Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Bowel Disease Research Foundation of The Association of Coloproctology of Great Britain and Ireland Advancing the cure and treatment of bowel disease Research Project Annual Report Lead investigator Project Title Professor John Williams Institution Ms Elizabeth Tweedle Targeting HSP27 in colorectal cancer University of Chester University of Liverpool Start date 04/2013 08/2016 Lay Summary (max 500 words) Background Colorectal cancer is the second highest cause of cancer deaths in the UK. Heat shock protein-27 (HSP27) protects stressed cells from undergoing cell death. We identified that some rectal cancers have high levels of HSP27 in their cells and this correlates with poor patient survival. Elevated HSP27 also predicts poor survival after chemotherapy in patients with colon cancer. HSP27 is released by tumour cells into their microenvironment and may reduce the ability of the patients’ immune cells to destroy the tumour and protect cancer cells from chemotherapy. Methods We extracted human colorectal cancer cells from recently excised tumours and tested their response to chemotherapy treatment with- and without- inhibiting HSP27 expression. We generated stable luminescent human and rodent colorectal cancer cells which either expressed or did not express the HSP27 (or the rodent equivalent HSP25) protein. We successfully implanted these cells into the colon of rodents in order to develop a model for testing new anti-tumour drugs. Multiple (n=400) sections of human colorectal cancer tissue were stained for two inflammatory cell types surrounding the tumour (CD68 and CD206). Results Inhibiting HSP27 expression in primary human colorectal cells increased susceptibility to the most commonly used chemotherapy agent (5FU). Tissue staining successfully detected different numbers of immune cells in the environment of human cancer cells. Correlation of the expression of HSP27 and the immune cell count in these tumours is ongoing. The rodent animal models developed both primary and metastatic tumours which were detectable by luminescent imaging. Drug testing in these animal models is ongoing. Survival from colorectal cancer is 50% overall. New treatments are required particularly to target disease which cannot be treated by surgery alone. Various proteins, expressed in the tumour cells or the tumour microenvironment, have been linked with a worse prognosis in this disease. It is anticipated that drugs designed to stop production of these proteins in the tumour cells will improve the survival of patients with this condition. Background (purpose for project) Finish date The purpose of this project was to develop reproducible and complimentary models of 1 Bowel Disease Research Foundation of The Association of Coloproctology of Great Britain and Ireland Advancing the cure and treatment of bowel disease colorectal cancer in order to test new drugs for efficacy or improve the efficacy of existing drugs. The first model used human cancer cells from recently excised tumours to culture and test for drug response. A second model used rodents implanted with luminescent tumour cells in the colon to track development and spread of the tumour in a living system in order to test response to drug treatment. Introduction HSP27 may influence tumour behaviour in two ways depending on whether the protein is inside or outside the cell. Intracellular HSP27 is an anti-apoptotic protein with several modes of action including stabilisation of the actin cytoskeleton and mitochondrial membrane and prevention of death receptor pathway activation (1). Elevated levels of HSP27 have been found in a number of tumour types and have been shown to protect against chemotherapy induced apoptosis, both in vitro and in murine models (2). We independently produced evidence that elevated HSP27 may be responsible for poor survival rates in colorectal cancer. Proteomic analysis at Liverpool identified elevated HSP27 to be independently linked to poor prognosis in rectal cancer, findings which were generated using samples from >700 colorectal cancer patients (3). Duke’s