5*
84.3F3.0*
83.8F2.8**
65.4F9.2
84.0F4.7*
83.7F1.7***
n.d.
n
4
6
8
3
5
7
6
6
2
Primer pair 4 (Table 1) was used to simultaneously amplify all four
isoforms in a competitive PCR reaction and each contribution to the total
amplicon was subsequently assessed by restrictive digest (Fig. 1) and
expressed as percent of the total intensity. Data are presented as
meanFS.E.M., (*pb0.05, **pb0.01, ***pb0.001 ANOVA: Sample vs.
PF, column wise. Brain results not compared to PF). n.d.: not detectable.
transcribed cDNA (RT-cDNA) was digested with RNase H.
Parts of the C-terminal region of canine Na+ channels:
cNav1.1 (2.2 kb), cNav1.2 (2.2 kb), and cNav1.3 (1.7 kb),
and the full-length cNav1.5 (accession AJ555547) were
amplified by PCR (Pfu DNA polymerase) and subcloned
into pUC119 for sequencing. Homologous regions between
the canine nucleotide sequences were used to design primers
(Table 1). Ten primer pairs were used to test for the
amplification efficiency of each Na+ channel isoform in the
competitive reaction. The selected primer pair amplified
cNav1.2, cNav1.3, and cNav1.5 with the same efficiency but
produced about two-fold higher levels of cNav1.1. Nav1.1
data in Fig. 1 are presented as uncorrected intensity values.
Individual Na+ channel fragments were identified by
restriction digests. Densitometric values were obtained with
the EASY Win32 system from Herolab (Wiesloch, Germany) coupled to a CCD camera.
119
between domains I and II or II and III (Nav1.6) of their
respective a-subunit. Navh2 antibodies (Alomone Labs)
target the intracellular C-terminus of the h2-subunit. In
control experiments, antibodies were pre-absorbed against
their respective antigen (2 Ag/ml) for 1 h at RT then
overnight at 4 8C in 1 ml of blocking solution (5% non-fat
dry milk, 5% goat serum).
2.4. Immunoblots
Total proteins were isolated from the organic phase
obtained from the RNA isolation procedure (Ambion) as
previously described [19]. Membrane proteins were isolated
by centrifugation on a sucrose gradient according to the
protocol published by Alomone Labs. Proteins were
denatured by heating for 30 s at 60 8C and were reduced
by application of h-mercaptoethanol (h-ME) where indicated (+) before loading and electrophoresis in SDS
polyacrylamide gels. Proteins were blotted on PVDF
2.2. Mutagenesis
Mutation C372Y was constructed using the megaprimer
method of site-directed mutagenesis on plasmid pcDNA3/
hH1a obtained by cloning the sodium channel SCN5A into
the vector pcDNA3.1+ (Invitrogen) as previously described
[18]. Full-length wild type and mutated pcDNA3/hH1a
cDNAs were linearized by digestion with EcoRI and
transcribed using the T7 mMessage mMachine transcription
kit (Ambion, Austin, TX). RNA was resuspended in 0.1 M
KCl and stored at 80 8C. The concentration and quality of
cRNA were assessed by optical density (OD260) reading and
electrophoresis.
2.3. Antibodies
The anti-Pan antibody (SP19, Sigma) targets a conserved region of the intracellular loop between domains III
and IV of the Na+ channel a subunits. Nav1.1, Nav1.2, and
Nav1.3, antibodies (Alomone Labs, Israel) target an epitope
Fig. 2. Neuronal Nav1.1 proteins in dog ventricles. (A) Detection of Na+
channels by SP19 antibodies. Left panel: Immunoblot of native proteins
( ) from the cortical region of dog brain. SP19 recognized major bands at
~250, ~150, and ~90 kDa. Application of the reducing agent hmercaptoethanol (h-ME; +; 165 mM) decreased the intensity of the
heaviest band. Right panel: In right ventricle (RV) membrane proteins,
SP19 recognized a ~150-kDa protein and a ~90-kDa proteolytic fragment.
SP19 antibodies pre-absorbed against their antigen (Pa) did not highlight
any band. (B) In brain, Nav1.1 antibodies recognized bands of ~250 and
~150 kDa. h-ME (+) reduced the intensity of the 250-kDa band and
increased the amount of ~150-kDa proteins suggesting a covalent link to a
h-subunit. In RV proteins Nav1.1 antibodies recognized ~150 kDa and,
faintly, 250-kDa proteins (arrow). h-ME (+) abolished the ~250-kDa band.
Pre-absorbed antibodies: Pa.
120
V. Haufe et al. / Cardiovascular Research 65 (2005) 117–127
membranes (Perkin Elmer) using standard methods. Antigen-bond primary antibodies (1:200) were detected with
HRP-conjugated goat anti-rabbit antibody (BioRad).
