Download Final Report - Bowel Disease Research Foundation

Bowel Disease Research Foundation
of The Association of Coloproctology of Great Britain and Ireland
Advancing the cure and treatment of bowel disease
Research Project Annual Report
Lead
investigator
Project Title
Professor John Williams Institution
Ms Elizabeth Tweedle
Targeting HSP27 in colorectal cancer
University of Chester
University of Liverpool
Start date
04/2013
08/2016
Lay
Summary
(max 500
words)
Background
Colorectal cancer is the second highest cause of cancer deaths in the UK. Heat shock
protein-27 (HSP27) protects stressed cells from undergoing cell death. We identified
that some rectal cancers have high levels of HSP27 in their cells and this correlates with
poor patient survival. Elevated HSP27 also predicts poor survival after chemotherapy in
patients with colon cancer. HSP27 is released by tumour cells into their
microenvironment and may reduce the ability of the patients’ immune cells to destroy
the tumour and protect cancer cells from chemotherapy.
Methods
We extracted human colorectal cancer cells from recently excised tumours and tested
their response to chemotherapy treatment with- and without- inhibiting HSP27
expression. We generated stable luminescent human and rodent colorectal cancer cells
which either expressed or did not express the HSP27 (or the rodent equivalent HSP25)
protein. We successfully implanted these cells into the colon of rodents in order to
develop a model for testing new anti-tumour drugs. Multiple (n=400) sections of
human colorectal cancer tissue were stained for two inflammatory cell types
surrounding the tumour (CD68 and CD206).
Results
Inhibiting HSP27 expression in primary human colorectal cells increased susceptibility
to the most commonly used chemotherapy agent (5FU). Tissue staining successfully
detected different numbers of immune cells in the environment of human cancer cells.
Correlation of the expression of HSP27 and the immune cell count in these tumours is
ongoing. The rodent animal models developed both primary and metastatic tumours
which were detectable by luminescent imaging. Drug testing in these animal models is
ongoing.
Survival from colorectal cancer is 50% overall. New treatments are required particularly
to target disease which cannot be treated by surgery alone. Various proteins,
expressed in the tumour cells or the tumour microenvironment, have been linked with
a worse prognosis in this disease. It is anticipated that drugs designed to stop
production of these proteins in the tumour cells will improve the survival of patients
with this condition.
Background
(purpose for
project)
Finish date
The purpose of this project was to develop reproducible and complimentary models of
1
Bowel Disease Research Foundation
of The Association of Coloproctology of Great Britain and Ireland
Advancing the cure and treatment of bowel disease
colorectal cancer in order to test new drugs for efficacy or improve the efficacy of
existing drugs. The first model used human cancer cells from recently excised tumours
to culture and test for drug response. A second model used rodents implanted with
luminescent tumour cells in the colon to track development and spread of the tumour
in a living system in order to test response to drug treatment.
Introduction
HSP27 may influence tumour behaviour in two ways depending on whether the protein
is inside or outside the cell. Intracellular HSP27 is an anti-apoptotic protein with several
modes of action including stabilisation of the actin cytoskeleton and mitochondrial
membrane and prevention of death receptor pathway activation (1). Elevated levels of
HSP27 have been found in a number of tumour types and have been shown to protect
against chemotherapy induced apoptosis, both in vitro and in murine models (2). We
independently produced evidence that elevated HSP27 may be responsible for poor
survival rates in colorectal cancer. Proteomic analysis at Liverpool identified elevated
HSP27 to be independently linked to poor prognosis in rectal cancer, findings which
were generated using samples from >700 colorectal cancer patients (3). Duke’s C colon
cancer patients with high HSP27 had a worse outcome following treatment with 5fluorouracil (5FU) (4). In vitro depletion of HSP27 using siRNA in 6 colorectal cancer cell
lines significantly increased rates of apoptosis in response to 5FU, oxaliplatin or
irinotecan (unpublished material Liverpool and Chester). Therefore elevated
intracellular HSP27 is anti-apoptotic and favours tumour cell survival.
