Download View PDF

Tamoxifen-resistant breast cancer cells possess cancer stem-like cell properties
Liu Hui1, Zhang Heng-wei2, Sun Xian-fu2, Guo Xu-hui2, He Ya-ning2, Cui Shu-de2, Fan Qing-xia1
1
Department of oncology, First Affiliated Hospital, Zhengzhou University, 1 Jianshe East Road, Zhengzhou 450052, China.
2
Department of Breast, He’ nan Tumor Hospital, 127 Dongming Road, Zhengzhou 450008, China
Corresponding author: Fan Qingxia, E-mail: [email protected], Tel: 86371-66862243, Fax: 86371-65615797
Word count: 3624
Number of figures: 3
Number of tables: 1
Running title: CSCs in tamoxifen resistance
1
Key Words: Breast cancer; tamoxifen resistance; cancer stem cells; epithelial-mesenchymal transition
Background
Cancer stem cells (CSCs) are the cause of cancer recurrence because they are resistant to conventional therapy
and contribute to cancer growth and metastasis. Endocrinotherapy is the most common breast cancer therapy and acquired
tamoxifen (TAM) resistance is the main reason for endocrinotherapy failure during such therapy. Although acquired resistance
to endocrine treatment has been extensively studied, the underlying mechanisms are unclear. We hypothesized that breast
CSCs played an important role in TAM-induced resistance during breast cancer therapy. Therefore, we investigated the
biological characteristics of TAM-resistant (TAM-R) breast cancer cells.
Methods
Mammosphere formation and tumorigenicity of wild-type (WT) and TAM-R MCF7 cells were tested by a
mammosphere assay and mouse tumor xenografts, respectively. Stem cell markers (SOX-2, OCT-4 and CD133) and
epithelial-mesenchymal transition (EMT) markers were tested by quantitative real-time (qRT)-PCR. Morphological
observation was performed to characterize EMT.
Results
After induction of TAM resistance, TAM-R MCF7 cells exhibited increased proliferation in the presence of TAM
compared with that of WT MCF7 cells (P<0.05), indicating enhanced TAM resistance of TAM-R MCF7 cells compared with
that of WT MCF7 cells. TAM-R MCF7 cells showed enhanced mammosphere formation and tumorigenicity in nude mice
compared with that of WT MCF7 cells (P<0.01), demonstrating the elevated CSC properties of TAM-R MCF7 cells.
Consistently, qRT-PCR revealed that TAM-R MCF7 cells expressed increased mRNA levels of stem cell markers including
SOX-2, OCT-4 and CD133, compared with those of WT MCF7 cells (P<0.05). Morphologically, TAM-R MCF7 cells showed
a fibroblastic phenotype, but WT MCF7 cells were epithelial-like. After induction of TAM resistance, qRT-PCR indicated that
MCF7 cells expressed increased mRNA levels of Snail, vimentin and N-cadherin, and decreased levels of E-cadherin, which
are considered as EMT characteristics (P<0.05).
Conclusions
TAM-R MCF7 cells possess CSC characteristics, and may be responsible for TAM resistance during breast
cancer therapy.
2
It is well known that estrogen plays a major role in the development and progression of breast cancers because of the
stimulating effect of estrogen on the growth of breast tissues via the estrogen receptor (ER). ER expression is observed in most
breast cancer tissues. Therefore, blocking the ER pathway by endocrine therapy is a safe and effective therapeutic option for all
stages of breast cancer. Although bilateral ovariectomy described in 1896 was the first method for endocrine therapy of breast
cancer,1 the ER antagonist tamoxifen (TAM) has been the most widely used drug for endocrine therapy of breast cancer.2
However, endocrine resistance in patients with breast cancer is a serious therapeutic problem. One-third of breast cancer
patients fail to respond to endocrine therapy and most patients with endocrine-responsive breast cancer will eventually develop
resistance to anti-hormone treatment and undergo tumor progression.3,4 Although the acquired resistance to endocrine therapy
has been extensively studied, the underlying mechanisms are not yet clear. There are several potential mechanisms for
endocrine resistance including altered ER expression, increased growth factor signaling, altered expression of co-regulators,
estrogen hypersensitivity, and altered metabolism caused by endocrine therapy.5-8 In addition, there is increasing evidence that
cancer stem cells (CSCs) might play a major role in endocrine resistance.
