Download PDF

DEVELOPMENT AND DISEASE
RESEARCH ARTICLE 3367
Development 136, 3367-3376 (2009) doi:10.1242/dev.034561
The zebrafish dystrophic mutant softy maintains muscle fibre
viability despite basement membrane rupture and muscle
detachment
Arie S. Jacoby1, Elisabeth Busch-Nentwich2, Robert J. Bryson-Richardson1,3,6, Thomas E. Hall1,6,
Joachim Berger1,6, Silke Berger1,6, Carmen Sonntag1,6, Caroline Sachs1, Robert Geisler4, Derek L. Stemple2
and Peter D. Currie1,5,6,*
The skeletal muscle basement membrane fulfils several crucial functions during development and in the mature myotome and
defects in its composition underlie certain forms of muscular dystrophy. A major component of this extracellular structure is the
laminin polymer, which assembles into a resilient meshwork that protects the sarcolemma during contraction. Here we describe a
zebrafish mutant, softy, which displays severe embryonic muscle degeneration as a result of initial basement membrane failure. The
softy phenotype is caused by a mutation in the lamb2 gene, identifying laminin β2 as an essential component of this basement
membrane. Uniquely, softy homozygotes are able to recover and survive to adulthood despite the loss of myofibre adhesion. We
identify the formation of ectopic, stable basement membrane attachments as a novel means by which detached fibres are able to
maintain viability. This demonstration of a muscular dystrophy model possessing innate fibre viability following muscle detachment
suggests basement membrane augmentation as a therapeutic strategy to inhibit myofibre loss.
INTRODUCTION
The basement membrane (BM) underlies the formation of most
tissues and organs in the developing embryo, providing a resilient
substratum of extracellular matrix that supports the overlying cell
layers to which it adheres. One organ system in which BM formation
and integrity is beginning to be well understood is the skeletal
musculature. In skeletal muscle, the BM surrounds each myofibre
and provides the elasticity that enables the sarcolemma to withstand
the mechanical stress of repeated contraction (Sanes, 2003). A key
component of all BMs is the glycoprotein laminin, which is secreted
from the cell as a heterotrimer that self-assembles into a
macromolecular lattice (McKee et al., 2007). The laminin subunit
consists of α, β and γ chains, each of which are comprised of short
and long arms at the N- and C-termini, respectively. The long arms
form a coiled-coiled domain that binds the chains together, whereas
the short arms are free, giving the trimer a cruciform structure
(Yurchenco et al., 1992). The spontaneous polymerisation of laminin
is facilitated by the interaction of the LN domains, globular domains
of ~250 amino acids at the N-terminal of each short arm (Odenthal
et al., 2004; McKee et al., 2007).
In mammals, five α, three β and three γ laminin chains have
been identified, combining in vivo to generate up to 15 different
heterotrimers, many with tissue- or cell-type-specific expression
(Aumailley et al., 2005). The laminin of the skeletal muscle BM,
1
The Victor Chang Cardiac Research Institute, Darlinghurst, NSW 2010, Australia.
The Wellcome Trust Sanger Institute, Cambridge CB10 1SA, UK. 3School of Medical
Sciences, Faculty of Medicine, University of New South Wales, NSW 2065, Australia.
4
Max-Planck Institute for Developmental Biology, Tübingen 72076, Germany.
5
St Vincent’s Clinical School, Faculty of Medicine, University of New South Wales,
NSW 2010, Australia. 6Australian Regenerative Medicine Institute, Monash
University, VIC 3800, Australia.
2
*Author for correspondence ([email protected])
Accepted 28 July 2009
which consists of several spatially restricted isoforms (Patton,
2000), is involved in two major types of linkages to the
sarcolemma. Firstly, it binds to the dystrophin glycoprotein
complex (DGC) via a direct interaction with α-dystroglycan.
Secondly, it forms an attachment via integrins to subsarcolemmal
focal adhesion complexes. These two linkages represent the major
connections between the actin cytoskeleton of the myofibre and
the extracellular matrix, transmitting much of the force generated
by muscle contraction across the sarcolemma (reviewed by Miner,
2008).
Recently, forward genetic strategies in the zebrafish have been
instrumental in addressing the functional importance of these
linkages in the context of muscle disease. Specifically, the
characterisation of a small class of ‘dystrophic’ mutants, which
undergo rapid degeneration of the embryonic skeletal muscle, has
established the zebrafish embryo as an informative model of
human muscular dystrophy (Granato et al., 1996; Bassett and
Currie, 2003). In the zebrafish embryonic myotome, laminin and
the DGC are concentrated at the vertical myoseptum, where the
muscle inserts into the connective tissue, a region referred to as
the myotendinous junction (MTJ) (Parsons et al., 2002; Hall et al.,
2007). The dystrophic mutant, sapje (sap) harbours a mutation in
the zebrafish orthologue of the Duchenne muscular dystrophy
gene (DMD, encoding dystrophin) and demonstrates that the
dystrophin protein is essential for maintaining the integrity of the
sarcolemma at the vertebrate MTJ (Bassett et al., 2003). A second
mutant in this class, candyfloss (caf), has a mutation in the gene
encoding the major α-laminin chain in skeletal muscle, laminin
α2 (Lama2), and recapitulates the major features of muscle
wasting in LAMA2-deficient congenital muscular dystrophy
(MDC1A). The progressive, lethal degeneration seen in caf
embryos results from the failure of the BM to maintain adhesion
to the sarcolemma at fibre termini, leading to detachment of
muscle fibres from the MTJ and subsequent fibre death (Hall et
al., 2007).
DEVELOPMENT
KEY WORDS: Skeletal muscle, Zebrafish, Laminin β2, Basement membrane, Muscular dystrophy
3368 RESEARCH ARTICLE
Here, we describe another mutant in the dystrophic class, softy
(sof). Like sap and caf, the damage seen in sof homozygous embryos
results from the loss of muscle fibre adhesion at the MTJ. We
demonstrate that in sof this failure occurs external to the
sarcolemma, with many fibres detaching from the vertical
myoseptum at the level of the BM. However, despite developing
severe embryonic muscle pathology similar to the lethal dystrophy
evident in other mutants of this class, the myotome is able to recover
so effectively that a substantial proportion of sof homozygotes can
survive to maturity. We attribute this recovery to the formation of
ectopic fibre terminations (EFTs), novel attachment sites that
preserve fibre viability by providing retracted fibre ends with a BM
layer. The sof phenotype is caused by a missense mutation in lamb2,
demonstrating a crucial role for laminin β2 (Lamb2) in MTJ stability
and the maintenance of skeletal muscle attachment. Furthermore,
the surprising ability of a subset of detached muscle fibres to remain
viable in sof, despite defects in BM structure, has ramifications for
the therapy of MDC1A and other diseases of BM failure.
