Download Viral Replication and Lesions in BALB/c Mice

Vet Pathol 38:74–82 (2001)
Viral Replication and Lesions in BALB/c Mice Experimentally
Inoculated with Porcine Circovirus Isolated from a Pig with
Postweaning Multisystemic Wasting Disease
M. KIUPEL, G. W. STEVENSON, J. CHOI, K. S. LATIMER,
C. L. KANITZ, AND S. K. MITTAL
Animal Disease Diagnostic Laboratory (MK, GWS, CLK) and Department of Veterinary Pathobiology (MK, GWS, JC,
CLK, SKM), Purdue University, West Lafayette, IN; and
College of Veterinary Medicine, Department of Veterinary Pathology, University of Georgia, Athens, GA (KSL)
Abstract. Eight-week-old BALB/c mice were either sham inoculated (control mice) or were inoculated
intraperitoneally (IP) and intranasally (IN) with a single (sPCV mice) or multiple (mPCV mice) doses of porcine
circovirus 2 (PCV2). Four control mice and 4 sPCV mice were sacrificed 7, 14, 28, and 42 days postinoculation
(PI). All 4 mPCV mice were sacrificed 42 days PI. In addition, 7-day and 14-day pregnant BALB/c mice were
either sham inoculated (control mice) or were inoculated IP and IN with a single dose of PCV2. Newborn mice
were euthanatized 1, 8, and 15 days after birth. Necropsies were performed on all euthanatized mice and tissues
were collected for histopathology, electron microscopy, in situ hybridization, and polymerase chain reaction
(PCR). PCV2 replicated in 8-week-old BALB/c mice that were inoculated with PCV2 and caused fetal infection
when inoculated into pregnant BALB/c mice at 7 days and 14 days of gestation. PCV was detected by in situ
hybridization and PCR in sPCV mice on days 7, 14, 28, and 42 PI; in mPCV mice on day 42 PI; and in
newborn mice from mothers inoculated with PCV at 7 days and 14 days of gestation at 1, 8, and 15 days after
birth, but not in control mice. No clinical signs or gross lesions were found in sPCV or mPCV mice during
the study. Microscopic lesions in sPCV mice and mPCV mice were characterized by expansion of germinal
centers in lymphoid organs with large numbers of histiocytic cells and lymphoblasts, apoptosis of histiocytic
cells in germinal centers, and mild lymphoid depletion of the paracortex. PCV nucleic acid was detected in the
nuclei and cytoplasm of histiocytes and apoptotic cells in germinal centers in lymphoid tissues as well as in
the nuclei of hepatocytes in the liver, in the nuclei of renal tubular epithelial cells, and in the cytoplasm of
single lymphocytes in the thymus. Congenitally infected mice only had PCV nucleic acid detected in putative
Kupffer cells in livers.
Key words:
BALB/c mice; circovirus; mice; pigs; postweaning multisystemic wasting syndrome.
in the USA, Canada, and Europe.3,6,10,15,16,21,25 The syndrome is characterized by progressive weight loss,
dyspnea, tachypnea, and icterus in postweaned pigs of
approximately 8–12 weeks of age.4 Gross lesions in
pigs with PMWS consist of generalized lymphadenopathy in combination with interstitial pneumonia, hepatitis, renomegaly, splenomegaly, gastric ulcers, and
intestinal wall edema.4,10 The most distinct microscopic
lesions in affected pigs are lymphoid cell depletion and
granulomatous inflammation in lymphoid organs with
inconsistently occurring clusters of intensely basophilic intracytoplasmic inclusion bodies in macrophages.4,6,10,15 PCV nucleic acid and circoviral antigen have
been demonstrated within lesions in multiple organs of
naturally diseased pigs with PMWS, and the characteristic intracytoplasmic inclusions in macrophages of
pigs with PMWS consist of circoviral particles.3,6,14,20,23
Recently clinical disease and severe lesions compatible
Porcine circovirus (PCV) was first isolated as a noncytopathic contaminant of a porcine kidney cell line
(PK-15)31 and has been characterized as a small icosahedral DNA virus.29 The viral genome has been sequenced18 and the virion has been characterized ultrastructurally.27 Inoculation studies in pigs using PK-15–
derived PCV did not result in clinical disease.2,30 Field
isolates of PCV have been associated with congenital
tremors (CT) type A28,11,12 and a recently described
postweaning multisystemic wasting syndrome
(PMWS) in pigs.1,3–6
CT type A2, the most common form of CT in North
America, are associated with myelin deficiency and
affected newborn pigs exhibit clonic contractions of
skeletal muscles of varying severity that usually diminish and resolve by 4 weeks of age but that may
continue until slaughter age.
