Download Identification and characterization of the DNA replication origin

Biosci. Rep. (2011) / 31 / 353–361 (Printed in Great Britain) / doi 10.1042/BSR20100047
Identification and characterization of the DNA
replication origin recognition complex gene family
in the silkworm Bombyx mori
Hui-Peng YANG*†, Su-Juan LUO*, Yi-Nü LI*, Yao-Zhou ZHANG†1 and Zhi-Fang ZHANG*1
*The Biotechnology Research Institute, Chinese Academy of Agricultural Sciences, Beijing 10081, People’s Republic of China, and
†Institute of Biochemistry, Zhejiang Sci-Tech University, Hangzhou, Zhejiang Province 310018, People’s Republic of China
'
$
Synopsis
The ORC (origin recognition complex) binds to the DNA replication origin and recruits other replication factors to form
the pre-replication complex. The cDNA and genomic sequences of all six subunits of ORC in Bombyx mori (BmORC1–
6) were determined by RACE (rapid amplification of cDNA ends) and bioinformatic analysis. The conserved domains
were identified in BmOrc1p–6p and the C-terminal of BmOrc6p features a short sequence that may be specific
for Lepidoptera. As in other organisms, each of the six BmORC subunits had evolved individually from ancestral
genes in early eukaryotes. During embryo development, the six genes were co-regulated, but different ratios of the
abundance of mRNAs were observed in 13 tissues of the fifth instar day-6 larvae. Infection by BmNPV (B. mori
nucleopolyhedrovirus) initially decreased and then increased the abundance of BmORC. We suggest that some of the
BmOrc proteins may have additional functions and that BmOrc proteins participate in the replication of BmNPV.
Key words: expression pattern, gene clone, origin recognition complex (ORC), reverse transcription–PCR (RT–PCR),
silkworm
&
INTRODUCTION
The ORC (origin recognition complex) was first discovered
in budding yeast [1]. It contains six different protein subunits
(Orc1p–6p) that are encoded by the genes ORC1–6, which are
located on different yeast chromosomes. Homologues of the six
Orc proteins have been identified in Arabidopsis thaliana [2],
Drosophila melanogaster [3] and even in Homo sapiens [4].
ORCs from different species are identified by the initials of the
genus and species name such as BmORC (Bombyx mori ORC) [5].
The heterohexameric ORC complex was shown to bind to
the origin of DNA replication during the transformation from M
phase to G1 phase of the cell cycle. ORC functions as a landing
pad for additional replication factors, including Cdc6 (cell division cycle 6), Cdt1 (chromatin licensing and DNA replication
factor 1) and MCM (mini-chromosome maintenance) to form
the pre-RC (pre-replication complex), which initiated the start of
DNA replication [5]. ScORC (Saccharomyces cerevisiae ORC)
also participates in sister-chromatid cohesion [6].
ScOrc1p–5p contained an AAA+ domain that consisted of four
motifs, including WA (Walker A), WB (Walker B), S1 (Sensor-
%
1) and S2 (Sensor-2) [7,8]. Conservation of these motifs was
strongest in Orc1p, 4p and 5p, and less in Orc2p and 3p. The
C-terminals of Orc1p–5p also contained a WH (winged-helix)
motif that mediated the binding between ORC and DNA replication origins [9–11]. Most of the Orc1p contained a BAH (bromoadjacent homology) domain at the N-termini, which was similar
to the Sir3 (silent information regulator 3) and it was also predicted to possess the same function [12,13]. Mutation analysis of
the BAH domain in H. sapiens Orc1p (HsOrc1p) indicated that it
mediated the interaction between HsOrc1p and the DNA replication origin during the transformation from M phase to G1 phase.
The BAH domain was also involved in the binding of HsOrc1p
to oriP, a replication origin of the Epstein–Barr virus, and it participated in the amplification of a plasmid containing oriP [14].
In addition, the BAH domain helped HsOrc2p bind to the origin of DNA replication [15,16]. In budding yeast and humans,
the Orc1p–Orc5p but not Orc6p were essential for ORC to recognize the origin of DNA replication [17]. All the six subunits were,
however, essential for origin recognition in D. melanogaster [18].
A mutation of D. melanogaster Orc3p caused a failure of
cell proliferation during larval development, which affected the
central nervous system including the brain [19]. The MmORC
.................................................................. ............................................................. ................................................................. .............................................................. ..............................................
Abbreviations used: BAH, bromo-adjacent homology; BmNPV, Bombyx mori nucleopolyhedrovirus; BV, budded virus; ORC, origin recognition complex; DmORC, D. melanogaster ORC;
EST, expressed sequence tag; hpi, h post-infection; MmORC, Mus musculus ORC; NUP, nested universal primer; RACE, rapid amplification of cDNA ends; ScORC, Saccharomyces
cerevisiae ORC.
1 Correspondence may be addressed to either of these authors (email [email protected] or [email protected]).
www.bioscirep.org / Volume 31 (5) / Pages 353–361
353
H. Yang and others
(Mus musculus ORC) core complex (containing Orc2p–5p) was
highly expressed in adult mouse brain tissue, and knockdown
using siRNA (small interfering RNA) reduced the dendrite and
dendritic spine developments in postmitotic neurons [20].
ScOrc6 proteins contain a unique conserved domain named
the Orc6 protein fold superfamily that was interrupted by a large
disordered region [21]. Orc6p of the lepidopteran Choristoneura
fumiferana contains approx. 100 C-terminal amino acids that
were not found in other Orc6 proteins [22].
