Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Effect of Decreasing Hsp27 on Egr1 Gene Expression in B16 cells Marissa Weinfeld, Department of Biology, York College Introduction Methods Prostate cancer is the most common form of cancer found in men in the United States as well as the second largest cause of cancer-related death in men signifying the importance of research in this major public health problem (Jemal, 2005). Design Hsp27 and scrambled control siRNA plasmid • Elevated expression of heat shock protein 27 (Hsp27) has been found in patients with prostate cancer and is associated with castration-resistant prostate cancer (CRPC) progression. CRPC progression is a process where cancer cells obtain the ability to survive and proliferate in the absence of testicular androgens. • • SiRNA Well 1 Well 2 Well 3 Hsp27 Untransfected Transfected Transfected/ DMSO scHsp27 Untransfected Transfected Transfected/ DMSO Table 1. A six well plate was used to transfect B16 cells with Hsp27 and scHsp27. Hsp27 insert primer sequence GTACCTCGTCCCTGGATGTCAACCACTTTCAA CCACTTTCAAGAGAAGTGGTTGACATCCAGG GACGAAAAGCTTTTCCAAAAAGTCCCTGGAT GTCAACCACTTCTCTTGAAAGTGGTTGACATC CAGGGACGAG Ligated insert at Hind III and ACC651 Transformed bacteria and selected for KAN resistance to isolate plasmid Primer Sequence 5’ to 3’ Fragment size Egr1For Egr1Rev Egr1.3For Egr1.3Rev TAATAGCAGCAGCAGCACCAGC GTCGTTTGGCTGGGATAACTCG CCACCATGGACAACTACCCC TCATAGGGTTGTTCGCTCGG 220 205 Table 2. Primer sequences for Egr1 and their expected fragment size. A more recent study shows Hsp27 initiatives the movement of human prostate cancer cells out of the prostate gland to distant organs (Voll, 2014). Conclusions Transfection • • Early growth response protein 1 (Egr1) levels are constitutively high and closely linked to cancer development and progression (Giteny, 2009). Results from a previous study indicate that the activation of Egr1 is an early event in the development of prostate cancer and the absence of the Egr1 gene results in significantly delayed tumor development. It is also suggested that Egr1 induced genes that accelerate tumor progression either by mitogenesis , angiogenesis or invasion (Svaren, 2000). Created plasmid construct Transfected B16 cells with 1 ug plasmid using the LyoVec reagent for 1 hour Cells were treated with DMSO dose for 4 hours Figure 1. Showed that the Egr1 primer set 1 (Table 2) did not produce expected bands. Figure 2. Performed a DNase treatment on RNA prior to PCR and no bands were present. RNA isolation and quantification Figure 3. A faint band was present in the untreated B16 cells. • Trizol reagent was used to isolate total RNA • 0.5 ug of RNA was used for Reverse transcriptase • RT was amplified with Egr1 primers (Table 2). • Universal primers (Ambion) Figure 4. Non specific interactions appeared in lane 3. A band was present for Egr1 gene expression in human DNA around 190. While primers were able to amplify in DNA little to no bands were observed in RNA isolates. The popular anticancer drug in chemotherapy 5-Fluorouracil (5FU) inhibited the phosphorylation of Hsp27, which decreased the induction of Egr1 (Zhao, 2008). Future Studies Reisolation of RNA to measure the effect of Hsp27 and Egr1 gene expression Hsp27 has been shown to induce NF-kB which induces expression of Egr1 (Shiota, 2013). References Biron-Pain, K., Grosset, A., Poirier, F., Gaboury, L., and Pierre, Y. 2013. Expresion and functions of galectin-7 in human and murine melanomas. PLOS ONE 8:1-10. Jemal, A., Murray, T., Ward, E., Samuels, A., Tiwari, R.C., Ghafoor, A., Feuer, E.J., and Thun, M.J. 2005. Cancer Statistics, 2005. CA