CSCs are defined as a subpopulation of cancer cells that have the ability to self-renew and produce daughter cells that lead to
the generation of bulk tumor cells.9,10 Breast CSCs (BCSCs) have a high resistance to chemotherapy and radiotherapy, and
contribute to breast cancer growth and metastasis.11-13 Unfortunately, the involvement of BCSCs in endocrine resistance is not
supported by substantial evidence. Although the role of BCSCs in endocrine resistance is less studied, the effect of BCSCs on
acquired TAM insensitivity of breast cancer cells can be explained by acquired resistance of BCSCs to chemotherapy and
radiotherapy.11-13 To determine whether BCSCs are involved in acquired TAM resistance of breast cancer after TAM treatment,
our study established a TAM-resistant (TAM-R) cell line using wild-type (WT) MCF7 cells and investigated whether TAM-R
MCF7 cells developed CSC properties.
MATERIAL AND METHODS
Materials
3
The breast cancer cell line MCF7 was purchased from the American Type Culture Collection (Manassas, VA, USA). RPMI
medium, fetal calf serum, penicillin-streptomycin (10 IU/ml-10 μg/ml) and fungizone were obtained from Life Technologies
Europe Ltd. (Paisley, UK). 4-hydroxytamoxifen (4-OH-TAM), epidermal growth factor (EGF), and insulin were obtained from
Sigma-Aldrich (St. Louis, MO, USA). Trypsin (0.25%) was purchased from GIBCO-BRL (Grand Island, NY, USA). Culture
plasticware were purchased from Nunc (Roskilde, Denmark). Glutamine and B27 supplement was purchased from Invitrogen
Life Technologies (Carlsbad, CA, USA). Ultra-low attachment plates were purchased from Corning Life Sciences (Amsterdam,
the Netherlands). Matrigel was purchased from BD Biosciences (Mississauga, ON, Canada)
Cell culture
WT MCF7 cells were cultured in phenol red-free RPMI medium containing 5% fetal calf serum, penicillin-streptomycin (10
IU/ml-10 μg/ml) and fungizone (2.5 μg/ml). Cells were cultured at 37°C in a humidified atmosphere with 5% CO2. At 80%
confluence, the cells were passaged by trypsinization.
Establishment of the TAM-R MCF7 cell line
TAM-R MCF7 cells were established using WT MCF7 cells as described previously.14,15 After washing thoroughly with PBS,
MCF7 cells were transferred to phenol red-free RPMI medium supplemented with 5% charcoal-stripped steroid-depleted fetal
calf serum, penicillin-streptomycin (10 IU/ml-10 μg/ml), fungizone(2μg/ml), glutamine (200 mM) and 4-OH-TAM (0.1 μM).
Cells were continuously exposed to this treatment regimen for 6 months. The medium was replaced every 3–4 days. At 80%
confluence, the cells were passaged by trypsinization. MCF7 cell growth rates decreased initially, and then increased after 2
months of culture, demonstrating MCF7 cell resistance to 4-OH-TAM. This cell line was cultured for a further 4 months in
4-OH-TAM-containing medium, and was then regarded as TAM resistant.
Cell counting
WT and TAM-R MCF7 cells were seeded at 1.5 × 104 cells per well in six-well plates. After 1, 3, 5, 7, 9 and 11 days, the cells
were harvested, re-suspended in 1 ml RPMI medium, and then counted. The growth rates were calculated as the ratio of
4-OH-TAM-treated and 4-OH-TAM-untreated cell numbers at 7 days.
4
Quantitative real-time polymerase chain reaction (qRT-PCR)
Total RNA was extracted from WT and TAM-R MCF7 cells using an RNeasy Kit (Qiagen, Crawley, UK). qRT-PCR was
performed using an ABI 7700 sequence detection system (Applied Biosystems, Foster City, CA, USA). The primer sequences
are list in Table 1. The expression of SOX-2, CD133, OCT-4, E-cadherin, N-cadherin, vimentin and Snail transcripts were
normalized to the mRNA expression of GAPDH, which was calculated using the ΔΔCt method.
Mammosphere assay
Cells were seeded in ultra-low attachment plates at a density of 10,000 cells/ml in serum-free medium containing 1× B27
supplement, 20 ng/ml EGF, 5 µg/ml insulin, 5 µg/ml β-mercaptoethanol and 1 µg/ml hydrocortisone. After 14 days,
mammospheres containing more than 50 cells were counted.