A two-hybrid experiment showed that DmOrc6p interacts with
Pnut protein (Septin protein family, involved in cell division)
[23]. Immunoprecipitation assays proved that the interaction was
mediated by the C-terminal domain of DmOrc6p. RNA interference of DmORC6 (D. melanogaster ORC 6) abolished DNA
replication and cytokinesis [23]. Imprecise splicing of DmOrc6p
using the P element had a similar effect, which could be released by introducing a full-length DmORC6 or HsORC6 gene
[24]. Cf MNPV (C. fumiferana multiple nucleopolyhedrovirus)
infection in Cf 124T cells did not change the level of Cf Orc6p
(C. fumiferana Orc6p) expression until 26 hpi (h post-infection)
[22]. The limited conservation of the individual eukaryotic ORC
subunits might be indicative of their diverse functions [25].
So far, the genes for the six ORC subunits of three Diptera species have been described from the genomic sequences of Aedes
aegypti, Culex quinquefasciatus and D. melanogaster.
Here we cloned the cDNA sequences and genomic sequences
of all six ORC subunits of the lepidopteran B. mori. Expression
of the BmORC subunit mRNAs was monitored by quantitative
real-time PCR during embryo development, and in 13 tissues of
fifth instar day-6 larvae and after BmNPV (B. mori nucleopolyhedrovirus) infection of fifth instar larvae.
MATERIALS AND METHODS
feeding was stopped until 12 h after all of the larvae
had moulted (fifth instar day-1 larvae). Feeding was resumed 1 h before the larvae were divided randomly into two
groups. One group was injected BV [5.0×105 pfu (plaqueforming units) of BmNPV each larva], and the other group
was mock-infected and used as a control. At 1 h postinfection was labelled as 0 hpi. At every time point, fat body
total RNA was isolated from five larvae according to the standard protocol supplied with the Invitrogen RNA isolation kit. The
remaining healthy larvae were kept fed to the fifth instar day-6.
Then total RNA was isolated from the head, epidermis, anterior
silk gland, middle silk gland, posterior silk gland, wing disc,
testis, haemocyte, ovary, Malpighian tube, tracheal bush, midgut
and fat body [31,32].
cDNA synthesis and RACE (rapid amplification of
cDNA ends)
A 1 μg sample of total RNA extracted from each given
condition was used for cDNA synthesis (BD SMARTTM
RACE cDNA Amplification Kit; Clontech), according to the
supplied user manual. Primers (Supplementary Table S1 at
http://www.bioscirep.org/bsr/031/bsr0310353add.htm) were designed according to the assembled sequences. PCR was performed using a specific primer 1 and NUP (nested universal
primer), followed by nested PCR using primer 2 and NUP, and
suitably diluted PCR product from the first round as the template.
Each PCR reaction was carried out under the following conditions: after denaturing for 5 min at 95◦ C, subsequent cooling on
ice and addition of Taq DNA polymerase, PCR was performed
for 30 cycles of 94◦ C for 1 min, 60◦ C for 1 min and 72◦ C for
1–2 min, followed by a 10-min incubation at 72◦ C. The PCR
products were separated by agarose-gel electrophoresis, purified
and ligated into the pMD18-T vector (Takara). Several clones
were sequenced by the dideoxynucleotide method using the ABI3730 automatic sequencer.
Insects and tissue dissection
The silkworm stock JY-1 was supplied by the Sericultural Research Institute of the Chinese Academy of Agricultural Sciences.
The insects were reared using common methods [26]. The BV
(budded virus) of BmNPV was maintained and titrated by our
laboratory.
DNA sequence analysis, protein sequence
alignment and phylogenetic analysis
DmORC sequences and BLAST searches were used to identify
homologous sequences in the EST (expressed sequence tag) library of B. mori (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Overlapping B. mori EST sequences (Table 1) were assembled into single
contigs using the DNASTAR software package.
The silkworm genome program (http://kaikoblast.dna.affrc.
go.jp) was used to identify the genomic DNA sequences corresponding to the assembled cDNA sequences for each BmORC
subunit. The protein sequence alignments were established using ClustalX and the neighbour-joining tree was constructed using MEGA 4. Conserved protein sequence domains
were identified using the NCBI conserved domain database
(http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi), and the
SignalIP 3.0 (http://www.cbs.dtu.dk/services/SignalP) server
program was used to search for possible signal peptides.
Infection with BmNPV and RNA isolation
Quantitative real-time PCR
Hibernating eggs were incubated using the simplified method
[26]. Total RNA was isolated daily until the larvae hatched.
When the larvae had grown to the fourth moulting stage,
A portion of total RNA (1 μg) was used to synthesize cDNAs
according to the Reverse Transcription Kit’s protocol (Promega;
cat no.: A3500). The real-time–PCRs were carried out according
Database searching and sequence assembly
..........................................................................................................................................................................................................................................................................................................................................................................
354
C The
Authors Journal compilation
C 2011
Biochemical Society
cDNA length
Number
[without
Conserved domain
GenBank®
Gene
Related ESTs
of introns Origin of mRNAs
poly(A) tail]
aa length
(aa position)
accession number
Chr location
BmORC1
CK563734; CK512140;
CK520558
6
Unfertilized embryo/fat
body/haemocyte
2003
595
240–420
GQ214390
Not mapped; Bm_scaf146
BmORC2
CK565003; CN212162;
CK514845
7
Unfertilized/fertilized
embryo/posterior silk gland
1835
549
229–549
GQ214391
Chr 9; Bm_scaf56
BmORC3
BY938544; AV398523;
DC439421; BP119933;
BB983596; DC556000;
DC554298; BY935502;
AU000373; DC434830;
BJ985480; CK537868;
CK527963; CK556136;
BP126248; BP119569;
CK519175; CK526722;
CK521977; CK542243;
CK521782; CK506238;
DC565627; DC567338
11
Embryo/ovary/epidermis/posterior
silk gland/compound eye/wing
disc/prothoracic
gland/maxillary
glae/haemocyte/ testis/fat
body
2750
722
35–330
GQ214392
Chr 22; Bm_scaf18
BmORC4
CK559677
6
Unfertilized embryo
1791
496
40–215
GQ214393
Chr 2; Bm_scaf27
BmORC5
AU003674; BW999349;
BW999377; BY921684;
BW998393; DC543047;
BW999431; BY930190
0
Wing disc/ovary/embryo
1511
460
5–205
GQ214394
Not mapped; Bm_scaf286
BmORC6
BP118659
5
Compound eye
1260
290
10–150
GQ214395
Chr 20; Bm_scaf79
DNA replication ORC gene family in Bombyx mori
www.bioscirep.org / Volume 31 (5) / Pages 353–361
355
..........................................................................................................................................................................................................................................................................................................................................................................
