Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Am J Physiol Regul Integr Comp Physiol 293: R47–R54, 2007. First published March 15, 2007; doi:10.1152/ajpregu.00745.2006. Low fat adiponectin expression is associated with oxidative stress in nondiabetic humans with chronic kidney disease—impact on plasma adiponectin concentration Rocco Barazzoni,1 Annamaria Bernardi,2 Franco Biasia,2 Annamaria Semolic,1 Alessandra Bosutti,1 MariaPia Mucci,3 Franca Dore,3 Michela Zanetti,1 and Gianfranco Guarnieri1 1 Clinica Medica, Dipartimento di Scienze Cliniche, Morfologiche e Tecnologiche, University of Trieste, Italy; Renal Unit, ULSS18, Rovigo, Italy; and 3Nuclear Medicine, Azienda Ospedaliera “Ospedali Riuniti,” Trieste, Italy 2 Submitted 14 October 2006; accepted in final form 8 March 2007 adipose-derived circulating protein and it is reported to exert protective metabolic and vascular effects (1, 16, 18, 32). High circulating adiponectin is strongly associated with reduced cardiovascular risk under different clinical and experimental conditions (33, 40) and low adipose tissue adiponectin transcriptional expression is associated with hypoadiponectinemia and could contribute to insulin resistance and cardiovascular disease in obesity and type 2 diabetes (18). Chronic kidney disease (CKD) is a unique condition in that exceedingly high incidence of insulin resistance [in turn independently associated with enhanced cardiovascular events (34)] and cardiovascular morbidity and mortality [increasing from conservative to maintenance hemodialysis (MHD) treatment (24, 41)] is paradoxically associated with elevated plasma adiponectin. Although recent data (27) have questioned the previously reported protective cardiovascular impact of adiponectin in earlier stages of renal disease (3), available evidence indicates that highest total adiponectin increments are associated with lower cardiovascular risk in end-stage CKD (40), and all studies agree on protective effects of higher circulating adiponectin on metabolic risk factors (3, 27, 40). We also observed a positive association between plasma adiponectin and insulin-mediated glucose disposal using the gold-standard hyperinsulinemic-euglycemic clamp technique to measure insulin action in nondiabetic MHD patients (R. Barazzoni, G. Guarnieri et al., unpublished data). The above observations suggest that adiponectin-dependent metabolic and cardiovascular protection is preserved in advanced chronic uremia, although its effectiveness could be blunted by additional CKD-associated alterations and risk factors. Understanding the regulation of circulating adiponectin levels in advanced CKD is therefore of substantial clinical importance. CKD-associated hyperadiponectinemia could be due at least in part to reduced glomerular filtration rate and passive accumulation (13, 28). Whether changes in adiponectin adipose expression contribute to modulation of circulating adiponectin in different stages of advanced CKD remains, however, to be defined. Oxidative stress can contribute to insulin resistance and cardiovascular risk in chronic disease states, including obesity and diabetes (9, 11, 25), due to imbalance between oxidant generation and antioxidant defense systems. Systemic and tissue oxidative stress is also often reported in CKD (5, 7, 15, 23, 30, 31, 39). CKD-associated oxidative stress is likely to be, at least in part, independent of changes in body mass and fat (5, 7, 15, 23, 30, 31, 39), and it could, in turn, increase with progressive reduction of renal function with highest levels reported in MHD (5, 7, 15, 23, 30, 31, 39). Rapid reversibility of oxidative stress has also been reported after renal transplantation (38), further supporting its link with CKD and changes in renal function. A link between oxidative stress and altered adiponectin production has, in turn, recently emerged in experimental models (11, 14, 19, 35), as oxidative stress reduced Address for reprint requests and other correspondence: R. Barazzoni, Clinica Medica, Univ. of Trieste, Ospedale Cattinara, Strada di Fiume 443, 34100 Trieste, Italy (e-mail: [email protected]). The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. adipose tissue; hemodialysis ADIPONECTIN IS THE MOST ABUNDANT http://www.ajpregu.org 0363-6119/07 $8.00 Copyright © 2007 the American Physiological Society R47 Downloaded from http://ajpregu.physiology.org/ by 10.220.33.1 on June 18, 2017 Barazzoni R, Bernardi A, Biasia F, Semolic A, Bosutti A, Mucci MP, Dore F, Zanetti M, Guarnieri G. Low fat adiponectin expression is associated with oxidative stress in nondiabetic humans with chronic kidney disease—impact on plasma adiponectin concentration. Am J Physiol Regul Integr Comp Physiol 293: R47–R54, 2007. First published March 15, 2007; doi:10.1152/ajpregu.00745.2006.—In spite of association between high plasma adiponectin and high metabolic and cardiovascular (CV) risk, highest adiponectin increments retain CV and metabolic protective effects in advanced chronic kidney disease (CKD). Passive accumulation can favor CKD-associated hyperadiponectinemia but potential additional regulation by adipose tissue remains undefined. Oxidative stress (OS) is associated with metabolic and CV disease and with CKD [increasing from conservative treatment (CT) to maintenance hemodialysis (MHD)], and OS can reduce adiponectin expression in experimental models. OS (in the form of plasma thiobarbituric acid-reactive substances: TBARS), subcutaneous adipose adiponectin mRNA, and plasma adiponectin were studied in CKD patients (stages 4 and 5) on CT (n ⫽ 7) or MHD (n ⫽ 11). Compared with CT and controls (C: n ⫽ 6) MHD had highest TBARS and lowest adiponectin mRNA (P ⬍ 