Mouse tumor xenografts
After harvesting by trypsinization, 5 × 105 WT or TAM-R MCF7 cells were re-suspended in 250 μl RPMI medium containing
Matrigel. The cell suspensions were injected into nude mice subcutaneously. After 60 days, tumors were harvested and
weighed. All animal experiments were conducted according to the guidelines for the care and use of laboratory animals.
Statistics
The unpaired Student’s t-test was used for inter-group comparisons. A P value of less than 0.05 was considered as statistically
significant.
RESULTS
Resistance of TAM-R MCF7 cells to 4-OH-TAM
To test whether the TAM-R MCF7 cell line was established successfully, we investigated the proliferation of TAM-R MCF7
cells. In the presence of 4-OH-TAM (0.1 μM), the growth rates of TAM-R MCF7 cells were higher than those of WT MCF7
cells at 5, 7, 9 and 11 days (Fig 1A, P<0.05, n=5), although there were no significance difference in the growth rates between
TAM-R and WT MCF7 cells at 1 and 3 days. The growth curve also showed that TAM-R MCF7 cells treated with 4-OH-TAM
had a growth rate similar to that of WT MCF7 in the absence of 4-OH-TAM. Furthermore, TAM-R MCF7 cells treated with
5
4-OH-TAM (0.0001–1 μM) showed no reduction in proliferation compared with that of WT MCF7 cells in the absence of
4-OH-TAM (shown as the % of untreated controls). However, WT MCF7 cell proliferation decreased in a
concentration-dependent manner in the presence of 4-OH-TAM (0.0001–1 μM) and significant differences between TAM-R
and WT MCF7 cell proliferation were observed in the presence of 0.01, 0.1 and 1 μM 4-OH-TAM (Fig 1B, P<0.001, n=5).
Properties of BCSCs derived from MCF7 cells
Because BCSCs are characterized by mammosphere formation, the mammosphere assay is widely used for characterization of
BCSCs. As shown in Figure 2A and B, TAM-R MCF7 cells generated more mammospheres than WT MCF7 cells (Fig 2A and
B, n=3, P<0.01). qRT-PCR revealed that the mean mRNA expression levels of stem cell markers16-18 SOX-2, OCT-4 and
CD133 in TAM-R MCF7 cells were significantly higher than those in WT MCF7 cells (Fig 2C, n=3, P<0.05). The degree of
tumorigenicity of WT and TAM-R MCF7 cells was assessed by injection of these cells into nude mice. After 60 days, the size
and weight of TAM-R MCF7 cell-derived tumors in nude mice were almost 5-fold greater than those of WT MCF7
cell-derived tumors (Fig 2D, E and F, n=3, P<0.01).
EMT induction in TAM-R MCF7 cells
Because EMT is regarded as an important characteristic of CSCs,
19-21
EMT phenotypes were observed by investigating
morphological alterations and testing EMT marker expression of MCF7 cells. WT MCF7 cells had highly organized adhesion
between cells, whereas TAM-R MCF7 cells developed a refractive and elongated appearance (Fig 3A). Moreover, scattered
TAM-R MCF7 cells indicated the loss of cell-cell adhesion (Fig 3A), which is regarded as a characteristic of EMT.22
Furthermore, cobblestone-like morphology was observed in WT MCF7 cell cultures, whereas TAM-R MCF7 cells showed a
spindle-like fibroblastic morphology (Fig 3A). After induction of TAM resistance, qRT-PCR showed that TAM-R MCF7 cells
expressed higher mRNA levels of Snail, N-cadherin and vimentin, three kinds of mesenchymal proteins, but expressed lower
levels of E-cadherin compared with that in WT MCF7 cells (Fig 3B, n=3, P<0.05).
DISCUSSION
TAM, a non-steroidal anti-estrogen, is regarded as the first-line anti-estrogen agent for the treatment of ER-positive breast
cancer, from which around 50% of patients benefit. However, almost all tumors responsive to TAM ultimately become
6
resistant to TAM treatment.23,24 We hypothesized that BCSCs were involved in the acquired resistance of breast cancer to TAM
because BCSCs possess higher resistance to chemotherapy and radiation therapy than that of other cancer cells in breast cancer
tissue.11-13 Compared with other cancer cells, the increased tumorigenicity and invasiveness of BCSCs in breast tumors
provides support for our hypothesis.25 To test our hypothesis, we first established a TAM-R MCF7 cell line and its resistance to
TAM was investigated by evaluating the growth curve. Our results demonstrated that, in the presence of 4-OH-TAM, TAM-R
MCF7 cells exhibited a higher growth rate compared with that of WT MCF7 cells, which was similar to TAM-R and WT
MCF7 cells in the absence of 4-OH-TAM. Thus, the results indicated that we successfully established a TAM-R MCF7 cell
line, a breast cancer cell line resistant to TAM.