HSP27 has also been detected in the extracellular environment. Secretion of HSP27 by
Chronic Lymphocytic Leukaemia cells has been identified in work done in Chester (5)
and has also been reported in breast cancer cells (6). Colorectal cancers show varying
degrees of desmoplastic stroma; secreted factors (including HSP27) may play a role in
development and maintenance of this stroma (7). One type of stromal response is
characterised by a ‘cytotoxic’ (CD8+) T lymphocytic and M1 type macrophage infiltrate
around the tumour margin and has been linked to tumour regression, inhibition of
metastases and good prognosis (8). Other forms of stromal responses are dominated
by a ‘suppressive’ (FOXP3+) T-reg and M2-type macrophage infiltrate and has been
associated with nodal metastases, angiogenesis, matrix remodelling and poor
prognosis (9). Exogenous HSP27 has been demonstrated to cause differentiation of
monocytes into anti-inflammatory (M2) macrophages which were capable of inducing
immune-tolerance in T cells (6). In murine models, breast tumours depleted of HSP25
(the murine equivalent of HSP27) had higher levels of cytotoxic CD8+ T lymphocyte
infiltrate and displayed tumour regression (10). Therefore, elevated extracellular HSP27
may promote a microenvironment conducive to tumour growth and metastasis.
Phase 2 trials of the HSP27-inhibiting drug OGX-427 are currently recruiting patients
with metastatic urothelial and prostate cancer. It is vital to establish whether this
exciting new treatment could be of benefit to colorectal cancer patients. Our in vivo
and in vitro work at Liverpool and Chester has already shown the importance of
intracellular HSP27 in colorectal cancer prognosis. We have also shown that HSP27 can
2
Bowel Disease Research Foundation
of The Association of Coloproctology of Great Britain and Ireland
Advancing the cure and treatment of bowel disease
be secreted from tumour cells. Further evidence, from primary cell culture and murine
models, was sought that HSP27 inhibition increases sensitivity to chemotherapeutics
and induces a beneficial immune response in the tumour microenvironment.
Methods
Primary cell culture
Fresh colorectal cancer tissue was collected from consented patients undergoing
surgery at the Countess of Chester Hospital. Epithelial cells from each specimen were
cultured to generate primary tumour cell populations. The resulting cancer cell
population were separated according to HSP27 expression by Fluorescence-Activated
Cell Sorting (FACS) using an established protocol (11). Baseline apoptosis (annexinV/propidium iodide) and proliferation (MTS assay) were performed. Apoptosis in
response to chemotherapy agents (5FU, oxaliplatin and irinotecan) were correlated
with HSP27 expression. The assays were repeated following both siRNA and drug
inhibition of HSP27 using OGX-427 (OncoGenex Pharmaceuticals). OGX-427 was used
alone and in combination with chemotherapy agents and synergistic HSP90 inhibition
(17-AAG, 17-DMAG).(12) Intracellular and secreted HSP27 was quantified by ELISA in
human colorectal cancer cell lines (HT29, SW837, HRT-18, SW480, HCT116) and in the
primary tumour culture populations generated. The effect of inhibiting HSP27 using
specific siRNA or OGX-427 on this secretion was quantified.
Cell culture and cell lysate production
CT26 murine cells were obtained from the American Type Culture Collection, ATCC.
CMT93 murine and DHD/K12 rat cell lines were obtained from the UK National Cell
Culture Collection. Cells were routinely maintained in 75 cm2 tissue culture flasks at
37°C with 5% supplemental CO2 and sub-cultured every 3-4 days, when confluency
reached approximately 80-90%. Cell lysates were prepared by incubating cells on ice in
RIPA buffer (50mM Tris-Cl Ph 7.5-8.0,150mM NaCl, 1% Triton X-100, 0.5% Nadeoxycholate, 0.1% SDS). Samples were sonicated then collected by centrifugation at
4°C for 10 min, with the consequent supernatant analysed by BCATM Protein Assay kit
(ThermoFisher Scientific) for protein concentration estimation.
Western blotting
Cell lysate was mixed with 1 x sample loading buffer (62.5 mM Tris-HCl pH 6.8, 2.5 %
SDS, 0.002 % Bromophenol Blue, 0.7135 M (5%) β-mercaptoethanol, 10 % glycerol).
The mixtures were then heated at 95°C for 10 min for protein denaturation.