0.05) with lower adipose adiponectin protein (P ⬍ 0.05 vs. CT). MHD also had lower plasma adiponectin than CT, although both had higher adiponectin than C (P ⬍ 0.05). In renal transplant recipients (RT: CKD stage 3; n ⫽ 5) normal TBARS were, in turn, associated with normal adiponectin mRNA (P ⬍ 0.05 vs. MHD). In all CKD (n ⫽ 23), adiponectin mRNA was associated positively with adiponectin plasma concentration (P ⬍ 0.01). In all subjects (n ⫽ 29), adiponectin mRNA was related (P ⬍ 0.05) negatively with TBARS after adjusting for plasma C-reactive protein (CRP) or CRP and creatinine. Thus altered OS, adiponectin expression, and plasma concentration represent a novel cluster of metabolic and CV risk factors in MHD that are normalized in RT. The data suggest novel roles of 1) MHD-associated OS in modulating adiponectin expression and 2) adipose tissue in contributing to circulating adiponectin in advanced CKD. R48 OXIDATIVE STRESS AND FAT ADIPONECTIN IN CKD MATERIALS AND METHODS Study subjects and experimental protocol. We examined 18 Caucasian patients with advanced CKD [stages 4 and 5 based on estimated glomerular filtration rate (eGFR) according to the National Kidney Foundation classification (29)] divided in two groups undergoing CT (n ⫽ 7) or MHD (n ⫽ 11) treatment. An additional group of age-, BMI- and gender-matched patients treated with kidney transplantation [CKD stage 3; renal transplant (RT), n ⫽ 5] was also studied to assess potential reversibility of observed alterations. The study was approved by the local Ethics Committee, and all participants gave informed consent to it. In CT patients cause of renal failure was hypertension (n ⫽ 2), glomerulonephritis (n ⫽ 3), or not known (n ⫽ 2). In MHD, the cause of renal failure was hypertension (n ⫽ 4), glomerulonephritis (n ⫽ 4), polycystic kidney disease (n ⫽ 2), or bilateral nephrectomy (n ⫽ 1). In RT, cause of renal failure before transplantation was hypertension (n ⫽ 1), glomerulonephritis (n ⫽ 3), and polycystic kidney disease (n ⫽ 1). All patients were taking antihypertensive treatment that included ACE inhibitors in seven MHD, five CT, and two RT patients and Ca-antagonists in five MHD, four CT, and two RT patients. One MHD and one CT female patient had hypothyroidism treated with thyroxin with excellent clinical and biochemical control at the time of the study. None of the patients was treated with fish oil. All patients were selected to be ambulatory, nonobese, and nondiabetic with BMI above 20 and below 30 kg/m2 to avoid the potential confounding associations of obesity, diabetes, and cachexia with oxidative stress and altered adipocytokine levels (9, 11, 17, 36). Lack of diabetes was defined on the basis of fasting glucose besides medical history and lack of antidiabetic medications at the time of study or before it. No CKD patient in any group had had cardiovascular events or had a positive history for coronary artery disease on the basis of examination and detailed clinical history. Additional exclusion criteria were liver disease and nephrotic syndrome (defined as daily proteinuria ⬎3.5 g/1.73 m2). All control subjects were healthy, as assessed by medical history and clinical examination, as well as lack of medications taken at the time of the study. Control subjects were selected to be matched for age and gender to the patient groups, as well as within the same BMI limits. Patients underwent subcutaneous adipose tissue biopsy in the morning after the overnight fast. In MHD patients, samples were taken before the start of a dialysis session to minimize the potential effect of previous dialysis session per se on the studied parameters (7, 30, 31) [although no major acute effects of dialysis have been reported on plasma adiponectin (10)]. After obtaining a blood sample for hormone and TBARS measurement, local anesthesia was induced in the periumbilical skin region under sterile conditions. A superficial incision was then performed followed by removal of 50 –100 mg of subcutaneous fat that was immediately frozen in liquid nitrogen and subsequently kept at ⫺80°C until analyses. Body composition. Body composition was measured using multifrequency bioimpedence analysis (Sta-Bia Soft Tissue Analyzer, Akern, Pontassieve, Italy) in a quiet environment, with proximal electrodes placed on the dorsal side of wrist and ankle, and the distal electrodes on the second metacarpal (metatarsal)-phalangeal joint (limbs contralateral to the a-v fistula were used in hemodialysis patients) with limbs at 45° abduction (4, 20). Resistance and reactance data were normalized for height and analyzed to calculate body composition parameters (Bodygram Software). Adipose tissue adiponectin mRNA and protein content. To assess adiponectin transcriptional expression, total adipose tissue mRNA was extracted from ⬃40 mg of adipose tissue using the RNeasy Mini Kit (Qiagen, Cologne, Germany). One microgram of total RNA was reverse-transcribed (RNA Reverse Transcription KIT, Applied Biosystems, Foster City, CA), and adiponectin transcripts were amplified using the following primers and probes, selected using the Primer Express Software (Applied Biosystems): Forward primer: TCAATGGCCCCTGCACTACT; Reverse primer: GGGATGAGTTCAGCACTTAGAGATG; Probe: CCTCTTACCTATGTCCCTTCTCATGCCTTTCC. 