Download A Sensitive Nested-Polymerase Chain Reaction Protocol to Detect

Acta Scientiae Veterinariae, 2012. 40(3): 1055.
ORIGINAL ARTICLE
ISSN 1679-9216 (Online)
Pub. 1055
A Sensitive Nested-Polymerase Chain Reaction Protocol to Detect Infectious
Laryngotracheitis Virus
Nilzane Beltrão1, Raul Flores Egochega1, Thales Quedi Furian1, Carla Rosane Rodenbusch1,
Luiz Cesar Bello Fallavena2, Giancarlo Pasquali3 & Cláudio Wageck Canal1
ABSTRACT
Background: Infectious laryngotracheitis virus (ILTV) is a member of the family Herpesviridae that has a worldwide distribution, although it is well controlled in areas of intensive production in which periodic outbreaks of the disease occur. ILTV is
an important respiratory pathogen of chickens that may cause severe or mild disease in layers and broilers. Severe disease is
characterized by respiratory depression, gasping, expectoration of bloody exudate and high mortality. Mild diseased chickens
exhibit milder clinical signs and low mortality, and laboratory techniques are mandatory for a final diagnosis. Several techniques have been described for the detection of ILTV, however they have disadvantages that constrains their use in routine
diagnosis. Viral multiplication is limited to respiratory tissue, which makes the trachea the ideal site to look for the virus. The
purpose of the present study was to develop a sensitive and specific nested Polymerase Chain Reaction (PCR) protocol to
detect ILTV DNA directly from tracheal swabs of naturally or experimentally infected chickens.
Materials, Methods & Results: The nested-PCR was carried out with two sets of primers selected from a portion of the
ILTV thymidine kinase gene. PCR sensitivity was determined by using five-fold serial dilutions of a commercial laryngotracheitis vaccine. PCR was specific as determined by testing related respiratory viruses (pathogens of chickens), ILTV
strain, and field isolates. Nested-PCR was 250 times more sensitive than virus isolation (VI). To further validate the ability
of this assay to detect ILTV from tracheal swabs, experimentally infected chickens and ILTV suspect cases were examined
by VI, PCR, and histopathology. VI and nested-PCR both detected virus in tracheas during all the experimental period.
With one exception, all positive samples by VI were also positive by the nested-PCR. However, nested-PCR detected 5
additional positive samples in the end of the experimental period. Through direct histopathology, typical syncytia and
inclusion bodies were found in only two samples. In the clinical cases of respiratory illness, VI detected ILTV positive
samples in 4 out of the 8 flocks with respiratory illness and histopathological analyses detected 3 flocks but the nested-PCR
detected 5 positive flocks including those positive by VI and histopathology.
Discussion: In the experimental infection, VI and PCR both detected ILTV in the majority of the samples but PCR detected
some additional positive samples close to the end of the experimental period. By comparison of the PCR with VI sensitivity,
it can be concluded that the protocol here described has a greater advantage over the previously described protocols that
afford a direct comparison. Histopathology was the least sensitive test, since viral inclusion bodies and syncytial cells were
only observed in two tracheal sections and a possible explanation for this result may be that necrosis and desquamation
destroy infected epithelium. In the detection of the virus from clinical cases, the nested-PCR also detected a greater number
of positive samples than VI and histopathology. Comparison of the nested-PCR with VI in experimentally infected broilers
indicates that the two diagnostic tests are very efficient to detect ILTV in the early time of infection. However, VI tests in
late infection may be not as sensitive as the nested-PCR if majority of the ILTV have been inactivated or become latent.
Two distinctive sequences were obtained from the positive controls and field isolates. The sequences were specific to ILTV
since they had a minimum of 99.5% similarity with previously described strains. The assay described in the present study
indicates that the nested-PCR protocol is more sensitive than previously described tests and can replace histopathology
and virus isolation with advantage.
Keywords: infectious laryngotracheitis virus (ILTV), avian pathology, PCR, diagnosis, detection.