Each well of a precast 86x67mm polyacrylamide gels from Biorad (Any kD™ MiniPROTEAN® TGX™) was loaded with 20µg of protein alongside a pre-stained molecular
weight ladder (PageRuler™ 10 to 180 kDa; ThermoFisher Scientific). Gels were
subjected to 160mA for 20-30 minutes. The stacking gel was removed and the proteins
in the resolving gel transferred onto a pre-cut polyvinylidene fluoride membrane using
Trans-blot Turbo Transfer system (Biorad). Following the transfer procedure, the
membrane was removed and washed in warm phosphate buffered saline tween (PBST)
solution repeated twice each for 5 minutes. The membrane was then blocked using 5 %
blocking milk TBST solution for 60 min. The primary antibody in 5% milk was added for
3
Bowel Disease Research Foundation
of The Association of Coloproctology of Great Britain and Ireland
Advancing the cure and treatment of bowel disease
60 min at room temperature according to the concentrations in Table 1.
Antibody
Company
Anti-HSP27 F4 mouse monoclonal antibody Santa Cruz (sc-13132)
Anti-HSP27 M-20 rabbit polyclonal antibody Santa Cruz (sc-1049)
Anti-GAPDH rabbit polyclonal antibody
Abcam (ab9485)
Anti-β-Actin mouse monoclonal antibody
Sigma Aldrich (A5441)
Table 1. Dilutions of antibodies used for Western blotting
Conc
1:5000
1:100
1:2000
1:10000
Following incubation with primary antibody, the membrane was washed with PBST and
the secondary horseradish peroxidase-linked antibody applied (dilution 1:2000, in 5%
milk PBST solution) for 60 minutes. ECL Reagent Plus was applied to the membrane for
5 minutes and the blots were developed using x-ray film for variable durations in a dark
room. Membranes were stripped of antibody using Restore™ Western Blot Stripping
Buffer (ThermoFisher Scientific) at 75°C for 30 minutes. Loading control was assessed
by re-probing with anti-β-actin or Glyceraldehyde-3-Phosphate Dehydrogenase
(GAPDH) antibodies as above.
Generation of plasmid
An HSP25-expressing plasmid was gifted from Dr Yong Lee (Department of Radiation
Oncology, William Beaumont Hospital, Royal Oak, MI, USA), the sequence of the insert
was given in Figure 1. Three sets of primers were designed to amplify the sequence for
insertion into a donor plasmid (pMONO-zeo-mcs; InvivoGen).
GATATCAACGTTGGCGCGCCGGTACCCGGTCCGGAATTCCCGGGATATCGTCGACCCACGCGTCCGCCCACGCGTC
CGGCACGCTGGGGCTCCAGTCCGGCACTTCTCGGATCCTCAGCCCAGTGCTTCTAGATCCTCAGCCTTGACCAGCC
AAGAACATGACCGAGCGCCGCGTGCCCTTCTCGCTGCTGCGGAGCCCGAGCTGGGAACCATTCCGGGACTGGTAC
CCTGCACACAGCCGCCTCTTCGATCAAGCTTTCGGGGTGCCCCGGTTGCCCGATGAGTGGTCGCAGTGGTTCAGCG
CCGCTGGGTGGCCCGGATACGTGCGCCCGCTGCCCGCCGCGACCGCCGAGGGCCCCGCGGCGGTGACCCTGGCC
GCACCAGCCTTCAGCCGAGCGCTCAACCGACAGCTCAGCAGCGGGGTCTCGGAGATCCGACAGACGGCTGATCGC
TGGCGCGTGTCCCTGGACGTCAACCACTTCGCTCCGGAGGAGCTCACAGTGAAGACCAAGGAAGGCGTGGTGGA
GATCACTGGCAAGCACGAAGAAAGGCAGGACGAACATGGCTACATCTCTCGGTGCTTCACCCGGAAATACACGCT
CCCTCCAGGTGTGGACCCCACCCTAGTGTCCTCTTCCCTATCCCCTGAGGGCACACTTACCGTGGAGGCTCCGTTGC
CCAAAGCAGTCACGCAGTCAGCGGAGATCACCATTCCGGTTACTTTCGAGGCCCGCGCCCAAATTGGGGGCCCAG
AAGCTGGGAAGTCTGAACAGTCTGGAGCCAAGTAGAAGCCATCAGCCTGCTGCCTATCTCCCATAGCCATTGCTGG
CCACCCCTCTCTGTCAATCTGTGCGCTCTTTTGATACATACATTTACCTGCTGTTTTTCTCAAATAAAAGTTGCAAGCT
ACTGCTCACCACAAAAAAAAAAAAAAAAAAAAGGGCGGCCGCTCTAGAGTATCCCTCGAGTGATCAGATCCACGC
GTATCGATTGTCGACCCTAGG
Figure 1: Sequence of the HSP25 insert (phsp6 plasmid)
PCR reactions were performed in 50µL volumes with final concentrations 1xPCR Buffer,
deoxynucleotide Mix 200 µM, Forward primer 0.1-0.5 µM, Reverse primer 0.1-0.5 µM,
AmpliTaq Gold® DNA Polymerase (Applied Biosystems) 0.05 units/µL, plasmid DNA
200pg/µL, MgCl2 0.1-0.5mM. Amplification was performed as follows: denature 94°C
for 1 min, annealing 55-68°C for 2 min, extension 72 °C for 3 min; total of 30 cycles.