MWS has been diagnosed with increasing frequency
74
Vet Pathol 38:1, 2001
PCV Pathogenesis in Mice
with those of PMWS have been reproduced in gnotobiotic pigs experimentally inoculated with PCV isolated from a pig with naturally occurring PMWS.13
Wasting disease has been reproduced in caesarian-derived and colostrum-deprived pigs infected dually with
PCV and porcine parvovirus (PPV),1 and in gnotobiotic pigs inoculated with a cell-free filtered tissue homogenate containing only PCV and porcine reproductive and respiratory syndrome virus (PRRSV).13
Isolates of PMWS–associated PCV are genetically
and antigenically different from the PK-15 cell
PCV.3,9,18,21 Isolates of PCV that are genetically like
PK-15 cell PCV are referred to as PK-15 PCV9 or
PCV118 and those like the first-characterized PMWS
isolates are referred to as PMWS PCV9 or PCV2.18
Although PMWS has been associated with infection
by PCV2, but not PCV1, whether CT type A2 is
caused by PCV2 or PCV1 or both is uncertain.
Inoculation of pregnant sows in the last third of gestation with a purified virus morphologically identical
to PCV reproduced CT.8,11 The virus was confirmed as
PCV by indirect immunologic methods; however, the
genetic type of this virus is not known. Recently,
PCV2 has been detected in large numbers of neurons
in the brain and spinal cord of pigs with CT.26 Whether
these neuron-associated isolates of PCV2 can cause
CT when inoculated into susceptible pregnant swine is
uncertain.
Antibodies that react with PCV1 were found in sera
of febrile human patients and mice in Germany by
means of indirect immunofluorescence assay and an
enzyme-linked immunosorbent assay (ELISA).28 Double-staining indirect immunofluorescence assays, immunoelectronmicroscopy, and immunoblotting demonstrated that nonporcine antibodies reacted with
PCV1 structural antigen in that study.28 Because of
lower maximal optical densities (ODs) obtained at
equal titers in ELISA with nonporcine than with porcine sera, antibodies in human patients and mice were
suggested possibly to be caused by different speciesspecific viruses that share antigenic epitopes with
PCV1.28 To date, circoviruses identical or similar to
PCV have not been detected in humans or mice.
Whether PCV can infect humans, mice, or other mammalian species is not known.
The aim of this study was to develop a BALB/c
mouse model for PMWS to evaluate for viral replication and associated lesions. The following hypotheses were investigated: that PCV2 replicates in mice,
that PCV2 causes lesions in mice that are similar to
lesions of PMWS in pigs, that PCV2 crosses the placenta in mice and causes fetal infection, and that PCV2
causes CT in newborn mice after intrauterine infection.
75
Materials and Methods
Source of PCV isolate
The PCV inoculum was prepared from an isolate of PCV2
(PMWS-PCV-4) that was obtained from the lymph nodes
and lung from an 8-week-old pig with PMWS.15 The PCV
isolate was characterized genetically as PCV2 by polymerase
chain reaction (PCR) using primers designed to detect either
PCV118 or PCV2.9
Preparation of PCV2 inoculum
Porcine fetal kidney cells (PFKC) were grown as monolayer cultures using Eagle’s minimum essential medium
(MEM, Life Technologies, Inc., Grand Island, NY) supplemented with 10% fetal bovine serum (HyClone Laboratories,
Inc., Logan, UT) and 50 mg/ml gentamicin. PFKC cells tested negative by PCR for PCV1, PCV2, and PPV and did not
develop cytopathic effect before inoculation. No contaminating viruses were identified by transmission electron microscopy. Sections of lymph node and lung from pig PMWSPCV-4 were homogenized (1 g of tissue was suspended in
5 ml of MEM). The homogenate was sonicated and then
centrifuged at 2,450 3 g at 4 C for 10 minutes, and the
supernatant blindly passaged in PFKC three times before use
as inoculum for virus stock preparation. Virus-infected cells
were harvested using a cell scraper. In order to release PCV
from infected cells, the cells were frozen and thawed three
times, sonicated, and then centrifuged at 2,700 3 g at 4 C
for 10 minutes. The supernatant was collected and further
centrifuged at 255,500 3 g at 4 C for 2 hours using Beckman
SW40 rotor (Palo Alto, CA). The pellet was resuspended in
MEM in 1/100 of the starting volume by sonication followed
by filtration through a 0.2-mm syringe filter. Aliquots of virus-infected cell extracts used for the inoculum were positive
for PCV2 and negative for PPV by PCR. Only PCV particles
were identified by transmission electron microscopy in the
inoculum. Results of indirect fluorescent antibody tests
(IFAs) against pseudorabies virus, porcine rotavirus, swine
influenza virus, porcine hemagglutinating encephalomyelitis
virus, PPV, or porcine transmissible gastroenteritis virus
were negative (data not shown).
