Download to view a document on Determining Whether My Water Is

How can I check whether my water is clean or
contaminated with plant pathogens?
Gary W. Moorman, Prof. of Plant Pathology
The Pennsylvania State University, Department of Plant Pathology and Environmental Microbiology
The first indication that would lead you to believe that you have a plant pathogen in your irrigation water
is a report from a plant disease clinic saying that the sick plant you submitted is infected with a specific
plant pathogen. Either you happen to know or the clinic may tell you that the particular pathogen found
can spread in several ways, including via irrigation water. Keep in mind that most plant pathogens can
spread or get into your crop from more than one source. Water is only one possibility. Review the
information in ‘How do plant pathogens enter irrigation systems’, to refresh your memory on pathogen
harbors and spread.
If you suspect that a plant pathogen affecting your crop is coming from
your water or if you are treating water you know contains plant pathogens
and you want to verify that you are eliminating the pathogen, then you
need have the water tested to determine whether the water really does or
does not contain that pathogen. It is not feasible to routinely test water for
everything. You need to look for a specific type of plant pathogen or
target species. The money that can be saved by determining that your
water is free of plant pathogens and does not require the installation and
operation of a special treatment system may, in the long run, be well worth
the cost of testing. On the other hand, the money saved by eliminating plant pathogens found in your
water thereby reducing crop losses could also significantly add to your profit margin.
Here, we provide an overview of the methods used to detect each of the important plant pathogens.
After reviewing this module you will…





know where, when, and how much water to collect for testing
know what baits are appropriate for specific plant pathogens and how to deploy them
understand what methods are applied to initially determine that plant pathogens are in the
water
understand what information you must receive from a testing lab for the report to be
useful to you
learn what kits or methods are available to you to do your own testing
Plant pathogens from almost every major group of living organisms have been found in irrigation water at
some time or place. Fungi, bacteria, nematodes, viruses, and the fungus-like Oomycetes all have species
that are sometimes found in water. Some actually reside there while others just happen to fall in!
Alternaria, a fungus
Bacteria stained for
Nematode
microscope examination
Phytophthora
(Oomycetes)
Crystalline inclusion
composed of virus
particles in a plant cell
There are two standard ways water is sampled in order to detect plant pathogens:


collecting and processing water
deploying a bait and then isolating organisms from or testing tissue from the bait
NOTE: A positive test tells you that the pathogen is present but a
negative test requires cautious interpretation. If the pathogen is not
found by the test, it could mean…



the pathogen is not present
the pathogen is present in such low numbers that it was
missed in the sampling or the test is not sensitive enough to
detect it at such a low concentration
the plant pathogen is present but the sample was taken at
the wrong place or time and it was missed
If testing sounds like a “game of chance”, you have good hearing!
Sometimes repeated sampling at various locations and at various times of the year are required.
Collecting water
A ‘grab sample’ is a volume of water collected
at a given time and place. It is important to
collect water at a time and location most likely
to capture the plant pathogen. Most plant
pathogen populations will be highest during the
growing season while water temperatures are
moderate and not too high rather than when
plants are dormant and the water is cold or
frozen. If a laboratory is performing the tests, it
is important to communicate with that lab to
determine when they can process the sample, the
volume of water they required, and how it
should be stored and shipped. In general, too
much water is better than too little and the water
needs to be kept cool and shipped rapidly to the
lab so that the target organism does not die.
A bottle or bucket may be all that is required to collect a
sample from the surface.
Where the grab samples are collected depends on the reasons
you are sampling. If you wish to know whether the water
being delivered to the crop harbors pathogens, then samples
should be taken at the pump inlet, at an emitter, from a
sprinkler head, or at the hose end. If you want to know what
plant pathogens are entering the water from a crop, samples
taken close to where runoff from the crop enters the reservoir
or holding tank are most likely to contain plant pathogens.
