Download Supplementary Information

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Bacterial cell structure wikipedia , lookup

Biofilm wikipedia , lookup

Molecular mimicry wikipedia , lookup

Horizontal gene transfer wikipedia , lookup

Magnetotactic bacteria wikipedia , lookup

Human microbiota wikipedia , lookup

Bacterial morphological plasticity wikipedia , lookup

Triclocarban wikipedia , lookup

Transcript
Supplementary Information.
Fig. S1. Characterisation of O antigen-producing E. coli K-12 strains. (A) Bacteriophage
P1 resistance assay. Bacterial strains were struck perpendicularly across a line of P1
lysate. A zone of clearing was observed for P1 sensitive cells, whilst the resistant strain
DFB1655 L9 grew across the lysate. (B) CaCl2 transformation assays. Equivalent
amounts of CaCl2 competent E. coli MG1655, DFB1655 L5 and DFB1655 L9 cells were
transformed with 0.3 g of pJB42 plasmid as in (3). (C) Bactericidal serum assays. Mid
logarithmic phase cultures of each strain were exposed to undiluted human serum and
viable bacterial counts were determined after 45, 90 and 180 minutes.
Fig. S2. (A) The panel shows the growth of E. coli MG1655, DFB1655 L5 and DFB1655
L9 in LB medium with shaking at 37ºC. (B) The figure shows the effect of triclosan on
the growth of MG1655, DFB1655 L5 and DFB1655 L9. Cultures were grown for 90
minutes in LB medium after which triclosan were added as indicated. Triclosan
concentrations are in g ml-1.
Fig. S3. Western blot analysis of outer membrane proteins. Cultures of strains E. coli
MG1655, DFB1655 L5 and DFB1655 L9 were grown to mid logarithmic phase, total
protein samples were prepared and equal amounts of protein subjected to Western
blotting using anti-OmpF, anti-BamD and anti-RNA polymerase  subunit antisera. Note
that anti-OmpF antiserum cross reacts with the porins OmpF, OmpC and OmpA (2).
Detection of RNA polymaerse  subunit is used as a protein loading control. (B) O
antigen production does not alter efflux. Hoescht 33342 efflux assays. The figure shows
the accumulation of Hoescht 33342 dye within E. coli MG1655, DFB1655 L5 and
DFB1655 L9 in the presence and absence of the efflux pump inhibitor (PAβN) after 60
minutes. There was no significant difference between strains under either condition as
judged by a student t-test. (C) Viability of E. coli MG1655 and LPS-mutants L5 and L9
during growth. Culture samples from mid-exponential (exp) and stationary (stat) growth
phases were stained with PI and BOX viability dyes and analysed by flow cytometry. The
fluorescence data is shown as dot plots with green (BOX; FITC) and red (PI; PE-Texas
Red) fluorescence intensities plotted on vertical and horizontal axes respectively. The cell
populations stain as follows: live cells - no staining, dead cells - PI+BOX-positive,
stressed cells (cells that have lost membrane potential) – BOX-positive.
Fig. S4. A silver stained SDS PAGE gel of LPS only samples from E. coli 042 based
strains. Cultures of strains E. coli 042 (lane 2) and DFB042 (lane 3) were grown to mid
logarithmic phase and LPS samples were prepared and subjected to SDS PAGE and
silver staining. SDS PAGE markers were loaded in lane 1.
Fig S5. O antigen biosynthesis decreases biofilm formation in E. coli K-12. (A)
Biofilm formation by strains MG1655, DFB1655 L5 and DFB1655 L9. Cells were grown
overnight in flat bottomed polystyrene microtitre plates, containing LB medium. Biofilm
formation was quantified using crystal violet staining. There was a significant difference
between MG1655 and DFB1655 L9 as judged by the student t-test (P<0.001). (B)
Fluorescence microscopy images of biofilms formed by MG1655, DFB1655 L5 and
DFB1655 L9 cells. All strains carried the GFP-expressing plasmid pJB42. Bacteria were
grown in flow chambers, containing LB medium, and the ability of each strain to adhere
to the glass surface was examined using fluorescence microscopy after 24 and 42 h of
growth.
Fig. S6. O antigen does not alter lysozyme resistance. Cultures were grown for two
hours in either the (A) absence or presence of (B) 1 mg ml-1 or (C) 2 mg ml-1 lysozyme
before calculating CFU ml-1. No difference was detected. In contrast adding (D) 1mg ml-1
lysozyme with 10 mM EDTA led to a large drop in CFU ml-1 in all strains.
Table S1. Chemical compounds which effected the growth of DFB1655 L9 and MG1655
differently during a Biolog Phenotypic MicroArray analysis.