MATERIALS AND METHODS
Zebrafish strains and maintenance
tm272a
teg15a
ta222a
The sof
, caf
and sap
mutant alleles were obtained from the
Tübingen Stock Collection. Attempts were made to revive the two other
identified sof alleles, te234 and tz212 (Granato et al., 1996), by in vitro
fertilisation, but heterozygotes could not be obtained. The tm272a allele was
maintained in the AB* and TU strain backgrounds and crossed to the WIK
strain for meiotic mapping, which was performed according to standard
protocols (Geisler, 2002). The cafteg15a and sapta222a mutants have been
described elsewhere (Bassett et al., 2003; Hall et al., 2007), as has the
transgenic line Tg(9.7kb smhyc1:gfp)i104 (Elworthy et al., 2008). Zebrafish
maintenance and embryo collection were carried out using established
protocols (Westerfield, 1993), and all animal experimentation was approved
by the Garvan/St Vincent’s Animal Ethics Committee.
Development 136 (19)
embryos. Two splice-site MOs (MO1 and MO2) and one translational
blocking MO (MO3) were used. The sequences of the morpholinos used
are as follows: MO1, 5⬘-CTGTGCGCTGACCGCTGACAGGACT-3⬘;
MO2, 5⬘-GAGAACAGATGAGGACCTTACCTGC-3⬘; MO3, 5⬘-CTGTATGGTGATGAATCTTCAACTG-3⬘.
Production of the acta1:EosFPtd and acta1:Lamb2-EGFP transgenic
constructs
The acta1:EosFPtd and acta1:Lamb2-EGFP constructs were created using
the tol2kit according to Kwan et al. (Kwan et al., 2007). The acta1:EosFPtd
vector was assembled from the entry clones p5E-acta1, pME-EosFPtd, p3EpolyA and the destination vector pDEST-tol2-pA2. The acta1:Lamb2-EGFP
vector was assembled from the entry clones p5E-acta1, pMELamb2_noSTOP, p3E-EGFP and the destination vector pDEST-tol2-pA2.
We generated p5E-acta1 by amplifying a 4 kb fragment from the upstream
sequence of the alpha actin gene (Higashijima et al., 1997) and subcloning
into pDONRp4-p1R. pME-EosFPtd was constructed by subcloning the
coding sequence of EosFPtd (Wiedenmann et al., 2004) into pDONR 221.
Similarly, pME-Lamb2_noSTOP was made by subcloning the rat Lamb2
coding sequence (Green et al., 1992) (kindly provided by Dr J. Miner,
Washington University, St Louis, MO) into pDONR 221.
Genotyping of mutant alleles
Embryos produced from an incross of sof and caf compound heterozygotes
were genotyped by restriction fragment length polymorphism analysis.
lamb2 exons 3 and 4 were amplified from genomic DNA to produce a 780
bp fragment using the primers GTGGAAACTTGGCCTTTGC (forward)
and TTCATTAACAGTTGGCAACCC (reverse). The softm272a mutation
introduces a StyI site into exon 3, resulting in digestion products of 260 bp
and 520 bp. The cafteg15a allele was genotyped using a derived cleaved
amplified polymorphic sequences (dCAPS) assay (Neff et al., 2002),
using the primers AGGTTGGTCATTGAGTTCGAGA (forward) and
TGCCCAGGTCGAAGCTTAGGTGAGCCAGTC (reverse) to introduce a
Tsp45I site into the mutant amplicon. PCR amplification with these primers
generated a 136 bp fragment, which was cleaved by Tsp45I into products of
104 bp and 32 bp.
For eye histology, embryos were fixed in 4% paraformaldehyde overnight at
4°C. Paraffin embedding and sectioning were carried out by standard methods
(Nüsslein-Volhard and Dahm, 2002). Sections were cut at a thickness of 8 μm
and stained with Hematoxylin and Eosin. For electron microscopy, embryos
were collected at 72 hours post-fertilisation (hpf), fixed in 2.5% glutaraldehyde
at 4°C and embedded in Spurr’s resin. Ultrathin sections were imaged on a
Philips EM410 transmission electron microscope.
Immunohistochemistry and in situ hybridisation
Whole-mount immunohistochemistry was performed by standard procedures
(Guille, 1999). Primary antibodies were used at the following dilutions: antimyosin heavy chain, slow isoform 1:10 (F59; DSHB, Iowa City, IA), antidystrophin 1:1000 (MANDRA1; Sigma, St Louis, MO), anti-β-dystroglycan
1:10 (MANDAG2; DSHB), anti-laminin 1:100 (L9393; Sigma). Alexa-fluor488- and Alexa-fluor-568-conjugated fluorescent secondary antibodies
(Invitrogen, Carlsbad, CA) were diluted 1:500. Whole-mount in situ
hybridisation was carried out essentially as described previously (Oxtoby and
Jowett, 1993). The lamb2 riboprobe was synthesised from a 347 bp DNA
template (GenBank Accession Number FJ619350) encoding the last EGF-like
domain of the short arm and the start of the long arm of zebrafish Lamb2. The
lamb2l riboprobe template was an 859 bp partial cDNA (GenBank Accession
Number FJ619351) encoding the last three EGF-like domains of the short arm
and approximately 130 amino acids of the long arm of Lamb2l. The
overlapping regions of the templates aligned with only 52% identity and did
not result in significant overlap in expression pattern.
Iontophoresis and microinjection
Iontophoretic injection of Rhodamine Dextran into muscle fibres was
performed as described (Hollway et al., 2007). Evans Blue dye injections
were carried out according to Bassett et al. (Bassett et al., 2003). lamb2
morpholino antisense oligonucleotides (MOs) (Gene Tools, Philomath,
OR) were diluted in distilled water and injected into one- to four-cell
RESULTS
Muscle degeneration in sof embryos
The softm272a mutant was isolated from a large-scale mutagenesis
screen as one of several mutants displaying reduced motility with
associated loss of muscle tissue (Granato et al., 1996). Although
muscle development is normal in this class of mutant, the onset of
spontaneous contractions is rapidly followed by degeneration of the
axial myotome. Birefringence of polarised light through the parallel
fibrillar arrays of the trunk muscle can be used to assay myofibre
disruption (Granato et al., 1996). When assessed using this
technique, the muscle degeneration in sof mutant embryos was
similar in severity to that seen in the other dystrophic mutants caf
and sap (Bassett et al., 2003; Hall et al., 2007) (Fig. 1).
In sof embryos, detachment of slow fibres from their insertion sites
at the vertical myoseptum was readily seen by 30 hpf, using the F59
antibody, which specifically recognises slow muscle in zebrafish (Fig.
2A,B). This early detachment suggests that the muscle fibre termini
in sof are prone to adhesion failure soon after mechanical load is
applied by the onset of strong contraction (Kimmel et al., 1995). By
72 hpf, lesions had accumulated throughout the myotome, and
multiple retracting fibres could be seen by differential interference
contrast (DIC) microscopy, with some somites severely affected (Fig.
2D). Newly detached fibre ends possessed a faceted morphology (Fig.
2F, arrows) and retracted into the myotome leaving a clearly visible
retraction groove (Fig. 2F, arrowhead). Fibre detachment could be
observed in vivo using time-lapse photomicroscopy and the
anaesthetic recovery technique described previously (Hall et al., 2007)
(see Movie 1 in the supplementary material; Fig. 2G). Muscle damage
DEVELOPMENT
Histology and electron microscopy
Fibre viability in basement membrane failure
RESEARCH ARTICLE 3369
Fig. 1. Muscle degeneration in the dystrophic mutants softm272a,
cafteg15a and sapta222a. Birefringence images comparing the loss of
striated muscle in mutant embryos at 72 hpf, viewed through a
polarising filter as dark patches on the trunk. The distribution and
severity of muscle lesions in sof are broadly similar to caf and sap, while
wild-type embryos (WT) display no loss of birefringency.