Research has shown that the pathogen population coming from
a crop decreases with distance from the runoff entry point in
outdoor holding ponds.
Water should be taken from the mid- to upper levels, avoiding
the collection of sediment. Tools are available that seal the
container until you place it at the desired depth and then pull a
cord to open a valve to fill the container. If just surface
samples are taken, a bucket with a rope tied to the handle
works. (Remember to hang onto the end of the rope when you
toss out the bucket! It’s amazing how far you can toss a bucket
underhand.).
If water from a certain depth is required,
there are tools that hold a sealed jar on the
end of the long handle. The tool seals the jar
until a cord is pulled to open a valve.
When sampling from indoor greenhouse recycling tanks in
active use, water can be taken from any depth. When in doubt
as to where the best samples should be taken, take samples
from several locations but keep the grab samples in separate
containers rather than mixing them in one bottle. Results from
tests of water from different locations may tell you where it is best to take future samples and where to
not bother sampling.
Clean plastic bottles or jugs can be used. Clean carbonated
beverage bottles are fine because they seal well. Avoid using glass
containers unless you are certain they can be shipped without
breakage. Label each bottle clearly. Because most indelible pens
will not mark a wet surface, label the outside of bottles before
taking the samples. Alternatively, write the information on a
narrow plastic or wooden flower pot label with an indelible
marker and insert the label into the bottle or attach a wooden,
metal, or heavy paper tag to the bottle neck with a twist-tie. In
addition to labeling the bottles, make a list of where, when, and
how many samples were taken noting which bottle corresponds to
each sample. Put one copy of this list in a sealed plastic bag with
the samples and keep another copy for your records. If you think it
is likely that the water contains a significant amount of a pesticide
or other chemical that could be toxic to the person testing the
water, please be certain the person testing the water is aware of the
possible hazard.
Once collected, the water should be immediately placed out of
direct sunlight, preferably in a covered box or cooler with cold
packs or plastic bags of ice that are not in close contact with the
bottles.
Label the sample bottles well
Cardboard panels or bubble wrap can be used to separate the cold packs or ice from the bottles. It is best
to process the samples within 24 hours if you are doing the work or ship the samples to the lab
immediately. Overnight shipping/next day delivery is best if the lab is prepared to receive them that
quickly. (It does little good to ship them Friday if the lab is closed on Saturday!) Be certain the lab knows
they are coming. If the samples must be held prior to processing or shipping, put them in a refrigerator as
if you were storing milk because some detection methods require that the pathogen be alive during the
test (see below).
Processing water
Usually the pathogen population in the water is low. One way to increase the odds of detecting a
pathogen is to concentrate it by removing the pathogen from the sample or removing water from the
sample. This is done in one of two ways. By knowing the identity of the plant pathogen of concern, a
filter of a pore size that captures the pathogen while allowing the water to pass through can be used. This
works particularly well for nematodes, fungi and the fungus-like Oomycetes because of their size. Filters
that have a pore size of 5 to 10 µm are usually sufficient. (1 µm is approximately 0.00004 inches). To
capture bacteria, pores must be no larger than 0.2 µm and these clog quickly with debris in the water.
Usually a gentle vacuum is applied during collection in order to process the water more quickly than
occurs if only gravity is relied upon. However, the vacuum must not be too high and it is best to turn off
the vacuum before all the water is pulled through and before the filter runs dry. Otherwise, the target
organism may be damaged.
Vacuum filtration system
Nematodes are actually not very good swimmers
and tend to settle out of the water column. The
water sample can be allowed to sit, undisturbed
in a cool place out of direct sunlight overnight.
Then most of the water can be slowly and
carefully decanted off the top while trying to not
disturb the debris in the bottom of the bottle.
Most of the nematodes will be in that bottom
residue. Pretend you are decanting a fine wine
and trying to leave the dregs in the bottom of the
bottle. In this case though, you want the dregs!