PCR product was visualised using a 2% agarose gel impregnated with GelRed nucleic
acid stain under UV light.
4
Bowel Disease Research Foundation
of The Association of Coloproctology of Great Britain and Ireland
Advancing the cure and treatment of bowel disease
Antibiotic kill curves
Cells were plated into 96 well plates at a density of 2, 000 cells per well and allowed to
grow to 70-80% confluence. Graded concentrations of Geneticin® (ThermoFisher) and
ZeocinTM (InvivoGen) antibiotics were applied from 0-1000µg/ml for 2 weeks with
exchange of media every 48 hours. Cell death was ascertained using light microscopy
and functional MTS Assay Kit (EZ4U) according to the manufacturer’s instructions.
Briefly, 2.5 mL of activator was added to the substrate. Then, 20µL of the mixture was
added into each well. The plates were then immediately read at 450 nm with the
biophotometer machine to determine the 0 hour readings. The plates were
subsequently read every hour for 4-5 hours. The concentration of antibiotic required to
produce 100% cell death after 5 days was utilised for selection of plasmid integration.
Generation of stable cell lines using plasmid transfection
Cells were transfected using Lipofectamine 2000 (Invitrogen, Paisley, UK) at three DNA:
lipofectamine ratios according to the manufacturer’s protocol. Briefly, cells were plated
at a density of 1 × 106 cells per 6 well plate and grown for 24 hours. Cells were placed
in serum- and antibiotic-free medium and transfected with 2.5μg of plasmid per well in
duplicate. Media was exchanged after 12 hours. At 48 hours cells were selected for
integration of coding sequences by treating with G418 (400μg/mL; Invitrogen, Paisley,
UK) for two weeks or ZeocinTM (100µg/ml; Invivogen).
Plasmid
pGL4.17[luc2/Neo]
phsp6
pMONO-zeo-mcs
pSELECt-zeo-LucSh
pCMV6-Kan/Neo
Encodes
Luciferase
HSP25
EMPTY
Luciferase
HSPB1 (untagged)- mouse
heat shock protein 25
Antibiotic
Neomycin
Neomycin
Zeocin
Zeocin
Neomycin
Company
Promega (E6721)
Gifted from Yong Lee
Invivogen (#pmonoz-mcs)
Invivogen (#psetz-lucsh)
Amsbio (MC203704)
Table 2. Characteristics of the plasmids used in the study.
Single colonies were separated into 96-well plates using serial dilution and expanded
into 75cm2 flasks. Positive clones were identified using western blot for HSP25
expression as previously described or a luciferase assay as follows. Briefly, cells were
harvested in 50μL 1 × Glo Lysis buffer (Promega, Southampton, UK) and assayed for
luciferase activity according to the manufacturer’s instructions using a plate reader
(PerkinElmer, Bucks, UK). Each clone was assayed in triplicate and experiments were
repeated at least three times.
Generation of orthotopic, synergic rodent models of colorectal cancer and metastasis
Six to eight week old male BALB/cAnNCrl mice (Charles River laboratories, Margate,
UK) were anaesthetised and injected with a suspension of luminescent CT26 cells
(5x105 cells in 50µl of the 50% PBS / 50% Matrigel) into the caecal submucosa following
laparotomy. Bioluminescent imaging was completed up to three times weekly using
the IVIS® Spectrum in vivo imaging system (Perkin-Elmer, Massachusetts, USA). Primary
5
Bowel Disease Research Foundation
of The Association of Coloproctology of Great Britain and Ireland
Advancing the cure and treatment of bowel disease
tumour uptake and growth rates were assessed, as was the frequency of metastatic
disease. Study end-points were established, with mice sacrificed if the severity limits of
the project licence were reached, usually due to bowel obstruction.