The vertical myoseptum in sof mutants has an
abnormal ultrastructure
The muscle detachment apparent in sof mutants implied a failure of
the anchorage of fibre ends to the embryonic MTJ at the vertical
myoseptum. In order to look for direct evidence of a defective MTJ
to explain this detachment, transmission electron microscopy was
carried out on sections of 72 hpf sof mutant and sibling embryos
(Fig. 3). The vertical myoseptum of wild-type siblings had a
uniform, well-organised appearance with a layered structure visible
at higher magnification (Fig. 3A,C). By contrast, even in regions
where the fibres were intact, the mutant myoseptum appeared
grossly distorted, with an irregular thickness and numerous blisters
within the extracellular matrix (Fig. 3B, arrowheads). Multiple short
processes branching off the myoseptum were also noticeable (Fig.
3B, arrows). A higher magnification view revealed that the surface
of the mutant myoseptum was rough and disorganised compared
with the wild type (Fig. 3C,D). The overall appearance of the
vertical myoseptum suggested that the underlying defect in sof
resided in the junctional extracellular matrix.
softm272a has a mutation in the zebrafish lamb2
gene
To investigate the molecular basis of the phenotype, meiotic mapping
of the sof mutation was carried out using standard approaches (Geisler,
2002). Linkage analysis defined a region on Chromosome 23 between
Fig. 2. Muscle degeneration in sof mutants results from
detachment of myofibres from the vertical myoseptum. Lateral
views of wild-type muscle (A,C,E) show fibres spanning the somite
between adjacent myosepta, whereas in sof mutants (B,D,F), lesions
rapidly develop. (A,B) Whole-mount immunohistochemistry using an
antibody against slow myosin demonstrates that, although slow fibres
develop normally in sof embryos, by 30 hpf fibres have already
detached from the myoseptum. (C-F) DIC images of axial muscle. By 72
hpf, the sof embryo appears severely damaged, with numerous
detached fibres scarring the myotome. A magnified view of a single
detached fibre (F) shows the characteristic invaginated membrane
(arrows) and retraction groove (arrowhead). (G) Retraction of a single
fibre (arrowhead), from left of frame to right, in a 72 hpf sof embryo.
Still images taken from Movie 1 in the supplementary material, with
elapsed time indicated in seconds.
SSLP markers z13424 (31.6 cM; 2 recombinants out of 94 meioses)
and z31657 (33.9 cM; 11 recombinants out of 94 meioses) and a nonrecombinant marker was found (z31489, 32.2 cM; 0 out of 770
meioses), indicating tight linkage to the sof mutation (Fig. 4A). An
inspection of the region surrounding z31489 in the Ensembl genome
assembly (Zv7; http://www.ensembl.org) revealed duplicate genes
that were strong candidates for the mutation. One gene, lamb2
(ENSDARG00000002084), encoded a predicted protein with
significant similarity to human laminin β2 (LAMB2; 59% identity).
The other candidate was the predicted gene ENSDARG00000033950,
which encoded a protein 49% identical to lamb2. This second gene,
lamb2l, was situated in the same relative location as human LAMB2like, a pseudogene, which is adjacent and upstream of LAMB2 (Durkin
et al., 1999). The gene order in this region is conserved between
human and zebrafish (Fig. 4B). This implies an ancestral tandem
duplication and subsequent inactivation of LAMB2-like in the
mammalian lineage.
DEVELOPMENT
was prevented by raising sof embryos in anaesthetic between 20 and
72 hpf, indicating that normal activity is sufficient to precipitate
degeneration in the mutant and that muscle load is an essential
component of the sof phenotype.
Remarkably, despite a myopathology as severe as in the other, lethal
dystrophic mutants, many sof larvae were able to recover completely
and were viable. When expressed relative to wild-type sibling rates of
survival, 64% (n=109) of homozygotes survived to maturity under
standard rearing conditions and were fertile, swam normally and were
indistinguishable from wild-type siblings. To test whether survival
correlated with phenotypic severity, mildly and severely affected
cohorts of sof mutant larvae were raised separately. Both groups
survived at frequencies similar to that of the overall mutant sample
(mild, 71%, n=21; severe, 66%, n=18), suggesting that viability of sof
mutants was not restricted to mildly affected larvae.
Fig. 3. Electron micrographs of the vertical myoseptum reveal a
highly irregular MTJ in sof embryos. (A,B) At lower magnification
(⫻10,400), the wild-type myoseptum is compact and linear (A) whereas
the sof myoseptum appears severely distorted, even in the absence of
fibre detachment (B). Numerous processes extending into the myotome
are clearly visible in the mutant (B, arrows), and blisters within the
myoseptum are also indicated (arrowheads). (C,D) At higher
magnification (⫻62,400), the smooth, layered structure of the BM at
the wild-type MTJ is evident (C). By contrast, the sof BM lacks
organisation, with a rough surface (bracketed) and only patches of
layering (arrowhead) (D).
As well as being genetically linked to the sof mutation, lamb2 and
lamb2l are candidates from a functional perspective because
mammalian LAMB2 is abundant at the MTJ, where it co-localises
with LAMA2 in a laminin α2β2γ1 complex (Pedrosa-Domellof et al.,
2000). As mentioned, the zebrafish lama2 mutant, caf, also displays
a muscle detachment phenotype (Hall et al., 2007). In addition, Lamb2
knockout mice have defects at the MTJ of the diaphragm (Miner et al.,
2006). The expression of the duplicate genes was, therefore, examined
by whole-mount in situ hybridisation (Fig. 5). At 24 hpf, the highest
level of lamb2 expression was seen in the axial muscle (Fig. 5A,C).
Expression was also seen in the eye and brain (Fig. 5E,F). Expression
of lamb2l was detected in the neural tube and the pronephric duct (Fig.
5B,D), with strong expression in the brain at 24 hpf but in a pattern
distinct from the neural expression of lamb2 (Fig. 5G,H). No
expression of lamb2l was detected in the skeletal muscle of wild-type
embryos, nor was it upregulated in sof mutant embryos (not shown).
These patterns of expression, which, when combined, broadly
encompass the expression pattern of mammalian Lamb2, were
consistent with a functional role for zebrafish Lamb2, but not Lamb2l,
in skeletal muscle attachment and so we proceeded to sequence lamb2
in sof mutants.
Sequencing of lamb2 exons from genomic DNA of sof mutant
embryos identified a single base change within the open reading
frame that altered the amino acid sequence. This was a T to C
transition in exon 3, resulting in a Leu38rPro substitution in the LN
domain of the predicted Lamb2 protein (Fig. 4C,D). This leucine
residue is completely conserved in all known Lamb2 sequences as
well as in other β-laminin chains (Fig. 4E). Prolines are known to
induce kinks in amino acid chains, so this substitution is likely to
affect the function of the globular LN domain, which participates in
the polymerisation of the laminin lattice (Colognato et al., 1999;
McKee et al., 2007). Sequencing of exon 3 in 14 affected and 14
unaffected embryos confirmed segregation of the homozygous
mutation with the sof phenotype.