Table 1 Gene family encoding ORC proteins in the silkworm B. mori
aa, amino acid; Chr, chromosome.
H. Yang and others
to calculate the absolute copy numbers of the relevant genes.
Comparison with the internal reference gave the relative copy
numbers [28].
RESULTS
Analysis of the six B. mori ORC subunit genes, their
mRNAs and predicted protein sequences
Figure 1 Genomic structures of BmORC1–6 of B. mori
Dark bands represent exons. BmORC5 consists of a single 1511 bp
uninterrupted exon.
to the user manual for the Toyobo SYBR Green Real-time PCR
master mix. For each BmActin3 was used as an internal reference.
Primers for real-time PCR are listed in Supplementary Table S1.
Standard curves and data analysis
The products of real-time PCR were separated by agarosegel electrophoresis, purified using glass milk and the DNA concentrations were determined using a spectrophotometer (an A260
of 1.0 is equivalent to 50 μg/ml). The molecular mass of the DNA
fragments was determined using the DNASTAR software package. Real-time PCR using dilutions from 109 to 104 copies/μl
was carried out to obtain a standard curve, which was then used
Figure 2
EST sequences specifying the six B. mori ORC subunits were
identified in the EST database of B. mori using BLAST searches
with the six known D. melanogaster ORC protein subunit sequences. Sequence information missing from the EST sequences
was obtained experimentally using 3 - or 5 -RACE. Typical polyadenylation (AAUAAA) signals were missing from all cDNAs
except for BmORC4. Comparison of the cDNA sequences with
the B. mori genome database revealed the intron structure of each
gene (GenBank® accession nos. GQ214390–GQ214395; Table 1
and Figure 1). The assembled cDNAs predicted the protein sequences of the six B. mori ORC proteins, each of which contained
an identifying homologous conserved domain (Figure 2) and no
indication of a signal peptide.
Phylogeny of the BmOrc1–6 protein subunits
The neighbour-joining tree in Figure 3 showed that each of the six
BmOrc proteins was most similar to its DmOrc counterpart from
Drosophila. They were also more similar to their mammalian
counterparts (HsOrc and MmOrc) than to each other. ScOrc1p–6p
The predicted functional domains in BmOrc proteins
The locations of the predicted functional domains in the six BmOrc proteins are indicated as dark bars. The AAA+ domains
were predicted in BmOrc1p and BmOrc4p. Conserved domain in Orc2p, Orc3p and Orc6p were named ORC2, ORC3 and
ORC6 superfamily sequence motifs respectively. A partial CDC6 domain was identified at the N-terminus of BmOrc5p.
..........................................................................................................................................................................................................................................................................................................................................................................
356
C The
Authors Journal compilation
C 2011
Biochemical Society
DNA replication ORC gene family in Bombyx mori
Figure 3
Evolutionary relationships of ORCs
The evolutionary history was inferred using the neighbour-joining method. The bootstrap consensus tree inferred from 500
replicates was taken to represent the evolutionary history of the ORCs. The Orc1p–6p sequences were obtained from the
NCBI protein database for H. sapiens (Hs), D. melanogaster (Dm), S. cerevisiae (Sc) and M. musculus (Mm). The Bombyx mori
BmOrc1p–6p (GenBank® accession no. GQ214390–GQ214395) were cloned by our laboratory. ScOrc1p–6p (GenBank®
accession nos. P54784, CAA79883, P54790, P54791, P50874 and P38826), DmOrc1p–6p (GenBank® accession nos.
NP_477303, NP_731873, AAD39472, AAD39473, NP_477132 and NP_477319), MmOrc1p–6p (GenBank® accession
nos. Q9Z1N2, Q60862, Q9JK30, O88708, Q9WUV0 and Q9WUJ8), HsOrc1p–6p (GenBank® accession nos. NP_004144,
NP_006181, NP_862820, NP_002543, NP_002544 and NP_055136).
were, as expected, most different from their animal counterparts,
but they still grouped with the expected clades.
The N-terminal sequences of Orc1p and Orc2p were
generally less conserved than the C-terminal ones. All
known Orc2p–5p homologues were similar to their counterparts in other species, and Orc3p–5p had high similarity along the entire sequences (Supplementary Figures S2–
S5 http://www.bioscirep.org/bsr/031/bsr0310353add.htm). The
N- and C-termini of BmOrc6p and Cf Orc6p were similar but
Cf Orc6p had an approx. 80 amino acid insert near the C-terminus
that was only found in lepidoptera (Supplementary Figure S6 at
http://www.bioscirep.org/bsr/031/bsr0310353add.htm).
The tissue expression pattern of BmORC in fifth
instar day-6 larvae
In the posterior silk gland, ovary, Malpighian tube, fat body and
testis, the BmORC mRNA copy number was higher than in most
other tissues. Values were lowest in the haemocyte and midgut.
The expression of BmORC1 was very low in most tissues. The
lowest level was observed in the midgut, and a slightly elevated
level in the fat body. BmORC2 and BmORC3 were most highly
expressed in the posterior silk gland and least in the haemocyte.