2.5. Cell isolation
Ventricular myocytes were dissociated from adult dog
heart left ventricle as previously described [20,21] and
resuspended in a sterile solution containing in mM: NaCl:
132, KCl: 5, CaCl2(2H2O): 0.5, MgSO4: 2, HEPES: 20, dGlucose: 11.1, and 1.5% Bovine Serum Albumin (BSA)
Fraction V (Sigma). PF were dissected out and myoytes
were dissociated by sequential incubations of 10 min in
collagenase (chunk method) as previously described [22].
2.6. Immunocytochemistry
Cells in low-calcium Tyrode solution containing (in
mM): NaCl: 130, KCl: 4, MgSO4: 1.2, HEPES: 10, DGlucose: 11.1, were cytospun on glass slides and immediately fixed in a solution containing: 5% ethanol, 25%
acetone, 70% formaldehyde/ZnCl2, pH 6 for 15 min at 4 8C
and then permeabilized for 10 min in a Ca2+-free Tyrode
solution containing Saponin (0.25% w/v) and CHAPS
(0.5% w/v). Primary antibodies (1:200) were applied over-
night at 4 8C and detected with a goat anti-rabbit antibody
(1:1000) conjugated to Alexa 488 (Molecular Probes, USA).
Propidium iodine (PI) was used to stain nucleotide rich
regions (nucleus). Cells mounted with Pro-Long antifade
mounting media (Molecular Probe) were visualized on a
Olympus Fluoview (Olympus, Japan) confocal microscope,
as previously described [21].
2.7. Electrophysiology
Whole-cell voltage clamp was performed on myocytes
allowed to adhere to the bottom of polylysine-coated Petri
Dish (35 mm) mounted on the stage of a Nikon Diaphot
microscope and superfused at a rate of 2–3 ml/min with
the extracellular solution. The outflow of a micro-manifold
fast perfusion apparatus (ALA Scientific Instruments,
Westbury, NY) placed closed to the cell was used to
deliver (2-aminoethyl)methanethiosulfonate (MTSEA).
MTSEA was prepared fresh before each application.
Experiments were performed at room temperature using a
VE-2 amplifier (Alembic Instruments, Montreal, Qc) or an
Axopatch-2B (Axon Instruments, CA), analysis of the data
with the pClamp 9 program suite (Axon Instruments).
Patch pipettes with 1.5–2.5 MV resistance were pulled
from borosilicate glass tubes (1.5 mm o.d. and 1.1 mm
Fig. 3. Nav1.2 and the ancillary h-subunit Navh2 are present in dog ventricles. (A) Left panel: Immunoblot of native brain proteins ( ). Nav1.2 antibodies
recognized ~250, ~150 and ~90 kDa proteins. h-ME (+) reduced the intensity of the ~250 kDa band. Right panel: In RV membrane proteins, a single ~150-kDa
protein was detected. Pa: Pre-absorbed Nav1.2 antibodies. (B) Left: Navh2 antibodies recognized a ~34-kDa protein in brain. h-ME (+) treatment revealed a
second ~42-kDa band previously linked to another protein. Right panel: In RV, Navh2 antibodies recognized a faint band above 210- and the 42-kDa protein. hME (+) had no effects on the size of the 42-kDa band. Pa: Pre-absorbed Navh2 antibodies.
V. Haufe et al. / Cardiovascular Research 65 (2005) 117–127
i.d.). Tip potentials (9–15 mV) were measured for voltage
corrections and series resistance were 85% to 95%
compensated. Currents were filtered online at 5 kHz
(Bessel filter). Reagents were obtained from regular
suppliers (Sigma, Alomone Labs, Fisher, Sardstead),
MTS reagents were obtained from Toronto Chemicals.
To minimize voltage clamp errors due to large cardiac
sodium currents, extracellular sodium concentration was
reduced and contained, (in mM)::94 Choline–Cl, 40 NaCl,
2 CaCl2, 1 MgCl2, 1 CoCl2, 10 HEPES, 10 glucose, pH
7.4 (Choline–OH). Pipette solution (mM): 5 NaOH, 145
Cs–aspartate, 1 MgCl2, 10 HEPES, 4 MgATP, 5 EGTA,
pH 7.2 (CsOH). An expected small shift in NaVs steadystate gating parameters due to the presence of CoCl2 in our
extracellular solution was observed and taken into consideration in our analysis but did not affect the MTSEA
block. Recordings in tsa201 cells were as previously
described [23].