Received: December 2011
www.ufrgs.br/actavet
1
Accepted: February 2012
Laboratório de Virologia, Faculdade de Veterinária (FaVet), Universidade Federal do Rio Grande do Sul (UFRGS), Porto Alegre, RS, Brazil. 2Universidade Luterana do Brasil (ULBRA), Canoas, RS, Brazil. 3Departamento de Biotecnologia, Universidade Federal do Rio Grande do Sul, Porto Alegre,
RS, Brazil. CORRESPONDENCE: C.W. Canal [[email protected] - Fax: +55 (51) 3308-7305]. Laboratório de Virologia - FaVet, Universidade
Federal do Rio Grande do Sul (UFRGS). Av. Bento Gonçalves n. 9090, Bairro Agronomia. CEP 91540-000 Porto Alegre, RS, Brazil.
1
N. Beltrão, R.F. Egochega, T.Q. Furian, et al. 2012. A Sensitive Nested-Polymerase Chain Reaction Protocol to Detect
Infectious Laryngotracheitis Virus.
Acta Scientiae Veterinariae. 40(3): 1055.
INTRODUCTION
pathogen free (SPF) embryos and identified by the
formation of opaque plaques in the chorioallantoic
membrane (CAM) in which intranuclear inclusion
bodies were present. The virus was grown in 9 dayold embryonated eggs. After 7 days of incubation, the
CAMs were harvested, ground with mortar and pestle
and ressuspended in a solution of phosphate-buffered
saline (PBS) with gentamicin and fungizone. The viral
suspension was cleared by centrifugation, titrated, and
stored as aliquots at -80oC. The tracheas from the originally infected layers and the viral suspension used as
inocula in the experimental infection were also tested
and resulted negative for the presence of other respiratory pathogens, such as infectious bronchitis virus,
Newcastle disease virus, influenza A virus, avian reovirus, Ornithobacterium rhinotracheale, Pasteurella
multocida and Haemophilus sp.
Infectious laryngotracheitis virus (ILTV) is a
member of the family Herpesviridae [25] that has a
worldwide distribution, although it is well controlled
in areas of intensive production in which periodic outbreaks of the disease occur [10,14]. ILTV has a very
narrow host range in vivo, and only domestic chickens,
pheasants, peafowl [14], and turkeys [24] have been
described as natural hosts. ILTV is an important respiratory pathogen of chickens that may cause severe
or mild disease in layers and broilers. Severe disease
is characterized by respiratory depression, gasping,
expectoration of bloody exudate and high mortality.
Mild diseased chickens exhibit milder clinical signs
as depression, conjunctivitis, sneezing, rales, nasal
exudate, and low mortality, and laboratory techniques
are mandatory for a final diagnosis [10]. Several techniques have been described for the detection of ILTV,
including virus isolation (VI) [16], direct fluorescent
antibody tests [11,15,19,29], histopathology for the
detection of syncytia and inclusion bodies [23], immunoperoxidase procedures (IP) [13], DNA probe
hybridization [22], and Polymerase Chain Reaction
(PCR) [2,3,9,18,26,30]. Viral multiplication is limited
to respiratory tissue [10], which makes the trachea
the ideal site to look for the virus. The purpose of the
present study was to develop a sensitive and specific
nested PCR protocol to detect ILTV DNA directly
from tracheal swabs of naturally or experimentally
infected chickens.
Experimental infection
Ninety-six broilers from a commercial line
were reared in an isolation facility. At 6 weeks of age
they were divided into two groups of 48 birds, one of
these to be used as a control group and the other to be
experimentally infected with ILTV. On day 0, chickens
were intratracheally inoculated with 0.2 mL with 0.2
x 104 EID50. On days 2, 4, 6, 8, 10 and 12 post infection (PI), six birds were arbitrarily selected from each
group, sacrificed and their tracheas were collected.
The medium portion of each trachea was sampled.
Then, half of this sample was fixed in formalin for
histopathology while the other half was swabbed for
PCR and virus isolation (VI). Tracheal swabs for PCR
and VI were kept at -80oC until use.
MATERIALS AND METHODS
Viruses
Virus isolation (VI)
The ILTV strains were the vaccine Laryngovac and inactivated strain Cover2, which were used
as positive controls. The field isolates ILTV-BR440,
ILTV-1158, ILTV-BR219, ILTV-BR100, ILTV-BR101
were obtained from flocks with respiratory illness
collected in the South and Southeast Region of Brazil
during the year 2002 [5] when vaccination was not
allowed. Tracheal swabs were collected and examined
by VI and PCR, tracheal sections were examined by
histopathology. Results from these diagnostic assays
were compared.