Figure 2: Technique for the orthtopic injection of cells
Immunohistochemistry (IHC) of human paraffin-embedded tissue
Staining of a colorectal tissue microarray was undertaken as follows; 5µm thick
sections of the array were deparaffinised, rehydrated and subject to antigen retrieval
using a PT link (DAKO, UK). Slides were incubated for 10 minutes in peroxidase block
(Envsion; Dako, UK) and rinsed in TBS. Primary antibodies were diluted in Chemomate
(Dako, UK) and applied to slides for 60 min at room temperature or overnight at 4°C,
for details see table 3. These slides were then rinsed in TBS and visualisation achieved
by incubating with a horseradish peroxidase conjugated secondary antibody for 30 min
followed by diaminobenzidine for 10 min. Negative controls were incubated with
conjugated secondary antibody only. Slides were counterstained with haematoxylin for
30s and coverslips mounted with DPX mountant, (BDH).
Antibody
Animal
Concentration
Company
Anti-CD68
Mouse
1:200
Dako (0876)
Anti-CD206
Mouse
1:200
Abcam (Ab117644)
Table 3: Primary antibodies used for immunohistochemistry
Results and
discussion
1. The effect of HSP27 inhibition on chemotherapy-induced apoptosis in primary
colorectal cancer cell cultures.
The intracellular level of HSP27 increased significantly (p<0.001) after HT29 cells were
treated with 5-FU, oxaliplatin, irinotecan and HSP90 inhibitors, confirming the
hypothesis that colorectal cancer cell increase expression of HSP27 in response to a
stressed cellular environment caused by cytotoxic and cytostatic agents. In HT29 cells,
silencing HSP27 prior to addition of 5-FU and oxaliplatin significantly (p>0.05) enhanced
their cytostatic and cytotoxic effect. However, this effect was not observed for
irinotecan. Collectively, these findings suggested that the cytoprotective effect of
HSP27 may be specific to the type of chemotherapy employed. Further elucidation of
the protective mechanism conferred by HSP27 is needed to understand its selectivity.
6
Bowel Disease Research Foundation
of The Association of Coloproctology of Great Britain and Ireland
Advancing the cure and treatment of bowel disease
When ex-vivo specimens were treated with HSP27 inhibitors, intracellular HSP27 did
not increase as expected. By contrast, out of the five ex-vivo specimens treated with
HSP90 inhibitors that were analysed, two normal samples displayed significant changes
in the level of HSP27, whereas none of the cancerous sample showed changes in
HSP27. There was no association between a positive response to the HSP27 inhibitor
and the level of intracellular HSP27, although this may be a reflection of individualised
heat shock response to HSP27 inhibitors. A larger number of specimens will be needed
to better understand the association between HSP27 and chemotherapeutic
treatment.
2. The effect of HSP27 inhibition on HSP27 secretion from primary colorectal cancer
cell cultures.
Extracellular level of HSP27 increased significantly when HT29 cells were treated with
5-FU, oxaliplatin and irinotecan, confirming the presence of HSP27 in the tumour
microenvironment following chemotherapeutic treatment. Compared to HT29 cells,
supernatant collected from ex-vivo cells contained a higher level of HSP27. In
particular, supernatant from ex-vivo tumour cells contained a higher amount of HSP27
compared to normal cells (p>0.05).
3a. Characterisation of cell lines
CT26 cells did not express HSP25 compared to control cell lines. As this synergic model
(with BALB/c mice) was optimal for fluorescence imaging we opted to attempt to
generate HSP25 expression in this cell line using plasmid transfection.
Additional cell lines tested were
found to express high levels of
HSP25 compared to the control cell
line (Panc1). The rat colon cancer
cell line DHD/K12 had higher levels
than the murine rectal cancer cell
line (CMT93) despite the loading
discrepancy (Figure 3) and was the
preferred cell line to take into
animal model after CT26.