Development 136 (19)
To demonstrate that a loss of Lamb2 function was responsible for
the sof phenotype, antisense MOs were injected into wild-type
embryos at the one- to four-cell stage. Initially, two splice-site MOs
(MO1 and MO2), complementary to the splice donor and acceptor
sequences, respectively, of exon 3 of lamb2 were used. Both in
combination and singly, these MOs were able to induce early fibre
detachment similar to that seen in the mutant (MO1+MO2 100 μM
each, 49% of injected embryos had fibre detachment, n=47; MO1 200
μM, 39%; MO2 200 μM, 50%, n=32) but did not produce as severe a
muscle loss as evident in sof homozygotes at later stages. A third,
translational blocking lamb2 MO (MO3) was, however, highly
effective in inducing muscle detachment up to and beyond 30 hpf and
completely phenocopied sof mutants. Thus, at 72 hpf, the MO3injected embryos displayed the same stochastic loss of birefringency
as sof mutants (Fig. 4F), with fibre detachment seen in 53% of injected
embryos (200 μm MO, n=270). All morphants survived beyond 7
days post-fertilisation (dpf), indicating that transient knockdown of
Lamb2 protein is not lethal. Moreover, when larvae were raised to 26
dpf, lamb2 morphant and sof mutant rates of survival were similar (sof
68% survival, n=50; lamb2 MO3 71% survival, n=49). Taken
together, these results strongly suggested that the sof phenotype was
caused by loss of normal Lamb2 function in muscle.
Transgenic expression of Lamb2 in sof does not
prevent fibre detachment
The nature of the mutation in sof led us to question whether the
muscle detachment could be prevented by cell-autonomous
expression of wild-type Lamb2. To that end, we constructed a rat
Lamb2-GFP fusion transgene under the control of the skeletal
muscle α-actin promoter and injected it into sof embryos to generate
mosaic expression of Lamb2 in sof muscle fibres (see Fig. S1 in the
supplementary material). The full-length Lamb2 cDNA used in this
construct has been demonstrated to be functional in rescuing defects
in the Lamb2–/– mouse (Miner et al., 2006). As a control, we injected
an EosFPtd construct (Wiedenmann et al., 2004) under the same
promoter, in order to mosaically label muscle fibres in sof mutants
for a baseline reading of the proportion of detached fluorescent
fibres under ‘non-rescue’ conditions. Transgenic fibres were
quantitated at 72 hpf.
The control EosFPtd construct, when injected into wild-type
siblings, elicited 0% fibre detachment (n=113 fibres; ten embryos).
When this construct was injected into sof embryos, detachment was
seen in 17% of fluorescent fibres (n=206; eight embryos). The
Lamb2-GFP fusion construct did not induce detachment in wild-type
siblings (0%, n=105; five embryos), ruling out the possibility of a
dominant-negative detrimental effect of overexpression of the
cDNA. Expression of Lamb2-GFP in sof mutants resulted in
detachment in 20% of transgenic fibres (n=93; five embryos),
clearly showing that the transgene failed to prevent muscle
detachment (see Fig. S1 in the supplementary material). This
outcome suggests that, as the sof phenotype cannot be rescued by
secretion of wild-type protein, it does not arise from the cellautonomous failure of laminin-mediated adhesion but, rather, from
a structural weakness within the laminin matrix at the MTJ caused
by a lack of functional Lamb2.
Ocular development is unaffected in sof mutants
As lamb2 is expressed in the zebrafish lens and cornea and
mutations in the human orthologue can cause malformation of
these tissues (Zenker et al., 2004), we decided to look for ocular
defects in sof mutant embryos and lamb2 MO-injected embryos.
By visual inspection and dark-field microscopy, the eyes appeared
DEVELOPMENT
3370 RESEARCH ARTICLE
Fibre viability in basement membrane failure
RESEARCH ARTICLE 3371
normal at all developmental stages in vivo (see Fig. S2A in the
supplementary material). Histological analyses of sof mutants at
72 hpf (not shown) and 7 dpf (see Fig. S2B,C in the
supplementary material) revealed that eye development was
overtly normal. However, we cannot rule out the presence of
subtle abnormalities or synaptic defects, such as those observed
in the Lamb2 knockout mouse (Libby et al., 1999).
Two distinct modes of fibre detachment in sof
mutants
Next, the pathobiology of the muscle detachment in sof was
explored by whole-mount fluorescence immunohistochemistry.
This revealed that components of the DGC, such as the
intracellular protein, dystrophin and the integral membrane
protein, β-dystroglycan, were present at the fibre ends of wildtype embryos at 72 hpf (Fig. 6A-C,G-I). In sof embryos, however,
these proteins remained associated with the sarcolemma of
detached fibres upon retraction (Fig. 6D-F,J-L, arrows), consistent
with attachment failure occurring external to the sarcolemma.
Upon closer inspection, two types of lesions could be seen in the
myotome of sof mutants and lamb2 morphants from 72 hpf (Fig.
7A-C; and data not shown). Firstly, as described earlier, individual
fibres that had detached at one end and retracted from their
insertion point at the myoseptum were observed (Fig. 7B). These
fibres were distinguished by highly condensed myofibrils within
the retracted end. A second type of detachment was associated
with fissures that appeared similar to the vertical myosepta and
were often seen to branch off these myosepta into the myotome to
span several fibre widths (Fig. 7C). In other cases, fissures were
found in the middle of the somite (e.g. Fig. 7P-S). We have termed
these novel structures ectopic fibre terminations (EFTs), defined
as ectopic, myoseptum-like structures within the mutant
myotome, clearly visible by DIC microscopy, to which fibres are
anchored. The fibres attached to these EFTs maintained normal
myofibrillar striations but often had an orientation oblique to that
of the remainder of the myotome.
DEVELOPMENT
Fig. 4. softm272a is an allele of lamb2. (A) softm272a was meiotically mapped to a 2.3 cM region on chromosome 23, delineated by the SSLP
markers z13424 and z31657. The non-recombinant marker z31489 was found to reside in an intron of lamb2l. The markers used have been placed
on a physical map of chromosome 23, with recombination frequencies shown (number of recombinants/number of meioses). The numbers below
the line represent the genetic (top) and physical (bottom) location of markers (Zv7; http://www.ensembl.org). The arrow above the genes indicates
transcriptional orientation. (B) The zebrafish lamb2 and lamb2l genes maintain a syntenic relationship with USP19 in human. LAMB2 regions of
human chromosome 3 and zebrafish chromosome 23 are displayed, with distances between genes shown (not to scale). Distances were taken from
the Ensembl database and Durkin et al. (Durkin et al., 1999). (C) Genomic sequence electropherograms of the mutated region in wild-type,
heterozygote and homozygote sof embryos. A single T to C transition was found in exon 3 of lamb2 (asterisk), resulting in the substitution of a
proline for a leucine at amino acid 38 of the unprocessed form of Lamb2. The translation is shown below each electropherogram. (D) Domains of
Lamb2. The softm272a mutation is in the LN domain, shown in red. Other domains represented are LF domain (blue), EGF-like domain (grey circles)
and coiled-coiled domain (grey bar) (Aumailley et al., 2005). (E) Amino acid sequence alignment of the N-terminal region of laminin β2 from
zebrafish (Dr), human (Hs), chicken (Gg) and the sole Caenorhabditis elegans β-laminin, LAM-1 (Ce), as well as zebrafish laminin β1, β4 and β2-like.