rXenopus laevis oocytes were prepared, co-injected with
0.2 to 1.25 ng of sodium channel cRNA, and currents were
recorded 4 to 10 days post-injection according to methods
previously described [18,24,25]. For electrophysiological
recordings at room temperature, external solution flowing at
2 to 3 ml/min contained (mM): 135 NaOH, 130 methanesulfonic acid, 5 NaCl, 5 CsCl, 0.2 CaCl2, 1.8 MgCl2, 10 N-2hydroxyethylpiperazine-NV-2-ethanesulfonic acid (HEPES),
pH 7.3 (NaOH). Oocyte whole cell currents recorded using
the two-electrode voltage-clamp method [25] with beveled
micropipettes filled with 1% agar in 3 M KCl [26] were
amplified by a Warner Oocyte Clamp 725C amplifier
(Warner Instrument, Hamden, CT), low pass-filtered at 5
kHz ( 3 dB, 4-pole Bessel filter) and digitized at 100 kHz.
The pCMV/SCN1A, pCD8-IRES-hh1 and pGFP-IREshh2 cDNA constructs [27] were transfected at a molar ratio
of 10:1:1, respectively, into tsa201 cells grown to 60%
confluency in 60-mM culturing dishes [23]. Data were
analysed using a Student’s T-test for paired data and
ANOVA for unpaired RT-PCR results.
This investigation conforms with the Guide for Care and
Use of Laboratory animals published by the US National
Institutes of Health (NIH Pub. No. 85-23, revised 1996).
121
right and left atria, V, HIS bundle and Purkinje fibers
showed the presence of nNaVs in each tissue type (Table 2).
RNA from nNaVs was more abundant in PF, accounting
for 35F7% of the total Na+ channel RT-cDNA compared to
values between 13F2% and 21F2% in other cardiac tissues
(Fig. 1C). When nNavs RNA contribution was broken down
into its constituents (Fig. 1D), Nav1.3 was the most
abundant transcript except in PF where Nav1.1 and Nav1.2
levels were higher.
We next tested for proportional amounts of proteins in
V and PF using immunoblots and immunofluorescence
assays. The SP19 antibody targets a conserved epitope
within the cytosolic III–IV loop of all NaVs [28,29] and
yielded bands with apparent molecular weight of ~250,
150 and 90 kDa in proteins from the cortical region of
dog brains (Fig. 2A) We next tested for covalent
assembly of nNAVs with h-subunits [5,30–32]. Application of the reducing agent h-mercaptoethanol (h-ME)
slightly decreased the intensity of the (~250 kDa) band
suggesting that some nNavs are heavily glycosylated or
not covalently linked to other subunits. Thus, the ~150kDa band represents the unglycosylated and reduced form
of nNaVs while the band at 90 kDa and the fainter bands
are likely to represent proteolytic fragments. In proteins
3. Results
We first determined the abundance of nNav mRNA in
different regions of the heart. In ventricles, primers (Table 1)
designed to simultaneously amplify the nNaV isofoms
Nav1.1, Nav1.2, Nav1.3 and Nav1.5 generated the expected
0.45-kb PCR amplicon (Fig. 1). Selective restriction digest
of this amplicon yielded bands of the expected size for each
nNaVs and Nav1.5 (Fig. 1A). In control experiments,
primers specifically targeting nNavs amplified the expected
0.75-kb amplicon. Restriction digests specific to each nNav
yielded the expected bands (Fig. 1B). PCR/selective-digest
experiments using RT-cDNA from the SA and AV nodes,
Fig. 4. Nav1.3 and Nav1.6 are not expressed in the plasma membrane of dog
ventricular myocytes. (A) Left: Anti-Nav1.3 antibodies recognized bands at
~150 and ~70 kDa in dog brain. h-ME (+) had no effects, Right: Nav1.3
antibodies recognized proteolytic fragments in RV total cell lysate but not in
isolated plasma membrane proteins (M). Pa: Pre-absorbed Nav1.3 antibodies. (B) Left: Nav1.6 recognized a ~150-kDa protein in brain. h-ME (+)
had no effects. Right: RV cell lysate and membrane proteins showed only
proteolytic fragments (b82 kDa). Pa: Pre-absorbed Nav1.6 antibodies
recognized unspecific IgGs around ~50 kDa.
122
V. Haufe et al. / Cardiovascular Research 65 (2005) 117–127
from right ventricles (RV), ~150 and ~82 kDa bands were
detected with SP19. A ~170-kDa band was expected
based on the literature provided by the manufacturer
(Alomone Labs). Immunoblots of brain proteins with
Nav1.1 antibodies revealed a banding pattern similar to
SP19 (Fig. 2B). Application of h-ME abolished the high
molecular weight band and increased the intensity of the
~150-kDa band suggesting covalent assembly of Nav1.1
with a h-subunit in dog brain. In RV, a faint band N250
kDa (arrow) was observed in all samples tested (n=4) and
disappeared after application of h-ME thus suggesting
that some Na v 1.1 channels are associated with a
h-subunit.
