* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download transformation - susanpittinaro
Survey
Document related concepts
Transcript
Biotechnology A Brave New World TACGCACATTTACGTACGCGGATGCCGCGACTA TGATCACATAGACATGCTGTCAGCTCTAGTAGA human genome CTAGCTGACTCGACTAGCATGATCGATCAGCTA 3.2 billion bases CATGCTAGCACACYCGTACATCGATCCTGACAT ~30,000 genes CGACCTGCTCGTACATGCTACTAGCTACTGACT CATGATCCAGATCACTGAAACCCTAGATCGGGT ACCTATTACAGTACGATCATCCGATCAGATCAT GCTAGTACATCGATCGATACTGCTACTGATCTA GCTCAATCAAACTCTTTTTGCATCATGATACTA GACTAGCTGACTGATCATGACTCTGATCCCGTA GATCGGGTACCTATTACAGTACGATCATCCGAT CAGATCATGCTAGTACATCGATCGATACTGCTA Biotechnology Genetic engineering ◦ Manipulation of DNA ◦ If you are going to engineer DNA, genes, & organisms, then you will need a set of tools to work with Bacteria Bacteria review ◦ One-celled prokaryotes ◦ Reproduce by mitosis Binary fission ◦ Rapid growth Generation every ~20 minutes 108 (100 million) colony population overnight ◦ Dominant form of life on Earth ◦ Incredibly diverse Bacterial genome Single, circular chromosome ◦ Haploid ◦ Naked DNA No histone proteins ◦ ~4 million base pairs ~4300 genes 1/1000 DNA in eukaryotes How have these little guys gotten to be so diverse?? Transformation Bacteria are opportunists ◦ Pick up naked foreign DNA wherever it may be hanging out mix heat-killed pathogenic & non-pathogenic bacteria Have surface transport proteins that are specialized for the uptake of naked DNA ◦ Import bits of chromosomes from other bacteria ◦ Incorporate the DNA bits into their own chromosome mice die Express new genes Called transformation A form of genomic recombination Plasmids Small supplemental circles of DNA 5000 – 20,000 base pairs Self-replicating ◦ Carry extra genes 2 – 30 genes Genes for antibiotic resistance ◦ Can be exchanged between bacteria Bacterial sex! Rapid evolution ◦ Can be imported from the environment How can plasmids help us? A way to get genes into bacteria easily ◦ Insert new gene into plasmid ◦ Insert plasmid into bacteria = vector ◦ Bacteria now expressed new gene! Bacteria will make the new protein gene from other organism cut DNA plasmid recombinant plasmid + vector glue DNA transformed bacteria Biotechnology Plasmids used to insert new genes into bacteria cut DNA gene we want like what? …insulin …HGH …lactase cut plasmid DNA Cut DNA? Need DNA scissors? ligase recombinant plasmid insert “gene we want” into plasmid... “glue” together How do we cut DNA? Restriction enzymes ◦ Restriction endonucleases Discovered in 1960s ◦ Evolved in bacteria to cut up foreign DNA “Restrict” the action of the attacking organism Protection against viruses & other bacteria Bacteria protect their own DNA by methylation & by not using the base sequences recognized by the enzymes in their own DNA d d What do you notice about these phrases? Radar palindromes Racecar Madam I’m Adam A man, a plan, a canal, Panama Was it a bar or a bat I saw? Taco cat Action of enzyme CTGAATTCCG GACTTAAGGC Restriction enzymes ◦ Cut DNA at specific sequences Restriction site ◦ Symmetrical palindrome ◦ Produces protruding ends CTG|AATTCCG GACTTAA|GGC Sticky ends Will bind to any complementary DNA Many different enzymes ◦ Named after organism they are found in EcoRI, HindIII, BamHI, SmaI Restriction enzymes 1st restriction enzyme found = EcoRI ◦ Found in E. coli Werner Arber Daniel Nathans Hamilton O. Smith Restriction enzymes Cut DNA at specific sites ◦ Leave “sticky ends” restriction enzyme cut site GTAACGAATTCACGCTT CATTGCTTAAGTGCGAA restriction enzyme cut site GTAACG AATTCACGCTT CATTGCTTAA GTGCGAA sticky ends Sticky ends Cut other DNA with same enzyme ◦ Leave “sticky ends” on both ◦ Can glue DNA together at “sticky ends” GTAACG AATTCACGCTT CATTGCTTAA GTGCGAA gene you want GGACCTG AATTCCGGATA CCTGGACTTAA GGCCTAT chromosome want to add gene to = GGACCTG Glue AATTCACGCTT ligase GTGCGAA CCTGGACTTAA combined DNA Sticky ends help glue genes together cut sites gene you want cut sites TTGTAACGAATTCTACGAATGGTTACATCGCCGAATTCACGCTT AACATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGTGCGAA AATTCTACGAATGGTTACATCGCCG sticky ends GATGCTTACCAATGTAGCGGCTTAA cut sites isolated gene chromosome want to add gene to TCAACGCTTTAACG AATTCTACGATCCCGGATCTT AGTTGCGAAATTGCTTAA GATGCTAGGGCCTAGAA DNA ligase joins the strands sticky ends stick together Recombinant DNA molecule