The mutation affects a completely conserved leucine, 21 amino acids from the predicted secreted N-terminal of zebrafish Lamb2. Asterisks denote
universally conserved residues. The signal peptide cleavage sites of each sequence were predicted using SignalP3.0 (Bendtsen et al., 2004).
(F) Injection of a lamb2 antisense MO precisely phenocopies the loss of birefringency seen in sof homozygous mutants. Top, uninjected wild-type
embryo; middle, lamb2 MO3-injected embryo; bottom, sof mutant embryo.
Fig. 5. Embryonic expression of the lamb2 and lamb2l genes.
(A) Lateral view of lamb2 expression in the trunk and tail at 24 hpf.
Strong expression is seen in the skeletal muscle. Expression is also seen in
the notochord of the tail (arrowhead). (B) Lateral view of lamb2l
expression in the trunk and tail at 24 hpf, showing staining in the neural
tube (arrowheads) and pronephric duct (arrow). (C,D) Transverse sections
of (C) lamb2- and (D) lamb2l-stained embryos, showing distinct
expression domains. Neural tube (arrowhead) and pronephric duct
(arrow) expression of lamb2l is indicated in D. (E) Dorsal view of head
expression of lamb2 at 24 hpf. (F) In a transverse section through the
head, at the position indicated by the line in E, lamb2 expression is visible
in the cornea, lens and diencephalon. (G) Dorsal view of head expression
of lamb2l at 24 hpf. Staining is prominent in the olfactory placode,
telencephalon and midbrain. (H) Transverse section of the head of a
lamb2l-stained embryo, at the position indicated by the line in G.
Expression is seen around the diencephalic ventricle but not in the eye.
In addition to their distinct appearances in vivo, the two
types of lesions described above could be differentiated
immunohistochemically. Double antibody staining was carried out
on 120 hpf sof mutant embryos using antibodies against dystrophin
and laminin to label the terminal sarcolemma and BM, respectively.
These proteins localise to the MTJ of wild-type embryos (Fig. 7DG). Within the myotome of sof embryos, the ends of single detached
fibres were immunoreactive for dystrophin, whereas the EFTs were
immunoreactive for both dystrophin and laminin, indicative of an
MTJ-like linkage (Fig. 7H-K). Interestingly, lamb2 morphants
formed EFTs very similar in appearance and quantity to those seen
in sof embryos (sof 4.4±0.8 EFTs/embryo, n=10 embryos; lamb2
MO3 5.3±1.2, n=10). This suggests that the EFTs are not a distinct
consequence of the sof missense mutation but are more generally
linked to the loss of Lamb2 function (Fig. 7L-O). As the
maintenance of a functional sarcolemma-BM attachment at these
sites may permit the survival of the detached fibres, the EFTs were
investigated further.
EFTs support the viability of detached fibres in sof
mutants
We attempted to determine the stability of the EFTs, as well as the
fibres attached to them, by two methods: time-lapse
photomicroscopy and iontophoretic labelling of single cells. Firstly,
we crossed the sof allele onto the Tg(9.7kb smhyc1:gfp)i104
transgenic line, which expresses GFP in the single layer of slow
muscle fibres at the lateral extremity of the myotome (Elworthy et
al., 2008). This enabled us to detect and follow EFTs and their
associated slow fibres by fluorescence microscopy in vivo. When a
single EFT in an anaesthetised sof embryo was monitored for 48
Development 136 (19)
Fig. 6. Analysis of detached fibres indicates that muscle
attachment failure occurs external to the sarcolemma. Wholemount immunohistochemistry of mutant embryos at 72 hpf reveals the
presence of dystrophin and β-dystroglycan at the ends of detached
fibres. (A-F) Wild-type (A-C) and sof (D-F) embryos stained with antidystrophin. (G-L) Wild-type (G-I) and sof (J-L) embryos stained with antiβ-dystroglycan. (A,D,G,J) DIC images, (B,E,H,K) fluorescence images,
(C,F,I,L) merged images. Arrows indicate fibre detachments. All panels
show lateral views with anterior to the left. dys, anti-dystrophin; bDG,
anti-β-dystroglycan.
hours, neither its position nor its width changed significantly and cell
turnover was not in evidence, illustrating the stability of these
structures over a period of days (Fig. 7P-R; see Movie 2 in the
supplementary material). The length of the EFT appeared to
decrease over this period, perhaps as a consequence of some repair
occurring at the tip of the lesion. Immunostaining of the embryo at
the conclusion of this period confirmed that the lesion that had been
monitored was, indeed, a true EFT, as laminin was detected at the
ends of the fibres (Fig. 7S).
Next, we undertook iontophoretic injection of fibres adjacent to
EFTs to determine their fate under load-bearing conditions.
Rhodamine Dextran was injected into detached slow fibres of sof
mutants at prominent EFTs on the aforementioned transgenic
background at 3 dpf and the embryos were allowed to develop and
swim normally (Fig. 7T,U, n=9). Embryos were observed again at 7
dpf (Fig. 7V,W). Using this approach, we were able to visualise
fibres attached to EFTs that remained viable for at least 4 days postinjection. In some instances, new fibres were even able to elongate
across the EFT to attach to the MTJ (Fig. 7W, arrow). These
observations suggest that formation of EFTs in sof mutants can
enhance overall myotomal stability and contribute to the viability of
this mutant.
The different modes of fibre detachment in sof
have opposing effects on sarcolemmal integrity
To determine if sarcolemmal damage was occurring in sof, the
fluorescent dye, Evans Blue, was injected into sof and wild-type
sibling embryos at 72 hpf. As expected, the dye was excluded
from the myotome of wild-type embryos (Fig. 8A-C). However,
uptake did occur in a subset of retracting fibres in sof embryos,
DEVELOPMENT
3372 RESEARCH ARTICLE
and this correlated with the mode of fibre detachment. Thus,
while the dye permeated the EFTs in a similar manner to the
myoseptum, the fibres attached to them remained impervious to
it. By contrast, staining was seen in single fibres, often before
complete sarcolemmal detachment from the myoseptum (Fig. 8DI). Transmission electron microscopy of a single detached fibre in
a sof embryo appeared to show filaments of trailing sarcolemma,
providing ultrastructural evidence of membrane damage (Fig.
8J,K). Permeation of the dye into the EFTs can be explained by
the observation that Evans Blue binds to connective tissue (Straub
et al., 1997). These results led to the conclusion that sarcolemmal
detachment from the BM in sof was accompanied by rupture of
the sarcolemma but that detachment of the BM itself, and EFT
formation, did not damage the sarcolemma. This provides a
further demonstration of: (1) the distinct nature of the two types
of fibre detachment; and (2) the importance of the EFTs to the
viability of the damaged myotome in sof mutants.