The ILTV strain used for experimental infections was ILTV-BR1158, which caused mild respiratory disease in layers. It was isolated in specific
The tracheal swabs were resuspended in PBS,
cell debris were removed by centrifugation at 1200 x
g for 3 min and supernatants were inoculated into the
CAM of 9-day-old embryonated eggs. After 7 days,
embryos were killed and the formation of opaque plaques on the CAM was verified. For determination of
PCR sensitivity, five-fold serial dilutions of Laryngovac vaccine were also inoculated in embryonated eggs,
the procedure was repeated three times.
1
Histopathology
CAMs or a portion of the trachea from broilers
experimentally inoculated with ILTV or clinical suspect cases were fixed in neutral buffered formalin and
2
N. Beltrão, R.F. Egochega, T.Q. Furian, et al. 2012. A Sensitive Nested-Polymerase Chain Reaction Protocol to Detect
Infectious Laryngotracheitis Virus.
Acta Scientiae Veterinariae. 40(3): 1055.
Sensitivity and specificity of nested PCR
processed for histopathology. The paraffin embedded
tracheas and CAMs were sectioned at 5 m, stained
with haematoxylin and eosin, and examined by light
microscopy. Diagnosis of ILTV was based on the
observation of typical intranuclear inclusion bodies
and syncytia.
PCR sensitivity was determined by PCR and
CAM inoculation using five-fold serial dilutions of the
ILTV positive control and supernatants of the tracheal
pool (15 samples). Five 9-day-old SPF embryonated
eggs were inoculated with 0.2 mL of each dilution
(5x10-1 to 10-6). After 7 days of incubation, the CAMs
were examined. The EID50 was calculated according
to the Sperman-Kärber method [28]. PCR sensitivity
was determined by comparison with the egg titration
results after adjustments for the dilution and volume.
PCR specificity was verified by using a cow
poxvirus strain (CPV) isolated from cattle lesions, a
Marek’s disease vaccine4 and one skin sample with
Marek’s disease lesions (MDV), one infectious bronchitis virus (IBV) vaccine5, and bovine herpesvirus
type 1 (BHV-1) strains Lam, 265, 123 and type 5
strain EVI-88 (BVH-5)6. The poultry respiratory bacterias Ornithobacterium rhinotracheale (ORT) [7],
Pasteurella multocida (PM), Haemophilus sp. (HS),
Mycoplasma gallisepticum, Mycoplasma synoviae and
Escherichia coli, and tracheal samples from clinically
normal birds, SPF chickens and ILTV positive controls
were also tested by the nested-PCR.
In order to confirm the identity of the amplification products, the 647-bp internal amplification
products from the two positive controls and five field
isolates were sequenced. The extension products were
purified on Centri-Sep columns7. Both strands were
sequenced using 30 to 45 ng of PCR DNA templates
labeled with 3.2 pmol of the PCR primers and BigDye
Terminator v3.1 Cycle Sequencing RR-1008. The reaction product was loaded on an automatic sequencer
ABI-PRISM 3100 Genetic Analyzer8. The Clustal X
software [27] was used for sequence analysis, which
included the published sequences of ILTV [12, 21].
Polymerase Chain Reaction (PCR)
The tracheal swabs resuspended in PBS were
used for DNA extraction by the phenol-chloroform
method as previously described [5]. Two sets of nested
primers (Table 1) were selected from the published
sequence data of the thymidine kinase (TK) gene of
ILTV [12].
The internal primers (ILTV/PCR 5’, and ILTV/
PCR 3’ called here as p1 and p2) were as described [2]. A
pair of external primers (p3 and p4) was selected in order
to increase the sensitivity. The PCR reaction contained
50 ng of template DNA, 20 pmol of each primer, 2.5
mM MgCl2, 10 mM Tris-HCl pH 8.3, 0.2 mM dNTP,
and 1 U Taq DNA Polymerase in a final volume of 25
L. The cycling parameters from the first PCR reaction
with primers p3 and p4 included an initial denaturation
step of 5 min at 95oC followed by 30 cycles of denaturation at 95oC for 1 min, annealing at 58oC for 1 min,
and extension at 72oC for 1.5 min. The final cycle was
followed by an extension step at 72oC for 10 min. Two
L from the first reaction were used as template for the
second amplification with p1 and p2. Second reaction
constitution and cycling parameters were the same used
in the first amplification, with exception of the annealing
temperate that was 50oC.