28S rRNA was used as reference gene using the following primers and probe: Forward primer: TGGGAATGCAGCCCAAAG; Reverse primer: CCTTACGGTACTTGTTGACTATCG; probe: TGGTAAACTCCATCTAAGGCTAAATACCGGCA. Target and housekeeping genes were amplified separately using real-time polymerase chain reaction, and their final quantitation was achieved using a relative standard curve, as previously described (2). Adiponectin mRNA values were divided by the corresponding 28S rRNA value and expressed as arbitrary units. To further confirm changes in adiponectin gene expression at the posttranscriptional level, we measured adiponectin protein content in aliquots from the same adipose tissue sample. Because of low tissue availability, this measurement was performed in 6 CT and 7 MHD, while not in control or RT patients. Briefly, total protein was extracted from 40 –50 mg of adipose tissue homogenized in sucrose buffer (0.25 mM sucrose, 10 mM HEPES, 0.2 mM EDTA) containing protease inhibitors. The homogenate was centrifuged at 2,500 rpm for 10 min, and the supernatant was transferred to a fresh tube and again centrifuged at 13,000 rpm at 4°C for 10 min. The supernatant was then divided into two aliquots; equal volumes of 10% TCA were added and incubated at ⫺20°C for 45 min. Samples were then centrifuged at 9,000 rpm at 4°C for 30 min. The pellet was washed with 90% acetone, evaporated, and suspended in 30-l solubilization buffer containing 40 mM Tris base and 2% SDS. After measurement of total protein concentration from the purified sample, 10 g total adipose tissue protein were used to measure total adiponectin concentration using a commercially available kit (ALPCO Diagnostics, Salem, NH) following the manufacturer’s recommendations except for a lower AJP-Regul Integr Comp Physiol • VOL 293 • JULY 2007 • www.ajpregu.org Downloaded from http://ajpregu.physiology.org/ by 10.220.33.1 on June 18, 2017 adipose tissue adiponectin transcript levels in vitro and in animal studies (11, 14, 19, 35). No information is available on the potential interactions between adipose tissue adiponectin and oxidative stress in human disease and in CKD, in particular. In the current study, we cross-sectionally investigated changes in oxidative stress (plasma thiobarbituric acid reactive substances: TBARS), subcutaneous adipose tissue adiponectin expression, and plasma adiponectin, as well as their potential relationships in patients with advanced CKD (stages 4 and 5) undergoing MHD (n ⫽ 11) or conservative treatment (CT; n ⫽ 7). It was hypothesized that 1) fat tissue adiponectin expression declines with increasing oxidative stress in patients undergoing MHD treatment and that 2) adiponectin expression is associated with parallel changes of its plasma concentration. It was further hypothesized that oxidative stress and adiponectin expression would, in turn, be normal in an additional group of nondiabetic renal transplant recipients. TBARS were selected as an oxidative stress marker because they reflect lipid peroxidation (10, 13, 18, 34) and were reported to be directly linked to adipose tissue adiponectin expression in animal models (11), as well as to adiponectin plasma concentration in nonrenal obese patients (11). In addition, TBARS were reported to be increased in subcutaneous adipose tissue samples from CKD patients (12). All patients were selected to be free of obesity and diabetes to avoid the confounding effect of these potential independent causes of oxidative stress and altered adiponectin production (9, 11, 17). The potential involvement of inflammatory state as reflected by the validated index C-reactive protein was also assessed since inflammation can occur in advanced CKD, is commonly negatively associated with circulating adiponectin (1, 32), and could negatively affect its adipose tissue expression (6). R49 OXIDATIVE STRESS AND FAT ADIPONECTIN IN CKD RESULTS Anthropometric, clinical, and biochemical parameters in control and CKD subjects. MHD, CT, and control subjects were comparable for gender, age, body mass index and body fat (Table 1). The groups also had comparable plasma insulin and glucose concentrations, as well as similar blood pressure recordings. Plasma creatinine concentration was higher by design in CKD groups with intermediate values in CT and highest levels in MHD. As expected, eGFR was lowest in MHD and within stages 4 and 5 for CT patients. Plasma high-sensitivity CRP was higher in MHD than in all other groups. Plasma adiponectin, adipose tissue adiponectin mRNA, and plasma TBARS. Plasma concentrations of TBARS were higher in MHD than in both CT and control subjects (Fig. 1A). Subcutaneous adipose tissue adiponectin mRNA levels were comparable to normal values in CT but substantially lower in MHD (Fig. 1B). Plasma adiponectin concentration was higher in both MHD and CT than in control subjects, but this increment was, however, less pronounced in MHD (Fig. 1C). Adipose tissue adiponectin protein level was also lower in MHD than in CT patients (7.2 ⫾ 0.8 vs. 18.3 ⫾ 5 pg/100 ng total adipose tissue protein; P ⫽ 0.043). Plasma adiponectin, adipose tissue adiponectin mRNA, and plasma TBARS in renal transplant recipients. To assess the potential impact of renal transplant on the observed alterations, we studied an additional group of nonobese, nondiabetic (as defined above for patients from other groups) RT recipients (n ⫽ 5, 3M, treated with hemodialysis before transplantation, time from transplantation 116 ⫾ 88 mo, range 47–228). Differences between RT and other groups were assessed using ANOVA and Student’s t-test or Wilcoxon test. RT patients had age (64 ⫾ 6 years, range 55– 67), body mass index (25.9 ⫾ 4, range 22–29.6) and body fat (26.4 ⫾ 11%, range 15– 40) comparable to the other experimental groups. Plasma glucose and insulin concentrations were also not different from all other groups (P ⬎ 0.05). RT patients had HS-CRP comparable to that of control and CT groups and lower than MHD (0.2 ⫾ 0.4 mg/dl, range 0.02– 0.9, P ⬍ 0.05 vs. MHD). Plasma creatinine was lower than both CT and MHD but higher than control subjects (1.5 ⫾ 0.2 mg/dl, range 1.3–1.7, P ⬍ 0.05 vs. all other groups) with eGFR of 44.9 ⫾ 4.9 ml䡠min⫺1 䡠1.73 m⫺2 (P ⬍ 0.05 vs. all other groups). Compared with MHD, RT had lower TBARS and higher adiponectin mRNA (Fig. 2) with both values comparable to CT and control subjects. Plasma adiponectin was conversely comparable in the MHD and RT groups (Fig. 3). Plasma adiponectin was also higher in the smaller RT than in the control group (P ⬍ 0.05, not shown). Plasma adiponectin to adipose tissue adiponectin mRNA ratio. The ratio between plasma adiponectin and adiponectin mRNA was calculated in all subjects as a potential index of hormone accumulation independent of its transcriptional ex- Table 1. Various parameters in chronic kidney disease subjects Sex (M/F) Age, yr BMI, kg/m2 Body fat, % SBP, mmHg DBP, mmHg Insulin, U/ml Glucose, mMol Total cholesterol, mg/dl Triglycerides, mg/dl hs-CRP, mg/dl Creatinine, mg/dl eGFR, ml 䡠 min⫺1 䡠 1.73m2 Dialysis, mo Control CT MHD 3/3 64⫾11 (52–78) 26.2⫾3.1 (22–29.3) 33.1⫾8 (19–41) 135⫾15 (122–155) 82⫾8 (72–90) 12.6⫾8 (3.5–22.1) 5⫾0.4 (4.1–5.1) 201⫾11 (172–250) 125⫾26 (38–215) 0.11⫾0.1 (0.03–0.4) 0.8⫾0.1 (0.7–0.9) 87⫾8.9 (80–101) / 4/3 68⫾7 (59–77) 26⫾3.7 (21–29.4) 30.6⫾9 (20–45) 140⫾22 (108–158) 87⫾12 (70–98) 14⫾10 (4.7–30) 4.8⫾0.5 (4–5.5) 207⫾13 (154–245) 195⫾22 (136–299) 0.44⫾0.6 (0.02–1.2) 4.2⫾1.3 (2.5–6.5)* 16.7⫾5.9 (9.5–27.9)* / 6/5 69⫾11 (46–80) 24.2⫾2.5 (21.8–28.6) 28.8⫾11 (9–45) 137⫾18 (105–155) 82⫾10 (73–95) 11.8⫾6 (3.5–17.4) 4.6⫾0.6 (3.9–5.4) 163⫾12 (117–213) 144⫾18 (88–221) 1.99⫾1.3 (0.3–4)† 8.9⫾1.5 (6.5–10.3)† 5.8⫾1.2 (4.3–8)† 31⫾21 (6–78) Values are presented as means (SD for range). Sex, age, body mass index (BMI), percent body fat, systolic (SBP) and diastolic (DBP) blood pressure, plasma insulin and glucose concentrations, plasma total cholesterol and triglyceride concentrations, plasma high-sensitivity C-reactive protein (hs-CRP), plasma creatinine, estimated glomerular filtration rate (eGFR) and dialysis duration in control subjects and in chronic kidney disease patients undergoing conservative treatment (CT) or maintenance hemodialysis (MHD). *P ⬍ 0.05 vs. control and MHD; †P ⬍ 0.05 vs. Control and CT, ANOVA and Student’s unpaired t-test. AJP-Regul Integr Comp Physiol • VOL 293 • JULY 2007 • www.ajpregu.org Downloaded from http://ajpregu.physiology.org/ by 10.220.33.1 on June 18, 2017 sample dilution (1:2,500: determined with preliminary tests) for final spectrophotometrical reading. Plasma biochemical profile. Plasma TBARS concentration was measured using a commercially available kit (Oxitek, Zeptometrix Co, Buffalo, NY) following the manufacturer’s recommendations (intraassay coefficient of variation: 4%, interassay coefficient of variation: 5.1%). A commercially available ELISA kit was also used to measure plasma total adiponectin (B-Bridge International, Sunnyvale, CA) (intraassay coefficient of variation: 4.2%, interassay coefficient of variation: 5.6%). Total adiponectin was chosen since it has been directly demonstrated to modulate metabolic and cardiovascular risk in advanced CKD (3, 27, 40). Plasma insulin concentrations were measured by radioimmunoassay (Linco, St Louis, MO). Blood glucose concentration was measured by reflectometer (Roche Diagnostics, Indianapolis, IN). High-sensitivity C-reactive protein (HS-CRP) plasma concentration, a marker of systemic inflammation, was measured using a commercially available ELISA kit (Diagnostics Biochem, London, Ontario, Canada). Plasma creatinine concentration was measured using standard methods, and glomerular filtration rate (GFR) was calculated using validated formula based on plasma creatinine according to Modification of Diet in Renal Disease Study Group equations (22). Statistical analysis. ANOVA followed by Student’s t-test or nonparametric Wilcoxon test (analyses of TBARS and adiponectin mRNA, as well as plasma adiponectin to mRNA ratio), were used to compare variables between the experimental groups. Log transformation was applied in linear regression analyses and for stepwise multiple regression analyses of plasma TBARS and adiponectin mRNA due to nonnormal data distribution. P values of 0.05 or less were considered statistically significant. R50 OXIDATIVE STRESS AND FAT ADIPONECTIN IN CKD DISCUSSION Fig. 1. A: plasma thiobarbituric acid-reactive substances (TBARS) concentration. B: adipose tissue adiponectin mRNA. C: plasma adiponectin concentration in nonuremic control subjects and in chronic kidney disease (CKD) patients undergoing conservative (CT) or maintenance hemodialysis (MHD) treatment. *P ⬍ 0.05 vs. Control and CT; $P ⬍ 0.05 vs. Control and MHD groups, ANOVA and Student’s unpaired t-test or Wilcoxon test. pression (Fig. 3). This ratio increased from control to MHD group and was significantly higher in the latter than in all other groups. RT and CT also had higher adiponectin to adiponectin mRNA values than the control group. Association of oxidative stress with adipose tissue adiponectin expression. In linear regression analysis in all subjects (n ⫽ 29), adipose tissue adiponectin mRNA was related negatively (P ⬍ 0.05) with plasma CRP (r ⫽ ⫺0.57), plasma creatinine (r ⫽ ⫺0.64) and log plasma TBARS (r ⫽ ⫺0.68, Table 2 and Fig. 4). In multiple regression analysis (Table 3), log plasma TBARS remained associated with adipose tissue adiponectin The current data demonstrate a novel link between increased oxidative stress and declining fat tissue adiponectin expression in patients with advanced CKD undergoing MHD compared with conservative treatment. Lower adiponectin mRNA was, in turn, notably associated with lower plasma adiponectin concentration, as well as lower tissue adiponectin protein content. Increased oxidative stress and reduced