C colon cancer patients with high HSP27 had a worse outcome following treatment with 5fluorouracil (5FU) (4). In vitro depletion of HSP27 using siRNA in 6 colorectal cancer cell lines significantly increased rates of apoptosis in response to 5FU, oxaliplatin or irinotecan (unpublished material Liverpool and Chester). Therefore elevated intracellular HSP27 is anti-apoptotic and favours tumour cell survival. HSP27 has also been detected in the extracellular environment. Secretion of HSP27 by Chronic Lymphocytic Leukaemia cells has been identified in work done in Chester (5) and has also been reported in breast cancer cells (6). Colorectal cancers show varying degrees of desmoplastic stroma; secreted factors (including HSP27) may play a role in development and maintenance of this stroma (7). One type of stromal response is characterised by a ‘cytotoxic’ (CD8+) T lymphocytic and M1 type macrophage infiltrate around the tumour margin and has been linked to tumour regression, inhibition of metastases and good prognosis (8). Other forms of stromal responses are dominated by a ‘suppressive’ (FOXP3+) T-reg and M2-type macrophage infiltrate and has been associated with nodal metastases, angiogenesis, matrix remodelling and poor prognosis (9). Exogenous HSP27 has been demonstrated to cause differentiation of monocytes into anti-inflammatory (M2) macrophages which were capable of inducing immune-tolerance in T cells (6). In murine models, breast tumours depleted of HSP25 (the murine equivalent of HSP27) had higher levels of cytotoxic CD8+ T lymphocyte infiltrate and displayed tumour regression (10). Therefore, elevated extracellular HSP27 may promote a microenvironment conducive to tumour growth and metastasis. Phase 2 trials of the HSP27-inhibiting drug OGX-427 are currently recruiting patients with metastatic urothelial and prostate cancer. It is vital to establish whether this exciting new treatment could be of benefit to colorectal cancer patients. Our in vivo and in vitro work at Liverpool and Chester has already shown the importance of intracellular HSP27 in colorectal cancer prognosis. We have also shown that HSP27 can 2 Bowel Disease Research Foundation of The Association of Coloproctology of Great Britain and Ireland Advancing the cure and treatment of bowel disease be secreted from tumour cells. Further evidence, from primary cell culture and murine models, was sought that HSP27 inhibition increases sensitivity to chemotherapeutics and induces a beneficial immune response in the tumour microenvironment. Methods Primary cell culture Fresh colorectal cancer tissue was collected from consented patients undergoing surgery at the Countess of Chester Hospital. Epithelial cells from each specimen were cultured to generate primary tumour cell populations. The resulting cancer cell population were separated according to HSP27 expression by Fluorescence-Activated Cell Sorting (FACS) using an established protocol (11). Baseline apoptosis (annexinV/propidium iodide) and proliferation (MTS assay) were performed. Apoptosis in response to chemotherapy agents (5FU, oxaliplatin and irinotecan) were correlated with HSP27 expression. The assays were repeated following both siRNA and drug inhibition of HSP27 using OGX-427 (OncoGenex Pharmaceuticals). OGX-427 was used alone and in combination with chemotherapy agents and synergistic HSP90 inhibition (17-AAG, 17-DMAG).(12) Intracellular and secreted HSP27 was quantified by ELISA in human colorectal cancer cell lines (HT29, SW837, HRT-18, SW480, HCT116) and in the primary tumour culture populations generated. The effect of inhibiting HSP27 using specific siRNA or OGX-427 on this secretion was quantified. Cell culture and cell lysate production CT26 murine cells were obtained from the American Type Culture Collection, ATCC. CMT93 murine and DHD/K12 rat cell lines were obtained from the UK National Cell Culture Collection. Cells were routinely maintained in 75 cm2 tissue culture flasks at 37°C with 5% supplemental CO2 and sub-cultured every 3-4 days, when confluency reached approximately 80-90%. Cell lysates were prepared by incubating cells