Figure 3: Western blot of cell lysate for HSP25 expression
3b. Generation of luminescent, HSP25-expressing clones for animal work
CT26 cells were successfully transfected with pGL4.51[luc2/Neo] (Promega) to
generate luciferase-expressing cells and underwent clonal selection. These cell lines
were targeted for transfection with an HSP25-expressing plasmid to generate the
7
Bowel Disease Research Foundation
of The Association of Coloproctology of Great Britain and Ireland
Advancing the cure and treatment of bowel disease
required phenotype.
The HSP25 plasmid gifted from Dr Yong was provided without a complete sequence.
The insert could not be amplified despite the use of three different primer pairs and
the plasmid could not be propagated in E.coli. Further work with the plasmid was
abandoned and a new commercial plasmid ordered from Amsbio with an HSP25 insert
(see Table 2). This plasmid was available only with a Neomycin resistance cassette.
The plasmid was amplified in E.coli and the insert was digested with restriction
enzymes and ligated into an empty vector pMONO-zeo-mcs (InVivogen) with the
required antibiotic resistance cassette (Zeocin). No appropriately sized product could
be generated despite a variety of different ligation temperatures and enzyme
concentrations.
A third attempt to generate the cell line phenotype required was made by dual
transfection of HSP25-expressing plasmid (Amsbio) with pSELECt-zeo-LucSh
(InVivogen), an alternative luciferase-expressing plasmid with a Zeocin resistance
cassette. Clones were successfully generated in each of three rounds of transfections
and found to be highly luminescent, but unfortunately none of the clones expressed
HSP25.
The CT26-derived luminescent clones generated were utilised to successfully generate
a murine orthotopic model of colorectal cancer and was found to be ideal for testing
other drug treatments.
An alternative cell line was selected for the HSP25 model based on results of the
western blots of HSP25 expression. DHD/K12 cells were chosen which necessitated the
use of BDIX rats for the host. DHD/K12 cells were naturally resistant to Neomycin on
kill curve testing. They were successfully transfected with the pSELECt-zeo-LucSh
plasmid (InVivogen) and underwent clonal selection in Zeocin.
4. Orthotopic model
A total of 68 immune-competent BALB/c mice have undergone caecal implantation of
the luminescent CT26 cell line with no peri-operative mortality or procedural
complications. Total flux (photons/second) increased throughout the study period in all
untreated mice (Figure 4) who developed tumours, with these mice having to be culled
by the 21st post-operative day due to the development of symptoms related to disease
burden, including weight loss, bowel obstruction and ascites. Primary tumours
developed in 44 (65%) mice by 7 days post-implantation (Figure 6) and of these 9 (20%)
developed liver metastases (Figure 5); no more than 2 metastases have been identified
in a single mouse. Gross peritoneal disease developed in 7 (16%) of mice. This model
has been used in the testing of various potential therapies relevant to the treatment of
colorectal cancer.
8
Bowel Disease Research Foundation
of The Association of Coloproctology of Great Britain and Ireland
Advancing the cure and treatment of bowel disease
Figure 4: IVIS imaging of mice after orthotopic injection of luminescent CT26 cells
Figure 5: 3D imaging and ex-vivo assessment confirming the presence of liver mets
Figure 6: Histology confirmed a poorly differentiated adenocarcinoma
The transfected DHD/K12 cell line demonstrated insufficient luminescent signal for in
vivo use, signal loss in rats is substantial due to their size. Further transfection, perhaps
utilising an alternative technique such as electroporation or CRISPR, will need to be
considered before in vitro findings can be translated into a murine model.
5. Immunohistochemistry
Whole sections of human colorectal cancer tissue were used to verify staining before
proceeding to the tissue microarrays. Staining was concentrated in the stromal
inflammatory cells and background tumour staining was minimal. Seven sections of
tissue microarray were successfully stained for both antibodies. Figure 7 shows
matched samples stained for CD68 and CD206.
9
Bowel Disease Research Foundation
of The Association of Coloproctology of Great Britain and Ireland
Advancing the cure and treatment of bowel disease
Cell counting and analysis of the samples are still ongoing. Results will be correlated
with HSP27 expression in the same tissue.
Figure 7: Aperio-captured images of matched colorectal cancer tissue from colorectal
cancer micorarrays stained separately for CD68 and CD206.