The dregs can be shaken gently and a small
amount poured into a clear container for
examination with a microscope or a good
dissecting scope in order to see the nematodes.
Plant parasitic nematodes have a hollow, spearlike mouth part called a stylet. Free-living
nematodes, ones that are not plant parasites, lack
the stylet. Their mouth part is a cylinder.
The ultra-filtration required for viruses is expensive but may be necessary to concentrate them. Another
method for virus concentration is to centrifuge or spin the water at high speed for an extended period of
time, forcing the virus particles to the bottom of the container. Then the water can be poured off. You
need an expensive, high speed centrifuge to spin the sample up to more g’s than an astronaut could
handle. But some labs are equipped to do it. A third technique for concentrating viruses is to add iron
chloride or polyethylene glycol at the proper concentration to cause the virus particles to clump together
(flocculate or precipitate) and settle to the bottom of a container.
Once a pathogen is concentrated by filtering, decanting, centrifuging, or clumping and excess water is
removed, then a test can be run on the material collected (see below).
Baiting
Instead of taking a water sample at one place and time, a bait can be deployed in the water source or
reservoir. Bacteria, fungi, and Oomycetes can be allowed to colonize bait placed in the water for a period
of time. The colonized bait can then be processed for the target species (the plant pathogen). You could
collect water and use a bait to capture the pathogen from a grab sample but baiting directly in the
reservoir is a better method.
The bait chosen is often a leaf or fruit from a health plant that is susceptible to the pathogen. The table
below lists some baits that have been used successfully to detect certain types of target species. There is
no ‘universal bait’ effective for any or all species. Any bait will be somewhat selective, meaning that it
will be colonized by some organisms and not by others or some species and not by others. Rhododendron
leaves capture many, but not all, species of the Oomycetes Phytophthora in water. Healthy grass blades
can trap many species of the Oomycetes Pythium.
Generally the bait is deployed in water for 24 to 48 hours but some can be deployed for up to a week
without deteriorating because of colonization by non-target species. If the bait is not a whole plant part
but is a slice from a leaf or fruit, opportunistic organisms often colonize the bait more quickly than the
target species. For example, researchers have found that the population of Pythium in water can be at least
ten times higher than that of Phytophthora. Opportunistic Pythium species will colonize a wounded bait
more rapidly than a Phytophthora. If leaf disks for fruit slices are used as bait, they are usually deployed
for shorter periods than whole leaves or whole fruit. If a water sample is collected and brought indoors, it
can be baited under more controlled conditions, at a temperature that favors the target species and inhibits
non-target species.
One advantage of baiting is that some plant pathogens may actually be attracted to the bait. The zoospores
of Phytophthora and Pythium, for example, may swim to the bait. The second advantage of baiting is that
over the time of deployment, a larger volume of water will come into contact with the bait than can be
collected in a grab sample. These two advantages increase the probability of detecting a plant pathogen
whose population in water is low.
Wounded or whole fruit can be used as bait.
Whole leaves or leaf disks can be used as bait.
Fruit or whole leaves can be placed in an onion bag or similar net bag and deployed. Note that turtles,
fish, or other animals may also be attracted to the bait. Fruit can be put in a wide-mouthed perforated
plastic jar to prevent such feeding. Leaves or leaf disks can be sandwiched between pieces of screening
or placed in a perforated screw-cap container.
One plastic jar, (on the left) was filled with sand to anchor the line
that keeps the bait holder in place. To create a bait holder, the
threaded part of a second jar was cut off. The center of the jar cap
was drilled out so that two pieces of screening could be inserted
into the cap and the cap then screwed onto the jar threads. One bait
holder was attached to the anchor in order to have bait at the
bottom of the reservoir while a second bait holder was attached to
a plastic shower curtain ring, allowing that holder to slide up and
down the anchor twine and always be at the water surface even as
the water level changed (below, left). ‘Simple and inexpensive’
are the watch-words in this endeavor, especially if you are sampling repeatedly or deploying baits at
several locations.