BmORC4 expression was highest in the Malpighian tube least in
the haemocyte. BmORC5 expression was highest in the posterior
silk gland and lowest in wing disc. BmORC6 expression was
highest in the ovary and lowest in the epidermis (Figure 5).
Expression of BmORC during embryo development
Hibernating eggs that were at the critical development stage
II were incubated by the simplified method [26] and BmORC
mRNA levels were measured for 11 days. Generally, the mRNA
expression levels decreased until the sixth day, and then increased
again. The copy number of BmORC2 peaked strongly on the
second day. An appreciable increase of the amounts of BmORC6
arose at the second and seventh days (Figure 4).
The change of BmORCs with BmNPV infection
At 0 hpi, the relative copy numbers of all BmORCs were at a high
level, followed by a rapid decrease reaching their lowest levels
at 2–4 hpi. After this, the relative values increased to a moderate
level until 36 hpi at which time the relative copy number declined
again (Figure 5).
..........................................................................................................................................................................................................................................................................................................................................................................
www.bioscirep.org / Volume 31 (5) / Pages 353–361
357
H. Yang and others
Figure 4 Quantitative real-time PCR measurements of the expression of BmORC mRNA during embryo development in the eggs
The hibernating eggs were synchronized to the critical development
stage II and stored at 5◦ C. At day zero, the eggs were warmed according
to the simplified incubation method [26]. The larvae hatched on day 11.
B. mori cytoplasmic actin (A3) was used as an internal reference. The
inset shows the poorly expressed samples enlarged.
Figure 5 Copy number change post BmNPV infection
The fifth instar day-1 larvae were injected with BV of BmNPV. The sample
taken 1 h after BmNPV infection was labelled as 0 hpi, and the later
time points were the corresponding time intervals. The relative change
is the copy number of BmORC in BmNPV-infected larvae divided by the
copy number of the same mRNA in non-infected larvae of the same
stage.
DISCUSSION
The structures of BmORC
Like ScORCs [27], BmORC2, 3, 4 and the 6 subunit genes are
on different chromosomes (BmORC1 and BmORC5 have not
yet been mapped to a chromosome). A total of 35 introns were
identified in the six BmORCs and only 16 in DmORCs.
In the Silkworm Genome Database [http://silkworm.
genomics.org.cn/silkdb/), only two sequences (BGIBMGA012496-TA and BGIBMGA009708-TA) were labelled as subunits of BmORC. Alignment using the protein database of
NCBI showed an ORC2 superfamily conserved domain in
BGIBMGA012496-TA and a TIGR02928 conserved domain (belonging to ORC/CDC6 superfamily) in BGIBMGA009708-TA.
Comparison with our sequences showed that BGIBMGA012496TA and BGIBMGA009708-TA corresponded to BmORC2 and
BmORC4 respectively, but with different predicted start codons
and some differences in the predicted introns.
Judging from the similarity of the protein structures, genomic
sequences and the relevant ESTs, we concluded that BmORC1–
6 were complete. The structures of the BmOrc proteins (Figure 2) and the alignment of ORC/Cdc6 domains of BmOrc1p–5p
(BmOrc6p does not contain this domain) (Figure 6) revealed that
the amino acid sequences were more varied than expected, even
though they all contained an AAA+ domain [21]. There was a
unique, highly similar fragment at the C-terminals of Cf Orc6p
and BmOrc6p that may be specific for lepidopterans (Supplementary Figure S6).
The phylogenetic analysis (Figure 3) of the subunits of ScORC,
DmORC, BmORC, MmORC and HsORC showed that BmOrc
proteins grouped with the same clade as their counterparts. This
was unlike the members of the Bm-YELLOW protein family
[28] and the Bm-ASH protein family, [29] whose duplication
must have occurred at the time or after the evolutionary separation of the insects from other animals. Consequently, the six
BmORC subunits must have originated before the differentiation
of eukaryotes and evolved individually ever since.
BmORC expression patterns during embryo
development and in different tissues of fifth instar
day-6 larvae
Embryos at the critical development stage II [26] were incubated and started cell division and organogenesis immediately,
continuing to the sixth day when the main organs had formed
and the embryo entered into the period of embryonic reversal.
The expression level of BmORCs was high on the first day, and
then decreased day by day until the sixth day when the expression levels were lowest (Figure 4). On the seventh day the reversal was completed, and the embryo became longer and formed
the dorsal-side integument and digestive tube. Concurrently, the
copy numbers of the BmORCs increased slightly. On day 8, the
seta appeared, the ocellus and mandible became pigmented and
the taenidia emerged in the trachea. With the stage of organogenesis finished and the embryo breathing using trachea, DNA
..........................................................................................................................................................................................................................................................................................................................................................................
358
C The
Authors Journal compilation
C 2011
Biochemical Society
DNA replication ORC gene family in Bombyx mori
Figure 6
Alignment of conserved domains
The domains of BmOrc1p–5p (indicated in Figure 2) were aligned. Similar amino acids were shaded using the same grey
shading. The dashes ( − ) represent no amino acid.
Figure 7
Expression of BmORC in different tissues of the fifth instar day-6 larvae
The tissues were collected from fifth instar day-6 larvae. The relative copy numbers were calculated as in Figure 5.
H: head; Ep: epidermis; Asg: anterior silk gland; Msg: middle silk gland; Psg: posterior silk gland; Wd: wing disc; Te: testis;
He: haemocyte; Ov: ovary; Mt: malpighian tube; Tb: tracheal bush; Mg: midgut; Fb: fat body.
replication became stabilized and consequently the copy number
of BmORCs remained stable.
