Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
SUPPLEMENTAL MATERIAL Supplemental Methods: Table 1. List of Q-RT-PCR primers Genes Forward Reverse Actb GGCTGTATTCCCCTCCATCG CCAGTTGGTAACAATGCCATGT Cd45 ACCACCAGGTGAATGTCAATTT CTTGCTTTCCCTCGGTTCTTT Arg1 TTTTTCCAGCAGACCAGCTT AGAGATTATCGGAGCGCCTT Ido TGGCGTATGTGTGGAACCG CTCGCAGTAGGGAACAGCAA Il17 CTCCAGAAGGCCCTCAGACTAC GGGTCTTCATTGCGGTGG Tgfb CTCCCGTGGCTTCTAGTGC GCCTTAGTTTGGACAGGATCTG Ifng GATGCATTCATGAGTATTGCCAAGT GTGGACCACTCGGATGAGCTC Ccl2 TTAAAAACCTGGATCGGAACCAA GCATTAGCTTCAGATTTACGGGT Foxp3 GGCCCTTCTCCAGGACAGA GCTGATCATGGCTGGGTTGT Tbx21 CAACAACCCCTTTGCCAAAG TCCCCCAAGCAGTTGACA Gzb CCACTCTCGACCCTACATGG GGCCCCCAAAGTGACATTTATT Fizz1 TGCTGGGATGACTGCTACTG AGCTGGGTTCTCCACCTCTT Mgl2 GGATCCCAAAATTCCCAGTT TCCCTCTTCTCCAGTGTGCT Mrc1 ATGCCAAGTGGGAAAATCTG TGTAGCAGTGGCCTGCATAG Nos2 GTTCTCAGCCCAACAATACAAGA GTGGACGGGTCGATGTCAC Scgb1 CCTTTCAACCCTGGCTCAGA AGGGTATCCACCAGTCTCTTCAG Supplementary method 1. Mass Spectrometry Analysis. Mass spectrometry performed as previously described in Taguchi A et al, 2011 Cancer Cell (see below reference 1). Briefly, lung cancer cell lines were grown in RPMI1640/10% FBS supplemented with 13C-lysine per standard SILAC protocol. Extracts from the nucleus, surface, cell culture media, and a total cell extract were analyzed separately. The tandem mass spectra were searched against a composite database of IPI human (v3.57) and IPI bovine (v3.43), with a fixed modification of 6.020129 mass units added to lysine residues for database searching to account for incorporation of 13C-lysine. PeptideProphet and ProteinProphet software tools were used to estimate significance and abundance of peptide and protein matches (Faca et al). Initial peptides identified with PeptideProphet were filtered for those only matching the human and not the bovine database, which were then submitted to ProteinProphet. Protein matches were filtered to a maximum 5% error, with the total number of spectral counts for each protein group used for semi-quantitative analyses. Each dataset was normalized to the total number of spectral counts of each compartment. Supplementary method 2. Western Blot Analysis. After 24 and 48 hours, protein was collected from cell lines by lysis using RIPA buffer including protease and phosphatase inhibitors (Roche). Protein concentration was measured using Bradford Assay (Bio-Rad Laboratories). Western blot analysis was performed using 20 µg protein/lane according to standard procedures using polyvinylidene fluoride (PVDF) membranes and an enhanced chemiluminescence system (GE Healthcare). Anti-phospho STAT3 (Tyr705) (Clone D3A7, Cell Signaling Technology) and anti- β-actin (Clone AC-15, Sigma) were used at 1:2000 and 1:20000 dilution, respectively. Supplemental Figure Legends: Supplementary Figure 1. Gating method for FACS analysis and sorting. After gating live, single CD45+ cells, each population were differentiated as:1) Alveolar Macrophage (CD11c+F4/80+); 2) Tumor Associated Macrophages (M1) (F4/80+/ Ly6C-/MHCII+); 3) M-MDSC (F4/80+/Ly6Chi/MHCII-) and 4) G-MDSC (CD11b+/Ly6Ghi). Supplementary Figure 2. (A) Heatmap representing IL-6/STAT3 pathway genes expression status. Gene (mRNA) expression status for IL6, IL6ST, IL6R and STAT3 in 39 non-small cell lung cancer cell lines. The table summarizes histology, KRAS status, plus IL6 and STAT3 expression in four representative cell lines used. (B-C) Mass spectrometric quantification of IL-6 and STAT3 in lung cancer cell lines. Analysis was performed separately on cell culture media and a nuclear, surface, and total cell extract. (B) IL-6 is predominantly found secreted into the cell culture media in four lung cancer cell lines. (C) STAT3 is found predominantly in the nuclear and surface compartments of these cells. (D) Siltuximab and Tocilizumab decreased STAT3 activation in NSCLC cell lines. NSCLC cell lines were incubated with siltuximab (S) (10g/mL) or tocilizumab (T) (1g/mL) for 24h or 48h and western blot was performed to detect p-STAT3 expression. Supplementary Figure 3. Increased levels of IL-6 in bronchoalveolar lavage fluid (BALF) of CC-LR mice during tumor progression. (A) BALF from LR and CC-LR mice were collected at the age of 14 weeks (B) BALF were collected at the age of 6 weeks, and 14 weeks from CC-LR mice treated or not treated with anti-IL-6 antibody (aIL-6). The IL-6 levels were measured by ELISA. (n=4 animals per group) (data represent means ± SEM **p<0.005. ****p<0.0001). Supplementary Figure 4. Lung lesion distribution in lungs of CC-LR mice. Multiple slides from CC-LR mice at the age of 14 weeks were evaluated for distribution of hyperplastic vs adenoma/adenocarcinoma lesions and overall percentages of lesion compared between anti IL-6 treated and non-treated groups were compared. Supplementary Figure 5. Relative expression of Arg1 mRNA normalized by Cd45 expression in lungs of CC-LR mice at the age of 14 weeks after IgG1 (n=4) or IL-6 blockade (n=5) (data represent means ± SEM ****P < 0.0001). Supplementary Figure 6. Increased levels of IL-6 in bronchoalveolar lavage fluid (BALF) of CC-LR mice after NTHi exposure. (A) BALF from LR and CC-LR mice were collected after 8 weeks of NTHi exposure (B) BALF from CC-LR were collected after 8 weeks of NTHi exposure and after IL-6 blockade. The IL-6 levels were measured by ELISA. (n=4 animals per group) (data represent means ± SEM **p<0.005. ****p<0.0001). Supplementary Figure 7. Relative expression of Scgb1 (CCSP) mRNA in lungs of CCLR mice at the age of 14 weeks after IgG1 (n=4) or IL-6 blockade (n=4) in the absence or presence of NTHi-induced COPD-type inflammation (data represent means ± SEM). Supplemental References: 1. Taguchi A, Politi K, Pitteri SJ, Lockwood WW, Faca vM, Kelly-Spratt K, and et al. Lung cancer signatures in plasma based on proteome profiling of mouse tumor models. Cancer Cell. 2011 Sep 13;20(3):289-99