Floating bait holder.
Sandwich of grass blades and
fiberglass screen.
Deploying baits and sampling can be a pleasant day on the water.
(Hey, are they also trolling for bass?)
Mesh bag of whole rhododendron
leaves attached to floats.
Baits used to detect plant pathogens in water
Plant
Part
Target
Apple (Malus domestica)
Fruit
Phytophthora
Camellia (Camellia japonica)
Leaf
Phytophthora
Cucumber (Cucumis sativus)
Fruits
Phytophthora and Pythium
Lupine (Lupinus angustifolius)
Seedling
Phytophthora and Pythium
Chamaecyparis
Needles
Phytophthora
Grass, creeping bentgrass (Agrostis stolonifera)
Leaf
Pythium
Oak (Quercus spp.)
Leaflets
Phytophthora
Pear (Pyrus spp)
Fruit
Phytophthora
Rhododendron (Rhododendron spp.)
Leaf
Phytophthora
Shore juniper (Juniperus conferta)
Needles
Phytophthora
Strawberry (Fragaria semperflorens)
Plant
Phytophthora
Processing baits
Baits, by definition, are colonized by the target species and usually by other living things. They are
actually rotting and must be processed promptly and can’t be held indefinitely, even when refrigerated.
Depending upon the target species, the bait can be rinsed in running water or even dipped in 70% alcohol
to reduce the number of non-target species on the surface. Using a clean knife, scalpel, or needle, some of
the colonized bait can be transferred to an agar that favors the growth of the target species. Or a bit of
tissue can be examined with a microscope to find spores or other structures characteristic of the target
species. Also, one of the tests described below can be performed on tissue from the bait.
Pythium, growing on a semi-selective agar (left) and water agar (right)
from grass blade baits.
Tests for plant pathogens
Many methods designed to detect human pathogens have been adapted to detect plant pathogens. These
include
 direct observation of pathogens using a microscope (from samples trapped on filter paper, tissue
taken from colonized bait, or a culture of the organism isolated from a filter or bait)
 inoculation of indicator plants (plants known to express specific symptoms when infected by
particular viruses)
 serological or immunological tests (based on antibodies binding to proteins, polysaccharides
(complex sugars), or other large molecules known to be characteristic of a particular plant
pathogen)
Living fungi and Oomycetes can be grown on agar and then identified by direct observation by those
trained to do so. Some agar recipe components may favor the growth of the target organism while other
components inhibit non- target organisms. These agars are termed ‘semi-selective’ because few things
other than the target organism grow on them. Usually the piece of filter paper used to concentrate the
pathogen from water is inverted onto the agar surface and allowed to incubate overnight. The filter paper
can then be removed and the plate incubated until colonies of the target organism are seen. It is often
possible to determine that a Pythium or a Fusarium or a Phytophthora is growing on the agar but close
observations or other tests are required to say exactly which Pythium, Fusarium, or Phytophthora species
is present. It is important to know exactly which species is present because not all species are plant
pathogens of your particular crop. It is not unusual to obtain more than one species of target organism
from a sample.
Semi-selective media for Pythium and Phytophthora:
PARP (pimarcin, ampicillin, rifampicin, pentachloronitrobenzene).
Jeffers, S. N, and Martin, S. B. 1986. Plant Disease 70:1038-1043.
500 ml
corn meal agar or V8 juice agar
2.5 mg
pimaricin (sold as Delvocid)
125 mg
sodium ampicillin
5 mg
rifampicin
50 mg
pentachloronitrobenzene (PCNB, sold asTerraclor fungicide)
PARP+B (pimarcin, ampicillin, rifampicin, pentachloronitrobenzene, benomyl)
Oudemans, P. V. 1999. Plant Disease 83:251-258.
Benomyl (or thiophanate methyl) will reduce Mortierella growth. Mortierella looks like some Pythium
species.