PCR products were analyzed by electrophoresis in a 1.2% agarose gel stained with ethidium bromide
and the band determined by comparison against a 100bp DNA ladder3.
Table 1. Nucleotide sequence of PCR primers, position in the sequence [12] and ILTV amplification product expected length.
Primer
Sequence 5’→ 3’
Position
p1
ACGATGACTCCGACTTTC
4501-4519
p2
CGTTGGAGGTAGGTGGTA
5112-5130
p3
TGGCAACGGATTCCGGCA
4403-4421
p4
GGCACTTGTTAAGGCTTCTTGCTCC
5170-5195
3
Amplification product
647 bp
792 bp
N. Beltrão, R.F. Egochega, T.Q. Furian, et al. 2012. A Sensitive Nested-Polymerase Chain Reaction Protocol to Detect
Infectious Laryngotracheitis Virus.
Acta Scientiae Veterinariae. 40(3): 1055.
RESULTS
USA [21]. The isolates ILTV-BR440, ILTV-BR1158,
and ILTV-BR219 were identical, but were 99.5% homologous to these previously described sequence [21].
PCR
PCR with primers 3 and 4 was 100 times more
sensitive than PCR with primers 1 and 2 and 25 times
more sensitive than VI. The use of primers 1 and 2 after
DNA amplification with primers 3 and 4 (nested-PCR)
increased 10 times the sensitivity. The nested-PCR
was 250 times more sensitive than VI. With grinded
trachea from naturally infected birds, the nested-PCR
was 125 times more sensitive than VI. From the same
15 tracheas, the use of PCR with primers 1 and 2 could
detect 3 positive samples; however the nested-PCR
detected ILTV DNA in all samples.
The nested-PCR protocol was specific, since it
amplified an approximately 647-bp product only from
ILTV positive controls and field strains (Figure 1) and
none of the additional samples from non-infected birds
or other bacterial and viral species.
Two distinctive sequences were obtained from
the positive controls and field isolates. The Laryngovac,
Cover, ILTV-BR100 and ILTV-BR101 strains were
identical to a sequence obtained from an isolate from
Experimental infection
ILTV experimentally infected broilers showed
mild respiratory signs 48 hours PI, including depression, and dyspnea. No respiratory signs were observed
after day 10 PI. Two of 48 (4.2%) inoculated birds died
between days 8 and 10 PI with apparent hemorrhagic
tracheal exudates. Neither respiratory signs nor lesions
were found in the control chickens.
Table 2 presents the results of the three
diagnostic tests performed on ILTV infected birds.
VI and nested-PCR both detected virus in tracheas
from day 0 through day 12 PI. With one exception,
all positive samples by VI were also positive by
the nested-PCR. However, nested-PCR detected 5
additional positive samples on days 10 and 12 PI.
Through direct histopathology, typical syncytia and
inclusion bodies were found in one sample of day
6 and another sample from day 8 PI (Table 2 and
Figure 2).
Figure 1. PCR products on a 1.2 % agarose gel stained
with ethidium bromide. Lane 1: 100-bp molecular
weight marker; Lane 2: Vaccine strain; Lane 3: Cover
strain; Lane 4: Tracheal swab from an infected bird;
Lane 4: Tracheal swab from a negative bird.
Figure 2. Tracheal section - syncytia with intranuclear inclusion
bodies [H&E, 1000x].
Table 2. Results of ILTV detection in trachea of experimentally infected chickens by virus isolation (VI), histopathology, and
nested-PCR (number of positive samples/number of samples).
Days post-inoculation
VI
Histopathology
Nested-PCR
0
0/6
0/6
0/6
2
3/6
0/6
3/6
4
4/6
0/6
3/6
6
5/6
1/6
6/6
8
6/6
1/6
6/6
10
3/6
0/6
4/6
12
2/6
0/6
6/6
4
N. Beltrão, R.F. Egochega, T.Q. Furian, et al. 2012. A Sensitive Nested-Polymerase Chain Reaction Protocol to Detect
Infectious Laryngotracheitis Virus.