Titration of PCV2 inoculum by ELISA
The PCV2 inoculum was titrated by ELISA following a
previously described protocol.19 Briefly, 96-well microtiter
plates (Becton Dickinson & Co., Franklin Lakes, NJ) were
coated with a serially diluted virus preparation at 4 C overnight. After blocking with 1% bovine serum albumin in
phosphate-buffered saline (PBS), 100 ml of 1 : 10,000 diluted
anti-PCV2 rabbit serum19 was added into each well and the
plate was incubated at 37 C for 2 hours. Subsequently, 100
ml of 1 : 5,000 diluted horseradish peroxidase–conjugated
goat anti-rabbit immunoglobulin G (IgG) (BioRad Laboratories, Hercules, CA) was added into each well as a secondary antibody. The color was developed with O-phenylenediamine substrate. The OD of each well was measured at a
dual wavelength of 490 nm and 650 nm using a microplate
reader (Molecular Devices, Inc., Sunnyvale, CA). The serum
dilution showing an OD reading of at least the mean OD 1
2 SD of a negative control was taken as the ELISA virus
76
Kiupel, Stevenson, Choi, Latimer, Kanitz, and Mittal
Vet Pathol 38:1, 2001
titer. The PCV2 inoculum titrated by this method had an
ELISA virus titer of 1,600.
delivered litters. Three mice from each litter were euthanatized 1, 8, and 15 days after birth.
Animals and husbandry
Necropsy procedure
All BALB/c mice used in this study were purchased from
a specific-pathogen–free (SPF) colony (Harlan SpragueDawley, Indianapolis, IN). SPF status was verified by serology, bacteriology, parasitology, histopathology, and genetic
testing through the supplier and no pathogens were detected
(a list of agents the mice were tested for is available through
the national customer service center of Harlan SpragueDawley). Mice were maintained in isolation rooms in filtertop cages and any handling and husbandry procedures were
performed under a laminar flow hood. Care-taking personnel
entered the rooms in a specific order to avoid contamination
and had to wear different protective clothing in each room.
The light cycle in the rooms was 12 hours daily, the room
temperature was at 72 6 2 F (22 6 1.1 C) and the rooms
had humidity in the range of 40–70%. All mice were fed
autoclaved Mouse Chow 5010 (Purina Mills, Inc., St. Louis,
MO) and autoclaved water; autoclaved CareFRESH (Absorption Corp., Bellingham, WA) was used as bedding. This
study met the standards of the Guide for the Care and Use
of Laboratory Animals and the study protocol was approved
by the Purdue Animal Care and Use Committee (PACUC
98–112).
All mice were euthanatized by anesthetic overdose (90
mg/kg ketamine and 10 mg/kg xylazine) followed by exsanguination by axillary bleeding.
A complete postmortem examination was performed.
Samples of spleen were fixed in glutaraldehyde for electron
microscopic examination. All detectable lymph nodes, ileum, lung, liver, kidney, stomach, jejunum, cecum, colon,
pancreas, heart, skin, brain (cerebellum, cerebrum, brainstem), and tongue were fixed in 10% neutral buffered formalin. These tissues were processed by routine methods and
stained with hematoxylin and eosin (HE) for histopathologic
examination. Serial sections were stained by in situ hybridization for PCV nucleic acid. Samples of spleen and liver
were collected and stored at 280 C for PCR testing for PCV
and PPV. In addition, samples of spleen, liver, kidney, and
brain were collected and stored frozen at 280 C for further
investigations.
Experimental design
Forty 8-week-old BALB/c mice were randomly allocated
four per filter-top cage into two treatment groups of 16 and
20 mice each and groups were housed in separate isolation
rooms. The remaining four mice were euthanatized as day 0
controls. Mice in the group of 16 were sham-inoculated on
day 0 with sterile cell culture medium, 0.2 ml intraperitoneally (IP) and 0.02 ml intranasally (IN), and served as negative control (cPCV) mice. Mice in the group of 20 were
inoculated in the same manner on day 0 with PCV2 viral
inoculum and 16 served as single-inoculated (sPCV) mice.
The remaining four mice were similarly inoculated five more
times on days 7, 14, 21, 28, and 35 and served as multipleinoculated (mPCV) mice. Multiple inoculations were performed to investigate the hypothesis that multiple inoculations would increase the number of macrophages susceptible
to infection and therefore render the animals susceptible to
more severe disease. Four cPCV mice and four sPCV mice
were euthanatized 7, 14, 28, and 42 days postinoculation (PI)
and all four mPCV mice were sacrificed on day 42 PI.