adiponectin expression and plasma concentration represent a novel cluster of cardiovascular risk factors that could contribute to excess metabolic and cardiovascular risk in MHD patients compared with patients undergoing CT (3, 27, 40). To the best of our knowledge, this is the first evidence of the above associations in renal disease models or in human disease in vivo. The above findings also support a novel active role of adipose tissue in the regulation of circulating adiponectin in advanced chronic kidney disease. Oxidative stress and adipose tissue adiponectin expression. Causes of oxidative stress in advanced renal failure are multifactorial, including both enhanced production of oxidant compounds and impaired antioxidant defense systems (5, 7, 15, 23, 30, 31, 39). Uremia per se could promote oxidant production as indirectly confirmed by a positive relationship between creatinine levels and oxidative stress markers observed in previous studies (39) and confirmed by the current results (not shown). Hemodialysis has been proposed to enhance systemic oxidative stress both acutely (in a time-dependent fashion) and chronically, although these effects remain, in part, controversial (7, 30, 31) and were not directly addressed in the current study. In the absence of known anthropometric confounding factors, we demonstrated changes in subcutaneous adipose tissue adiponectin expression opposite to those in lipid oxidative stress in three major stages of kidney disease, such as advanced CKD on CT, advanced CKD on hemodialysis treatment, and kidney transplantation. Negative relationships were accordingly observed between subcutaneous adipose tissue adiponectin ex- AJP-Regul Integr Comp Physiol • VOL 293 • JULY 2007 • www.ajpregu.org Downloaded from http://ajpregu.physiology.org/ by 10.220.33.1 on June 18, 2017 mRNA (F ⫽ 9.41; P ⬍ 0.01), after adjusting for plasma hs-CRP and also after adjusting for both plasma hs-CRP and creatinine (F ⫽ 5.1; P ⬍ 0.05). Similar results were observed when the three groups of CKD patients (n ⫽ 23) were included without control subjects. On the other hand, hs-CRP or creatinine were no longer significantly associated with adiponectin mRNA after adjusting for plasma TBARS (not shown). Considering CKD and control subjects together (n ⫽ 29), no correlations were observed between plasma adiponectin and adiponectin mRNA (r ⫽ 0.30; P ⫽ 0.14). Because different adiponectin excretion can alter the association between its mRNA and plasma concentration in renal failure compared with control subjects, we also separately analyzed the whole group of renal failure patients and the control groups (Fig. 5). A positive correlation was observed between the variables in all CKD patients (n ⫽ 23, P ⫽ 0.01, Fig. 5), while no significant associations were, in turn, observed in the six control subjects alone (P ⫽ not significant, Fig. 5). In multiple regression analysis, adipose tissue adiponectin mRNA remained significantly associated with circulating adiponectin in CKD patients (P ⬍ 0.05) also after adjusting for plasma hs-CRP that could potentially alter adiponectin secretion (6) (not shown). R51 OXIDATIVE STRESS AND FAT ADIPONECTIN IN CKD Fig. 2. Plasma TBARS (A), adipose tissue adiponectin mRNA (B), and plasma adiponectin concentration (C) in MHD and renal transplant (RT) patients. *P ⬍ 0.05 vs. Control, Student’s t-test or Wilcoxon test. tissue in patients with advanced chronic kidney disease. Oxidative stress is notably a potential negative modulator of cardiovascular risk in kidney disease (15, 23), and the current data indicate that its clustering with low adiponectin expression and plasma concentration could contribute to this negative impact. Adipose tissue adiponectin expression and adiponectin plasma concentration. The active metabolic and cardiovascular impact of adipose tissue has been established in recent years in metabolic disease states (9, 11, 17). This potential role remains, however, to be defined in uremia due to the relevant role of passive accumulation in causing increased plasma concentrations of several hormones (13, 28). Increasing ratio of circulating adiponectin to its adipose tissue expression from healthy subjects to end-stage renal disease in four different control or patient groups, indeed, suggests increasing passive accumulation in renal failure. The latter could, in turn, contribute to increasing plasma adiponectin concentration in the presence of comparable adiponectin transcript levels in RT and CT groups, while the highest relative contribution of passive accumulation could further account for preserved adiponectin concentration in spite of very low adiponectin transcript levels in MHD. On the other hand, the marked decline in fat tissue adiponectin expression in MHD could have played a major role in blunting circulating adiponectin increments, resulting in circulating horTable 2. Linear correlation between adipose tissue adiponectin mRNA and plasma TBARS, creatinine, hsCRP, age, BMI, and body fat in all study subjects Fig. 3. Ratio between plasma adiponectin and adipose tissue adiponectin mRNA in nonuremic control subjects (Control) and in CKD patient groups (CT, MHD, and RT). $P ⬍ 0.05 vs. Control and RT-CT groups; *P ⬍ 0.05 vs. Control, ANOVA, and Wilcoxon test. Subject Characteristics (n ⫽ 29) r P TBARS, log nmol/ml Creatinine, mg/dl hsCRP, mg/dl Age, yr BMI, kg/m2 Fat, % ⫺0.68 ⫺0.64 ⫺0.57 0.09 0.16 0.15 ⬍0.0001 0.002 0.014 ⬎0.2 ⬎0.2 ⬎0.2 TBARs, thiobarbituric acid-reactive substances; hsCRP, high-sensitivity C-reactive protein. AJP-Regul Integr Comp Physiol • VOL 293 • JULY 2007 • www.ajpregu.org Downloaded from http://ajpregu.physiology.org/ by 10.220.33.1 on June 18, 2017 