500 ml
corn meal agar or V8 juice agar
2.5 mg
pimarcin (sold as Delvocid)
125 mg
sodium ampicillin
5 mg
rifampicin
50 mg
pentachloronitrobenzene (PCNB, sold asTerraclor fungicide)
5 mg
benomyl or thiophanate methyl
NARF (nystatin, ampicillin, rifampicin, and fluazinam)
Morita, Y., and Tojo, M. 2007. Plant Disease 91:1591-1599.
500 ml
corn meal agar or V8 juice agar
25 mg
nystatin
150 mg
sodium ampicillin
5 mg
rifampicin
5 ul
fluazinam (Omega 500 fungicide, Syngenta)
Water agar for Pythium
Pythium species tend to grow very rapidly, initially needing no nutrients. The resulting hyphae can be
transferred to a medium containing nutrients 24 to 48 hr. after plating on water agar.
500 ml
water
12 g
agar
With careful direct microscopic observation, some species of Pythium and Phytophthora can be identified
with the aid of the references below. New species in these genera are being described at a rapid rate. In
order to induce Pythium to form all the structures needed to identify it microscopically, the isolate should
be grown in a plate of sterile water into which grass blades that had been boiled for 10 minutes are
inserted. Usually all the structures needed can be found after 24-72 hours of incubation at room
temperature in this nutrient-poor environment. Transfer as little nutrient-containing agar from the source
plate to the grass blade plate as possible. It is best to observe the cultures using an inverted compound
microscope so that the culture is not disturbed and the position of the structures in relation to one another
can be seen. Temporary microscope slide mounts can be used but the relative position of structures is
usually disrupted.
References for identification of Pythium and Phytophthora species:
Van Der Plaats-Niterink, A. J. 1981. Monograph of the genus Pythium. Studies in Mycology. Baarn,
Centraalbureau voor Schimmelcultures. Monograph No. 21:242.
Gallegly, M. E. and Hong, C. X. 2008. Phytophthora: Identifying Species by Morphology and DNA
Fingerprints. St. Paul, MN, APS Press.
Bacteria are so similar to one another in culture and microscopically that it is not possible to determine
which genus is present. The color or shape of the bacterial colony may be a clue to the genus or may be
used to say that it is not a particular genus. However that is just an educated guess and requires further
testing. There are some selective media that encourage the growth of some target bacteria. Other tests can
also be run. Bacteria can be grown on a series of carbon sources to determine which they can use and
which they do not use. The results from an unknown bacterium can then be compared to the results used
to create a database from known bacteria. In that way, the unknown can be matched to a known bacterium
and identified. One such system commercially available is called Biolog. Many different bacteria will be
isolated from a sample and tests must be run on each isolate in order to identify each.
Semi-selective media recipes for a variety of plant pathogens can be found at,
http://wiki.bugwood.org/Main_Page
Serological methods are based on the use of antibodies, produced by mammalian immune systems, in
reaction to the presence of a pathogen or molecules produced by the pathogen. If for example, a plant
virus coat protein is injected into a rabbit or mouse, the animal’s immune system produces antibodies
against that protein. Those antibodies can be taken from the animal, purified, and used to test for that
virus. Similarly, antibodies can be made that ‘recognize’ bacterial, fungal, Oomycetes, or nematode
molecules. Various ways of using these antibodies have been commercialized including enzyme-linked
immunosorbent assay (ELISA), lateral flow device (LFD), immunosorbent-electron microscopy (ISEM)
and the dip-stick assay (DSA). There is a lateral flow device for detecting Phytophthora. But the test
cannot tell the difference between Phytophthora cinnamomi and Phytophthora nicotianae. A positive test
indicates that a Phytophthora of unknown identity is present in the sample. Some immunological tests can
detect specific species of plant pathogen. For example there are tests specifically for Ralstonia
solaneacearum, Xanthomonas pelargonii, cucumber mosaic virus, tobacco mosaic virus, and others.