RESEARCH ARTICLE 3373
Sarcolemmal detachment affects membrane
integrity differently in sof and the lama2 mutant
caf
It has previously been shown that the sarcolemma of detached fibres
in lama2-null caf embryos remains intact and impermeable to Evans
Blue dye (Hall et al., 2007). As Lama2 and Lamb2 associate in the
same laminin trimer at the MTJ, the uptake of Evans Blue by a subset
of detaching fibres in sof mutants was a surprising finding. In order to
verify this difference in phenotype between sof and caf, Evans Blue
was injected into embryos of both mutants in parallel at 72 hpf (see
Fig. S3 in the supplementary material). This demonstrated a clear
difference in sarcolemmal integrity between the two mutants.
Although the dye again entered detached fibres in the sof myotome,
there was no uptake by detaching fibres in the caf myotome. This
experiment also reinforced the difference in the morphology of the
detached ends, with the sof fibres often appearing invaginated,
compared with the more angular fibre ends in the caf mutant (compare
Fig. 7. Two modes of fibre detachment occur in sof muscle. (A-C) In vivo observation of intact fibres in the wild type (A) in comparison with a
retracted fibre (B) and an EFT (arrowhead, C) in sof embryos at 120 hpf. Condensed myofibrils can be seen in the retracted fibre (arrowhead, B),
whereas fibres attached to the EFT maintain a normal striated appearance. The vertical myoseptum is indicated by arrows in C. (D-K) Antibody costaining with anti-dystrophin (E,I) and anti-laminin (F,J) reveals the presence of sarcolemma-BM linkages at EFTs in sof embryos (arrow in K), whereas
single detached fibres retain sarcolemma only (arrowheads in K). BM detachment can be seen at the junction of the vertical myoseptum and an EFT
(inset in K). (L-O) EFTs seen in lamb2 morphants appear identical to those in sof embryos (arrow in O). (P-R) Time points from the monitoring of a
single EFT (bracketed) on the Tg(9.7kb smhyc1:gfp)i104 background, with panels labelled according to the stages at which images were captured.
The last 16 hours of this period are depicted in Movie 2 in the supplementary material. (S) Anti-laminin staining of the same somite, in red, overlaid
onto the GFP fluorescence image, confirming lesion as an EFT. (T-W) Labelling of fibres adjacent to an EFT (arrow in T) with Rhodamine Dextran
illustrates viability of detached fibres over 4 days under load-bearing conditions. New fibres occasionally elongate over the EFT (arrow in W),
extending to the myoseptum (dashed lines). Panels are labelled according to the stages at which images were captured. (A-C,D,H,L) DIC images,
(E,F,I,J,M,N,P-R) fluorescence images, (G,K,O,S,U,W) merge of fluorescence images, (T,V) merge of DIC and fluorescence images. All panels show
lateral views with anterior to the left. dys, anti-dystrophin; lam, anti-laminin.
DEVELOPMENT
Fibre viability in basement membrane failure
3374 RESEARCH ARTICLE
Development 136 (19)
Fig. 8. Sarcolemmal rupture correlates with the mode of fibre
detachment in sof muscle. (A-C) Evans Blue is excluded from the
myotome of wild-type embryos. (D-F) The dye infiltrates a subset of
damaged fibres in sof embryos before complete detachment. The fibre
depicted still spans the somite, but the contractile cytoskeleton has
collapsed in the centre. (G-I) Evans Blue permeates an EFT (arrow in H)
but does not enter the fibres attached to it. (J) Electron micrograph of a
retracting fibre in a sof embryo at 72 hpf. The vertical myoseptum is to
the left of the fibre. (K) A magnified view of the boxed area in J
showing trailing sarcolemma at the newly detached tip of the fibre
(arrows). (A,D,G) DIC images, (B,E,H) fluorescence images, (C,F,I) merge
of DIC and fluorescence images. All panels show lateral views with
anterior to the left.
Fig. S3A with S3D in the supplementary material). This may indicate
that caf fibres can maintain their sarcolemmal shape and tension upon
detachment whereas the terminal sarcolemma of sof fibres collapses
following tearing and detachment from the BM.
Analysis of softy;candyfloss double mutant
embryos
As Lama2 and Lamb2 are co-localised at the MTJ, we sought to
determine the epistatic relationship between the two laminin chains.
Embryos produced from an incross of sof/+;caf/+ compound
heterozygotes were assayed by birefringence at 120 hpf. As no
additive phenotype was evident, those embryos with the greatest loss
of birefringency were genotyped for the presence of the mutant
alleles. This revealed that 59% (n=22) of the selected embryos were
homozygous for the caf allele whereas 41% were homozygous for
both caf and sof alleles (i.e. double mutants). As no sof mutants
alone were selected in this assay, we concluded that, by 120 hpf, the
muscle degeneration in caf has progressed more than in sof.
Furthermore, the presence of one mutant lama2 allele on a
homozygous sof background did not increase the severity of the sof
mutant phenotype, as assayed by loss of birefringence (n=12). These
results demonstrate that caf is epistatic to sof, such that the presence
of a mutant Lamb2 chain does not exacerbate the phenotype caused
by loss of Lama2 (see Fig. S4 in the supplementary material).
DISCUSSION
Previous work has demonstrated that loss of crucial components of
the zebrafish MTJ, either intracellularly (dystrophin, integrin-linked
kinase) or extracellularly (Lama2), results in an embryonic myofibre
detachment phenotype (Bassett et al., 2003; Hall et al., 2007; Postel
et al., 2008). In this study we extend our knowledge of the role of
another extracellular component, Lamb2, by showing that a
disorganised MTJ, detachment of muscle fibres and sarcolemmal
damage all result from a missense mutation in the zebrafish lamb2
gene in the softm272a mutant. Whereas secondary changes in levels
of LAMB2 immunoreactivity have been seen in congenital muscular
dystrophy, this laminin chain has not been implicated as a direct
cause of inherited muscle disease (Cohn et al., 1997). Rather,
mutations in LAMB2 cause Pierson syndrome, an autosomal
recessive, oculorenal disease with neurological involvement (Zenker
et al., 2004). No dystrophy has been reported in Pierson syndrome;
however, deletion of Lamb2 in the mouse results in MTJ defects in
addition to renal and motor endplate dysfunction (Miner et al.,
2006). As we have shown, the specificity of the sof phenotype,
compared with mammalian alleles, can be explained by gene
duplication and subdivision of expression domains of the duplicate
genes, lamb2 and lamb2l. These findings reinforce the importance
of Lamb2 in maintaining the structural integrity of the skeletal
muscle BM and the stability of myofibre attachment.
The initial severity of the sof phenotype may be explained by the
Leu38rPro substitution being located in the LN domain of Lamb2.
This domain participates in assembly of the laminin polymer via
non-covalent tripartite interactions with the LN domains of adjacent
β and γ chains (Colognato et al., 1999; McKee et al., 2007). A
compromised polymerisation interface will have an impact on the
integrity of the laminin network as a whole, thereby affecting the
strength of extracellular matrix adhesion to the sarcolemma at the
MTJ. Although the short stretches of layered BM seen in electron
micrographs of sof MTJ imply that the mutant protein can still be
assembled into a macromolecular lattice, the onset of muscle
activity, imposing physical strain on the MTJ, will expose any
weakness in the polymer, triggering the muscle attachment failure
seen in sof. The inability of exogenous Lamb2 to prevent
detachment also supports a model of overall instability of the
laminin lattice in sof mutants that cannot be overcome by localised,
cell-autonomous secretion of wild-type protein into the extracellular
matrix.
