Download ___ _____ Describes gene expression in which genes are being

1. ___ _____ Describes gene expression in which genes are being transcribed all the time.
2. _____ ____ Describes a single mRNA transcript containing two or more adjacent
protein-coding genes
3. To inhibit transcription of operon genes, the lac repressor binds to
a. the promoter
b. the operator
c. the inducer
d. β-galactosidase
4. Which of the following is an example of positive control?
a. lactose inducing the lac operon
b. CAP-cAMP binding to the lac promoter
c. trp binding to the trp repressor
d. lac repressor binding to the lac operator
5. __ __ In an inducible operon, induction occurs when the inducer binds to the operator.
6. Your bone cells, muscle cells, and skin cells perform different functions because
a. each cell contains different kinds of genes.
b. they are present in different organs.
c. different genes are active in each kind of cell.
d. they contain different numbers of genes.
e. each cell has different mutations.
7. What is the product of the lacI gene?
a. lactose
b. tryptophan
c. B-galactosidase
d. repressor
e. CAP protein
8. Under normal conditions in wild type E. coli, the lac operon is under ________ control.
a. positive
b. negative
c. inducible
d. both B and C
e. all of the above
9. The following DNA sequence includes the beginning of a sequence coding for a protein.
What type of mutation is created if the C marked by an asterisk was changed to an A?
5’ AGGCTATGAATGGACACTGCGAGCCC…3’
*
a. missense mutation
b. nonsense mutation
c. silent mutation
d. frameshift mutation
10. A point mutation may be insignificant because:
a. a new amino acid is coded at an unimportant location.
b. it creates a frameshift
c. a new amino acid may not be encoded.
d. point mutations are neutral
e. a and b
f. a and c
g. a and d
11. _______ In the lac operon, the repressor protein is synthesized only in the presence of
lactose.
12. Fill in the blanks regarding the Lac Operon:
__________---_ binds to the repressor, changes its shape so that the repressor__________
(does/does not) bind the operator.
For lac operon expression, the ____________ __can’t be bound to the operator and
___________(glucose/lactose) can not be present.
Low levels of glucose result in __________(high/low) levels of cyclic AMP.
In the lac operon, the _______________-binding to the operator is an example of negative
gene regulation, while__________________ is an example of positive gene regulation.
The lac operon is an example of a(n) _______________(repressible/inducible) operon. In
other words, gene expression is_____________(repressed/induced) when the effecter
(lactose) is bound to the repressor.
13. Fill in the blanks regarding the Trp Operon:
When levels of tryptophan are low, there is a __________expression of the trp operon. The
repressor ____________(is/ is not) bound to the operator.
When levels of tryptophan are high, there is a ___________ expression of the trp operon.
Tryptophan acts as a(n) ____________-, and binds to the ___________, altering its shape so
now it binds the operator.
In the trp operon, the repressor binding to the operator is an example of __________ ___.
The trp operon is a _____________-- ___, effector (trp) binding to ___________ shuts down
expression.
14. Early regulation in the pathway of gene expression is faster than later regulation of gene
expression, true or false. _______
15. These are involved in the packaging of DNA and organizing DNA into a very small nucleus.
______ ________
16. What is the charge of the answer of the question above and why is this charge important?
17. This level of DNA packaging involves a core of 8 histones with about 200 base pairs of DNA
wrapped around this core. ________
18. This level of DNA packaging is basically 2 nucleosome chains stacked on top of each other
and production of this is facilitated by H1, found in linker DNA. ___ _____