pression and lipid peroxidation markers in all study subjects. Because proinflammatory mediators have been recently reported to negatively modulate adiponectin expression in subcutaneous adipose tissue in nonrenal patients (6) and inflammation can occur in advanced stages of CKD, the validated clinical marker of inflammation C-reactive protein was measured in all patients and included in statistical analysis. CRP was negatively related with adiponectin expression [in agreement with the above observations (6)]. Adjustment for plasma CRP concentration did not, however, modify the relationship between adiponectin expression and circulating TBARS, suggesting that the latter is at least in part independent of inflammation. It should be pointed out that associations may suggest but not prove cause-effect relationships. Lipid oxidative stress has been, however, recently reported to negatively modulate adiponectin expression in vitro and in animal models of metabolic disease (11, 14, 19, 35). On the basis of available knowledge, the current findings therefore support a role of oxidative stress to downregulate adiponectin expression in fat R52 OXIDATIVE STRESS AND FAT ADIPONECTIN IN CKD mone levels lower than those of patients undergoing conservative treatment and similar to those of patients with intermediate residual renal disease following transplantation. The current data therefore provide the first direct evidence supporting an active role of adipose tissue adiponectin expression in modulating its circulating levels in CKD. The functional impact of reduced adiponectin expression was notably further supported by the lower adiponectin protein content in adipose tissue of MHD compared with conservative treatment patients and by the positive association between adiponectin transcript levels and plasma concentration in all CKD patients. The data suggest that modulation of oxidative stress and adipose tissue adiponectin expression could represent a potential target for therapeutic strategies aimed at enhancing plasma adiponectin and reducing CKD-associated metabolic and cardiovascular risk (3, 27, 34, 40). Previous reports notably agree with the current data in indicating lack of increments of circulating adiponectin in renal patients undergoing hemodialysis compared with conservative treatment, in spite of presumable extreme reductions of renal function in the hemodialysis groups (8, 37). In the above studies, it is well possible that lack of plasma adiponectin increments in hemodialysis resulted from a decline in adipose Table 3. Multiple regression analyses (F value) of plasma TBARS and adiponectin mRNA in all subjects Adjusted Value Independent variable: Plasma TBARS Adiponectin mRNA, au a 9.41† b 5.10* a: adjusted for plasma hs-CRP; b: adjusted for plasma hs-CRP and plasma creatinine. *P ⬍ 0.05; †P ⬍ 0.01. Fig. 5. Positive correlation between log subcutaneous adipose tissue adiponectin mRNA and plasma adiponectin concentration in CKD patients (CT, MHD, RT; n ⫽ 23). No correlation was observed in the smaller control group considered alone. tissue contribution with a parallel relative increment of passive accumulation (8, 37). The only available report of adipose tissue adiponectin expression in chronic kidney disease (with no information on oxidative stress) showed reduced adipose tissue adiponectin mRNA in end-stage renal disease patients compared with healthy control subjects, and it was concluded that adipose tissue does not actively contribute to regulate circulating adiponectin in CKD (26). The above study most importantly did not extend to different degrees or treatments of renal failure (26). Plasma adiponectin was not available in the majority of patients or in any control subjects (26). In addition, collection of adipose tissue samples in control subjects occurred during surgery and anesthesia, which could also have potentially directly or indirectly (i.e., via the underlying disease) affected adiponectin expression (26). It is therefore likely that the above differences and the less comprehensive study design and population (26) contributed to different conclusions. Patients with obesity or diabetes were excluded from this study, since we aimed at excluding known sources of oxidative stress and adiponectin suppression (as well as inflammation) independent of kidney failure or its treatment per se (9, 11, 17). The current results provide a strong rationale for future studies to directly investigate the potential independent role of diabetes in the regulation of adiponectin adipose tissue expression and plasma concentration in advanced CKD. In this study, total adiponectin was measured since it has been so far reported to be associated with positive metabolic and cardiovascular end points in advanced CKD (3, 27, 34, 40). Altered adiponectin AJP-Regul Integr Comp Physiol • VOL 293 • JULY 2007 • www.ajpregu.org Downloaded from http://ajpregu.physiology.org/ by 10.220.33.1 on June 18, 2017 Fig. 4. Negative log correlations between plasma TBARS and subcutaneous adipose tissue adiponectin mRNA in all subjects (control, CT, MHD, RT; n ⫽ 29). OXIDATIVE STRESS AND FAT ADIPONECTIN IN CKD ACKNOWLEDGMENTS We thank A. de Santis for skillful technical assistance. We are most grateful to Prof. Lucio Torelli, Statistics Department, University of Trieste, Italy, for advice and support in statistical analyses. REFERENCES 1. Axelsson J, Heimburger O, Lindholm B, Stenvinkel P. Adipose tissue and its relation to inflammation: the role of adipokines. J Ren Nutr 15: 131–136, 2005. 