on ice in RIPA buffer (50mM Tris-Cl Ph 7.5-8.0,150mM NaCl, 1% Triton X-100, 0.5% Nadeoxycholate, 0.1% SDS). Samples were sonicated then collected by centrifugation at 4°C for 10 min, with the consequent supernatant analysed by BCATM Protein Assay kit (ThermoFisher Scientific) for protein concentration estimation. Western blotting Cell lysate was mixed with 1 x sample loading buffer (62.5 mM Tris-HCl pH 6.8, 2.5 % SDS, 0.002 % Bromophenol Blue, 0.7135 M (5%) β-mercaptoethanol, 10 % glycerol). The mixtures were then heated at 95°C for 10 min for protein denaturation. Each well of a precast 86x67mm polyacrylamide gels from Biorad (Any kD™ MiniPROTEAN® TGX™) was loaded with 20µg of protein alongside a pre-stained molecular weight ladder (PageRuler™ 10 to 180 kDa; ThermoFisher Scientific). Gels were subjected to 160mA for 20-30 minutes. The stacking gel was removed and the proteins in the resolving gel transferred onto a pre-cut polyvinylidene fluoride membrane using Trans-blot Turbo Transfer system (Biorad). Following the transfer procedure, the membrane was removed and washed in warm phosphate buffered saline tween (PBST) solution repeated twice each for 5 minutes. The membrane was then blocked using 5 % blocking milk TBST solution for 60 min. The primary antibody in 5% milk was added for 3 Bowel Disease Research Foundation of The Association of Coloproctology of Great Britain and Ireland Advancing the cure and treatment of bowel disease 60 min at room temperature according to the concentrations in Table 1. Antibody Company Anti-HSP27 F4 mouse monoclonal antibody Santa Cruz (sc-13132) Anti-HSP27 M-20 rabbit polyclonal antibody Santa Cruz (sc-1049) Anti-GAPDH rabbit polyclonal antibody Abcam (ab9485) Anti-β-Actin mouse monoclonal antibody Sigma Aldrich (A5441) Table 1. Dilutions of antibodies used for Western blotting Conc 1:5000 1:100 1:2000 1:10000 Following incubation with primary antibody, the membrane was washed with PBST and the secondary horseradish peroxidase-linked antibody applied (dilution 1:2000, in 5% milk PBST solution) for 60 minutes. ECL Reagent Plus was applied to the membrane for 5 minutes and the blots were developed using x-ray film for variable durations in a dark room. Membranes were stripped of antibody using Restore™ Western Blot Stripping Buffer (ThermoFisher Scientific) at 75°C for 30 minutes. Loading control was assessed by re-probing with anti-β-actin or Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH) antibodies as above. Generation of plasmid An HSP25-expressing plasmid was gifted from Dr Yong Lee (Department of Radiation Oncology, William Beaumont Hospital, Royal Oak, MI, USA), the sequence of the insert was given in Figure 1. Three sets of primers were designed to amplify the sequence for insertion into a donor plasmid (pMONO-zeo-mcs; InvivoGen). GATATCAACGTTGGCGCGCCGGTACCCGGTCCGGAATTCCCGGGATATCGTCGACCCACGCGTCCGCCCACGCGTC CGGCACGCTGGGGCTCCAGTCCGGCACTTCTCGGATCCTCAGCCCAGTGCTTCTAGATCCTCAGCCTTGACCAGCC AAGAACATGACCGAGCGCCGCGTGCCCTTCTCGCTGCTGCGGAGCCCGAGCTGGGAACCATTCCGGGACTGGTAC CCTGCACACAGCCGCCTCTTCGATCAAGCTTTCGGGGTGCCCCGGTTGCCCGATGAGTGGTCGCAGTGGTTCAGCG CCGCTGGGTGGCCCGGATACGTGCGCCCGCTGCCCGCCGCGACCGCCGAGGGCCCCGCGGCGGTGACCCTGGCC GCACCAGCCTTCAGCCGAGCGCTCAACCGACAGCTCAGCAGCGGGGTCTCGGAGATCCGACAGACGGCTGATCGC TGGCGCGTGTCCCTGGACGTCAACCACTTCGCTCCGGAGGAGCTCACAGTGAAGACCAAGGAAGGCGTGGTGGA GATCACTGGCAAGCACGAAGAAAGGCAGGACGAACATGGCTACATCTCTCGGTGCTTCACCCGGAAATACACGCT CCCTCCAGGTGTGGACCCCACCCTAGTGTCCTCTTCCCTATCCCCTGAGGGCACACTTACCGTGGAGGCTCCGTTGC CCAAAGCAGTCACGCAGTCAGCGGAGATCACCATTCCGGTTACTTTCGAGGCCCGCGCCCAAATTGGGGGCCCAG AAGCTGGGAAGTCTGAACAGTCTGGAGCCAAGTAGAAGCCATCAGCCTGCTGCCTATCTCCCATAGCCATTGCTGG CCACCCCTCTCTGTCAATCTGTGCGCTCTTTTGATACATACATTTACCTGCTGTTTTTCTCAAATAAAAGTTGCAAGCT ACTGCTCACCACAAAAAAAAAAAAAAAAAAAAGGGCGGCCGCTCTAGAGTATCCCTCGAGTGATCAGATCCACGC GTATCGATTGTCGACCCTAGG Figure 1: Sequence of the HSP25 insert (phsp6 plasmid) PCR reactions were performed in 50µL volumes with final concentrations 1xPCR Buffer, deoxynucleotide Mix 200 µM, Forward primer 0.1-0.5 µM, Reverse primer 0.1-0.5 µM, AmpliTaq Gold® DNA Polymerase (Applied Biosystems) 0.05 units/µL, plasmid DNA 200pg/µL, MgCl2 0.1-0.5mM. Amplification was performed as follows: denature 94°C for 1 min, annealing 55-68°C for 2 min, extension 72 °C for 3 min; total of 30 cycles. PCR product was visualised using a 2% agarose gel impregnated with GelRed nucleic acid stain under UV light. 