CSCs have the ability to self-renew symmetrically or differentiate asymmetrically. Tumors are organized hierarchically, and
CSCs are the only cells that play a central role in tumor growth and progression by unlimited proliferation. Until the 1990s, the
remaining tumor cells after anti-cancer therapy were regarded as a result of selection through a random mechanism. However,
the idea that remaining tumor cells after anti-cancer therapy had a distinct phenotype described by therapeutic resistance was
widely accepted with the progression of CSC research.25,26 There are several different approaches for identification of CSCs in
tumors, including the mammosphere assay. CSCs possess the unique ability to survive and grow in serum-free suspension.
Based on this property, dispersed BCSCs can be induced into mammospheres under certain conditions. A mammosphere is a
spherical cell cluster without cell-cell adhesion, which is regarded as a characteristic of BCSCs and is widely used for their
identification.27-29 In the present study, TAM-R MCF7 cells produced a significantly higher number of mammospheres than
that of WT MCF7 cells, demonstrating the enhanced CSC phenotype after induction of TAM resistance.
In our study, qRT-PCR showed that the expression of stem cell markers in TAM-R MCF7 cells was significantly higher
compared with that in WT MCF7 cells, demonstrating the CSC phenotype after induction of TAM resistance. Additionally,
BCSCs are characterized by their ability to differentiate into all cells of the tumor, which is called tumorigenicity. The
generation of tumors in immunodeficient mice is considered as a gold standard for testing the tumorigenicity of CSCs. Our
results showed that TAM resistance enhanced the tumorigenicity of breast cancer cells by TAM-R MCF7 cells producing
larger and heavier tumors in nude mice compared with that of their non-resistant counterpart.
7
Because EMT is regarded as an important characteristic of CSCs,19-21 we investigated the EMT phenotype of MCF7 cells.
During the acquisition of EMT, morphological and molecular alterations representing mesenchymal differentiation are
observed in tumor cells. Morphological changes are defined as the transition of cobblestone morphology to an elongated,
spindle-shaped morphology, which improves the invasion of tumor cells by limiting their contact with neighboring cells.30,31
Our results indicated that TAM-R MCF7 cells developed an elongated appearance and loss of cell-cell contacts. Molecular
changes include the loss of E-cadherin expression, which is a specialized epithelial cell adhesion molecule, and the acquisition
of mesenchymal marker expression including Snail, vimentin and N-cadherin. Because of the loss of E-cadherin, tumor cells
become more mobile and subsequently dislodge from their original location.32 Compared with WT MCF7 cells, the greatly
reduced E-cadherin expression and elevated expression of Snail, vimentin and N-cadherin in TAM-R MCF7 cells confirmed
their EMT phenotype, a characteristic of CSCs during induction of TAM resistance.
Although our study indicated that TAM-treated MCF7 cells developed the properties of CSCs, we failed to demonstrate that
TAM resistance was due to the generation of CSCs. Therefore, further study should be performed to resolve this issue.
REFERENCES
1.
Beatson GT. On the treatment of inoperable cases of carcinogen of the mamma: suggestions for a new method of
treatment with illustrative cases. Lancet 1896; 2: 104–107, 162–167.
2.
Massarweh S, Schiff R. Resistance to endocrine therapy in breast cancer: exploiting estrogen receptor/growth factor
signaling crosstalk. Endocr Relat Cancer 2006; 13: S15-24.
3.
Kurebayashi J. Endocrine-resistant breast cancer: underlying mechanisms and strategies for overcoming resistance. Breast
Cancer 2003; 10: 112-119.
4.
Schiff R, Massarweh S, Shou J, Osborne CK. Breast cancer endocrine resistance: how growth factor signaling and
estrogen receptor coregulators modulate response. Clin Cancer Res 2003; 9: 447S-454S.
5.
Zilli M, Grassadonia A, Tinari N, Di Giacobbe A, Gildetti S, Giampietro J, et al. Molecular mechanisms of endocrine
resistance and their implication in the therapy of breast cancer. Biochim Biophys Acta 2009; 1795: 62-81.