2. Barazzoni R, Zanetti M, Bosutti A, Biolo G, Vitali-Serdoz L, Stebel M, Guarnieri G. Moderate caloric restriction, but not physiological hyperleptinemia per se, enhances mitochondrial oxidative capacity in rat liver and skeletal muscle–tissue-specific impact on tissue triglyceride content and AKT activation. Endocrinology 146: 2098 –2106, 2005. 3. Becker B, Kronenberg F, Kielstein JT, Haller H, Morath C, Ritz E, Fliser D. Renal insulin resistance syndrome, adiponectin and cardiovascular events in patients with kidney disease: the mild and moderate kidney disease study. J Am Soc Nephrol 16: 1091–1098, 2005. 4. Chumlea WC, Guo SS, Kuczmarski RJ, Flegal KM, Johnson CL, Heymsfield SB, Lukaski HC, Friedl K, Hubbard VS. Body composition estimates from NHANES III bioelectrical impedence data. Int J Obes Relat Metab Disord 26: 1596 –1609, 2002. 5. Canaud B, Cristol JP, Morena M, Leray-Moragues H, Bosc JY, Vaussenat F. Imbalance of oxidants and antioxidants in haemodialysis patients. Blood Purif 17: 99 –106, 1999. 6. Degawa-Yamauchi M, Moss KA, Bovenkerk JE, Shankar SS, Morrison CL, Lelliott CJ, Vidal-Puig A, Jones R, Considine RV. Regulation of adiponectin expression in human adipocytes: effects of adiposity, glucocorticoids, and tumor necrosis factor. Ob Res 13: 662– 669, 2005. 7. Descamps-Latscha B, Drueke T, and Witko-Sarsat V. Dialysis-induced oxidative stress: biological aspects, clinical consequences, and therapy. Semin Dial 14: 193–199, 2001. 8. Diez JJ, Iglesias P, Fernandez-Reyes MJ, Aguilera A, Bajo MA, Alvarez-Fidalgo P, Codoceo R, Selgas R. Serum concentrations of leptin, adiponectin and resistin, and their relationship with cardiovascular disease in patients with end-stage renal disease. Clin Endocrinol (Oxf) 62: 242–249, 2005. 9. Evans JL, Goldfine ID, Maddux BA, Grodsky GM. Are oxidative stress activated signaling pathways mediators of insulin resistance and beta-cell dysfunction? Diabetes 52: 1– 8, 2003. 10. Filippidis G, Liakopoulos V, Mertens PR, Kiropoulos T, Stakias N, Verikouki C, Patsidis E, Koukoulis G, Stefanidis I. Resistin serum levels are increased but not correlated with insulin resistance in chronic hemodialysis patients. Blood Purif 23: 421– 428, 2005. 11. Furukawa S, Fujita T, Shimabukuro M, Iwaki M, Yamada Y, Nakajima Y, Nakayama O, Makishima M, Matsuda M, Shimomura I. Increased oxidative stress in obesity and its impact on metabolic syndrome. J Clin Invest 114: 1752–1761, 2004. 12. Gotoh M, Nagase S, Aoyagi K, Hirayama A, Takemura K, Ueda A, Tomida C, Kikuchi C, Koyama A. Thiobarbituric acid reactive substances are increased in the subcutaneous fat tissue of patients with end-stage renal disease. Nephrol Dial Transplant 12: 713–717, 1997. 13. Guebre-Egziabher F, Bernhard J, Funahashi T, Hadj-Aissa A, Fouque D. Adiponectin in chronic kidney disease is related more to metabolic disturbances than to decline in renal function. Nephrol Dial Transplant 20: 129 –134, 2005. 14. Hattori Y, Akimoto K, Gross SS, Hattori S, Kasai K. Angiotensin-IIinduced oxidative stress elicits hypoadiponectinaemia in rats. Diabetologia 48: 1066 –1074, 2005. 15. Himmelfarb J, Stenvinkel P, Ikizler TA, Hakim RM. The elephant in uremia: oxidant stress as an unifying concept of cardiovascular disease in uremia. Kidney Int 62: 1524 –1538, 2002. 16. Kawanami D, Maemura K, Takeda N, Harada T, Nojiri T, Imai Y, Manabe I, Utsunomiya K, Nagai R. Direct reciprocal effects of resistin and adiponectin on vascular endothelial cells: a new insight into adipocytokine-endothelial cell interactions. Biochem Biophys Res Commun 314: 415– 419, 2004. 17. Kern PA, Di Gregorio GB, Lu T, Rassouli N, Ranganathan G. Adiponectin expression from human adipose tissue: relation to obesity, insulin resistance, and tumor necrosis factor-alpha expression. Diabetes 52: 1779 –1785, 2003. 18. Kobashi C, Urakaze M, Kishida M, Kibayashi E, Kobayashi H, Kihara S, Funahashi T, Takata M, Temaru R, Sato A, Yamazaki K, Nakamura N, Kobayashi M. Adiponectin inhibits endothelial synthesis of interleukin-8. Circ Res 97: 1245–1252, 2005. 19. Kurata A, Nishizawa H, Kihara S, Maeda N, Sonoda M, Okada T, Ohashi K, Hibuse T, Fujita K, Yasui A, Hiuge A, Kumada M, Kuriyama H, Shimomura I, Funahashi T. Blockade of Angiotensin II type-1 receptor reduces oxidative stress in adipose tissue and ameliorates adipocytokine dysregulation. Kidney Int 70: 1717–1724, 2006. 20. Kyle UG, Bosaeus I, De Lorenzo AD, Deurenberg P, Elia M, Gomez JM, Heitmann BL, Kent-Smith L, Melchior JC, Pirlich M, Scharfetter H, Schols AMWJ, Pichard C. Composition of the ESPEN Working Group: Bioelectrical impedance analysis—part I: review of principles and methods. Clin Nutr 23: 1226 –1243, 2004. 21. Lara-Castro C, Luo N, Wallace P, Klein RL, Garvey WT. Adiponectin multimeric complexes and the metabolic syndrome trait cluster. Diabetes 55: 249 –259, 2006. 22. Levey AS, Bosch JP, Lewis JB, Greene T, Rogers N, Roth D. A more accurate method to estimate glomerular filtration rate from serum creatinine: a new prediction equation. Modification of Diet in Renal Disease Study Group. Ann Intern Med 130: 461– 470, 1999. 23. Locatelli F, Canaud B, Eckardt KU, Stenvinkel P, Wanner C, Zoccali C. Oxidative stress in end-stage renal disease: an emerging threat to patient outcome. Nephrol Dial Transplant 18: 1272–1280, 2003. 24. Luke RG. Chronic renal failure—a vasculopathic state. N Engl J Med 339: 841– 843, 1998. 25. Madamanchi NR, Vendrov A, Runge MS. Oxidative stress and vascular disease. Arterioscler Thromb Vasc Biol 25: 29 –38, 2005. 26. Marchlewska A, Stenvinkel P, Lindholm B, Danielsson A, PecoitsFilho R, Lönnqvist F, Schalling M, Heimbürger O, Nordfors L. Reduced gene expression of adiponectin in fat tissue from patients with end-stage renal disease. Kidney Int 66: 46 –50, 2004. 