Companies that produce such test kits include Agdia, Inc., Bioreba, Neogen Europe Ltd – Adgen
Phytodiagnostics, Loewe, Pocket Diagnostic, and Primediagnostic. (Search for these on the internet to
obtain specific, up-to-date product and service information.)Their test kits are available and some of them
are very simple to use and can be used routinely. An internet search of the products offered by those
companies will reveal the availability of specific tests.
Assay for four different viruses.
Note the 2 pink lines on the third strip,
indicating a positive test for that virus.
If only one pink line appears, that means
the test strip was working properly but the
pathogen was not present in the sample.
Assay for one bacterium. The 2 pink lines
indicates a positive test for that bacterium.
A modification of the immune-assay is immune-fluorescence microscopy (IFM) which uses antibodies
bound to fluorescent markers. When these antibodies bind to the pathogen molecule, they glow and can
be seen with a fluorescence microscope to visualise the pathogen structures to which they bind. This
technique can be applied to tissue taken from an infected plant or from colonized bait.
Indicator plants are ones that develop a symptom when inoculated with a plant pathogen. Indicator plants
are often used in virus detection. Chenopodium quinoa, for example, develops small yellow or dead spots
(termed, local lesions) when infected with any one of many different viruses. (Chenopodium quinoa seed
is readily purchased because people are now growing ‘Quinoa’ (pronounced, keen-wa) and using the seed
as a protein source.) Material taken from a sample processed to concentrate virus, used to inoculate such a
plant would be said to harbour a virus if symptoms developed. If you are targeting a specific, well known,
plant-infecting virus, it may be possible to select a few different indicator plants that, together, tell you
that a specific virus is present. An internet search for information on a specific virus can reveal a list of
appropriate indicator plants. If you get different symptoms than the ones described for the virus you are
seeking or no symptoms when some are expected, it is possible that a different virus is present in the
sample.
Tomato bushy stunt virus indicator plants (see, http://www.agls.uidaho.edu/ebi/vdie/descr825.htm)
Gomphrena globosa - dead reddish local lesions or a systemic mosaic, depending upon the particular
virus isolate
Chenopodium amaranticolor - dead white spots with yellow haloes
Nicotiana glutinosa - dead brown spots
Nicotiana clevelandii - yellow or grown spots or systemic mottle and death of the leaves
Datura stramonium – mosaic
Cucumber green mottle mosaic virus indicator plants (see,
http://www.agls.uidaho.edu/ebi/vdie/descr265.htm)
Chenopodium amaranticolor – dead spots
Cucumis sativus - systemic mosaic
Citrullus vulgaris - systemic mosaic
Datura stramonium – no symptoms (non-host)
Petunia × hybrida– no symptoms (non-host)
Tomato mosaic virus (see, http://www.agls.uidaho.edu/ebi/vdie/descr832.htm)
Nicotiana glutinosa – dead spots
N. tabacum cvs Xanthi-nc and Samsun NN – dead spots
N. clevelandii – mosaic
Solanum giganteum - mosaic
Nicotiana tabacum cv. White Burley – dead spots
Nicotiana rustica, Petunia × hybrida – dead spots
Cucumis sativus– no symptoms (non-host)
Cyphomandra betacea – no symptoms (non-host)
Phaseolus vulgaris– no symptoms (non-host)
Pelargonium flower break virus indicator plants (see, http://www.agls.uidaho.edu/ebi/vdie/descr590.htm)
Chenopodium quinoa - numerous yellow and dead spots
Gomphrena globosa – a few brown dead spots
Nicotiana clevelandii – slight yellowing with a few dead spots
Tetragonia tetragonioides – yellow spots
Cucumis sativus– no symptoms (non-host)
Nicotiana glutinosa– no symptoms (non-host)
Nicotiana tabacum– no symptoms (non-host)
Phaseolus vulgaris– no symptoms (non-host)
Pisum sativum– no symptoms (non-host)
Indicator plants can also be used ad baits for fungi and Oomycetes in two different ways. For example,
Catharanthus (annual vinca) is highly susceptible to Phytophthora nicotianae and wilts and dies rapidly
when infected. Potted Catharanthus could be placed in various locations in a nursery or greenhouse and
watered along with other crops and observed for disease symptoms. Also, material captured on filters or
taken from colonized baits can be used to inoculate a plant known to be highly susceptible. The ideal
indicator plant is easily grown or readily available and is more susceptible to the target pathogen than the
crop or develops obvious symptoms rapidly. To verify the identity of the pathogen infecting an indicator
plant, it can be tested with a serological or other kit (noted above) or sent to a testing service or plant
disease clinic.