Two days before larvae hatched, the development of the embryo entered into the stage of embryogenesis perfection during
which the head and other body parts became pigmented one after
another. Until day 10 the expression of BmORCs stayed at a low
level. Subsequently, the newly hatched larvae appeared and the
BmORCs increased again, possibly as a result of the preparation
for feeding and rapid growth of the newly hatched larvae. Among
all subunits, the change of BmORC5 expression was the sharpest.
Perhaps BmOrc5p played additional roles, and this will require
further investigation.
The expression levels of BmORCs (Figure 7) varied from tissue to tissue according to the stage of development: as larvae
..........................................................................................................................................................................................................................................................................................................................................................................
www.bioscirep.org / Volume 31 (5) / Pages 353–361
359
H. Yang and others
grew to the fifth instar stage on day 6, the silk gland had nearly
matured and large quantities of silk fibroin were produced. The
fat body thickened rapidly for storing energy, and the organs of
the reproductive system started to prepare for germ cell genesis.
Consequently, the DNA replication in these tissues was vigorous,
so that the copy number of BmORCs was higher than that in the
haemocyte and midgut, which started to degenerate.
The different expression levels of different subunits of
BmORCs might reflect their additional non-replication functions.
Remarkably, the high-expression level and pronounced change
in the intron-free BmORC5 during both embryo development and
in different tissues might indicate that this subunit might play important additional roles. The relative copy numbers of BmORC2–
5 were increased in head tissue, suggesting that BmOrc2–5 proteins are involved in the brain development in the silkworm.
The relevance of BmORC and BmNPV DNA
replication
Baculovirus is the only virus with biphasic replication [30]. The
period 0–4 hpi of baculovirus is called the eclipse phase when
the copy number of virions decreased rapidly, and the relative
copy numbers of BmORCs followed the same trend. From 8 to
12 hpi was the replication fastigium of BV virions, at which time
the relative copy numbers of BmORCs rose again. At 18 hpi, the
replication of BV was almost completed and the relative copy
number of BmORCs declined slightly. The relative copy number
of BmORCs reached a second peak at 24–36 hpi, when there
was the period of occluded virus replication. After 48 hpi, the
replication of virions was nearly completed, and the copy number
of BmORCs decreased until 96 hpi (Figure 5). This suggested
that the viral replication of baculovirus affected the expression
of BmORCs, but the relevance and mechanism in detail remains
to be discovered.
REFERENCES
1
2
3
4
5
6
7
8
9
10
11
12
13
AUTHOR CONTRIBUTION
Hui-Peng Yang, Su-Juan Luo and Yi-Nü Li carried out the silkworm
rearing, tissue dissection, RNA extraction, cDNA synthesis and realtime PCR. Hui-Peng Yang carried out the data analysis and the
drafting of the manuscript. Yao-Zhou Zhang and Zhi-Fang Zhang
conceived the study and participated in its design. Zhi-Fang Zhang
helped to draft the manuscript. All authors read and approved the
final manuscript.
14
15
16
ACKNOWLEDGEMENTS
We thank Dr T. Kieser and Dr Q. Chen for helpful discussions and
critical reading of the manuscript prior to submission.
17
18
FUNDING
This work was supported by the National Natural Sciences Foundation of China [grant number 30770279] and the National High
Technology Research and Development Program of China (‘863’)
[grant number 2006AA10A119].
19
Bell, S. P. and Stillman, B. (1992) ATP-dependent recognition of
eukaryotic origins of DNA replication by a multiprotein complex.
Nature 357, 128–134
Diaz-Trivino, S., del Mar Castellano, M., de la Paz Sanchez, M.,
Ramirez-Parra, E., Desvoyes, B. and Gutierrez, C. (2005) The
genes encoding Arabidopsis ORC subunits are E2F targets and the
two ORC1 genes are differently expressed in proliferating and
endoreplicating cells. Nucleic Acids Res. 33, 5404–5414
Gossen, M., Pak, D. T., Hansen, S. K., Acharya, J. K. and Botchan,
M. R. (1995) A Drosophila homolog of the yeast origin recognition
complex. Science 270, 1674–1677
Dhar, S. K. and Dutta, A. (2000) Identification and characterization
of the human ORC6 homolog. J. Biol. Chem. 275, 34983–34988
Bell, S. P. (2002) The origin recognition complex: from simple
origins to complex functions. Genes Dev. 16, 659–672
Shimada, K. and Gasser, S. M. (2007) The origin recognition
complex functions in sister-chromatid cohesion in Saccharomyces
cerevisiae. Cell 128, 85–99
Speck, C., Chen, Z., Li, H. and Stillman, B. (2005)
ATPase-dependent cooperative binding of ORC and Cdc6 to origin
DNA. Nat. Struct. Mol. Biol. 12, 965–971
Iyer, L. M., Leipe, D. D., Koonin, E. V. and Aravind, L. (2004)
Evolutionary history and higher order classification of AAA+
ATPases. J. Struct. Biol. 146, 11–31
Dueber, E. L., Corn, J. E., Bell, S. D. and Berger, J. M. (2007)
Replication origin recognition and deformation by a heterodimeric
archaeal Orc1 complex. Science 317, 1210–1213
Gaudier, M., Schuwirth, B. S., Westcott, S. L. and Wigley, D. B.
(2007) Structural basis of DNA replication origin recognition by an
ORC protein. Science 317, 1213–1216
Clarey, M. G., Botchan, M. and Nogales, E. (2008) Single particle
EM studies of the Drosophila melanogaster origin recognition
complex and evidence for DNA wrapping. J. Struct. Biol. 164,
241–249
Bell, S. P., Mitchell, J., Leber, J., Kobayashi, R. and Stillman, B.