Fifteen 7-days-pregnant and 12 14-days-pregnant inbred
BALB/c mice were placed singly in filter-top cages and randomly allocated into two treatment groups that were placed
in separate isolation rooms. Mice in one group, composed
of 5 7-day-pregnant and 5 14-day-pregnant mice, were
sham-inoculated on day 0 with tissue culture fluid administered as 0.2 ml IP and 0.02 ml IN. Mice in the other group,
composed of 10 7-day-pregnant and 7 14-day-pregnant mice,
were inoculated in like manner on day 0 with PCV2 viral
inoculum. Only one each of the sham-inoculated 7-day-pregnant and 14-day-pregnant mice as well as one each of the
PCV-inoculated 7-day-pregnant and 14-day-pregnant mice
In situ hybridization
In situ hybridization for demonstration of PCV nucleic
acid by using a PCV-specific oligoprobe was performed as
previously described.23 Briefly, a specific oligonucleotide
was 39-end–labeled with digoxigenin (Boehringer Mannheim
Biochemica, Indianapolis, IN). After deparaffinization, proteolytic digestion with 0.25% pepsin and prehybridization
was done. Hybridization was performed for 5 minutes at 105
C and 60 minutes at 37 C with a probe concentration of 5
ml/1 ml using a microprobe workstation (Fischer Scientific,
Pittsburgh, PA). The detection system consisted of the antidigoxigenin antibody conjugated with alkaline phosphatase
(dilution 1 : 500) and the substrates nitro-blue tetrazolium/5bromo-4-chloro-3-indolylphosphate (NBT/X-Phos, Boehringer Mannheim Biochemica, Indianapolis, IN). Controls included lymphoid tissue from PCV-infected pigs and sections
of spleen and liver from PCV-negative pigs and mice.
Polymerase chain reaction
Samples of spleen and liver from each mouse were pooled
and homogenized in equal volumes of 10 mM Tris-HCl plus
1 mM ethylenediaminetetraacetic acid (pH 7.5) using a tissumizer. Total cellular DNA was extracted using a standard
protocol.24 A set of PCV2-specific primers (59ACGCTGAATAATCCTTCC39, 59CCAACAAAATCTCTATACCC39)
were used to amplify PCV sequences by PCR using Vent
DNA polymerase (New England Biolab, Inc., Beverly, MA).
PCR conditions consisted of an annealing temperature of 56
C for 1 minute, an extension temperature of 74 C for 2
minutes, and a melting temperature of 95 C for detection of
PPV; one set of specific primers (59GCAGTACCAATTCATCTTCT39, 59TGGTCTCCTTCTGTGGTAGG39) was
designed as previously described.13 PCR-amplified DNA
samples were analyzed on 1% agarose gel by electrophoresis
and the bands of the expected size were visualized by an
ultraviolet (UV) transilluminator.
Vet Pathol 38:1, 2001
PCV Pathogenesis in Mice
77
Transmission electron microscopy
Samples of spleen from control and inoculated mice were
fixed in 4% glutaraldehyde and postfixed by osmium tetroxide. Tissues were embedded in epon and ultrathin sections
were cut and stained with lead citrate and uranyl acetate.
Sections were examined and photographed using a Jeol
JEM-1000CX transmission electron microscope (JEOL
USA, Inc., Peabody, MA).
Serology
Serum collected from sPCV and mPCV mice at necropsy
was tested for antibodies to PCV by IFA. PCV1-infected
PCNS cells, a primary cell line derived from the brain of a
PCV1-infected pig with CT,12 were grown on Teflon-coated
dot slides, fixed in acetone for 10 minutes, rinsed with distilled water, and stored at 220 C. Cells were covered with
serum from control and principal mice and incubated for 30
minutes in a humidified chamber at 37 C. After incubation,
cells were rinsed in PBS and distilled water and air dried.
Slides were incubated with fluorescein isothiocyanate–conjugated rabbit anti-mouse IgG (Sigma Immunochemicals, St.
Louis, MO) for 30 minutes at 37 C, then rinsed in PBS and
water. Slides were cover-slipped using 50% glycerol in PBS.
Fluorescence was detected using an epifluorescent UV illumination microscope. All samples were screened at a dilution of 1 : 8. Those with cells exhibiting typical multifocal
perinuclear, nuclear fluorescence, or both for PCV were considered positive for PCV antibodies. Positive serum samples
were titrated to determine the level of antibodies.
Results
Validation of control mice
All day 0 control mice and cPCV mice euthanatized
on days 7, 14, 28, and 42 PI were negative for PCV
by PCR and in situ hybridization and antibodies for
PCV were not detected. Sham-inoculated 7-day-pregnant or 14-day-pregnant BALB/c mice and their litters
were also negative for PCV by PCR and in situ hybridization. No clinical signs or gross or microscopic
lesions were found in day 0 control mice, cPCV mice
on days 7, 14, 28, and 42 PI, or newborn mice from
sham-inoculated mothers 1, 8, and 15 days after birth.
←
Fig. 1. Cervical lymph node from a control BALB/c
mouse 28 days PI. No germinal centers are noticeable. HE.
Bar 5 200 mm.
Fig. 2. Cervical lymph node from a PCV-inoculated
BALB/c mouse 28 days PI. Prominent germinal centers occupy most of the parenchyma (arrows). HE. Bar 5 200 mm.