Another method of identifying a living organism is to obtain its nucleic acid sequence and compare that
sequence to those in a database known as GenBank (http://www.ncbi.nlm.nih.gov/genbank/). For
technical information on what is involved in obtaining a sequence, see White, T. J., Bruns, T., Lee, S. and
Taylor, J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics.
PCR Protocols, a guide to methods and application. M. A. Innis, D. H. Gelfand, J. J. Sninsky and T. J.
White. San Diego, Academic Press. pp. 315-322. This work must be done by a laboratory but such
processing is commercially available or is available through some plant disease clinics.
In the DNA (deoxyribonucleic acid) molecule, adenine =
A; thymine =T; guanine = G; cytosine = C. Cs, Ts, As,
and Gs are strung together in a long, ladder-like
structure. Certain parts of the DNA ladder are
characteristic of a species within a genus and can be used
to identify the organism. The success of this method of
identification depends entirely upon the reliability of the
information in the database, some of which is not reliable
(For a discussion of this see, Kang, S., Mansfield, M. A.,
Park, B., Geiser, D. M., Ivors, K. L., Coffey, M. D.,
Grünwald, N. J., Martin, F. N., Lévesque, C. A. and
Blair, J. E. 2000. The promise and pitfalls of sequencebased identification of plant-pathogenic fungi and
Centrifuge and thermocycler critical for
Oomycetes. Phytopathology 100:732-737). Although
processing DNA in order to obtain a sequence.
the GenBank database contains millions of sequences,
sequences are not yet available for every living organism. Also, sequences from several parts of the
organism’s DNA may be required to unequivocally match it to a known organism.
Below are examples of the sequences from two different species of Pythium. Just from their different
lengths, it can be seen that the sequences of these two species differ. The ITS region sequence of one
isolate of P. aphanidermatum is the same as the ITS region sequence of all other P. aphanidermatum’s,
thus allowing matching of sequences for identification purposes.