In brain, Nav1.2 antibodies highlighted bands similar
to the ones obtained with the Nav1.1 antibody (Fig. 3A)
and h-ME abolished the ~250-kDa band. In RV, only the
~150-kDa band was observed, suggesting that Nav1.2
does not co-assemble with other subunits in this tissue.
Since nNaVs covalently assemble with Navh2, we tested
for its presence in brain and RV (Fig. 3B). A 42-kDa protein
and a ~250-kDa band were detected in both tissues. A third
34-kDa band was present only in brain. h-ME reduced the
high MW protein in RV but did not change the size of the
42-kDa protein.
Nav1.3 and Nav1.6 antibodies recognized proteins of
similar sizes (~150 kDA) in brain (Fig. 4A,B). In RV,
Nav1.3 antibodies detected proteins likely to be proteolytic
fragments in total protein preparations but none in membrane fractions separated by centrifugation (Fig. 4A)
suggesting cytosolic degradation of NaV1.3 proteins before
Fig. 5. In-situ localization of neuronal nNaVs in dog ventricular myocytes. Confocal immunofluorescence assays on freshly dissociated and fixed RV myocytes
probed with Nav1.1, Nav1.2, Navh2, Nav1.3, and Nav1.6 antibodies (Green). Propidium iodine (PI, red) stained nucleotide rich areas (nucleus). (A) Staining by
SP19. Left panel: Single optical section from the sarcolemma showing strong intercalated disks, Z lines and dotted surface staining. Right panel:
Reconstruction from 15 serial optical sections (OS) showing strong perinuclear staining. (B) Nav1.1 antibody primarily stained the intercalated disks and the
perinuclear region. (C–D) Nav1.2 and Navh2 were detected at the Z lines (25 OS). (E) Nav1.3 antibodies stained the Z lines and intracellular organelles (25
OS). (F) Nav1.6 antibodies show diffused intracellular staining (15 OS). (G–I) Controls: Pre-absorbed Nav1.1, Nav1.3, and Nav1.6 antibodies. Pre-absorbed
Nav1.6 antibodies showed unspecific staining. Scale bars: 50 Am.
V. Haufe et al. / Cardiovascular Research 65 (2005) 117–127
translocation to the sarcolemma. In RV, Nav1.6 antibodies
recognized unspecific low MW bands also detected by preabsorbed antibodies.
In ventricular myocytes, SP19 recognized NaVs at the
intercalated disks, Z lines and perinuclear region (Fig. 5A).
A dotted pattern typical of the T-tubule distribution was
observed in optical sections (~0.4 Am) of the sarcolemma.
Nav1.1 was abundant at the intercalated disks and in the
perinuclear region with a faint distribution at the Z lines
(Fig. 5B). Nav1.2 and Navh2 were found only along the Z
lines suggesting co-localization of the two proteins in V
(Fig. 5C,D). The distribution of Nav1.3 antigens was highly
variable but in most cells appeared as a diffuse signal in the
cytoplasm (Fig. 5E). Nav1.3 staining at the Z lines was
observed in only one of the four dogs tested. Nav1.6
antibodies gave a diffused fluorescent signal through the
entire cell thickness (Fig. 5F). In all control experiments,
except for Nav1.6 (Fig. 5I), cells probed with pre-absorbed
antibodies did not generate fluorescent signals above background levels (Fig. 5G,H).
In PF, immunoblots showed a distribution pattern similar
to V for NaV1.1 and NaV1.2 (Fig. 6A). In contrast to V,
Navh2 antibodies recognized only the 34-kDa protein in PF.
123
In-situ, NaV1.1 and Navh2 co-localized at the PF intercalated disks (Fig. 6B,C). In cryosections taken just below the
AV node (Fig. 6D,E) localized Nav1.2 and NaV1.1 were
more abundant in the left and right bundle branch.
To estimate the contribution of nNaVs to I Na, we took
advantage of structural differences in the pore region of
NaVs. A cysteine at position 372 in NaV1.5 confers high
sensitivity to Zinc and low affinity for TTX [33]. In nNaVs
of all species studied including dog, a phenylalanine or
tyrosine (NaV1.4) at the corresponding position (Y381 in
human) increases NaV1.1 and NaV1.2 sensitivity to TTX
and reduces sensitivity to zinc. Since the sulfhydryl group of
cysteine binds covalently to methanethiosulfonate reagents,
we reasoned that MTSEA could be used to specifically
block NaV1.5 current.
In control experiments (Fig. 7), MTSEA irreversibly
blocked human NaV1.5 currents. Replacing the cysteine
at position 372 by a tyrosine abolished the covalent block
by MTSEA. In native myocytes, MTSEA covalently
blocked 90F5% and 78F5% of the peak sodium current
within 2 min of application onto V and PF myocytes
(Fig. 8A,C). MTSEA weakly and reversibly blocked
NaV1.1 channels expressed in tsa201 cells (Fig. 8B).