8
6.
Johnston SR. Acquired tamoxifen resistance in human breast cancer-potential mechanisms and clinical implications.
Anticancer Drugs 1997; 8: 911-930.
7.
Normanno N, Di Maio M, De Maio E, De Luca A, de Matteis A, Giordano A, et al. Mechanisms of endocrine resistance
and novel therapeutic strategies in breast cancer. Endocr Relat Cancer 2005; 12: 721-747.
8.
Lewis JS, Jordan VC. Selective estrogen receptor modulators (SERMs): mechanisms of anticarcinogenesis and drug
resistance. Mutat Res 2005; 591: 247-263.
9.
O'Brien CA, Kreso A, Jamieson CH. Cancer stem cells and self-renewal. Clin Cancer Res 2010; 16: 3113-3120.
10. Lin ZX. Patterns in the occurrence and development of tumors. Chin Med J (Engl) 2011; 124: 1097-104.
11. Li X, Lewis MT, Huang J, Gutierrez C, Osborne CK, Wu MF, et al. Intrinsic resistance of tumorigenic breast cancer cells
to chemotherapy. J Natl Cancer Inst 2008; 100: 672–679.
12. Liu H, Patel MR, Prescher JA, Patsialou A, Qian D, Lin J, et al. Cancer stem cells from human breast tumors are involved
in spontaneous metastases in orthotopic mouse models. Proc Natl Acad Sci U S A 2010; 107: 18115–18120.
13. Wicha MS, Liu S, Dontu G. Cancer stem cells: an old idea–-a paradigm shift. Cancer Res 2006; 66: 1883–1890.
14. Knowlden JM, Hutcheson IR, Jones HE, Madden T, Gee JM, Harper ME, et al. Elevated Levels of Epidermal Growth
Factor Receptor/c-erbB2 Heterodimers Mediate an Autocrine Growth
Regulatory Pathway in Tamoxifen-Resistant
MCF7 Cells. Endocrinology 2003; 144: 1032.
15. Hiscox S, Morgan L, Barrow D, Dutkowskil C, Wakeling A, Nicholson RI. Tamoxifen resistance in breast cancer
cells is accompanied by an enhanced motile and invasive phenotype: inhibition by gefitinib (‘Iressa’, ZD1839). Clin
Exp Metastasis 2004; 21: 201–212.
16. Yang JP, Liu Y, Zhong W, Yu D, Wen LJ, Jin CS. Chemoresistance of CD133+ cancer stem cells in laryngeal carcinoma.
Chin Med J (Engl). 2011; 124: 1055-1060.
17. Kim K, Ihm H, Ro JY, Cho YM. High-level expression of stem cell marker CD133 in clear cell renal cell carcinoma with
favorable prognosis. Oncol Lett 2011; 2: 1095-1100.
9
18. Kemmerling R, Alinger B, Dietze O, Bösmüller HC, Ocker M, Wolkersdörfer GW, et al. Association of stem cell marker
expression pattern and survival in human biliary tract cancer. Int J Oncol 2012; 41: 511-522.
19. Zhou C, Liu J, Tang Y, Liang X. Inflammation linking EMT and cancer stem cells. Oral Oncol 2012; 48: 1068-1075.
20. Cioce M, Ciliberto G. On the connections between cancer stem cells and EMT. Cell Cycle 2012; 11: 4301.
21. Biddle A, Mackenzie IC. Cancer stem cells and EMT in carcinoma. Cancer Metastasis Rev 2012; 31: 285-293.
22. Kim MR, Choi HK, Cho KB, Kim HS, Kang KW. Invovement of Pin1 induction in epithelial-mesenchymal transition of
tamoxifen-resistant breast cancer cells. Cancer Sci 2009; 100: 1834-1841.
23. Prud'homme GJ, Glinka Y, Toulina A, Ace O, Subramaniam V, Jothy S. Breast cancer stem-like cells are inhibited by a
non-toxic aryl hydrocarbon receptor agonist. PLoS One 2010; 5: e13831.
24. Osborne CK, Fuqua SA. Mechanisms of tamoxifen resistance. Breast Cancer Res Treat 1994; 32: 49–55.
25. Lawson JC, Blatch GL, Edkins AL. Cancer stem cells in breast cancer and metastasis. Breast Cancer Res Treat 2009; 118:
241-254.