chromosome with new gene added TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATC CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC Why mix genes together? How can bacteria read human DNA? Gene produces specified protein in different organism (i.e. bacteria) human insulin gene in bacteria TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATC CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC “new” protein from organism ex: human insulin from bacteria aa aa aa aa aa aa aa aa aa aa bacteria human insulin The code is universal Since all living organsims … ◦ Use the same DNA ◦ Codons code for the same amino acids ◦ Create the same polypeptide chains ◦ Read their genes the same way Copy (& read) DNA Transformation ◦ Insert recombinant plasmid into bacteria ◦ Grow recombinant bacteria in agar cultures Bacteria make lots of copies of plasmid “cloning” the plasmid ◦ Production of many copies of inserted gene ◦ Production of “new” protein Transformed phenotype DNA RNA protein trait Want more protein? Grow more bacteria gene from other organism recombinant plasmid + vector plasmid grow bacteria harvest (purify) protein transformed bacteria Uses of genetic engineering Genetically modified organisms (GMO) ◦ Enabling plants to produce new proteins Protect crops from insects: BT corn Corn produces a bacterial toxin that kills corn borer (caterpillar pest) Extending growing season: fishberries Strawberries with an anti-freeze gene from flounder Improve quality of food: golden rice Rice enriched with beta-carotene, which is converted into vitamin A (improved nutritional value) Green with envy? Jelly fish “GFP” Cells from these specimens are used to study transplants & grafts Transformed vertebrates Factor-IX Sheep Sheep produce human clotting factors in their milk Used in treatment for hemophilia The ethical debate of GMO crops Benefits ◦ Increased crop yields ◦ Crops can be grown in harsher environments Salt-resistant tomatoes ◦ Decreased needs for pesticides ◦ Nutrient-enhanced crops Potential harms ◦ Genetic pollution through fertilization Pollen Monsanto ◦ Unknown health risks ◦ Potential hybridization with other species Gene therapy A virus vector is used to insert the recombinant plasmid into the genes of affected cells The virus is chosen and designed to target only those specific cells Clones A group of genetically identical organisms A group of cells derived from a single parent cell Monozygotic twins are naturally occurring clones ◦ Why do appear different as they age? ◦ Epigenetics Plant cuttings are clones Asexual reproduction results in clones Reproductive cloning Remove a differentiated diploid nucleus from individual to be cloned Enucleate a donor egg cell ◦ Remove nucleus Insert the diploid nucleus into the enucleated cell Implant into the endometrium of a surrogate & gestate Newborn will be genetically identical to the parent that donated the diploid nucleus Called nuclear transfer Dolly the sheep First successful cloning of a mammal from a differentiated somatic cell She was the result of many attempts ◦ 277 attempts (276 failures) She died young ◦ Age-related illnesses Severe arthritis & progressive lung disease Had shortened telomers Human reproductive cloning is illegal Therapeutic cloning Remove a differentiated diploid nucleus from the cell to be cloned Enucleate a donor egg cell Insert the diploid nucleus into the enucleated cell Stimulate it to divide & grow in vitro Resulting blastocyst is a rich source of stem cells Outer layer is removed, so only inner cell mass is used to culture tissues Uses for therapeutic cloning Create stem cells for transplants ◦ Burn patients ◦ Leukemia Replace damaged tissues ◦ Nerves ◦ Pancreatic cells Significantly reduced risk of rejection of cells that are genetically identical to the recipient Ethics of therapeutic cloning In favor ◦ Stem cells can be created without the destruction of human embryos ◦ Decreased risk of transplant rejection ◦ Transplants don’t require the death of another person ◦ Embryos are not allowed to develop to point where a nervous system forms First organ to form in embryo development Against ◦ Religious/moral objections “playing God” ◦ Embryo could be used in IVF Develop into a fetus Are we destroying a life? ◦ Even though illegal, potential attempts to clone first human Any Questions??