Conclusion
In vitro studies using human cell lines have established that there is a direct
relationship between cytostatic and cytotoxic stress brought about by
chemotherapeutic agents and the production of intra- and extra- cellular HSP27 in
10
Bowel Disease Research Foundation
of The Association of Coloproctology of Great Britain and Ireland
Advancing the cure and treatment of bowel disease
colorectal cancer cells. However, ex-vivo studies have suggested that this association is
complex and may involve an individualised response. A more robust translational study
should be conducted before moving targeting HSP27 in colorectal cancer patients into
clinical practice. These findings are borne out by the lack of HSP25 expression in CT26
cells, despite the rapid growth and aggressive behaviour of this colorectal cancer cell
line. Furthermore, HSP25 expression could not be generated in this cell line suggesting
that HSP25-expressing cells grew less well than their native counterparts and were outcompeted.
Despite the difficulties with generating HSP25-expressing CT26 cells, luminescent CT26
cell lines were successfully generated and were used to produce the first working
colorectal orthotopic implantation model in the UK. This model has been used for
testing of potential therapies for colorectal cancer, generating vital data to translate
these projects into clinical trials.
Further efforts to generate a murine model which can be used for testing anti-HSP27
drugs are ongoing and this second orthotopic, synergic rat model should open up
additional routes for drug testing in the future.
References
(author,
title, date of
publication)
1. Jego G, Hazoume A, Seigneuric R, Garrido C. Targeting heat shock proteins in cancer. Cancer
letters. 2010.
2. Ganachari N, Kaur P, Asea A. Role of Human and Mouse HspB1 in Metastasis. Current
molecular medicine. 2012.
3. Tweedle EM, Khattak I, Ang CW, Nedjadi T, Jenkins R, Park BK, et al. Low molecular weight
heat shock protein HSP27 is a prognostic indicator in rectal cancer but not colon cancer.
Gut. 2010;59(11):1501-10.
4. Ang CW TE, Neoptolemos JP, Rooney PS, Costello E. Tumour heat shock protein (HSP)-27
expression as predictive factor of patient response to adjuvant 5-fluorouracil in Dukes’ C
colorectal cancer. British Journal of Surgery. 2010;97(S2):83.
5. Dempsey NC, Leoni F, Ireland HE, Hoyle C, Williams JH. Differential heat shock protein
localization in chronic lymphocytic leukemia. Journal of leukocyte biology. 2010;87(3):46776. PMCID: 2830125.
6. Banerjee S, Lin CF, Skinner KA, Schiffhauer LM, Peacock J, Hicks DG, et al. Heat shock
protein 27 differentiates tolerogenic macrophages that may support human breast cancer
progression. Cancer research. 2011;71(2):318-27.
7. Mantovani A, Allavena P, Sica A, Balkwill F. Cancer-related inflammation. Nature.
2008;454(7203):436-44.
8. de la Cruz-Merino L, Henao Carrasco F, Vicente Baz D, Nogales Fernandez E, Reina Zoilo JJ,
Codes Manuel de Villena M, et al. Immune microenvironment in colorectal cancer: a new
hallmark to change old paradigms. Clinical & developmental immunology.
2011;2011:174149. PMCID: 3226426.
9. Allavena P, Mantovani A. Immunology in the clinic review series; focus on cancer: tumourassociated macrophages: undisputed stars of the inflammatory tumour microenvironment.
Clinical and experimental immunology. 2012;167(2):195-205. PMCID: 3278685.
10. Nagaraja GM, Kaur P, Neumann W, Asea EE, Bausero MA, Multhoff G, et al. Silencing
Hsp25/Hsp27 gene expression augments proteasome activity and increases CD8+ T-cellmediated tumor killing and memory responses. Cancer Prev Res (Phila). 2012;5(1):122-37.
11
Bowel Disease Research Foundation
of The Association of Coloproctology of Great Britain and Ireland
Advancing the cure and treatment of bowel disease
PMCID: 3252476.
11. Dempsey NC, Leoni F, Hoyle C, Williams JH. Analysis of heat-shock protein localisation using
flow cytometry. Methods Mol Biol. 2011;787:155-64.
12. Sheah Lin Lee ND-H, Terry Wardle John Williams. Comparison of four HSPC1 inhibitors in
colorectal cancer. European Surgical Society annual Meeting. 2012;Edinburgh.
12