4 Bowel Disease Research Foundation of The Association of Coloproctology of Great Britain and Ireland Advancing the cure and treatment of bowel disease Antibiotic kill curves Cells were plated into 96 well plates at a density of 2, 000 cells per well and allowed to grow to 70-80% confluence. Graded concentrations of Geneticin® (ThermoFisher) and ZeocinTM (InvivoGen) antibiotics were applied from 0-1000µg/ml for 2 weeks with exchange of media every 48 hours. Cell death was ascertained using light microscopy and functional MTS Assay Kit (EZ4U) according to the manufacturer’s instructions. Briefly, 2.5 mL of activator was added to the substrate. Then, 20µL of the mixture was added into each well. The plates were then immediately read at 450 nm with the biophotometer machine to determine the 0 hour readings. The plates were subsequently read every hour for 4-5 hours. The concentration of antibiotic required to produce 100% cell death after 5 days was utilised for selection of plasmid integration. Generation of stable cell lines using plasmid transfection Cells were transfected using Lipofectamine 2000 (Invitrogen, Paisley, UK) at three DNA: lipofectamine ratios according to the manufacturer’s protocol. Briefly, cells were plated at a density of 1 × 106 cells per 6 well plate and grown for 24 hours. Cells were placed in serum- and antibiotic-free medium and transfected with 2.5μg of plasmid per well in duplicate. Media was exchanged after 12 hours. At 48 hours cells were selected for integration of coding sequences by treating with G418 (400μg/mL; Invitrogen, Paisley, UK) for two weeks or ZeocinTM (100µg/ml; Invivogen). Plasmid pGL4.17[luc2/Neo] phsp6 pMONO-zeo-mcs pSELECt-zeo-LucSh pCMV6-Kan/Neo Encodes Luciferase HSP25 EMPTY Luciferase HSPB1 (untagged)- mouse heat shock protein 25 Antibiotic Neomycin Neomycin Zeocin Zeocin Neomycin Company Promega (E6721) Gifted from Yong Lee Invivogen (#pmonoz-mcs) Invivogen (#psetz-lucsh) Amsbio (MC203704) Table 2. Characteristics of the plasmids used in the study. Single colonies were separated into 96-well plates using serial dilution and expanded into 75cm2 flasks. Positive clones were identified using western blot for HSP25 expression as previously described or a luciferase assay as follows. Briefly, cells were harvested in 50μL 1 × Glo Lysis buffer (Promega, Southampton, UK) and assayed for luciferase activity according to the manufacturer’s instructions using a plate reader (PerkinElmer, Bucks, UK). Each clone was assayed in triplicate and experiments were repeated at least three times. Generation of orthotopic, synergic rodent models of colorectal cancer and metastasis Six to eight week old male BALB/cAnNCrl mice (Charles River laboratories, Margate, UK) were anaesthetised and injected with a suspension of luminescent CT26 cells (5x105 cells in 50µl of the 50% PBS / 50% Matrigel) into the caecal submucosa following laparotomy. Bioluminescent imaging was completed up to three times weekly using the IVIS® Spectrum in vivo imaging system (Perkin-Elmer, Massachusetts, USA). Primary 5 Bowel Disease Research Foundation of The Association of Coloproctology of Great Britain and Ireland Advancing the cure and treatment of bowel disease tumour uptake and growth rates were assessed, as was the frequency of metastatic disease. Study end-points were established, with mice sacrificed if the severity limits of the project licence were reached, usually due to bowel obstruction. Figure 2: Technique for the orthtopic injection of cells Immunohistochemistry (IHC) of human paraffin-embedded tissue Staining of a colorectal tissue microarray was undertaken as follows; 5µm thick sections of the array were deparaffinised, rehydrated and subject to antigen retrieval using a PT link (DAKO, UK). Slides were incubated for 10 minutes in peroxidase block (Envsion; Dako, UK) and rinsed