Cancer J Clin 55:10-30. Shiota, M., Bishop, J., Nip, K., Zardan, A., Takeuchi, A., Cordonnier, T., Beraldi, E., Bazov, J., Fazil, L., Chi, K., Gleave, M., and Zoubeidi, A. 2013. Hsp27 regulates epithelial mesenchymal transition, metastasis, and circulating tumor cells in prostate cancer. The Journal of Cancer Research 70:3109-3119 Svaren, J., Ehrig, T., Abdulkadir, S., Ehrengruber, M., Watson, M., and Milbrandt J. 2000. Egr1 Targets genes in prostate carcinoma cells identified by mircroarray analysis. The Journal of Biological Chemistry 275: 38524-38531. Voll, E.A., Ogden. I.M., Pavese, J.M., Huang, X., Xu, Li., Jovanovic, B.D., and Bergan, R.C. 2014. Heat shock protein 27 regulates human prostate cancer cell motility and metastatic progression. Oncotarget 9:2648-2663. Zhao, H.Y. Ooyama A., Yamamoto, M., Ikeda, R., Haraguchi, M., Tabata, S., Furukawa, T., Che, X., Zhang, S., Oka, T., Fukushima, M., Nakagawa, M., Ono, M., Kuwano, M., Akiyama, S. 2008. Molecular basis for the induction of an angiogenesis inhibitor, thrombospondin-1, by 5-Fluorouracil. American Association for Cancer Research 68:7035-7041. The melanoma B16 cell line was used in previous experiments expressing Hsp27 and Egr1 (Biron-Pain, 2013). Objective and Hypothesis The objective of this study was to determine if decreasing Hsp27 alters Egr1 gene expression in B16 cells. The hypothesis was that the knockdown of Hsp27 would lead to a reduction in Egr1 expression. Acknowledgements I would like to thank Dr. Kaltreider for his patience, work and support on this senior thesis project. Results Human DNA ScHsp27 Untransfected Hsp27/DMSO Hsp27 ScHsp27/DMSO ScHsp27 Untransfected ScHsp27 Hsp27/DMSO Untransfected ScHsp27/DMSO ScHsp27/DMSO ScHsp27 ScHsp27 Untransfected Hsp27/DMSO Hsp27 Hsp27 ScHsp27 Hsp27/DMSO Hsp27 Untransfected Untransfected Hsp27 Hsp27 Hsp27/DMSO Hsp27/DMSO Untransfected ScHsp27 ScHsp27 ScHsp27/DMSO ScHsp27/DMSO Hsp27 ScHsp27 Untransfected Hsp27 Untransfected ScHsp27 Untransfected Untransfected Hsp27 Hsp27 Hsp27/DMSO Hsp27/DMSO Untransfected ScHsp27 ScHsp27 ScHsp27/DMSO ScHsp27/DMSO Hsp27 Hsp27 Untransfected Hsp27 300 200 200 100 200 200 100 A 100 100 B 300 200 200 100 100 Fig.3. Egr1 expression in the control B16 cells. Total RNA was Fig. 1. 18S expression in B16 cells (A). Egr1 gene expression in B16 cells (B). Total RNA was isolated from the cells and the reverse transcription reaction was performed using the High Capacity cDNA Reverse Transcriptase Kits Protocol (Applied bio systems). The cDNA was then amplified by PCR using the Egr1 primer (Table 1.)PCR produced was electrophoresed on a 2% agarose gel and PCR fragments were visualized by SYBR green. 300 Fig. 2. PCR reaction of RNA isolates. Total RNA was isolated from the B16 cells. The RNA was treated with the DNase treatment and was electrophoresed on a 2% agarose gel. PCR fragments were visualized by SYBR green. isolated from the cells and the reverse transcription reaction was performed using the High Capacity cDNA Reverse Transcriptase Kits Protocol (Applied bio systems). The cDNA was then amplified by PCR using the Egr1 primer (Table 2.) PCR produced was electrophoresed on a 2% agarose gel and PCR fragments were visualized by SYBR green (Applied bio systems). Fig. 4. Egr1 gene expression in B16 cells. Total RNA was isolated from the cells and the reverse transcription reaction was performed using the High Capacity cDNA Reverse Transcriptase Kits Protocol (Applied bio systems). The cDNA was then amplified by PCR using the Egr1 primer (Table 2). PCR produced was electrophoresed on a 2% agarose gel and PCR fragments were visualized by SYBR green.