Fig. 6. In-situ localization of Nav1.1, Nav1.2, and Navh2 in PF and conduction system. (A) Nav1.1 and NaV1.2 antibodies recognized a ~150-kDa protein in PF.
Navh2 antibodies also recognized primarily a 34-kDa protein and a second band of ~70 kDa indicating possible dimers. Pre-absorbed antibodies (Pa) did not
detect any band. (B–C) Immunostaining as described in Fig. 5. Nav1.1 (B) and Navh2 (C) showed a preferential distribution at the intercalated disks in PF cells.
No PI was used in these experiments. Scale bars: 50 Am. (D) Anatomical location of the cryosection shown in (E). The plane corresponds to the cut area. RBB:
right bundle branch, AVN: atrio-ventricular node. (E) Fifteen-micrometer-thick cryosection probed with anti-Nav1.1 and Nav1.2 antibodies and PI indicating
the presence of nNaVs in the left and right bundle branch (RBB). Scale bar: 100 Am.
124
V. Haufe et al. / Cardiovascular Research 65 (2005) 117–127
Fig. 7. MTSEA specifically targets a cysteine residue in the pore region of NaV1.5. (A) Electrical current recordings from X. laevis oocytes injected with
NaV1.5 mRNA. MTSEA (5 mM) covalently blocked NaV1.5 peak current within 10 min. Mutating cysteine at position 372 for a tyrosine (C372Y) abolished
NaV1.5 covalent block by MTSEA. (B) Time course of the blockade by MTSEA. In NaV1.5, a irreversible 98% block consistent with a covalent bound
between MTSEA and C372 was observed within 10 min. C372Y eliminated the covalent block by MTSEA and reduced the affinity for Zinc. Filled symbols:
NaV1.5, Open: NaV1.5/C372Y.
A hallmark of nNaVs in most species including dog [34–
36] is their high sensitivity to TTX. We next tested if the
residual current was TTX-sensitive. Fig. 9 shows that
MTSEA insensitive currents in PF and V were abolished
by 100 nM TTX, a concentration with minimal effects on
NaV1.5. TTX applied before or after wash in of MTSEA
Fig. 8. Inhibition of NaV1.5 current by MTSEA in Purkinje fibers (PF) and ventricular (V) cardiomyocytes from adult dogs. (A) Representative current
recordings from V and PF in low Na+ (40 mM) elicited by sequential 15-ms steps to 10 mV every 30 s. MTSEA block reached a steady state within 2 min. In
these recordings, 8.5% of the V peak current remained after application of MTSEA compared to 20% in PF. Block was not removed by washout of MTSEA.
(B) Current recordings from tsa201 cells transfected with NaV1.1, NaVh1 and NaVh2 during application and washout of MTSEA. (C) Average MTSEA
insensitive current in V and PF (n=7 for both cell types). Statistical significance *pb0.05, double sided Student’s T-test V vs. PF.
V. Haufe et al. / Cardiovascular Research 65 (2005) 117–127
125
Fig. 9. MTSEA insensitive current in PF and V is tetrodotoxin (TTX) sensitive. (A) Representative traces following sequential application of TTX (100 nM)
and MTSEA (2 mM) on a PF myocyte. (B) Current recording following sequential application of MTSEA (2 mM) and TTX on a V myocyte. Residual currents
were blocked by low TTX concentrations. (C–D) Time course of the MTSEA and TTX block for experiments illustrated in (A) and (B), respectively. Arrows
indicate the time of application of each compound.
abolished the residual current in four PF and four V cells
tested, thus confirming the neuronal nature of the MTSEA
insensitive current.
4. Discussion
We found Nav1.1 and Nav1.2 in V but more abundantly
in PF. In V, NaV1.1 is primarily located at the intercalated
disks, an important region for cell-to-cell conduction [37],
along the Z lines and in the perinuclear region. These
preferential locations suggest that Nav1.1 may play a role in
AP propagation by a mechanism similar to neuronal
saltatory conduction.
Despite an abundant amount of mRNA, we did not detect
mature Nav1.3 proteins in immunoblot assays and confocal
microscopy revealed a diffused cytosolic distribution. The
low density of proteins in the sarcolemma may be due to a
rapid turnover of NaV1.3 or recycling of the proteins in
intracellular organelles. Alternatively, ventricular cells may
be lacking an accessory protein for proper translocation of
Nav1.3. We could not detect proteins of the expected size for
Nav1.6, suggesting that this protein is not expressed in V
and PF.