in TBS. Primary antibodies were diluted in Chemomate (Dako, UK) and applied to slides for 60 min at room temperature or overnight at 4°C, for details see table 3. These slides were then rinsed in TBS and visualisation achieved by incubating with a horseradish peroxidase conjugated secondary antibody for 30 min followed by diaminobenzidine for 10 min. Negative controls were incubated with conjugated secondary antibody only. Slides were counterstained with haematoxylin for 30s and coverslips mounted with DPX mountant, (BDH). Antibody Animal Concentration Company Anti-CD68 Mouse 1:200 Dako (0876) Anti-CD206 Mouse 1:200 Abcam (Ab117644) Table 3: Primary antibodies used for immunohistochemistry Results and discussion 1. The effect of HSP27 inhibition on chemotherapy-induced apoptosis in primary colorectal cancer cell cultures. The intracellular level of HSP27 increased significantly (p<0.001) after HT29 cells were treated with 5-FU, oxaliplatin, irinotecan and HSP90 inhibitors, confirming the hypothesis that colorectal cancer cell increase expression of HSP27 in response to a stressed cellular environment caused by cytotoxic and cytostatic agents. In HT29 cells, silencing HSP27 prior to addition of 5-FU and oxaliplatin significantly (p>0.05) enhanced their cytostatic and cytotoxic effect. However, this effect was not observed for irinotecan. Collectively, these findings suggested that the cytoprotective effect of HSP27 may be specific to the type of chemotherapy employed. Further elucidation of the protective mechanism conferred by HSP27 is needed to understand its selectivity. 6 Bowel Disease Research Foundation of The Association of Coloproctology of Great Britain and Ireland Advancing the cure and treatment of bowel disease When ex-vivo specimens were treated with HSP27 inhibitors, intracellular HSP27 did not increase as expected. By contrast, out of the five ex-vivo specimens treated with HSP90 inhibitors that were analysed, two normal samples displayed significant changes in the level of HSP27, whereas none of the cancerous sample showed changes in HSP27. There was no association between a positive response to the HSP27 inhibitor and the level of intracellular HSP27, although this may be a reflection of individualised heat shock response to HSP27 inhibitors. A larger number of specimens will be needed to better understand the association between HSP27 and chemotherapeutic treatment. 2. The effect of HSP27 inhibition on HSP27 secretion from primary colorectal cancer cell cultures. Extracellular level of HSP27 increased significantly when HT29 cells were treated with 5-FU, oxaliplatin and irinotecan, confirming the presence of HSP27 in the tumour microenvironment following chemotherapeutic treatment. Compared to HT29 cells, supernatant collected from ex-vivo cells contained a higher level of HSP27. In particular, supernatant from ex-vivo tumour cells contained a higher amount of HSP27 compared to normal cells (p>0.05). 3a. Characterisation of cell lines CT26 cells did not express HSP25 compared to control cell lines. As this synergic model (with BALB/c mice) was optimal for fluorescence imaging we opted to attempt to generate HSP25 expression in this cell line using plasmid transfection. Additional cell lines tested were found to express high levels of HSP25 compared to the control cell line (Panc1). The rat colon cancer cell line DHD/K12 had higher levels than the murine rectal cancer cell line (CMT93) despite the loading discrepancy (Figure 3) and was the preferred cell line to take into animal model after CT26. Figure 3: Western blot of cell lysate for HSP25 expression 3b. Generation of luminescent, HSP25-expressing clones for animal work CT26 cells were successfully transfected with pGL4.51[luc2/Neo] (Promega) to generate luciferase-expressing cells and underwent clonal selection. These cell lines were targeted for transfection with an HSP25-expressing plasmid to generate the 7 Bowel Disease Research Foundation of The Association of Coloproctology of Great Britain and Ireland Advancing the cure and treatment of bowel disease required phenotype. The HSP25 plasmid gifted