(1995) The multidomain structure of Orc1p reveals similarity to
regulators of DNA replication and transcriptional silencing. Cell 83,
563–568
Callebaut, I., Courvalin, J. C. and Mornon, J. P. (1999) The BAH
(bromo-adjacent homology) domain: a link between DNA
methylation, replication and transcriptional regulation. FEBS Lett.
446, 189–193
Schepers, A., Ritzi, M., Bousset, K., Kremmer, E., Yates, J. L.,
Harwood, J., Diffley, J. F. and Hammerschmidt, W (2001) Human
origin recognition complex binds to the region of the latent origin of
DNA replication of Epstein–Barr virus. EMBO J. 20, 4588–4602
Noguchi, K., Vassilev, A., Ghosh, S., Yates, J. L. and DePamphilis,
M. L. (2006) The BAH domain facilitates the ability of human Orc1
protein to activate replication origins in vivo. EMBO J. 25,
5372–5382
Dhar, S. K., Yoshida, K., Machida, Y., Khaira, P., Chaudhuri, B.,
Wohlschlegel, J. A., Leffak, M., Yates, J. and Dutta, A (2001)
Replication from oriP of Epstein–Barr virus requires human ORC
and is inhibited by geminin. Cell 106, 287–296
Lee, D. G. and Bell, S. P. (1997) Architecture of the yeast origin
recognition complex bound to origins of DNA replication. Mol. Cell.
Biol. 17, 7159–7168
Chesnokov, I., Remus, D. and Botchan, M. (2001) Functional
analysis of mutant and wild-type Drosophila origin recognition
complex. Proc. Natl. Acad. Sci. U.S.A. 98, 11997–12002
Pinto, S., Quintana, D. G., Smith, P., Mihalek, R. M., Hou, Z. H.,
Boynton, S., Jones, C. J., Hendricks, M., Velinzon, K.,
Wohlschlegel, J. A. et al. (1999) Latheo encodes a subunit of the
origin recognition complex and disrupts neuronal proliferation and
adult olfactory memory when mutant. Neuron 23, 45–54
..........................................................................................................................................................................................................................................................................................................................................................................
360
C The
Authors Journal compilation
C 2011
Biochemical Society
DNA replication ORC gene family in Bombyx mori
20 Huang, Z., Zang, K. and Reichardt, L. F. (2005) The origin
recognition core complex regulates dendrite and spine
development in postmitotic neurons. J. Cell Biol. 170, 527–535
21 Duncker, B. P., Chesnokov, I. N. and McConkey, B. J. (2009) The
origin recognition complex protein family. Genome Biol. 10, 214
22 Wang, X., Carstens, E. B. and Feng, Q. (2006) Characterization of
Choristoneura fumiferana genes of the sixth subunit of the origin
recognition complex: CfORC6. J. Biochem. Mol. Biol. 39, 782–787
23 Chesnokov, I. N., Chesnokova, O. N. and Botchan, M. (2003) A
cytokinetic function of Drosophila ORC6 protein resides in a
domain distinct from its replication activity. Proc. Natl. Acad. Sci.
U.S.A. 100, 9150–9155
24 Balasov, M., Huijbregts, R. P. and Chesnokov, I. (2009) Functional
analysis of an Orc6 mutant in Drosophila. Proc. Natl. Acad. Sci.
U.S.A. 106, 10672–10677
25 Chesnokov, I. N. (2007) Multiple functions of the origin recognition
complex. Int. Rev. Cytol. 256, 69 – 109
26 Hongsheng, L. (1991) The Sericultural Science in China,
pp. 413–432, Shanghai Scientific and Technical Publishers,
Shanghai
27 Spingola, M., Grate, L., Haussler, D. and Ares, Jr, M. (1999)
Genome-wide bioinformatic and molecular analysis of introns in
Saccharomyces cerevisiae. RNA 5, 221–234
28 Xia, A. H., Zhou, Q. X., Yu, L. L., Li, W. G., Yi, Y. Z., Zhang, Y. Z. and
Zhang, Z. F. (2006) Identification and analysis of YELLOW protein
family genes in the silkworm, Bombyx mori. BMC Genom. 7, 195
29 Zhou, Q., Zhang, T., Xu, W., Yu, L., Yi, Y. and Zhang, Z. (2008)
Analysis of four achaete-scute homologs in Bombyx mori reveals
new viewpoints of the evolution and functions of this gene family.
BMC Genet. 9, 24
30 Hongsheng, L. (1998) Molecular Biology of Insect Viruses, p. 151,
China Agricultural Scientech Press, Beijing
31 Daojun, C., Qingyou, X., Zeyang, Z., Cheng, L. and Zhonghuai, X.
(2003) cDNA libraries construction and large-scale ESTs
sequencing of the silkworm. Acta Sericol. Sin. 29, 335–339
32 Mita, K., Morimyo, M., Okano, K., Koike, Y., Nohata, J., Kawasaki,
H., Kadono-Okuda, K., Yamamoto, K., Suzuki, M. G., Shimada, T.
et al. (2003) The construction of an EST database for Bombyx mori
and its application. Proc. Natl. Acad. Sci. U.S.A. 100,
14121–14126
Received 27 April 2010/13 December 2010; accepted 17 December 2010
Published as Immediate Publication 17 December 2010, doi 10.1042/BSR20100047
..........................................................................................................................................................................................................................................................................................................................................................................
www.bioscirep.org / Volume 31 (5) / Pages 353–361
361
Biosci. Rep. (2011) / 31 / 353–361 (Printed in Great Britain) / doi 10.1042/BSR20100047
SUPPLEMENTARY ONLINE DATA
Identification and characterization of the DNA
replication origin recognition complex gene family
in the silkworm Bombyx mori
Hui-Peng YANG*†, Su-Juan LUO*, Yi-Nü LI*, Yao-Zhou ZHANG†1 and Zhi-Fang ZHANG*1
*The Biotechnology Research Institute, Chinese Academy of Agricultural Sciences, Beijing 10081, People’s Republic of China, and
†Institute of Biochemistry, Zhejiang Sci-Tech University, Hangzhou, Zhejiang Province 310018, People’s Republic of China
See the following pages for Supplementary Figures S1–S6 and
Supplementary Table S1
1
Correspondence may be addressed to either of these authors (email [email protected] or [email protected]).
www.bioscirep.org / Volume 31 (5) / Pages 353–361
H. Yang and others
Figure S1
Aligment of ORC1
..........................................................................................................................................................................................................................................................................................................................................................................