We previously reported that a fraction of Nav1.5 channels
remains trapped in the ER [21]. Our results showing Nav1.1
proteins in the perinuclear envelope of V myocytes suggest
a similar ER trapping mechanism. Retention and exit from
the ER often involve protein phosphorylation and are
common mechanism regulating gene expressions [38–41].
Given the strong modulation of nNaVs expression and
gating by phosphorylation [16,42], we speculate that
phosphorylation of Nav1.1 modulates its trafficking through
the ER. This may have important consequences for the
surface expression of nNaVs during metabolic challenges.
In contrast to our results, Maier et al. [14] did not detect
Nav1.2 in mouse V but found Nav1.1, Nav1.3 and Nav1.6 at
the Z lines. Differences in the species studied or in the
epitope recognized by the antibodies may account for the
discrepancies.
Our experiments revealed that two isoforms of Navh2 (a
and b) with MW of 42 and 34 kDa were present in the V and
PF, respectively. Navh2a co-localized with Nav1.2 at the Z
lines in V but Navh2b co-localized with Nav1.1 at the
intercalated disks in PF. These results suggest tissue-specific
nNav/Navh2 complexes. The nature of the two subunits and
their potential role in the heart remain to be determined.
Our EP results show 10F5% and 22F5% contribution of
nNaVs to I Na in V and PF, respectively, in close agreement
with the mRNA data (sum of NaV1.1 and NaV1.2 mRNA,
Table 2). The residual MTSEA insensitive current was
blocked by nanomolar concentrations of TTX thus confirming the neuronal nature of the underlying canine channels
[34].
A 10–20% contribution of nNaVs, especially NaV1.1 and
NaV1.2, is physiologically significant. Nav1.1 and Nav1.2
display a greater availability than Nav1.5 at positive
potentials making them adequately suited to trigger AP in
126
V. Haufe et al. / Cardiovascular Research 65 (2005) 117–127
the more depolarized neuronal cells. Their abundance in PF
cells with more positive resting membrane potentials
suggests that nNaVs provide a conduction safety margin
for the triggering of AP in PF and HIS bundle. Such safety
margin may become important for survival of cardiac cells
depolarized by ischemia. The appearance of a large TTX
sensitive current in myocytes from post-infarction remodelled myocardium [43] and PF surviving infarction [44]
seems to support this hypothesis. To test this hypothesis, we
looked for differences in steady-state inactivation after
application of MTSEA (not shown). Unfortunately, the
surface charge effects introduced by the positively charged
MTSEA rendered the interpretation of the results difficult.
The use of bulkier polar MTS reagents with side chains long
enough for the sulphydryl group to reach C372 inside the
pore of the channel would be more suitable for these
measurements but are not available at this time.
In our institution, the cardiac left V is shared by several
scientists and used for cell dissociation and tissue studies
thus leaving RV and PF tissues readily available. Our EP
results from myocytes from the left V are in good agreement
with the biochemical and RT-PCR data from RV tissues
suggesting that nNaVs are similarly expressed in both
ventricles.
In conclusion, we demonstrated that Nav1.1, Nav1.2 and
two isoforms of the ancillary subunit Navh2 are present in
the heart. Their cellular location suggests a preferential role
for them in cardiac conduction, possibly as a safety margin.
Their exact physiological function in the heart however
remains to be fully determined.
Acknowledgments
We thank Dr. C. Antzelevitch for giving us access to dog
tissues and cells, Dr. Al George for providing us with the
SCN1A, NaVh1 and Navh2 constructs, Dr. Arthur Iodice,
Ms. J. Hefferon and Mr. Robert Goodrow for the cell
dissociation and Ms. K. Schoknecht for her contribution to
the cloning of the dog Na+ channels. This work was
supported by AHAF grant H2004-011 (JMC), DFG grant
1250/9-2 (KB, TZ), BMBF grant 01ZZ0105/IZKF Jena
(TZ), grant N13 from the IZKF Jena (VH), and NIH grant
HL59449 (RD).
References
[1] Opie LH. Electrophysiology and electrocardiogram. In: Opie LH,
editor. The heart physiology, from cell to circulation. Philadelphia7
Lippincott-Raven; 1998. p. 71 – 115.
[2] Fozzard HA, Hanck DA. Structure and function of voltage-dependent
sodium channels: comparison of brain II and cardiac isoforms. Physiol
Rev 1996;76:887 – 926.
[3] Gellens ME, George Jr AL, Chen L, Chahine M, Horn R, Barchi RL,
et al. Primary structure and functional expression of the human cardiac
tetrodotoxin-insensitive voltage-dependent sodium channel. Proc Natl
Acad Sci U S A 1992;89:554 – 8.