Acta Scientiae Veterinariae. 40(3): 1055.
Clinical cases
Tracheal sections from day 2 PI often-contained
normal structures, such as intact cilia and epithelial cells.
By day 10 PI, the histological lesions were not characteristic
of the disease, since the sections presented necrosis and
desquamation of epithelial cells, areas of hiperplasia of the
epithelium, subepithelial infiltration of inflammatory cells
and presence of bacteria in the lumen of the organs. By day
12 PI, tracheas were histologicaly normal. The uninfected
chicken tracheal samples were negative by the three tests.
VI detected ILTV positive samples in 4 out
of the 8 flocks with respiratory illness. Histopathological analyses detected 3 flocks as ILTV positive.
The nested-PCR detected 5 positive flocks including
those positive by VI and histopathology (Table 3).
Table 3. Results of ILTV detection in tracheas of suspect cases by virus isolation (VI), histopathology, and nested-PCR (number
of positive samples/total number of samples per flock).
Flock
440
1158
219
100
101
59
71
72
Nested-PCR
10/15
15/15
12/15
9/16
1/1
0/9
0/6
0/6
VI
3/5
4/5
1/5
0/5
1/1
0/9
0/6
0/6
Histopathology
1/5
1/4
0/1
0/5
1/1
0/1
0/1
0/1
DISCUSSION
in experimentally infected broilers indicates that the
two diagnostic tests are very efficient to detect ILTV
in the early time of infection. However, VI tests in late
infection may be not as sensitive as the nested-PCR if
majority of the ILTV have been inactivated or become
latent [4,17]. Some authors [3] used conjunctival swabs
and their results showed on day 5 and 6 PI more PCR
positives (19%) than VI (3%). Although no sample
was positive by VI on day 8 PI, 11% of the samples
were PCR positive. In the present study, VI and PCR
both detected ILTV in 100% of the samples on day 8
PI but PCR detected 100% more positive samples on
days 10 and 12 PI. Histopathology was the least sensitive test, since viral inclusion bodies and syncytial
cells were only observed in two tracheal sections on
day 6 and 8 PI. These results agree with the ones from
other experimental infections that indicated that ILTV
is not detected or detected inconsistently [1,14]. One
possible explanation for this result may be that necrosis
and desquamation destroy infected epithelium [14].
The assay described in the present study indicates that the nested-PCR protocol described is more
sensitive than previously described protocols and
specific to detect ILTV DNA from tracheal swabs
and can replace histopathology and virus isolation
with advantage.
The nested-PCR protocol was developed to
detect ILTV DNA from tracheal swabs of poultry. Since
there is considerable similarity between the TK genes
from different ILTV strains [12,21], it was decided to
select diagnostic primers from this region. PCR based
on ILTV TK gene primers offered a specific means of
detecting various ILTV strains and field isolates but
did not amplify DNA from other viruses, bacteria and
poultry tracheal swabs from clinically normal birds.
All sequenced amplification products were specific to
ILTV since they had a minimum of 99.5% similarity
with previously sequenced strains [12,21].
In the sensitivity test, the nested-PCR was 100
times more sensitive than a previously described PCR
protocol [2] and 25 times more sensitive than VI. The
nested-PCR established to detect ILTV gE [8] was 4.5
times more sensitive than VI. A previously described
real time PCR was 3.7 times more sensitive than VI [6].
By comparison of the PCR with VI sensitivity, it can be
concluded that the protocol here described has a greater
advantage over the previously described protocols that
afford a direct comparison [2,6,8]. In the detection of
the virus from clinical cases, the nested-PCR also detected a greater number of positive samples than VI and
histopathology. Comparison of the nested-PCR with VI
5
N. Beltrão, R.F. Egochega, T.Q. Furian, et al. 2012. A Sensitive Nested-Polymerase Chain Reaction Protocol to Detect
Infectious Laryngotracheitis Virus.
Acta Scientiae Veterinariae. 40(3): 1055.