from Dr Yong was provided without a complete sequence. The insert could not be amplified despite the use of three different primer pairs and the plasmid could not be propagated in E.coli. Further work with the plasmid was abandoned and a new commercial plasmid ordered from Amsbio with an HSP25 insert (see Table 2). This plasmid was available only with a Neomycin resistance cassette. The plasmid was amplified in E.coli and the insert was digested with restriction enzymes and ligated into an empty vector pMONO-zeo-mcs (InVivogen) with the required antibiotic resistance cassette (Zeocin). No appropriately sized product could be generated despite a variety of different ligation temperatures and enzyme concentrations. A third attempt to generate the cell line phenotype required was made by dual transfection of HSP25-expressing plasmid (Amsbio) with pSELECt-zeo-LucSh (InVivogen), an alternative luciferase-expressing plasmid with a Zeocin resistance cassette. Clones were successfully generated in each of three rounds of transfections and found to be highly luminescent, but unfortunately none of the clones expressed HSP25. The CT26-derived luminescent clones generated were utilised to successfully generate a murine orthotopic model of colorectal cancer and was found to be ideal for testing other drug treatments. An alternative cell line was selected for the HSP25 model based on results of the western blots of HSP25 expression. DHD/K12 cells were chosen which necessitated the use of BDIX rats for the host. DHD/K12 cells were naturally resistant to Neomycin on kill curve testing. They were successfully transfected with the pSELECt-zeo-LucSh plasmid (InVivogen) and underwent clonal selection in Zeocin. 4. Orthotopic model A total of 68 immune-competent BALB/c mice have undergone caecal implantation of the luminescent CT26 cell line with no peri-operative mortality or procedural complications. Total flux (photons/second) increased throughout the study period in all untreated mice (Figure 4) who developed tumours, with these mice having to be culled by the 21st post-operative day due to the development of symptoms related to disease burden, including weight loss, bowel obstruction and ascites. Primary tumours developed in 44 (65%) mice by 7 days post-implantation (Figure 6) and of these 9 (20%) developed liver metastases (Figure 5); no more than 2 metastases have been identified in a single mouse. Gross peritoneal disease developed in 7 (16%) of mice. This model has been used in the testing of various potential therapies relevant to the treatment of colorectal cancer. 8 Bowel Disease Research Foundation of The Association of Coloproctology of Great Britain and Ireland Advancing the cure and treatment of bowel disease Figure 4: IVIS imaging of mice after orthotopic injection of luminescent CT26 cells Figure 5: 3D imaging and ex-vivo assessment confirming the presence of liver mets Figure 6: Histology confirmed a poorly differentiated adenocarcinoma The transfected DHD/K12 cell line demonstrated insufficient luminescent signal for in vivo use, signal loss in rats is substantial due to their size. Further transfection, perhaps utilising an alternative technique such as electroporation or CRISPR, will need to be considered before in vitro findings can be translated into a murine model. 5. Immunohistochemistry Whole sections of human colorectal cancer tissue were used to verify staining before proceeding to the tissue microarrays. Staining was concentrated in the stromal inflammatory cells and background tumour staining was minimal. Seven sections of tissue microarray were successfully stained for both antibodies. Figure 7 shows matched samples stained for CD68 and CD206. 