Fig. 3. Same germinal center in cervical lymph node as
in Fig. 2. Large numbers of apoptotic cells (arrowheads) in
germinal centers. HE. Bar 5 40 mm.
Fig. 4. Same germinal center in cervical lymph node as
in Fig. 2. The cytoplasm of multiple macrophages (arrows)
and few nuclei (arrowheads) in the enlarged germinal centers
stain dark blue for PCV nucleic acid. In situ hybridization,
hematoxylin counterstain. Bar 5 40 mm.
78
Kiupel, Stevenson, Choi, Latimer, Kanitz, and Mittal
Vet Pathol 38:1, 2001
Fig. 9. Thymus from a control BALB/c mouse 28 days
PI. HE. Bar 5 200 mm.
Fig. 10. Thymus from a BALB/c mouse that was inoculated with PCV six times 42 days after the first inoculation.
In some lobules the cortex has diffuse depletion of small
lymphocytes. HE. Bar 5 200 mm.
Serology
Antibodies against PCV were first detected in one
of four sPCV mice euthanatized 14 days PI. The detected titer was 1 : 16. On days 28 and 42 PI, three of
four sPCV mice were positive at titers of 1 : 16 or 1 :
32. All four mPCV mice were seropositive on day 42
PI with titers of 1 : 18, 1 : 32, 1 : 64 and 1 : 64.
←
Fig. 5. Spleen from a control BALB/c mouse 28 days
PI. No germinal centers are noticeable. HE. Bar 5 200 mm.
Fig. 6. Spleen from a PCV-inoculated BALB/c mouse
28 days PI. Prominent germinal centers (arrows). HE. Bar
5 200 mm.
Fig. 7. Same germinal center in spleen as in Fig. 6.
Large numbers of apoptotic macrophages (arrowheads) in
germinal centers. HE. Bar 5 40 mm.
Fig. 8. Same germinal center in spleen as in Fig. 6. The
majority of apoptotic macrophages (arrowheads) stain dark
blue for PCV nucleic acid. In situ hybridization, hematoxylin
counterstain. Bar 5 200 mm.
Vet Pathol 38:1, 2001
PCV Pathogenesis in Mice
Fig. 11. Liver from a BALB/c mouse that was inoculated with PCV six times 42 days after the first inoculation.
Nuclei of multiple hepatocytes stain dark blue for PCV nucleic acid (arrowheads). In situ hybridization, hematoxylin
counterstain. Bar 5 50 mm.
Fig. 12. Thymus from a PCV-inoculated BALB/c mouse
28 days PI. Multiple lymphocytes randomly distributed
throughout the parenchyma have cytoplasmic labeling for
PCV nucleic acid (arrowheads). In situ hybridization, hematoxylin counterstain. Bar 5 50 mm.
sPCV and mPCV mice
No clinical signs or gross lesions were observed in
sPCV or mPCV mice at any time during the study.
PCV was detected in lymphoid organs, liver, and kidney of sPCV mice on days 7, 14, 28, and 42 PI and
of mPCV mice on day 42 PI by in situ hybridization
and PCR. Microscopic alterations in sPCV mice were
first noticed on day 7 PI, were most prominent on days
14 and 28 PI, and were slightly less severe on day 42
PI. The most severe microscopic alterations were
found in mPCV mice 42 days PI. Microscopic lesions
were limited to lymphoid organs, affecting mainly
bronchial and mesenteric lymph nodes, spleen, Peyer’s
patches, and thymus and were always associated with
intralesional PCV-positive cells (Figs. 1–12). The
number of PCV-positive cells was proportional to the
severity of microscopic alterations, with mPCV mice
having the highest number of PCV-positive cells.
In contrast to cPCV mice (Figs. 1, 5), sPCV and
mPCV mice developed prominent germinal centers
79
that occupied most of the parenchyma in multiple
lymph nodes (Figs. 2–4), Peyer’s patches, and the
spleen (Figs. 6–8). These enlarged germinal centers
consisted of large lymphoblastic cells and histiocytic
cells (Figs. 2, 6). Large numbers of histiocytic cells in
the germinal centers had microscopic changes typical
of apoptosis (Figs. 3, 7). The cytoplasm and less frequently the nuclei of such apoptotic histiocytes were
positive for PCV nucleic acid by in situ hybridization
(Figs. 4, 8). The paracortex had mild loss of lymphocytes and was infiltrated by large numbers of histiocytes. In addition to the described alterations, mPCV
mice had diffuse depletion of small lymphocytes in the
thymus on day 42 PI (Fig. 10). PCV nucleic acid was
also detected in nuclei of hepatocytes (Fig. 11) and
renal tubular epithelial cells and in the cytoplasm of
single lymphocytes in the thymus (Fig. 12) in sPCV
mice on days 14 and 28 PI and in mPCV mice 42 days
PI.
