Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Taura syndrome wikipedia , lookup
Hepatitis B wikipedia , lookup
Marburg virus disease wikipedia , lookup
Canine parvovirus wikipedia , lookup
Swine influenza wikipedia , lookup
Canine distemper wikipedia , lookup
Orthohantavirus wikipedia , lookup
Avian influenza wikipedia , lookup
IAV H3N2 (A/Marseille, A/Marseille/90454111/2011) Cat.No: DAG-T2188 Lot. No. (See product label) PRODUCT INFORMATION Product Overview Virus Family: Orthomyxoviridae Virus Genus: Influenzavirus A Strain: A/Marseille/90454111/2011 (H3N2) Nucleic Acid: Thegenome is segmented and consists of eight segments of linear negative-sense, single-stranded RNA. The complete genome is 13588 nucleotides long. Sequence can be accessed from EBI-EMBL, GenBank; the segment 1 is fully sequenced, complete sequence is 2341 nucleotides long. Segment 2 is sequenced, but only an estimate is available, complete sequence is 2341 nucleotides long. Segment 3 is fully sequenced, complete sequence is 2233 nucleotides long. Segment 4 has been fully sequenced, complete sequence is 1778 nucleotides long. Segment 5 has been sequenced, but only an estimate is presented, complete sequence is 1565 nucleotides long . Segment 6 has been sequenced, but only an estimate is given, complete sequence is 1413 nucleotides long. Segment 7 has been sequenced, but only an estimate is presented, complete sequence is 1027 nucleotides long, has been sequenced, but only an estimate is available; complete sequence is 890 nucleotides long. The genome has terminally redundant sequences. The genome sequence is repeated at both ends. Nucleotide sequences at the 3-terminus are identical. The 5terminal sequence has conserved regions and repeats complementary to the 3-terminus (5AGUAGAAACAAGG..., terminal repeats at the 5-end are 13 nucleotides long. The 3-terminus has conserved nucleotide sequences; of 12 nucleotides in length; in viruses of same species; sequence has conserved regions (3-UCG(U/C)UUUCGUCC..., in all RNA species. The multipartite genome is encapsidated, each segment in a separate nucleocapsid, and the nucleocapsids are surrounded by one envelope. Each virion contains defective interfering copies (may be present). Antigen Description This virus is classified in the BSL 2 category. This Influenza A virus[A/Marseille/90454111/2011 (H3N2)] is preserved under Freeze Dried (-20°C).Tests for the presence of mycoplasmae were negative. Nature Native Expression System N/A Species IAV Conjugate Unconjugated Sequence Similarities Fully sequenced PB2 AGCAAAAGCAGGTCAATTATATTCAGTATGGAAAGAATAAAAGAACTACGGAATCTGATG TCGCAGTCTCGCACTCGCGAGATACTGACAAAAACCACAGTGGACCATATGGCCATAATT AAGAAGTACACATCTGGAAGACAGGAAAAGAACCCGTCACTTAGGATGAAATGGATGATG GCAATGAAATACCCAATCACTGCTGACAAAAGGGTAACAGAAATGATTCCGG Size 200 μl Storage Freeze Dried (-20°C) Background Creative Diagnostics. All rights reserved 45-1 Ramsey Road Shirley, NY 11967, USA Tel: 1-631-624-4882 Fax: 1-631-938-8221 E-mail: [email protected] www.creative-diagnostics.com 1 Introduction Influenza A virus causes influenza in birds and some mammals, and is the only species of influenza virus A. Influenza virus A is a genus of the Orthomyxoviridae family of viruses. Strains of all subtypes of influenza A virus have been isolated from wild birds, although disease is uncommon. Some isolates of influenza A virus cause severe disease both in domestic poultry and, rarely, in humans. Occasionally, viruses are transmitted from wild aquatic birds to domestic poultry, and this may cause an outbreak or give rise to human influenza pandemics. Keywords IAV A/Marseille/90454111/2011 (H3N2); Influenza A virus A/Marseille/90454111/2011 (H3N2); IAV; Influenza A virus; Orthomyxoviridae Creative Diagnostics. All rights reserved 45-1 Ramsey Road Shirley, NY 11967, USA Tel: 1-631-624-4882 Fax: 1-631-938-8221 E-mail: [email protected] www.creative-diagnostics.com 2