27. Menon V, Li L, Wang X, Greene T, Balakrishnan V, Madero M, Pereira AA, Beck GJ, Kusek JW, Collins AJ, Levey AS, Sarnak MJ. AJP-Regul Integr Comp Physiol • VOL 293 • JULY 2007 • www.ajpregu.org Downloaded from http://ajpregu.physiology.org/ by 10.220.33.1 on June 18, 2017 polymerization with reduced high-molecular weight forms is emerging as a modulator of metabolic and vascular complications in metabolic diseases (21). It is possible that changes in the ratio of adiponectin circulating forms could be influenced by CKD stage and oxidative stress, and these issues could be addressed in future investigations. It should also be pointed out that renal transplant patients were treated with immunosuppressive therapy, including prednisone in two patients and methylprednisolone in one, while dexamethasone was reported to acutely and moderately reduce adiponectin secretion from human adipocytes by ⬃10% (6). Although it is not known whether this effect occurs in vivo following sustained administration, treatment could have caused a potential moderate reduction of adiponectin transcript levels and plasma concentration with no impact on the study’s conclusions of positive effects of renal transplantation on oxidative stress and adiponectin expression (which would be if anything underestimated). In conclusion, the current data demonstrate that increased oxidative stress is associated with declining adiponectin transcriptional expression in fat tissue in patients undergoing MHD compared with conservative treatment. Oxidative stress and adiponectin expression are, in turn, normalized in renal transplant recipients. Reduced adiponectin expression appears to have a negative impact on plasma adiponectin concentration in MHD. Increased oxidative stress with reduced adiponectin expression and plasma concentration represent a novel cluster of risk factors potentially contributing to enhance metabolic and cardiovascular disease in MHD patients. On the basis of available knowledge, the data support a novel role of oxidative stress in the modulation of adiponectin expression and of adipose tissue as an active player in the regulation of circulating adiponectin in advanced CKD. R53 R54 28. 29. 30. 31. 32. 34. 35. Adiponectin and mortality in patients with chronic kidney disease. J Am Soc Nephrol 17: 2599 –2606, 2006. Merabet E, Dagogo-Jack S, Coyne DW, Klein S, Santiago JV, Hmiel SP, Landt M. Increased plasma leptin concentration in end-stage renal disease. J Clin Endocrinol Metab 82: 847– 850, 1997. National Kidney Foundation. K/DOQI clinical practice guidelines for chronic kidney disease: evaluation, classification, and stratification. Am J Kidney Dis 39 Suppl 1: S1–S266, 2002. Oberg BP, McMenamin E, Lucas FL, McMonagle E, Morrow J, Ikizler TA, Himmelfarb J. Increased prevalence of oxidant stress and inflammation in patients with moderate to severe chronic kidney disease. Kidney Int 65: 1009 –1016, 2004. Pupim LB, Himmelfarb J, McMonagle E, Shyr Y, Ikizler TA. Influence of initiation of maintenance hemodialysis on biomarkers of inflammation and oxidative stress. Kidney Int 65: 2371–2379, 2004. Rajala MW, Scherer PE. Minireview: The adipocyte—at the crossroads of energy homeostasis, inflammation, and atherosclerosis. Endocrinology 144: 3765–3773, 2003. Shetty GK, Economides PA, Horton ES, Mantzoros CS, Veves A. Circulating adiponectin and resistin levels in relation to metabolic factors, inflammatory markers, and vascular reactivity in diabetic patients and subjects at risk for diabetes. Diabetes Care 27: 2450 –2457, 2004. Shinohara K, Shoji T, Emoto M, Tahara H, Koyama H, Ishimura E, Miki T, Tabata T, Nishizawa Y. Insulin resistance as an independent predictor of cardiovascular mortality in patients with end-stage renal disease. J Am Soc Nephrol 13: 1894 –1900, 2002. Soares AF, Guichardant M, Cozzone D, Bernoud-Hubac N, BouzaidiTiali N, Lagarde M, Geloen A. Effects of oxidative stress on adiponectin 36. 37. 38. 39. 40. 41. AJP-Regul Integr Comp Physiol • VOL secretion and lactate production in 3T3–L1 adipocytes. Free Radic Biol Med 38: 882– 889, 2005. Stenvinkel P, Barany P, Heimburger O, Pecoits-Filho R, Lindholm B. Mortality, malnutrition, and atherosclerosis in ESRD: what is the role of interleukin-6? Kidney Int 61 Suppl 80: 103–108, 2002. Tentolouris N, Doulgerakis D, Moyssakis I, Kyriaki D, Makrilakis K, Kosmadakis G, Stamatiadis D, Katsilambros N, Stathakis C. Plasma adiponectin concentrations in patients with chronic renal failure: relationship with metabolic risk factors and ischemic heart disease. Horm Metab Res 36: 721–727, 2004. Vural A, Yilmaz MI, Caglar K, Aydin A, Sonmez A, Eyileten T, Acikel C, Gulec B, Kozak O, Oner K. Assessment of oxidative stress in the early posttransplant period: comparison of cyclosporine A and tacrolimusbased regimens. Am J Nephrol 25: 250 –255, 2005. Witko-Sarsat V, Friedlander M, Khoa TN, Capeille’re-Blandin C, Nguyen AT, Canteloup S, Dayer J-M, Jungers P, Drueke T, and Descamps-Latscha B. Advanced oxidation protein products as novel mediators of inflammation and monocyte activation in chronic renal failure. J Immunol 161: 2524 –2532, 1998. Zoccali C, Mallamaci F, Tripepi G, Benedetto FA, Cutrupi S, Parlongo S, Malatino LS, Bonanno G, Seminara G, Rapisarda F, Fatuzzo P, Buemi M, Nicocia G, Tanaka S, Ouchi N, Kihara S, Funahashi T, Matsuzawa Y. Adiponectin, metabolic risk factors, and cardiovascular events among patients with end-stage renal disease. J Am Soc Nephrol 13: 134 –141, 2002. Zoccali C. Cardiovascular risk in uraemic patients—is it fully explained by classical risk factors? Nephrol Dial Transplant 15: 454 – 457, 2000. 293 • JULY 2007 • www.ajpregu.org Downloaded from http://ajpregu.physiology.org/ by 10.220.33.1 on June 18, 2017 33. OXIDATIVE STRESS AND FAT ADIPONECTIN IN CKD