In terms of aetiology, sof is most similar to the zebrafish lama2
mutant, caf, a model for MDC1A (Hall et al., 2007). caf is also
epistatic to sof, with no increased severity seen in sof;caf double
homozygotes. This implies that the major function of Lamb2 in
stabilising muscle attachments is mediated through its complex with
Lama2, rather than another α chain. However, a number of
intriguing phenotypic differences exists between the two mutants.
These include different MTJ pathologies, differences in the
permeability of detached single fibres to Evans Blue dye and a
DEVELOPMENT
Double mutant embryos were also immunostained for dystrophin
and laminin to ascertain whether Lama2 is required for the formation
of EFTs (see Fig. S5 in the supplementary material). When
compared with sof and caf mutant embryos, it was evident that the
double mutants were most similar to caf. EFTs were readily seen in
sof mutants, whereas intramyotomal co-localisation of dystrophin
and laminin in caf and sof;caf mutants was restricted to condensed
fragments of membrane at the ends of retracted fibres. This clearly
indicates that the formation of EFTs is dependent on the availability
of Lama2 in the extracellular matrix.
contrasting capacity for recovery and survival. In addition, although
the nature of the respective mutations is different – truncation of
Lama2 in caf, amino acid substitution in Lamb2 in sof – the precise
recapitulation of the sof phenotype by knockdown of Lamb2 in
morphant embryos strongly suggests that the sof mutation is also a
loss-of-function mutation. Furthermore, the presence of normal
levels of immunoreactive laminin at fibre ends in lamb2 morphants
indicates that an alternate laminin β chain may be present. The
laminin complex containing this alternate β chain, the identity of
which is under investigation, may be sufficient for initial attachment
but, when Lamb2 levels are reduced, may not provide the necessary
resilience to prevent fibre detachment in the morphants. Together,
these findings suggest a complexity of interaction between multiple
laminin isoforms in the developing skeletal muscle BM that is only
beginning to be explored (Snow et al., 2008).
A major, unexpected finding of this report is that, despite a severe
muscle pathology comparable to that seen in other dystrophic
zebrafish mutants, sof is viable. This contrasts with the other
dystrophic mutants, which have an average life span of three weeks
or less (Bassett et al., 2003; Hall et al., 2007). In attempting to
elucidate the basis of this capacity for recovery, we uncovered
ectopic fibre terminations associated with a subset of retracted fibres
as a phenotypic element unique to sof. The fact that these were also
seen in lamb2 morphant embryos indicates that the loss of functional
Lamb2 protein predisposes to EFT formation. Furthermore, our
evidence suggests that the EFTs act as a stable substrate, providing
a mechanical support and/or survival factor(s) to the associated
fibres, despite having detached from the myoseptum. The retracted
fibres may even continue to secrete BM components, increasing the
strength of the EFT. Overall, the viability afforded by attachment to
EFTs may act to slow down the cascade of dystrophic muscle
degeneration and allow regenerative processes to take effect in the
damaged myotome. EFT formation may thus be a pivotal factor
contributing to the recovery seen in sof mutants.
The inherited muscular dystrophies are a large group of diseases
characterised by skeletal muscle wasting and loss of muscle function
(Emery, 2002). None of these diseases are currently curable, and many
experimental therapies are being investigated. A viable zebrafish
muscular dystrophy model has the potential to make a significant
contribution to research in this field (Bassett and Currie, 2003; Guyon
et al., 2007). Uncovering the mechanisms that enable the sof mutant
to recover from severe, early muscle degeneration and thrive as adults
may ultimately have important ramifications. Although our
understanding of EFT formation is incomplete, their contribution to
stabilising a damaged myotome offers promise for a novel therapeutic
approach to the muscular dystrophies. If the BM of diseased muscle
fibres can be augmented in a way that mimics the structures described
here, then the severity of dystrophic muscle damage may be alleviated.
Acknowledgements
We are grateful to Dr H.-G. Frohnhöfer and Prof. P. Ingham for fish strains. We
thank J. Cocks, C. Jenkin and P. Yudhyantara for expert fish care. We also
thank Dr M. Wouters and Dr I. Martin for useful discussion and the Fatkin Lab
for technical help. The F59 and MANDAG2 antibodies (developed by F.
Stockdale and G. Morris, respectively) were obtained from the Developmental
Studies Hybridoma Bank developed under the auspices of the NICHD and
maintained by The University of Iowa, Department of Biological Sciences, Iowa
City, IA 52242, USA. This work was funded by the NHMRC, Australia, the
MDA, USA and the Human Frontiers Science Program. E.B.-N. and D.L.S. were
supported by the Wellcome Trust (WT 077037/Z/05/Z, WT 077047/Z/05/Z).
Deposited in PMC for release after 6 months.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/136/19/3367/DC1
RESEARCH ARTICLE 3375
References
Aumailley, M., Bruckner-Tuderman, L., Carter, W. G., Deutzmann, R., Edgar,
D., Ekblom, P., Engel, J., Engvall, E., Hohenester, E., Jones, J. C. et al.
(2005). A simplified laminin nomenclature. Matrix Biol. 24, 326-332.
Bassett, D. I. and Currie, P. D. (2003). The zebrafish as a model for muscular
dystrophy and congenital myopathy. Hum. Mol. Genet. 12 Spec No 2, R265R270.
Bassett, D. I., Bryson-Richardson, R. J., Daggett, D. F., Gautier, P., Keenan, D.
G. and Currie, P. D. (2003). Dystrophin is required for the formation of stable
muscle attachments in the zebrafish embryo. Development 130, 5851-5860.
Bendtsen, J. D., Nielsen, H., von Heijne, G. and Brunak, S. (2004). Improved
prediction of signal peptides: SignalP 3.0. J. Mol. Biol. 340, 783-795.
Cohn, R. D., Herrmann, R., Wewer, U. M. and Voit, T. (1997). Changes of
laminin beta 2 chain expression in congenital muscular dystrophy. Neuromuscul.
Disord. 7, 373-378.
Colognato, H., Winkelmann, D. A. and Yurchenco, P. D. (1999). Laminin
polymerization induces a receptor-cytoskeleton network. J. Cell Biol. 145, 619631.
Durkin, M. E., Jager, A. C., Khurana, T. S., Nielsen, F. C., Albrechtsen, R. and
Wewer, U. M. (1999). Characterization of the human laminin beta2 chain locus
(LAMB2): linkage to a gene containing a nonprocessed, transcribed LAMB2-like
pseudogene (LAMB2L) and to the gene encoding glutaminyl tRNA synthetase
(QARS). Cytogenet. Cell Genet. 84, 173-178.
Elworthy, S., Hargrave, M., Knight, R., Mebus, K. and Ingham, P. W. (2008).