SOURCES AND MANUFACTURERS
Acknowledgements. Financial support was provided by Conselho Nacional de Desenvolvimento Científico e Tecnológico
(CNPq) and Fundação de Amparo a Pesquisa do Estado do Rio
Grande do Sul (FAPERGS). N. Beltrão and C.R. Rodenbusch
received a scholarship from Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) and T. Q. Furian from
UFRGS/CNPq.
1
Solvay Animal Health, Charles City, IL, USA.
Spafas, Storrs, CT, USA.
3
Amersham Biosciences Corp, Piscataway, NJ, USA.
4
Rhodia Mérieux Veterinária Ltda, Brazil.
5
Intervet International B.V., Boxmeer, Holland.
6
Instituto de Pesquisas Veterinárias Desidério Finamour, FEPAGRO,
RS, Brazil.
7
Princeton Separations, Adelphia, NJ, USA.
8
Applied Biosystems, Foster, CA, USA.
2
Declaration of interest. The authors report no conflicts of
interest. The authors alone are responsible for the content and
writing of the paper.
REFERENCES
1 Abbas F. & Andreasen R.J. 1996. Comparison of diagnostic tests for infectious laryngotracheitis. Avian Diseases.
40(2): 290-295.
2 Abbas F., Andreasen R.J. & Jackwood M.W. 1996. Development of a polymerase chain reaction and a nonradioactive
DNA probe for infectious laryngotracheitis virus. Avian Diseases. 40(1): 56-62.
3 Alexander H.S. & Nagy E. 1997. Polymerase chain reaction to detect infectious laryngotracheitis virus in conjunctival
swabs from experimentaly infected chickens. Avian Diseases. 41(3): 646-693.
4 Bagust T.J. 1986. Laryngotracheitis (gallid-1) herpesvirus infection in the chicken. Latency establishment by wild and
vaccine strains of ILT virus. Avian Pathology. 15(3): 581-595.
5 Beltrão N., Furian T.Q., Leão J.A., Pereira R.A., Morais L.B. & Canal C.W. 2004. Detecção do vírus da laringotraqueíte das galinhas no Brasil. Pesquisa Veterinária Brasileira. 24(3): 85-88.
6 Callison S.A., Riblet S.M., Oldoni I., Sun S., Zavala G., William S., Resurreccion R.S., Spackman E. & Garcia M.
2007. Development and validation of a real-time Taqman PCR assay for the detection and quantification of infectious
laryngotracheitis virus in poultry. Journal of Virological Methods. 139(1-2): 31-38.
7 Canal C.W., Leão J., Rocha S., Macagnan M., Lima Rosa C.A., Oliveira S.D. & Back A. 2005. Isolation and characterization of Ornithobacterium rhinotracheale from chickens in Brazil. Research in Veterinary Science. 78(3): 225-230.
8 Chacón J.L. & Ferreira A.J.P. 2008. Development and validation of nested-PCR for the diagnosis of clinical and subclinical infectious laryngotracheitis. Journal of Virological Methods. 151(2): 188-193.
9 Clavijo A. & Nagy E. 1997. Differentiation of infectious laryngotracheitis virus strain by polymerase chain reaction.
Avian Diseases. 41(1): 241-246.
10 Gama N.M.S.Q. & Canal C.W. 2009. Laringotraqueíte infecciosa das galinhas. In: Doenças das Aves. 2nd edn.
Campinas: Fundação APINCO de Ciência e Tecnologia Avícolas, pp.787-800.
11 Goodwin M.A., Smeltzer M.A., Brown J., Resurreccion R.S. & Dikson T.G. 1991. Comparison of histopathology to the direct immunofluorescent antibody test for the diagnosis of infectious laryngotracheitis in chickens.
Avian Diseases. 35(2): 389-391.
12 Griffin A.M. & Boursnell E.G. 1990. Analysis of the nucleotide sequence of DNA from the region of the thymidine
kinase gene of infectious laryngotracheitis virus: potencial evolutionary relationships between the herpesvirus subfamilies. Journal of General Virology. 71(4): 841-850.
13 Guy J.S., Barnes H.J. & Smith L.G. 1992. Rapid diagnosis of infectious laryngotracheitis using a monoclonal antibodybased immunoperoxidade procedure. Avian Pathology. 21(1): 77-86.