Infection with PCV and apoptosis of infected macrophages was confirmed with transmission electron
microscopy on sections of spleen from sPCV mice 28
days PI. Large numbers of histiocytes in germinal centers had nuclear lysis and margination of chromatin
aggregates (Fig. 13). Nuclei were often segmented and
blebs of nucleolemma contained electron-dense aggregates of chromatin fragments that resembled apoptotic
bodies (Fig. 14). The nuclei of multiple apoptotic histiocytes contained centrally located electron-dense inclusions that consisted of viral particles, approximately
10–12 nm in diameter (Fig. 13). Few macrophages had
small intracytoplasmic viral inclusions that were composed of loosely aggregated icosahedral viruslike particles, 12 6 2 nm in diameter, consistent with circoviral particles (Fig. 15). No trilaminar membranes
were found surrounding these inclusions.
Newborn mice
No differences were found in newborn mice whether the mothers had been inoculated at 7 or 14 days of
gestation. Newborn mice had difficulties righting
themselves during the first 3 days of their lives and
were less active than their age-matched uninfected
controls. No gross or microscopic lesions were found
in newborn mice euthanatized 1 and 8 days after birth.
Low amounts of PCV nucleic acid were detected in
the liver of all newborn mice within the cytoplasm of
few putative Kupffer cells 1 and 8 days after birth. No
PCV nucleic acid was detected in other organs including the central nervous system. Newborn mice euthanatized 15 days after birth had similar lesions as sPCV
inoculated mice 7 days PI and PCV nucleic acid was
detected in similar locations as in sPCV mice.
80
Kiupel, Stevenson, Choi, Latimer, Kanitz, and Mittal
Vet Pathol 38:1, 2001
Fig. 13. Spleen from a PCV-inoculated BALB/c mouse 28 days PI. Macrophage with nuclear lysis and margination of
multiple chromatin aggregates and suspected intranuclear viral inclusion (arrows). Uranyl acetate and lead citrate. Bar 5 1
mm.
Fig. 14. Same spleen as in Fig. 13. Macrophage with segmented nucleus with multiple marginated electron-dense
aggregates of chromatin fragments that resemble apoptotic bodies. Uranyl acetate and lead citrate. Bar 5 1 mm.
Fig. 15. Same spleen as in Fig. 13. Small intracytoplasmic circoviral inclusion in macrophage composed of loosely
aggregated icosahedral virions, 12 6 2 nm in diameter. No trilaminar membrane surrounds the inclusion. Uranyl acetate
and lead citrate. Bar 5 200 nm.
Discussion
Results of this study demonstrate that PCV2 replicates in BALB/c mice. Replication of PCV2 in BALB/
c mice was confirmed by the increasing amount of
PCV nucleic acid in a variety of tissues at sequential
study days and detection of intranuclear PCV nucleic
acid in macrophages, hepatocytes, and renal tubular
epithelial cells. The ability of PCV to infect naı̈ve
pigs1,2,7,13 and to cross the placenta causing fetal infection in pigs8,11 was previously demonstrated in experimentally infected pigs. This study demonstrates that
infection of mice by PCV2 can also occur either directly or transplacentally.
The observed enlargement of germinal centers by
infiltration with large numbers of lymphoblastic and
histiocytic cells, apoptosis of histiocytes, and mild
lymphocytic depletion in the paracortex in PCV2-inoculated mice in this study resembled early lesions 20
days PI in lymph nodes of PCV2-inoculated gnotobiotic pigs.13 However, later lesions observed in PCV2inoculated pigs 35 days PI were not observed in infected mice, including interstitial pneumonia, hepatitis,
nephritis, perivasculitis, multinucleated giant cells, and
typical circoviral intracytoplasmic inclusion bodies.
The lymphoid lesions in germinal centers of infected
mice in this study, termed ‘‘complete germinal center
structures,’’ are nonspecific alterations that develop in
mice after experimental exposure to a number of different antigens.32 Development of complete germinal
centers in mice is associated with expression of lymphotoxin-a in T helper 1 lymphocytes and B lymphocytes, tumor necrosis factor-a, or other cytokine–re-
Vet Pathol 38:1, 2001
PCV Pathogenesis in Mice
ceptor interactions.17 Evaluation of cytokine profiles in
control and infected mice as well as in vitro studies
should elucidate the mechanism of PCV-induced lymphoid lesions.
More severe microscopic lesions in mPCV mice
than in sPCV mice are most likely the result of a higher viral dose, but could also be due to an increased
number of proliferating macrophages, which have
been suggested as the target cells of viral infection,
after antigenic stimulation. Although PCV-inoculated
mice failed to develop the full range of microscopic
lesions associated with PCV infection in pigs, this
study demonstrated that mice might serve as a potential reservoir or vector for PCV. Furthermore, this
mouse model of PCV2 viral replication with hyperplastic and apoptotic germinal centers will allow studies aimed at determining the role of PCV in induction
of apoptosis.