Expression of multiple slow myosin heavy chain genes reveals a diversity of
zebrafish slow twitch muscle fibres with differing requirements for Hedgehog
and Prdm1 activity. Development 135, 2115-2126.
Emery, A. E. (2002). The muscular dystrophies. Lancet 359, 687-695.
Geisler, R. (2002). Mapping and cloning. In Zebrafish (ed. C. Nüsslein-Volhard and
R. Dahm), pp. 175-212. Oxford: Oxford University Press.
Granato, M., van Eeden, F. J., Schach, U., Trowe, T., Brand, M., FurutaniSeiki, M., Haffter, P., Hammerschmidt, M., Heisenberg, C. P., Jiang, Y. J. et
al. (1996). Genes controlling and mediating locomotion behavior of the
zebrafish embryo and larva. Development 123, 399-413.
Green, T. L., Hunter, D. D., Chan, W., Merlie, J. P. and Sanes, J. R. (1992).
Synthesis and assembly of the synaptic cleft protein S-laminin by cultured cells. J.
Biol. Chem. 267, 2014-2022.
Guille, M. (1999). Molecular Methods in Developmental Biology: Xenopus and
Zebrafish. New York: Humana Press.
Guyon, J. R., Steffen, L. S., Howell, M. H., Pusack, T. J., Lawrence, C. and
Kunkel, L. M. (2007). Modeling human muscle disease in zebrafish. Biochim.
Biophys. Acta 1772, 205-215.
Hall, T. E., Bryson-Richardson, R. J., Berger, S., Jacoby, A. S., Cole, N. J.,
Hollway, G. E., Berger, J. and Currie, P. D. (2007). The zebrafish candyfloss
mutant implicates extracellular matrix adhesion failure in laminin alpha2deficient congenital muscular dystrophy. Proc. Natl. Acad. Sci. USA 104, 70927097.
Higashijima, S., Okamoto, H., Ueno, N., Hotta, Y. and Eguchi, G. (1997).
High-frequency generation of transgenic zebrafish which reliably express GFP in
whole muscles or the whole body by using promoters of zebrafish origin. Dev.
Biol. 192, 289-299.
Hollway, G. E., Bryson-Richardson, R. J., Berger, S., Cole, N. J., Hall, T. E.
and Currie, P. D. (2007). Whole-somite rotation generates muscle progenitor
cell compartments in the developing zebrafish embryo. Dev. Cell 12, 207219.
Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B. and Schilling, T. F.
(1995). Stages of embryonic development of the zebrafish. Dev. Dyn. 203, 253310.
Kwan, K. M., Fujimoto, E., Grabher, C., Mangum, B. D., Hardy, M. E.,
Campbell, D. S., Parant, J. M., Yost, H. J., Kanki, J. P. and Chien, C. B.
(2007). The Tol2kit: a multisite gateway-based construction kit for Tol2
transposon transgenesis constructs. Dev. Dyn. 236, 3088-3099.
Libby, R. T., Lavallee, C. R., Balkema, G. W., Brunken, W. J. and Hunter, D. D.
(1999). Disruption of laminin beta2 chain production causes alterations in
morphology and function in the CNS. J. Neurosci. 19, 9399-9411.
McKee, K. K., Harrison, D., Capizzi, S. and Yurchenco, P. D. (2007). Role of
laminin terminal globular domains in basement membrane assembly. J. Biol.
Chem. 282, 21437-21447.
Miner, J. H. (2008). Laminins and their roles in mammals. Microsc. Res. Tech. 71,
349-356.
Miner, J. H., Go, G., Cunningham, J., Patton, B. L. and Jarad, G. (2006).
Transgenic isolation of skeletal muscle and kidney defects in laminin beta2
mutant mice: implications for Pierson syndrome. Development 133, 967-975.
Neff, M. M., Turk, E. and Kalishman, M. (2002). Web-based primer design for
single nucleotide polymorphism analysis. Trends Genet. 18, 613-615.
Nüsslein-Volhard, C. and Dahm, R. (2002). Zebrafish: A Practical Approach.
Oxford: Oxford University Press.
Odenthal, U., Haehn, S., Tunggal, P., Merkl, B., Schomburg, D., Frie, C.,
Paulsson, M. and Smyth, N. (2004). Molecular analysis of laminin N-terminal
domains mediating self-interactions. J. Biol. Chem. 279, 44504-44512.
DEVELOPMENT
Fibre viability in basement membrane failure
Oxtoby, E. and Jowett, T. (1993). Cloning of the zebrafish krox-20 gene (krx-20)
and its expression during hindbrain development. Nucleic Acids Res. 21, 10871095.
Parsons, M. J., Pollard, S. M., Saude, L., Feldman, B., Coutinho, P., Hirst, E.
M. and Stemple, D. L. (2002). Zebrafish mutants identify an essential role for
laminins in notochord formation. Development 129, 3137-3146.
Patton, B. L. (2000). Laminins of the neuromuscular system. Microsc. Res. Tech.
51, 247-261.
Pedrosa-Domellof, F., Tiger, C. F., Virtanen, I., Thornell, L. E. and Gullberg, D.
(2000). Laminin chains in developing and adult human myotendinous junctions.
J. Histochem. Cytochem. 48, 201-210.
Postel, R., Vakeel, P., Topczewski, J., Knoll, R. and Bakkers, J. (2008). Zebrafish
integrin-linked kinase is required in skeletal muscles for strengthening the
integrin-ECM adhesion complex. Dev. Biol. 318, 92-101.
Sanes, J. R. (2003). The basement membrane/basal lamina of skeletal muscle. J.
Biol. Chem. 278, 12601-12604.
Snow, C. J., Goody, M., Kelly, M. W., Oster, E. C., Jones, R., Khalil, A. and
Henry, C. A. (2008). Time-lapse analysis and mathematical characterization
Development 136 (19)
elucidate novel mechanisms underlying muscle morphogenesis. PLoS Genet. 4,
e1000219.
Straub, V., Rafael, J. A., Chamberlain, J. S. and Campbell, K. P. (1997). Animal
models for muscular dystrophy show different patterns of sarcolemmal
disruption. J. Cell Biol. 139, 375-385.
Westerfield, M. (1993). The Zebrafish Book. Eugene, OR: University of Oregon
Press.
Wiedenmann, J., Ivanchenko, S., Oswald, F., Schmitt, F., Rocker, C., Salih, A.,
Spindler, K. D. and Nienhaus, G. U. (2004). EosFP, a fluorescent marker
protein with UV-inducible green-to-red fluorescence conversion. Proc. Natl.
Acad. Sci. USA 101, 15905-15910.
Yurchenco, P. D., Cheng, Y. S. and Colognato, H. (1992). Laminin forms an
independent network in basement membranes. J. Cell Biol. 117, 1119-1133.
Zenker, M., Aigner, T., Wendler, O., Tralau, T., Muntefering, H., Fenski, R.,
Pitz, S., Schumacher, V., Royer-Pokora, B., Wuhl, E. et al. (2004). Human
laminin beta2 deficiency causes congenital nephrosis with mesangial sclerosis
and distinct eye abnormalities. Hum. Mol. Genet. 13, 2625-2632.
DEVELOPMENT
3376 RESEARCH ARTICLE