9 Bowel Disease Research Foundation of The Association of Coloproctology of Great Britain and Ireland Advancing the cure and treatment of bowel disease Cell counting and analysis of the samples are still ongoing. Results will be correlated with HSP27 expression in the same tissue. Figure 7: Aperio-captured images of matched colorectal cancer tissue from colorectal cancer micorarrays stained separately for CD68 and CD206. Conclusion In vitro studies using human cell lines have established that there is a direct relationship between cytostatic and cytotoxic stress brought about by chemotherapeutic agents and the production of intra- and extra- cellular HSP27 in 10 Bowel Disease Research Foundation of The Association of Coloproctology of Great Britain and Ireland Advancing the cure and treatment of bowel disease colorectal cancer cells. However, ex-vivo studies have suggested that this association is complex and may involve an individualised response. A more robust translational study should be conducted before moving targeting HSP27 in colorectal cancer patients into clinical practice. These findings are borne out by the lack of HSP25 expression in CT26 cells, despite the rapid growth and aggressive behaviour of this colorectal cancer cell line. Furthermore, HSP25 expression could not be generated in this cell line suggesting that HSP25-expressing cells grew less well than their native counterparts and were outcompeted. Despite the difficulties with generating HSP25-expressing CT26 cells, luminescent CT26 cell lines were successfully generated and were used to produce the first working colorectal orthotopic implantation model in the UK. This model has been used for testing of potential therapies for colorectal cancer, generating vital data to translate these projects into clinical trials. Further efforts to generate a murine model which can be used for testing anti-HSP27 drugs are ongoing and this second orthotopic, synergic rat model should open up additional routes for drug testing in the future. References (author, title, date of publication) 1. Jego G, Hazoume A, Seigneuric R, Garrido C. Targeting heat shock proteins in cancer. Cancer letters. 2010. 2. Ganachari N, Kaur P, Asea A. Role of Human and Mouse HspB1 in Metastasis. Current molecular medicine. 2012. 3. Tweedle EM, Khattak I, Ang CW, Nedjadi T, Jenkins R, Park BK, et al. Low molecular weight heat shock protein HSP27 is a prognostic indicator in rectal cancer but not colon cancer. Gut. 2010;59(11):1501-10. 4. Ang CW TE, Neoptolemos JP, Rooney PS, Costello E. Tumour heat shock protein (HSP)-27 expression as predictive factor of patient response to adjuvant 5-fluorouracil in Dukes’ C colorectal cancer. British Journal of Surgery. 2010;97(S2):83. 5. Dempsey NC, Leoni F, Ireland HE, Hoyle C, Williams JH. Differential heat shock protein localization in chronic lymphocytic leukemia. Journal of leukocyte biology. 2010;87(3):46776. PMCID: 2830125. 6. Banerjee S, Lin CF, Skinner KA, Schiffhauer LM, Peacock J, Hicks DG, et al. Heat shock protein 27 differentiates tolerogenic macrophages that may support human breast cancer progression. Cancer research. 2011;71(2):318-27. 7. Mantovani A, Allavena P, Sica A, Balkwill F. Cancer-related inflammation. Nature. 2008;454(7203):436-44. 8. de la Cruz-Merino L, Henao Carrasco F, Vicente Baz D, Nogales Fernandez E, Reina Zoilo JJ, Codes Manuel de Villena M, et al. Immune microenvironment in colorectal cancer: a new hallmark to change old paradigms. Clinical & developmental immunology. 2011;2011:174149. PMCID: 3226426. 9. Allavena P, Mantovani A. Immunology in the clinic review series; focus on cancer: tumourassociated macrophages: undisputed stars of the inflammatory tumour microenvironment. Clinical and experimental immunology. 2012;167(2):195-205. PMCID: 3278685. 10. Nagaraja GM, Kaur P, Neumann W, Asea EE, Bausero MA, Multhoff G, et al. Silencing Hsp25/Hsp27 gene expression augments proteasome activity and increases CD8+ T-cellmediated tumor killing and memory responses. Cancer Prev Res (Phila). 2012;5(1):122-37. 11 Bowel Disease Research Foundation of The Association of Coloproctology of Great Britain and Ireland Advancing the cure and treatment of bowel disease PMCID: 3252476. 11. Dempsey NC, Leoni F, Hoyle C, Williams JH. Analysis of heat-shock protein localisation using flow cytometry. Methods Mol Biol. 2011;787:155-64. 12. Sheah Lin Lee ND-H, Terry Wardle John Williams. Comparison of four HSPC1 inhibitors in colorectal cancer. European Surgical Society annual Meeting. 2012;Edinburgh. 12