C The
Authors Journal compilation
C 2011
Biochemical Society
DNA replication ORC gene family in Bombyx mori
Alignments of individual Orc1 proteins from different species were carried out using ClustalX. The ruler for the sequences is at the bottom.
Similar amino acids are shaded using the same colour. The dashes ( − ) indicate no amino acid. There was good similarity between the fragments
containing conserved domains. Aa, Aedes aegypti; Cq, Culex quinquefasciatus; Dm, Drosophila melanogaster; Am, Apis mellifera; Nv, Nasonia
vitripennis; Hs, Homo sapiens; Bm, Bombyx mori; Sc, Saccharomyces cerevisae. AaOrc1p, NCBI accession number XP_001660622: CqOrc1p, NCBI
accession number XP_001861388: DmOrc1p, NCBI accession number NP_477303: AmOrc1p, NCBI accession number XP_392056: NvOrc1p,
NCBI accession number XP_001604978: HsOrc1p, NCBI accession number NP_004144: NmOrc1p, NCBI accession number GQ214390: ScOrc1p,
NCBI accession number P54784.
Figure S2
Aligment of ORC2
Alignments of individual Orc2 proteins from different species were carried out using ClustalX. The ruler for the sequences
is at the bottom. Similar amino acids are shaded using the same colour. The dashes ( − ) indicate no amino acid.
There was good similarity between the fragments containing conserved domains. Cq, Culex quinquefasciatus; Aa, Aedes
aegypti; Dm, Drosophila melanogaster; Tc, Tribolium castaneum; Bm, Bombyx mori; Nv, Nasonia vitripennis; Hs, Homo
sapiens; Sc, Saccharomyces cerevisae. CqOrc2p, NCBI accession number XP_001848025; AaOrc2p, NCBI accession
number XP_001658369; DmOrc2p, NCBI accession number NP_477303; TcOrc2p, NCBI accession number XP_966877;
BmOrc2p, NCBI accession number GQ214391: NvOrc2p, NCBI accession number XP_0016040001; HsOrc2p, NCBI
accession number NP_006181; ScOrc2p, NCBI accession number CAA79883.
..........................................................................................................................................................................................................................................................................................................................................................................
www.bioscirep.org / Volume 31 (5) / Pages 353–361
H. Yang and others
Figure S3
Aligment of ORC3
Alignments of individual Orc3 proteins from different species were carried out using ClustalX. The ruler for the sequences
is at the bottom. Similar amino acids are shaded using the same colour. The dashes ( − ) indicate no amino acid. There
was good similarity between the fragments containing conserved domains. Tc, Tribolium castaneum; Bm, Bombyx mori; Aa,
Aedes aegypti; Cq, Culex quinquefasciatus; Dm, Drosophila melanogaster; Nv, Nasonia vitripennis; Hs, Homo sapiens; Sc,
Saccharomyces cerevisae. TcOrc3p, NCBI accession number XP_975229: BmOrc3p, NCBI accession number GQ214392;
AaOrc3p, NCBI accession number XP_001648923; CqOrc3p, NCBI accession number XP_001866560; DmOrc3p, NCBI
accession number AAD39472; NvOrc3p, NCBI accession number XP_001606719; HsOrc3p, NCBI accession number
NP_862820; ScOrc3p, NCBI accession number, P54790.
..........................................................................................................................................................................................................................................................................................................................................................................
C The
Authors Journal compilation
C 2011
Biochemical Society
DNA replication ORC gene family in Bombyx mori
Figure S4
Aligment of ORC4
Alignments of individual Orc4 proteins from different species were carried out using ClustalX. The ruler for the sequences
is at the bottom. Similar amino acids are shaded using the same colour. The dashes ( − ) indicate no amino acid.
There was good similarity between the fragments containing conserved domains. Am, Apis mellifera; Nv, Nasonia vitripennis; Bm, Bombyx mori; Cq, Culex quinquefasciatus; Aa, Aedes aegypti; Dm, Drosophila melanogaster; Tc, Tribolium
castaneum; Hs, Homo sapiens; Sc, Saccharomyces cerevisae. AmOrc4p, NCBI accession number XP_625030; NvOrc4p,
NCBI accession number XP_001600474; BmOrc4p, NCBI accession number GQ214393; CqOrc4p, NCBI accession number XP_001846465; AaOrc4p, NCBI accession number XP_001653985; DmOrc3p, NCBI accession number AAD39473;
TcOrc4p, NCBI accession number XP_970921; HsOrc4p, NCBI accession number NP_002543; ScOrc4p, NCBI accession
number P54791.
..........................................................................................................................................................................................................................................................................................................................................................................
www.bioscirep.org / Volume 31 (5) / Pages 353–361
H. Yang and others
Figure S5
Aligment of ORC5
Alignments of individual Orc5 proteins from different species were carried out using ClustalX. The ruler for the sequences
is at the bottom. Similar amino acids are shaded using the same colour. The dashes ( − ) indicate no amino acid. There
was good similarity between the fragments containing conserved domains. Aa, Aedes aegypti; Cq, Culex quinquefasciatus;
Dm, Drosophila melanogaster; Tc, Tribolium castaneum; Bm, Bombyx mori; Hs, Homo sapiens; Sc, Saccharomyces cerevisae. AaOrc5p, NCBI accession number XP_001655299; CqOrc5p, NCBI accession number XP_001869238; DmOrc5p,
NCBI accession number NP_477132; TcOrc5p, NCBI accession number XP_974215; BmOrc5p, NCBI accession number
GQ214394; HsOrc5p, NCBI accession number NP_002544; ScOrc5p, NCBI accession number, P50874.
