Download Quarter 1 Midterm Study Guide:

NAME:_____________________________
PERIOD:_____________
Quarter 1 Midterm Study Guide: Answer the following questions..
1. What are the 4 nitrogen bases? (spell them out) adenine, thymine, guanine, cytosine
2. What does it mean to classify something? To group things together that are alike in some ways
3. What are the 5 skills scientists use? Observing, Inferring, Predicting, Classifying, and Making Models
4. List 3 types of specialized cells. Muscle, nerve, and red blood cell
5. Where would you find a nuclear envelope? Surrounding the nucleus.
6. What is the double helix? A DNA molecule
7. What are chloroplasts? Cell organelles that take in sunlight and convert
it to energy the cell can use.
8. What are chromosomes? Tightly wound DNA
9. What does DNA stand for? Deoxyribonucleic Acid
10. Define and draw a quick sketch of DNA replication. see diagram 
11. What are the 3 stages of the cell cycle? Interphase, Mitosis, and
Cytokinesis
12. What are the 4 stages of mitosis? Draw what DNA looks like in each of
the stages.
see diagram 
13. What cell cycle phase does DNA replication occur in? Interphase
14. Draw and label a chromosome. Include a centromere and chromatids.
NAME:_____________________________
PERIOD:_____________
15. Describe how the nitrogen bases pair in a DNA molecule. Adenine pairs with Thymine and Guanine
pairs with Cytosine
16. If given a strand of DNA, write the complementary strand:
CCGATGCCATTGCTAACTCTAGGGCTAATC
GGCTACGGTAAGCATTGAGATCCCGATTAG
________________________________________
17. Where is genetic material stored? In the nucleus
18. Where are proteins made? In the ribosomes
19. What does endoplasmic reticulum do? It transports materials around the cell (like a highway)
20. What kind of scientist studies animals and plants? Biologists
21. What kind of cell has a cell wall? Plant cell
22. Define science. Science is a way of learning about the natural world; it includes all of the knowledge
gained by exploring the natural world.
23. What is the nucleolus? Where would you find one? The nucleolus produces ribosomes, it is inside the
nucleus.
24. What is the purpose of cytoplasm? It constantly moves and supports organelles.
25. What do Golgi bodies do? They receive materials from the Endoplasmic Reticulum and sent them to
other parts of the cell. (like a mail room)
26. Define organelle. Tiny cell structures that carry out specific functions.
27. Define specialized cells. Cells that perform a specific functions.
28. What does mitochondria do? Produces most of the cell’s energy.
29. Define inferring. An interpretation based on observations and prior knowledge.
30. What do lysosomes do? They break down large food particles and worn-out cell parts.
31. What does a vacuole do? It stores food, water, waste, and other materials.
32. Write out the steps to the scientific method. Posing Questions, Developing a Hypothesis, Designing an
experiment, collecting and interpreting data, drawing conclusions, and communicating.
NAME:_____________________________
PERIOD:_____________
33. What are chromosomes? Condensed chromatin, it appears as a double rod structure
34. Define qualitative observations. Observations dealing with descriptions.
35. Define quantitative observations. Observations dealing with numbers.
36. What is the difference between prediction and inferring? A prediction is making a forecast of what will
happen in the future, while an inference is a possible explanation of observations.
37. Draw and label the “Metric Staircase” and fill in the table:
Measurement:
19.6 m
975.6 kg
1001 dL
5.23 hm
90.7 cm
Conversion:
__1960_cm
__97560_dag __0.1001_kL __523,000_mm _0.00907_hm