Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Transcriptome analysis of the TnrA regulon in Bacillus subtilis Hanne Jarmer Center for Biological Sequence analysis Technical University of Denmark Bacillus subtilis • Bacillus means rod-shaped bacteria. The rod in the gut was Bacillus coli and the rod found in rotting hay was Bacillus subtilis • Louis Pasteur used heat-attenuated Bacillus anthracis as the first anti-bacterial vaccine • Subtilis means: highly sensitive – weak – mild (subtle) • Soil bacteria typically found in association with plants Bacillus subtilis • B. subtilis has been used for studying different systems: gene regulation, metabolism and differentiation • The second most extensively studied bacteria • The first to be transformed in the laboratory. This process was optimized by Anagnostopoulos and Spizizen in 1961 Bacillus subtilis • Fully sequenced and has around 4,225 predicted genes (SubtiList, R16.1) • Non-hasardous • Easy to grow and manipulate genetically • Sporulates • Secretes proteins • Of extensive interest to industry Glutamine synthetase NH4+ + glutamate glutamine Access to nitrogen through alternative pathways gltAB gabP nasA pucR ykzB-ykoL nasABCDEF nrgAB ansZ ycs-kip pucABCDE glnR glnA GlnA Glutamine Synthetase GlnR TnrA tnrA ureA ureB ureC NH4/glutamate wildtype versus wildtype in different media Allantoin Glutamate Glutamine TnrA GlnA wildtype versus mutant in the same medium GlnR NH2 Out In H Adenine N N H N Purine catabolism N H H2O Adenine deaminase (adeC) NH3 O N HN H O H2O2 HN In O N H In In H Uric acid N O N H CO2 Guanine In H N N H Out pbuG 2NH3 + CO2 Urease (ureABC) PucR H2O Urea Glyoxylic acid O OH H2N + O O NH2 H Pathway specific regulator of purine catabolism H2N O Allantoin permease (pucI) NH2 H Allantoin N H2N O N H O N H H O2 Allantoinase (pucH) O Out H2O N HN H2O2 O Allantoin permease (pucI) NH3 O2 Uricase (pucLM) Uric acid permease (pucJK) Out Guanine deaminase (gde) N H ALLANTOIN O Xanthine O2 Xanthine dehydrogenase (pucABCDE) O Out pbuG O2 Xanthine dehydrogenase (pucABCDE) H N H Xanthine permease (pbuX) Out TnrA N H N HN In In H N O Out Hypoxanthine Ureidoglycolase (pucG) CO2 Ureidoglycine Ureidoglycolic acid Allantoic acid O OH O OH Allantoate Allantoate NH2 HN amidohydrolase (pucF) 2 amidohydrolase (pucF) H2N OH N H N H H O H O NH +CO 3 2 2 O N H NH2 H O 2 H NH3 O N H OH REFERENCE SAMPLE mRNA mRNA cDNA cDNA Cy5-cDNA Cy3-cDNA B. subtilis microarrays • PCR products from ~97% of all genes • spotted onto poly-L-lysine coated glass microscope slides using a 16-pin microarrayer • Hybridized to Cy3 and Cy5 labeled first-strand cDNAs • Scanned NUMBERS: 2 different growth experiments 3 hybridizations (arrays) per culture 2 spots per gene on each array 2x3x2= 12 intensities for each gene Normalization .... is it worth it? RESULT: 6 lists Allantoin: 132 Glutamine: 60 Glutamate: 91 TnrA: 239 GlnA: 159 GlnR: 67 Extraction - Visualization • Extraction: The gene should be significantly affected in at least two of the six experiments (except “Glutamine”) • List of ~100 genes highly likely to be involved in the TnrA-GlnA system • Visualization: ClustArray GlnR GlnA TnrA Opposite expression profile Glutamine Glutamate Allantoin – common TnrA regulated regulator? pucA yrbD nrgB nrgA pucJ hxlA ywpH pucL pucK ureC ureB gabP ywfM yhdG dppA pucB nasA nasE ykoL tnrA ysnE cotZ guaD Activated by TnrA or PucR? What is the function of these genes ? yrbD: sodium/proton-dependent alanine carrier hxlA: 3-hexulose-6-phosphate synthase ywpH: single-strand DNA-binding protein ywfM: unknown yhdG: amino acid transporter dppA: D-alanyl-aminopeptidase ysnE: similar to acetyltransferase cotZ: spore coat protein TnrA box = TGT.A.......T.ACA • Built a Weight Matrix from known sites • searched the upstream regions • sorted and extracted • clustered and displayed GlnR GlnR braB GlnA GlnA Repressed by TnrA ? TnrA TnrA Glutamine Glutamine Repressed by GlnR ? Glutamate Glutamate Allantoin Allantoin pucA yrbD ykoLyocR tnrA bioA pucR yuiA nasA yycB nrgA yodF pucJ gltA hisI ykzB yyaF pucH ywoE gabP yhdG ycsF Repressed by TnrA? glnR TnrA activated genes? yrbD: similar to sodium/proton-dependent alanine carrier protein yhdG: similar to amino acid transporter yyaF: similar to GTP-binding protein yrbD and yhdG have the TnrA box in a plausible position Experimental investigations TnrA repressed genes? yuiA: ?? yycB: similar to permease yodF: similar to proline permease hisI: phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP pyrophosphohydrolase yocR: similar to sodium-dependent transporter bioA: adenosylmethionine-8-amino-7oxononanoate aminotransferase Experimental investigations GlnR repressed gene ? braB: branched-chain amino acid transporter Experimental investigations A GlnR knockout with a braB-lacZ fusion do have higher b-galactosidase activity than the wildtype .... and two putative binding sites ureP3 TnrA box TnrA box gatgtgaataaatataacaaaaaaagaagctgatttggtcaaggtaactaaattttttaaatattctttgaattaataggcctcttctatataatgatgacataagttgtaaacttttataacatcat -35 -10 +1 g cggtacaaggtatgatatttatgttaccataacaaaatttaatagaaaattacgaaaaactagtattgacttctaatttttttaccatataataagatttgttcgtttcgtcatattatctgacaatta TnrA box TnrA box braB Verified new discoveries: ureABC (urease operon) is activated by PucR ACTIVITY OF yhdG wildtype: +N –N 700 3.000 TnrA-mutant: allantoin glutamine 700 700 1.000 GlnA -mutant : PucR -mutant : yrbD and yhdG: 2.000 3.000 2.000 activated by TnrA repressed by PucR ...more verified new discoveries • Compentence is induced in glutamate medium = one-step transformation procedure • A TnrA mutant has reduced competence ...only 2% of wildtype level • TnrA somehow regulates the development of competence Acknowledgements Novozymes Biotech Inc – Davis, California: Section of Molecular Microbiology DTU: Randy Berka Hans Henrik Saxild Maria Tang Lars Beier Alan Sloma Department of Microbiology – Boston University: Center for Biological Sequence analysis – DTU: Steen Knudsen Susan Fisher Chris Workman (software) Lewis Wray, Jr. Laurent Gautier (statistics) Jaclyn Brandenburg The array group (discussions) Kristine Dahlin Todays exercise inferring regulatory networks Experiment Gene nrgA TnrA GlnA GlnR purE -1 1 1 -1 0 0 glnR 1 1 1 Redundant Parsimonious A B A B C D C D See you here again at 10:45