Pythium cryptoirregulare ITS region sequence:
ccacacctaaaaaaactttccacgtgaactgtcgttatttgttgtgtgtgtgcgcgttggtagcatgcgcgtttgcttacgcttcggtgtttgcgagtgcgcgtgctggcggtg
cgcagactgaacgaaggtcgtgtgtttgctgtgtgcctgctgcaccgctgacttttgcattgatttgcatgatgttggcggagcggcgggtgctgtgcgtgcgcgcggctg
acctatttttttcaaaccccatacctaaatgactgattatactgtgagaacgaaagttcttgctttaaactagataacaactttcagcagtggatgtctaggctcgcacatcgatg
aagaacgctgcgaactgcgatacgtaatgcgaattgcagaattcagtgagtcatcgaaattttgaacgcatattgcacttccgggttatgcctggaagtatgtctgtatcagt
gtccgtaaatcaaacttgcgtttcttccttccgtgtagtcggtggaggatcgttgcagatgtgaagtgtctcgctgtggttggcgttcgttgtttgcaatgaatgcacagcttgc
gagtccttttaaatggacacgactttctcttttttgtatgtgcgcggtgctgtgcgtgaacgcggtggttttcggatcgctcgcggctgtcggcgacttcggtgaatgcataatg
gagtggacctcgattcgcggtatgttgggcttcggctggacaatgttgcttattgttgtgtctgttccgcgttcgccttgaggtgtactggtggctgtgggattgaactggttac
tgttgttagtagtgtgtgtggcacgttgtcgtggatgcatctgtgttttttttgcatactttgtgtgtgcagttgagggcagaagagaagtctcaatttgggaaaagttttgtatact
ccgggttgatcctgcgtgtatatctcaa
Pythium aphanidermatum ITS region sequence:
ccacacctacaaactttccacgtgaaccgttgaaatcatgttctgtgctctctttcgggagggctgaacgaaggtgggctgcttaattgtagtctgccgatgtatttttcaaacc
catttacctaatactgatctatactccaaaaacgaaagtttatggttttaatctataacaactttcagcagtggatgtctaggctcgcacatcgatgaagaacgctgcgaactgc
gatacgtaatgcgaattgcagaattcagtgagtcatcgaaattttgaacgcacattgcactttcgggttatgcctggaagtatgcctgtatcagtgtccgtacatcaaacttgc
ctttctttttctgtgtagtcagggagagagatggcagaatgtgaggtgtctcgctggctcccttttcggaggagaagacgcgagtccctttaaatgtacgttcgctctttcttgt
gtctaagatgaagtgtgattctcgaatcgcggtgatctgtttggatcgctttgcgcatttgggcgacttcggttaggacattaaaggaagcaacctctattggcggtatgttag
gcttcggcccgacgttgcagctgacagagtgtggttttctgttctttccttgaggtgtacctgaattgtgtgaggcaatggtctgggcaaatggttgctgtgtagtagggttttg
ctgctcttggacgccctgttttcggatagggtaaaggaggcaacaccaatttgggactgtttgcaatttattgtgaacaactttctaa
From this discussion, you can appreciate the amount of work required to determine whether your water is
contaminated with a plant pathogen. Some of the work can be done by you while some must be done by a
trained person in a well-equipped laboratory.





Grower-conducted testing:
Indicator plant inoculation
Immuno-strips
Baiting and direct observation
Water filtering followed by plant inoculations, direct observation, or plating on semi-selective
media
Service labs that do water testing for plant pathogens (Contact the lab to verify that they will test
your sample and to determine their current charges to do so.):
Oregon State University
http://www.bcc.orst.edu/bpp/Plant_Clinic/index.htm
541-737-3472
North Carolina State University
http://www.cals.ncsu.edu/plantpath/extension/clinic/services.html
919-515-3619
[email protected]
University of Guelph
http://www.guelphlabservices.com/AFL/water.aspx
877-863-4235
[email protected]
Water sampling tool sources:
Ben Meadows (benmeadows.com)
Fieldmaster Water Bottle Kit (JF1-125042)
Sub-surface grab sampler (JF1-35109)
Whirl-Pak Sampling Pole (JF1-57582) or Line (JF1-57583)
Forestry Suppliers, Inc. (www.forestry-suppliers.com)
Sub-surface telescopic grab sampler (3227)
Fieldmaster Basic Water Bottle (5021)
MMI (Micro Macro International)
183 Paradise Blvd.
Suite 108
Athens, GA 30607
706-548-4557
More water-related information:
Green Industry Knowledge Center for water, nutrient, and plant health management.
http://waternut.org/KnowledgeCenter.html
http://waternut.org/moodle/
Water Education Alliance for Horticulture
http://www.watereducationalliance.org/default.asp
Collecting water samples for testing
http://edis.ifas.ufl.edu/EP051
Search: Greenhouse*A*Syst at,
http://www.caes.uga.edu/publications/
Water and Nutrient Management for Greenhouses, NRAES-56
http://www.nraes.org/publications/nraes56.html