26. Benson JR, Jatoi I, Keisch M, Esteva FJ, Makris A, Jordan VC. Early breast cancer. Lancet 2009; 373: 1463-1479.
27. Kai K, Arima Y, Kamiya T, Saya H. Breast cancer stem cells. Breast Cancer 2010; 17: 80-85.
28. Dontu G, Abdallah WM, Foley JM, Jackson KW, Clarke MF, Kawamura MJ, et al. In vitro propagation and transcriptional
profiling of human mammary stem/progenitor cells. Genes Dev 2003; 17: 1253-1270.
29. Morel AP, Lièvre M, Thomas C, Hinkal G, Ansieau S, Puisieux A. Generation of breast cancer stem cells through
epithelial-mesenchymal transition. PLoS One 2008; 3: e2888.
30. Christiansen JJ, Rajasekaran AK. Reassessing epithelial to mesenchymal transition as a prerequisite for carcinoma
invasion and metastasis. Cancer Res 2006; 66: 8319–8326.
31. Xu XF, Dai HP. Type 2 epithelial mesenchymal transition in vivo: truth or pitfalls? Chin Med J (Engl) 2012; 125:
3312-3317.
32. Han L, Zhang HW, Zhou WP, Chen GM, Guo KJ. The effects of genistein on transforming growth factor-β1-induced
invasion and metastasis in human pancreatic cancer cell line Panc-1 in vitro. Chin Med J (Engl) 2012; 125:2032-2040.
10
Table 1. PCR primer sequences
Gene
primer sequences (5’-3’) forward and reverse
SOX-2
F: CGAGTGGAAACTTTTGTCGGA,
R: TGTGCAGCGCTCGCAG
Oct-4
F: ACCCACACTGCAGCAGATCAG,
R: CGTTGTGCATAGTCGCTGCTT
CD133
F: GCACTCTATACCAAAGCGTCA,
R: CCATACTTCTTAGTTTCCTCA
E-cadherin
F: GGATTGCAAATTCCTGCCATTC
R: AACGTTGTCCCGGGTGTCA
snail
F: AATGCTCATCTGGGACTCTGTC
R: TCTTGACATCTGAGTGGGTCTG
Vimentin
F: AAAGTGTGGCTGCCAAGAAC
R: CTGCACCTGTCTCCGGTACT
N-cadherin
F: CCACAGTACCCAGTCCGATCC
R: ACTAAGAGGGAGTCATACGGTGG
GAPDH
F: TCCTGCACCACCAACTGCTTAG,
R: AGTGGCAGTGATGGCATGGACT
Figure legends
11
Figure 1. Resistance of the TAM-R MCF7 cell line to 4-OH-TAM. A: Growth curve of TAM-R and WT MCF7 cells in the
presence or absence of 4-OH-TAM (0.1 μM). B: Proliferation responses of WT and TAM-R MCF7 cells to increasing
concentrations of 4-OH-TAM from 0.0001 to 1 μM at 7 days. Data are expressed as the mean±SD of triplicate wells from five
separate experiments. *: Statistical comparison between WT and TAM-R MCF7 cells. **: P<0.01, ***: P<0.001.
12
Figure 2. BCSC properties of WT and TAM-R MCF7 cells. A and B: Mammosphere formation of WT and TAM-R MCF7
cells. After acquisition of TAM resistance, the capacity for mammosphere formation of TMA-R MCF7 cells increased
significantly compared with that of WT MCF7 cells. Data were collected from triplicate wells of three separate experiments. C:
Expression of stem cell markers. After acquisition of TAM resistance, the mRNA expression of SOX-2, OCT-4 and CD133
increased significantly in TMA-R MCF7 cells compared with that in WT MCF7 cells. D, E and F: Assessment of the
13
tumorigenicity of WT and TAM-R MCF7 cells. TAM-R MCF7 cells formed larger tumors than those of WT MCF7 cells in
nude mice. Data are expressed as the mean±SD. *: P<0.05, **: P<0.01, compared with WT MCF7 cells.
Figure 3. Induction of EMT in TAM-R MCF7 cells. A: Cell morphology of WT and TAM-R MCF7 cells. B: mRNA
expression of E-cadherin, Snail, vimentin and N-cadherin in WT and TAM-R MCF7 cells as determined by qRT-PCR. Data
are expressed as the mean±SD. *: P<0.05, compared with WT MCF7 cells.
14