14 Guy J.S. & Bagust T.J. 2003. Laryngotracheitis. In: Saif Y.M. (Ed). Diseases of Poultry. 11th edn. Ames: Iowa State
University Press, pp.121-134.
15 Hitchner S.B., Fabricant J. & Bagust J.A. 1977. A fluorescent-antibody study of the pathogenesis of infectious
laryngotracheitis. Avian Diseases. 21(2): 85-194.
16 Hughes C.S. & Jones R.C. 1988. Comparison of cultural methods for primary isolation of infectious laryngotracheitis
virus from field materials. Avian Pathology. 17(2): 295-303.
17 Hughes C.S., Williams R.A., Gaskell R.M., Jordan F.T.W., Bradbury J.M., Bennett M. & Jones R.C. 1991. Latency
and reactivation of infectious laryngotracheitis vaccine virus. Archives of Virology. 121(1-4): 213-218.
6
N. Beltrão, R.F. Egochega, T.Q. Furian, et al. 2012. A Sensitive Nested-Polymerase Chain Reaction Protocol to Detect
Infectious Laryngotracheitis Virus.
Acta Scientiae Veterinariae. 40(3): 1055.
18 Humberd J., Garcia M., Riblet S.M., Resurreccion R.S. & Brown T.P. 2002. Detection of infectious laryngotracheitis
virus in formalin-fixed, paraffin-embedded tissues by nested polymerase chain reaction. Avian Diseases. 46(1): 64-74.
19 Ide P.R. 1978. Sensitivity & specificity of the fluorescent antibody technique for detection of infectious laryngotracheitis
virus. Canadian Journal of Comparative Medicine. 42(1): 54-62.
20 Keam L., York J.J., Sheppard M. & Fahey K.J. 1991. Detection of infectious laryngotracheitis virus in chickens
using a non-radioactive DNA probe. Avian Diseases. 35(2): 257-262.
21 Keeler C.L., Kingsley D.H. & Adams Burton C.R. 1991. Identification of the thymidine kinase gene of infectious
laryngotracheitis virus. Avian Diseases. 35(4): 920-929.
22 Key D.W., Gough B.C., Derbyshire B. & Nagy E. 1994. Development and evaluation of a non-isotopically labeled
DNA probe for the diagnosis of infectious laryngotracheitis. Avian Diseases. 38(3): 467-474.
23 Pirozok R.P., Helmbolt C.F. & Jungherr E.L. 1957. A rapid histological technique for the diagnosis of infectious
avian laryngotracheitis. Journal of the American Veterinary Medical Association. 103(9): 406-407.
24 Portz C., Beltrão N., Furian T.Q., Júnior A.B., Macagnan M., Griebeler J., Lima Rosa C.A., Colodel E.M.,
Driemeier D., Back A., Schatzmayr O.M.B. & Canal C.W. 2008. Natural infection of turkeys by infectious laryngotracheitis virus. Veterinary Microbiology. 131(1-2): 57-64.
25 Roizmann B. 1982. The family Herpesviridae: General description, taxonomy and classification. In: The Herpesviruses.
New York: Iowa State University Press, pp.1-23.
26 Scholz R.E.P. & Guo P. 1994. Differential diagnosis of infectious laryngotracheitis from other avian respiratory diseases
by a simplified PCR procedure. Journal of Virological Methods. 50(1-3): 313-321.
27 Thompson J.D., Gibson T.J., Plewniak F., Jeanmougin F. & Higgins D.G. 1997. The Clustal X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research. 25(24): 4876-4882.
28 Villegas P. & Purchase H.G. 1989. Titration of biological suspensions. In: A Laboratory Manual for the Isolation and
Identification of Avian Pathogens. 3rd edn. Philadelphia: American Association of Avian Pathologists, pp.186-191.
29 Wilks C.R. & Kogan V.G. 1979. An immunofluorescence diagnostic test for avian infectious laryngotracheitis. Australian Veterinary Journal. 55(8): 385-388.
30 Williams R.A., Savag C.E. & Jones R.C. 1994. A comparison of direct electron microscopy, virus isolation and a
DNA amplification method for the detection of avian infectious laryngotracheitis virus in field material. Avian Pathology. 23(4): 709-720.
www.ufrgs.br/actavet
7
Pub. 1055