..........................................................................................................................................................................................................................................................................................................................................................................
C The
Authors Journal compilation
C 2011
Biochemical Society
DNA replication ORC gene family in Bombyx mori
Figure S6
Aligment of ORC6
Alignments of individual Orc6 proteins from different species were carried out using ClustalX. The ruler for the sequences
is at the bottom. Similar amino acids are shaded using the same colour. The dashes ( − ) indicate no amino acid.
There was good similarity between the fragments containing conserved domains. Tc, Tribolium castaneum; Hs, Homo
sapiens; Cf, Choristoneura fumiferana; Bm, Bombyx mori; Cq, Culex quinquefasciatus; Aa, Aedes aegypti; Dm, Drosophila
melanogaster; Sc, Saccharomyces cerevisae. TcOrc6p, NCBI accession number XP_973201; HsOrc6p, NCBI accession
number NP_0055136; CfOrc6p, GenBank® accession number ABR09538; BmOrc6p, NCBI accession number GQ214395;
CqOrc6p, NCBI accession number XP_001846657; AaOrc6p, NCBI accession number XP_001655299; DmOrc6p, NCBI
accession number NP_477319; ScOrc6p, NCBI accession number, P38826.
..........................................................................................................................................................................................................................................................................................................................................................................
www.bioscirep.org / Volume 31 (5) / Pages 353–361
H. Yang and others
Table 1 Primers used in the present study
F, forward; R, reverse.
Gene
Name
Primer (5 →3 )
Annotation
BmORC1
5-ORC1-1
TTTGAAGCTGTGTGTGAGTGTAAGG
For 5 RACE
5-ORC1-2
TGCTAATGCTCTCTCCGGTAAGTCC
For 5 RACE
5-ORC1-3
TCAAGTAATGAGCAAGCCTGCTCCC
For 5 RACE
N-ORC1F1
AGGAATGTTAGTGAATATTAAATTGAC
For confirmation
ORC1-RT-F
CGCTGTACAGTTAATCGCAAGGAAAGTC
For real-time PCR
ORC1-RT-R
CATCCGACCCTGTTCTTTCGACCTC
For real-time PCR
ORC2-1
GCAGAGCTCAACTATAACCATCGAC
For 3 RACE
ORC2-2
CCGAGTCTCACCATTAAGGATATCC
For 3 RACE
ORC2-RT-F
TTCATGGTGGGATGTAACTTCG
For real-time PCR
ORC2-RT-R
AGAGATCCTTAAATGGTAGTCCTTG
For real-time PCR
ORC 3-1
GTACATATCTTCCTTGCCCATAGTG
For 3 RACE
ORC 3-2
CCCATATGAGGTGTCATCGAAAC
For 3 RACE
BmORC2
BmORC3
BmORC4
BmORC5
BmORC6
BmactinA3
ORC3-RT-F
AGTTCGTACATATCTTCCTTGCCCATAG
For real-time PCR
ORC3-RT-R
CGTCTGTGAGCAATTCGAACGC
For real-time PCR
ORC4-1
CTCGGTACTTCACCAGCTCTCTAG
For 3 RACE
ORC4-2
CTGAATGGCCTTGTACATAGTG
For 3 RACE
ORC4-RT-F
CTTAAAGCTATCACAGCGCAGATGC
For real-time PCR
ORC4-RT-R
CCATAATGTCTAAGCGACTTGTTACACC
For real-time PCR
ORC4-3
GAAGTCAATGATGACGACCGGTATG
For 3 RACE
ORC5F
GAGTGTATTCTATAGGCCATGTCGAG
For confirmation
ORC5R
GCTCAACTAATGTCGCTATTTGTGC
For confirmation
ORC5-RT-F
ACAATCCGCCCAAAGAAGACAAG
For real-time PCR
ORC5-RT-R
GCTCAACTAATGTCGCTATTTGTGC
For real-time PCR
ORC6-1
CGACTGGAATTGGATGTCGACAGAC
For 3 RACE
ORC6-2
GAATTGGATATGAGTCTTCCTC
For 3 RACE
ORC6-3
GTCAATTTGCCGATACACACTTTGC
For 3 RACE
ORC6-RT-F
GTATGGTACTGAATTTGATGTTAAGCAAGC
For real-time PCR
ORC6-RT-R
ACAGCCATACACACATACTGAGGAAGAC
For real-time PCR
BmactinA3-F
CGCCGTGTTCCCCTCGATCGT
For reference
BmactinA3-R
TCTGGGTCATCTTCTCTCTGTTG
For reference
NUP
AAGCAGTGGTATCAACGCAGAGT
Nested universal primer
3 -CDS
AAGCAGTGGTATCAACGCAGAGTAC(T)30 V N
Using as primer for cDNA synthesis (3 RACE)
V = A, C or G; N = A, T, C or G
5 -CDS
AAGCAGTGGTATCAACGCAGAGTACG(C)9 DN
Using as primer for cDNA synthesis (5 RACE)
D = A, T or G; N = A, T, C or G
Received 27 April 2010/13 December 2010; accepted 17 December 2010
Published as Immediate Publication 17 December 2010, doi 10.1042/BSR20100047
..........................................................................................................................................................................................................................................................................................................................................................................
C The
Authors Journal compilation
C 2011
Biochemical Society