Download Datasheet - Creative Diagnostics

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project

Document related concepts

Taura syndrome wikipedia , lookup

Hepatitis B wikipedia , lookup

Marburg virus disease wikipedia , lookup

Canine parvovirus wikipedia , lookup

Swine influenza wikipedia , lookup

Canine distemper wikipedia , lookup

Orthohantavirus wikipedia , lookup

Avian influenza wikipedia , lookup

Henipavirus wikipedia , lookup

Influenza A virus wikipedia , lookup

Transcript
IAV H3N2 (A/Marseille, A/Marseille/90454111/2011)
Cat.No: DAG-T2188
Lot. No. (See product label)
PRODUCT INFORMATION
Product Overview
Virus Family: Orthomyxoviridae
Virus Genus: Influenzavirus A
Strain: A/Marseille/90454111/2011 (H3N2)
Nucleic Acid: Thegenome is segmented and consists of eight segments of linear negative-sense,
single-stranded RNA. The complete genome is 13588 nucleotides long. Sequence can be accessed
from EBI-EMBL, GenBank; the segment 1 is fully sequenced, complete sequence is 2341 nucleotides
long. Segment 2 is sequenced, but only an estimate is available, complete sequence is 2341
nucleotides long. Segment 3 is fully sequenced, complete sequence is 2233 nucleotides long.
Segment 4 has been fully sequenced, complete sequence is 1778 nucleotides long. Segment 5 has
been sequenced, but only an estimate is presented, complete sequence is 1565 nucleotides long .
Segment 6 has been sequenced, but only an estimate is given, complete sequence is 1413
nucleotides long. Segment 7 has been sequenced, but only an estimate is presented, complete
sequence is 1027 nucleotides long, has been sequenced, but only an estimate is available; complete
sequence is 890 nucleotides long. The genome has terminally redundant sequences. The genome
sequence is repeated at both ends. Nucleotide sequences at the 3-terminus are identical. The 5terminal sequence has conserved regions and repeats complementary to the 3-terminus (5AGUAGAAACAAGG..., terminal repeats at the 5-end are 13 nucleotides long. The 3-terminus has
conserved nucleotide sequences; of 12 nucleotides in length; in viruses of same species; sequence
has conserved regions (3-UCG(U/C)UUUCGUCC..., in all RNA species. The multipartite genome is
encapsidated, each segment in a separate nucleocapsid, and the nucleocapsids are surrounded by
one envelope. Each virion contains defective interfering copies (may be present).
Antigen Description
This virus is classified in the BSL 2 category. This Influenza A virus[A/Marseille/90454111/2011
(H3N2)] is preserved under Freeze Dried (-20°C).Tests for the presence of mycoplasmae were
negative.
Nature
Native
Expression System
N/A
Species
IAV
Conjugate
Unconjugated
Sequence Similarities
Fully sequenced
PB2
AGCAAAAGCAGGTCAATTATATTCAGTATGGAAAGAATAAAAGAACTACGGAATCTGATG
TCGCAGTCTCGCACTCGCGAGATACTGACAAAAACCACAGTGGACCATATGGCCATAATT
AAGAAGTACACATCTGGAAGACAGGAAAAGAACCCGTCACTTAGGATGAAATGGATGATG
GCAATGAAATACCCAATCACTGCTGACAAAAGGGTAACAGAAATGATTCCGG
Size
200 μl
Storage
Freeze Dried (-20°C)
Background
Creative Diagnostics. All rights reserved
45-1 Ramsey Road Shirley, NY 11967, USA
Tel: 1-631-624-4882 Fax: 1-631-938-8221
E-mail: [email protected]
www.creative-diagnostics.com
1
Introduction
Influenza A virus causes influenza in birds and some mammals, and is the only species of influenza
virus A. Influenza virus A is a genus of the Orthomyxoviridae family of viruses. Strains of all subtypes
of influenza A virus have been isolated from wild birds, although disease is uncommon. Some isolates
of influenza A virus cause severe disease both in domestic poultry and, rarely, in humans.
Occasionally, viruses are transmitted from wild aquatic birds to domestic poultry, and this may cause
an outbreak or give rise to human influenza pandemics.
Keywords
IAV A/Marseille/90454111/2011 (H3N2); Influenza A virus A/Marseille/90454111/2011 (H3N2); IAV;
Influenza A virus; Orthomyxoviridae
Creative Diagnostics. All rights reserved
45-1 Ramsey Road Shirley, NY 11967, USA
Tel: 1-631-624-4882 Fax: 1-631-938-8221
E-mail: [email protected]
www.creative-diagnostics.com
2