[4] Sato C, Ueno Y, Asai K, Takahashi K, Sato M, Engel A, et al. The
voltage-sensitive sodium channel is a bell-shaped molecule with
several cavities. Nature 2001;409:1047 – 51.
[5] Isom LL. Sodium channel beta subunits: anything but auxiliary.
Neuroscientist 2001;7:42 – 54.
[6] Ritchie JM, Rogart RB. The binding of saxitoxin and tetrodotoxin to
excitable tissue. Rev Physiol, Biochem Pharmacol 1977;79:1 – 50.
[7] Cohen CJ, Bean BP, Colatsky TJ, Tsien RW. Tetrodotoxin block of
sodium channels in rabbit Purkinje fibers. Interactions between toxin
binding and channel gating. J Gen Physiol 1981;78:383 – 411.
[8] Brown AM, Lee KS, Powell T. Sodium current in single rat heart
muscle cells. J Physiol 1981;318:479 – 500.
[9] Coraboeuf E, Deroubaix E, Coulombe A. Effect of tetrodotoxin on
action potentials of the conducting system in the dog heart. Am J
Physiol 1979;236:H561.
[10] Renaud JF, Kazazoglou T, Lombet A, Chicheportiche R, Jaimovich E,
Romey G, et al. The Na+ channel in mammalian cardiac cells. Two
kinds of tetrodotoxin receptors in rat heart membranes. J Biol Chem
1983;258:8799 – 805.
[11] Rogart RB, Cribbs LL, Muglia K, et al. Molecular cloning of a
putative tetrodotoxin-resistant rat heart Na channel isoform. Proc Natl
Acad Sci U S A 1989;86:8170 – 4.
[12] Schaller KL, Krzemien DM, McKenna NM, Caldwell JH. Alternatively spliced sodium channel transcripts in brain and muscle. J
Neurosci 1992;12:1370 – 81.
[13] Malhotra JD, Chen C, Rivolta I, Abriel H, Malhotra R, Mattei LN, et
al. Characterization of sodium channel alpha- and beta-subunits in rat
and mouse cardiac myocytes. Circulation 2001;103:1303 – 10.
[14] Maier SK, Westenbroek RE, Schenkman KA, Feigl EO, Scheuer T,
Catterall WA. An unexpected role for brain-type sodium channels in
coupling of cell surface depolarization to contraction in the heart. Proc
Natl Acad Sci U S A 2002;99:4073 – 8.
[15] Maier SK, Westenbroek RE, Yamanushi TT, Dobrzynski H, Boyett
WA, Catterall WA, et al. An unexpected requirement for brain-type
sodium channels for control of heart rate in the mouse sinoatrial node.
Proc Natl Acad Sci U S A 2003;100:3507 – 12.
[16] Rossie S. Regulation of voltage-sensitive sodium and calcium
channels by phosphorylation. Adv Second Messenger Phosphoprot
Res 1999;33:23 – 48.
[17] Maier SK, Westenbroek RE, McCormick KA, Curtis R, Scheuer T,
Catterall WA. Distinct subcellular localization of different sodium
channel alpha and beta subunits in single ventricular myocytes from
mouse heart. Circulation 2004;109:1421 – 7.
[18] Dumaine R, Hartmann HA. Two conformational states involved in the
use-dependent TTX blockade of human cardiac Na+ channel. Am J
Physiol 1996;270:H2029 – 37.
[19] Ramakers C, Vos MA, Doevendans PA, Schoenmakers M, Wu YS,
Scicchitano S, et al. Coordinated down-regulation of KCNQ1 and
KCNE1 expression contributes to reduction of I(Ks) in canine
hypertrophied hearts. Cardiovasc Res 2003;57:486 – 96.
[20] Zygmunt AC, Goodrow RJ, Weigel CM. I NaCa and I Cl(Ca) contribute
to isoproterenol-induced delayed afterdepolarizations in midmyocardial cells. Am J Physiol 1998;275:H1979 – 92.
[21] Zimmer T, Biskup C, Dugarmaa S, Vogel F, Steinbis M, Bohle T, et al.
Functional expression of GFP-linked human heart sodium channel
(hH1) and subcellular localization of the a subunit in HEK293 cells
and dog cardiac myocytes. J Membr Biol 2002;186:1 – 12.
[22] Cordeiro JM, Spitzer KW, Giles WR. Repolarizing K+ currents in
rabbit heart Purkinje cells. J Physiol 1998;508(Pt.3):811 – 23.
[23] Dumaine R, Towbin JA, Brugada P, Vatta M, Nesterenko VV,
Nesterenko DV, et al. Ionic mechanisms responsible for the electrocardiographic phenotype of the Brugada syndrome are temperature
dependent. Circ Res 1999;85:803 – 9.
[24] Dumaine R, Hartmann HA, Leishman DJ, Brown AM, Galvan M.