Biolog Compound
Difference a
Mode of action b
Phenotypes Gained:
Tolylfluanid
Trifluorothymidine
129
187
Fungicide, phenylsulphamide
Nucleic acid analog, pyrimidine, DNA synthesis
-252
-198
Lipid synthesis, fatty acid inhibitor
Membrane, detergent, cationic
Phenotypes Lost:
Triclosan
Poly-L-lysine
a
Differences between the strains are shown in arbitrary units. The average signal for each PM array well
was calculated as the mean of the signal from DFB1655 L9 or MG1655 in two independent PM array
experiments. The metabolic differences between the strains are shown as the arithmetic difference of the
mean DFB1655 L9 signal minus the mean of the MG1655 signal for each test well. Wells where there was
no difference are not shown. Wells in which there was a greater signal from DFB1655 L9 than MG1655 are
shown as positive values (phenotypes gained) whilst lower signals are shown as negative values
(phenotypes lost).
b
Note that as strain DFB1655 L9 carries pJP5603/ wbbL, cells are resistant kanamycin and as a
consequence cells were also found to be resistant to related aminoglycoside antibiotics
Table S2. Strains, plasmids and primers used in this work.
Bacterial strains.
Relevant genotype.
Reference.
MG1655
K-12 strain. F- - rfb-50 rph-1 (CGSC7740)
(1)
DFB1655 L9
MG1655 with pJP5603/ wbbL integrated into the
This work
rfb gene cluster. O antigen producing strain.
DFB1655 L5
MG1655 with pJP5603/ wbbL integrated into the
This work
rfb gene cluster. O antigen producing strain.
WG1
DH5
pir
K-12 strain. F+ rfb-51 F1-1(CGSC5073)
(2)
recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1
(3)
deoR
(lacZYA-argF)U169 pir+
S17-1 pir
pro res mod+ RP4-2 Tet::Mu-Kan::Tn7
(4)
042
Wild type pathogenic enteroaggregative E. coli
(5)
DFB042
E. coli 042 with pCVD442/ wbaC integrated into
This work
the rfb gene cluster. Rough LPS strain.
OP50
E. coli B strain
(6)
Bacterial plasmids.
pET20b
T7 expression vector (AmpR)
Novagen
pET20b/wbbL
pET20b carrying wbbL
This work
pET20b/wbbL1 pET20b carrying wbbL, which contains a 1 bp
This work
deletion of the 10th nucleotide of wbbL.
pJP5603
3.1 kb R6K-based suicide vector (KanR)
pJP5603/ wbbL pJP5603 carrying wbbL.
pCVD442
kb R6K-based suicide vector (AmpR)
pCVD442/wbaC pCVD442 carrying an internal fragment of wbaC.
(7)
This work
(8)
This work
pDOC-C
Gene doctoring plasmid (AmpR)
(9)
pJB42
GFP expressing vector constructed from pDOC-C
This work
Primers (all are shown 5' to 3').
WbbL(NdeI)
CCCGAATTCATATGGTATATATAATAATCGTTTCCC
WbbL(HindIII) CCCAAGCTTCTCGAGTTACGGGTGAAAAACTGATGAAATTC
WbbLFW
GTATTAGTTGGGTTTGATGAACTAG
M40Rev
CAGGAAACAGCTATGAC
wbaCUP
CCCCTCTAGACTTGTGCAAAAGTTAAGAGAC
wbaCDWN
CCCCTCTAGATTCCATACCCCTCGGCAAGCGAATG
References for Supplementary Information.
1. Blattner FR et al. (1997) The complete genome sequence of Escherichia coli K12. Science 277:1453-1462.
2. Bachmann BJ (1990) Linkage map of Escherichia coli K-12, edition 8. Microbiol
Rev 54:130-97.
3. Elliott SJ, Kaper JB (1997) Role of type 1 fimbriae in EPEC infections. Microb
Pathog 23:113-118.
4. Simon R, Priefer U, Pohler A (1983). A broad host range mobilization system for
in vivo genetic engineering: transposon mutagenesis in Gram-negative bacteria.
Bio/Technology 1:784-791.
5. Nataro JP, et al. (1995) Heterogeneity of enteroaggregative Escherichia coli
virulence demonstrated in volunteers. J Infect Dis 171(2):465-468.
6. Brenner S (1974) The genetics of Caenorhabditis elegans. Genetics 77:71-94.
7. Penfold RJ, Pemberton JM (1992) An improved suicide vector for construction of
chromosomal insertion mutations in bacteria. Gene 118:145-146.
8. Mobley
HL,
et
al.
(1993)
Isogenic
P-fimbrial
deletion
mutants
of
pyelonephritogenic Escherichia coli: the role of alpha Gal(1-4) beta Gal binding
in virulence of a wild-type strain. Mol Microbiol 10:143-155.
9. Lee DJ et al. (2009) Gene doctoring: a method for recombineering in laboratory
and pathogenic Escherichia coli strains. BMC Microbiol 9:252.
10. Liu D, Reeves PR (1994) Escherichia coli K12 regains its O antigen.
Microbiology 140:49-57.
11. Bennion D, Charlson ES, Coon E, Misra R (2010) Dissection of β-barrel outer
membrane protein assembly pathways through characterizing BamA POTRA 1
mutants of Escherichia coli. Mol Microbiol 77:1153-1171.
12. Sambrook J, Russell DW (2001) Molecular Cloning: A laboratory manual, 3 ed,
vol. 1-3. Cold Spring Harbor Laboratory Press, Cold Spring harbor, New York.