Even though PCV2 infected fetal mice transplacentally and resulted in congenital infection, whether
PCV2 caused the impaired mobility in newborn mice
observed during the first 3 days after birth is unclear
and most affected mice were not euthanatized for several days. Of 18 newborn mice that had problems
righting themselves, 6 were euthanatized 1 day after
birth. The other 12 mice exhibited normal behavior by
3 days after birth. CT in pigs has been reproduced by
inoculation of pregnant sows with PCV8,11,12 and is associated with dysmyelinogenesis22 and PCV infection
of neurons in the brain and spinal cord in affected
pigs.26 PCV nucleic acid was demonstrated only in putative hepatic Kupffer cells and not in the brain or
spinal cord of congenitally PCV2-infected mice. Lesions were not demonstrated in the brain or spinal cord
of affected mice by HE staining. No special stains
were applied to sections of spinal cord to evaluate for
possible dysmyelinogenesis as described in neonatal
pigs with CT.22 Although transplacental transmission
of PCV was confirmed in mice, the small number of
newborn control and PCV infected mice makes further
conclusions about this part of the study questionable.
More work is needed to determine whether congenital
PCV infection of mice results in a model of CT or
other disease.
Antibodies against PCV or a closely related circovirus have been demonstrated in mice and febrile human patients.28 The ability of PCV2 to replicate in
mice and to cause lesions was confirmed. Whether the
circoviral antibodies that were detected in fetal mice
were due to PCV1, PCV2 or a closely related speciesspecific circovirus remains unclear. Whether PCV or a
closely related circovirus infects humans also remains
unknown. PCV2 has been demonstrated to infect cardiomyocytes and to cause myocardial necrosis in experimentally infected pigs.7,13 Considering the increas-
81
ing importance of porcine tissues as xenotransplants,
especially mitral valves, the potential of PCV to infect
humans should be further investigated.
Acknowledgements
We would like to thank D. Vanhorn for electronmicroscopic preparations, G. Sailaja for ELISA, S. Royer for photomicroscopy, and R. Campagnoli for technical advice. We
also thank Dr. J. P. Sundberg, The Jackson Laboratory, for
assistance with experimental design and critical review of
this manuscript.
References
1 Allan GM, Kennedy S, McNeilly F, Foster JC, Ellis JA,
Krakowka SJ, Meehan BM, Adair B: Experimental reproduction of severe wasting disease by co-infection of
pigs with porcine circovirus and porcine parvovirus. J
Comp Pathol 121:1–11, 1999
2 Allan GM, McNeilly F, Cassidy JP, Reilly GAC, Adair
B, Ellis WA, McNulty MS: Pathogenesis of porcine circovirus; experimental infections of colostrum deprived
piglets and examination of pig foetal material. Vet Microbiol 44:49–64, 1995
3 Allan GM, McNeilly F, Kennedy S, Daft B, Clarke EG,
Ellis JA, Haines DM, Meehan BM, Adair B: Isolation of
porcine circovirus-like viruses from pigs with a wasting
disease in the USA and Europe. J Vet Diagn Invest 10:
3–10, 1998
4 Clark EG: Post-weaning multisystemic wasting syndrome. Proc Annu Meet Am Assoc Swine Pract 28:499–
501, 1997
5 Daft B, Nordhausen RW, Latimer KS, Niagro FD: Interstitial pneumonia and lymphadenopathy associated with
circoviral infection in a six-week-old pig. Proc Annu
Meet Am Assoc Vet Lab Diagn 39:32, 1996
6 Ellis J, Hassard L, Clark E, Harding J, Allan G, Willson
P, Strokappe J, Martin K, McNeilly F, Mehan B, Todd
D, Haines D: Isolation of circovirus from lesions of pigs
with postweaning multisystemic wasting syndrome. Can
Vet J 39:44–51, 1998
7 Ellis J, Krakowka S, Lairmore M, Haines D, Bratanich
A, Clark E, Allan G, Konoby C, Hassard L, Meehan B,
Martin K, Harding J, Kennedy S, McNeilly F: Reproduction of lesions of postweaning multisystemic wasting
syndrome in gnotobiotic pigs. J Vet Diagn Invest 11:3–
14, 1999
8 Gustafson DP, Kanitz CL: Experimental transmission of
congenital tremors in swine. US Anim Hosp Assoc 78:
338–345, 1974
9 Hamel AL, Lin LL, Nayar GPS: Nucleotide sequence of
porcine circovirus associated with postweaning multisystemic wasting syndrome in pigs. J Virol 72:5262–5267,
1998
10 Harding JCS, Clark EG: Recognizing and diagnosing
postweaning multisystemic wasting syndrome (PMWS).