Actions of dolasetron and its major metabolite on guinea-pig papillary
muscle fibres and the a-subunit of human heart sodium channels
expressed in xenopus oocytes. Drug Dev Res 1996;37:223 – 30.
V. Haufe et al. / Cardiovascular Research 65 (2005) 117–127
[25] Dumaine R, Wang Q, Keating MT, Hartmann HA, Schwartz PJ,
Brown AM, et al. Multiple mechanisms of Na+ channel-linked longQT syndrome. Circ Res 1996;78:916 – 24.
[26] Schreibmayer W, Lester HA, Dascal N. Voltage clamping of Xenopus
laevis oocytes utilizing agarose-cushion electrodes. Pflugers Arch
1994;426:453 – 8.
[27] Lossin C, Wang DW, Rhodes TH, Vanoye CG, George Jr AL.
Molecular basis of an inherited epilepsy. Neuron 2002;34:877 – 84.
[28] French AS, Sanders EJ, Duszyk E, Prasad S, Torkkeli PH, Haskins J,
et al. Immunocytochemical localization of sodium channels in an
insect central nervous system using a site-directed antibody.
J Neurobiol 1993;24:939 – 48.
[29] Gordon D, Merrick D, Wollner DA, Catterall WA. Biochemical
properties of sodium channels in a wide range of excitable tissues
studied with site-directed antibodies. Biochemistry 1988;27:7032 – 8.
[30] Isom LL, De Jongh KS, Patton DE, Reber BFX, Offord J,
Charbonneau H, et al. Primary structure and functional expression
of the h1 subunit of the rat brain sodium channel. Science 1992;
256:839 – 42.
[31] Catterall WA. Cellular and molecular biology of voltage-gated sodium
channels. Physiol Rev 1992;72:S15–48.
[32] Kupershmidt S, Yang T, Roden DM. Modulation of cardiac Na+
current phenotype by beta1-subunit expression. Circ Res
1998;83:441 – 7.
[33] Heinemann SH, Terlau H, Imoto K. Molecular basis for pharmacological differences between brain and cardiac sodium channels.
Pflugers Arch 1992;422:90 – 2.
[34] Green WN, Weiss LB, Andersen OS. Batrachotoxin-modified
sodium channels in planar lipid bilayers. Characterization of
saxitoxin- and tetrodotoxin-induced channel closures. J Gen Physiol
1987;89:873 – 903.
[35] Ahmad S, Allescher HD, Manaka H, Manaka Y, Daniel EE.
[3H]saxitoxin as a marker for canine deep muscular plexus neurons.
Am J Physiol 1988;255:G462–9.
127
[36] Chen J, Ikeda SR, Lang W, Isales CM, Wei X. Molecular cloning of a
putative tetrodotoxin-resistant sodium channel from dog nodose
ganglion neurons. Gene 1997;202:7 – 14.
[37] Kucera JP, Rohr S, Rudy Y. Localization of sodium channels in
intercalated disks modulates cardiac conduction. Circ Res
2002;91:1176 – 82.
[38] Cornet V, Bichet D, Sandoz G, Marty I, Brocard J, Bourinet E, et al.
Multiple determinants in voltage-dependent P/Q calcium channels
control their retention in the endoplasmic reticulum. Eur J Neurosci
2002;16:883 – 95.
[39] Kupershmidt S, Yang T, Chanthaphaychith S, Wang Z, Towbin JA,
Roden DM. Defective human Ether-a-go-go-related gene trafficking
linked to an endoplasmic reticulum retention signal in the C terminus.
J Biol Chem 2002;277:27442 – 8.
[40] Scott DB, Blanpied TA, Swanson GT, Zhang C, Ehlers MD. An
NMDA receptor ER retention signal regulated by phosphorylation and
alternative splicing. J Neurosci 2001;21:3063 – 72.
[41] Zhou J, Shin HG, Yi J, Shen W, Williams CP, Murray KT.
Phosphorylation and putative ER retention signals are required for
protein kinase A-mediated potentiation of cardiac sodium current.
Circ Res 2002;91:540 – 6.
[42] Catterall WA. Modulation of sodium and calcium channels by protein
phosphorylation and G proteins. Adv Second Messenger Phosphoprot
Res 1997;31:159 – 81.
[43] Huang B, El Sherif T, Gidh-Jain M, Qin D, El-Sherif N.
Alterations of sodium channel kinetics and gene expression in the
postinfarction remodeled myocardium. J Cardiovasc Electrophysiol
2001;12:218 – 25.
[44] Bril A, Kinnaird AA, Man RY. Comparison of the sodium currents in
normal Purkinje fibres and Purkinje fibres surviving infarction–a
pharmacological study. Br J Pharmacol 1989;97:999 – 1006.