Swine Health Prod 5:201–203, 1997
11 Hines RK: Porcine circovirus causes congenital tremors
type A-II proved by fulfilling Koch’s postulates. PhD
Diss., University of Georgia, Athens, GA, 1994
82
Kiupel, Stevenson, Choi, Latimer, Kanitz, and Mittal
12 Kanitz CL: Myoclonia congenita: studies of the resistance to viral infection of tissue culture cell lines derived
from myclonic pigs. PhD Diss., Purdue University, West
Lafayette, IN, 1972
13 Kiupel M, Stevenson GW, Choi J, Latimer KS, Kanitz
CL, Mittal SK: Production of clinical disease and lesions
typical of postweaning multisystemic wasting syndrome
(PMWS) in experimentally inoculated gnotobiotic pigs.
J Vet Diagn Invest (in press)
14 Kiupel M, Stevenson GW, Kanitz CL, Anothayanontha
L, Latimer KS, Mittal SK: Cellular localization of porcine circovirus in postweaning pigs with chronic wasting
disease. Eur J Vet Pathol 5:45–50, 1999
15 Kiupel M, Stevenson GW, Mittal SK, Clark EG, Haines
DM: Circovirus-like viral associated disease in weaned
pigs in Indiana. Vet Pathol 35:303–307, 1998
16 LeCann PE, Albina F, Madec R: Piglet wasting disease.
Vet Rec 141:660, 1997
17 Matsumoto M, Mariathasan S, Nahm MH, Baranyay F,
Peschon JJ, Chaplin DD: Role of lymphotoxin and type
1 TNF receptor in the formation of germinal centers.
Science 271:1289–1291, 1996
18 Meehan BM, Creelan JL, McNulty MS, Todd D: Sequence of porcine circovirus DNA: affinities with plant
circoviruses. J Gen Virol 78:221–227, 1997
19 Mittal SK, Middleton DM, Tikoo SK, Babiuk LA: Pathogenesis and immunogenicity of bovine adenovirus type
3 in cotton rats (Sigmodon hispidus). Virology 213(1):
131–139, 1995
20 Morozov I, Sirinarumitr T, Sorden SD, Halbur PG, Morgan MK, Yoon KJ, Paul PS: Detection of a novel strain
of porcine circovirus in pigs with postweaning multisystemic wasting syndrome. J Clin Microbiol 36:2535–
2541, 1998
21 Nayar GP, Hamel SA, Lin L: Detection and characterization of porcine circovirus associated with post-weaning multisystemic wasting syndrome in pigs. Can Vet J
38:385–386, 1997
22 Patterson DSP, Done JT, Foulkes JA, Sweasey D: Neu-
23
24
25
26
27
28
29
30
31
32
Vet Pathol 38:1, 2001
rochemistry of the spinal cord in congenital tremor of
piglets (type A2), a spinal dysmyelimogenesis of infectious origin. J Neurochem 26:481–485, 1976
Rosell C, Segales J, Plana-Duran J, Balasch M, Rodriguez-Arrioja GM, Kennedy S, Allan GM, McNeilly F,
Latimer KS, Domingo M: Pathological, immunohistochemical, and in-situ hybridization studies of natural cases of postweaning multisystemic wasting syndrome
(PMWS) in pigs. J Comp Pathol 120:59–78, 1999
Sambrook J, Fritsch EF, Maniatis T: Molecular Cloning:
A Laboratory Manual 9.14–9.23. Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY, 1998
Segales JM, Sitjar M, Domingo S: First report of postweaning syndrome in piglets in Spain. Vet Rec 141:600–
601, 1997
Stevenson GW, Kiupel M, Mittal SK, Choi J, Latimer
KS, Kanitz CL: Tissue distribution and genetic typing of
porcine circoviruses in pigs with naturally occurring congenital tremors. J Vet Diagn Invest (in press)
Stevenson GW, Kiupel M, Mittal SK, Kanitz CL: Ultrastructure of porcine circovirus in persistently infected
PK-15 cells. Vet Pathol 36:368–378, 1999
Tischer I, Bode L, Apodaca J, Timm H, Peters D, Rasch
R, Pociuli S, Gerike E: Presence of antibodies reacting
with porcine circovirus in sera of humans, mice and cattle. Arch Virol 140:1427–1439, 1995
Tischer I, Gelderblom H, Vettermann W, Koch MA: A
very small porcine virus with circular single-stranded
DNA. Nature 295:64–66, 1982
Tischer I, Mields W, Wolff D, Vagt M, Griem W: Studies
on epidemiology and pathogenity of porcine circovirus.
Arch Virol 91:271–276, 1986
Tischer I, Rasch R, Tochtermann G: Characterization of
papovavirus and picornavirus-like particles in permanent
pig kidney cell lines. Zentralbl Bakteriol Hyg A 226:
153–167, 1974
Tsiagbe VK, Inghirami G, Thorbecke GJ: The physiology of germinal centers. Crit Rev Immunol 16:381–421,
1996
Request reprints from Dr. M. Kiupel, Animal Disease Diagnostic Laboratory, Purdue University, West Lafayette, IN 479061175 (USA). E-mail: [email protected].