Download Low fat adiponectin expression is associated with oxidative stress in

Am J Physiol Regul Integr Comp Physiol 293: R47–R54, 2007.
First published March 15, 2007; doi:10.1152/ajpregu.00745.2006.
Low fat adiponectin expression is associated with oxidative stress in
nondiabetic humans with chronic kidney disease—impact on plasma
adiponectin concentration
Rocco Barazzoni,1 Annamaria Bernardi,2 Franco Biasia,2 Annamaria Semolic,1 Alessandra Bosutti,1
MariaPia Mucci,3 Franca Dore,3 Michela Zanetti,1 and Gianfranco Guarnieri1
1
Clinica Medica, Dipartimento di Scienze Cliniche, Morfologiche e Tecnologiche, University of Trieste, Italy;
Renal Unit, ULSS18, Rovigo, Italy; and 3Nuclear Medicine, Azienda Ospedaliera “Ospedali Riuniti,” Trieste, Italy
2
Submitted 14 October 2006; accepted in final form 8 March 2007
adipose-derived circulating
protein and it is reported to exert protective metabolic and
vascular effects (1, 16, 18, 32). High circulating adiponectin is
strongly associated with reduced cardiovascular risk under
different clinical and experimental conditions (33, 40) and low
adipose tissue adiponectin transcriptional expression is associated with hypoadiponectinemia and could contribute to insulin
resistance and cardiovascular disease in obesity and type 2
diabetes (18). Chronic kidney disease (CKD) is a unique
condition in that exceedingly high incidence of insulin resistance [in turn independently associated with enhanced cardiovascular events (34)] and cardiovascular morbidity and mortality [increasing from conservative to maintenance hemodialysis (MHD) treatment (24, 41)] is paradoxically associated
with elevated plasma adiponectin. Although recent data (27)
have questioned the previously reported protective cardiovascular impact of adiponectin in earlier stages of renal disease
(3), available evidence indicates that highest total adiponectin
increments are associated with lower cardiovascular risk in
end-stage CKD (40), and all studies agree on protective effects
of higher circulating adiponectin on metabolic risk factors (3,
27, 40). We also observed a positive association between
plasma adiponectin and insulin-mediated glucose disposal using the gold-standard hyperinsulinemic-euglycemic clamp
technique to measure insulin action in nondiabetic MHD patients (R. Barazzoni, G. Guarnieri et al., unpublished data). The
above observations suggest that adiponectin-dependent metabolic and cardiovascular protection is preserved in advanced
chronic uremia, although its effectiveness could be blunted by
additional CKD-associated alterations and risk factors.
Understanding the regulation of circulating adiponectin levels in advanced CKD is therefore of substantial clinical importance. CKD-associated hyperadiponectinemia could be due at
least in part to reduced glomerular filtration rate and passive
accumulation (13, 28). Whether changes in adiponectin adipose expression contribute to modulation of circulating adiponectin in different stages of advanced CKD remains, however,
to be defined. Oxidative stress can contribute to insulin resistance and cardiovascular risk in chronic disease states, including obesity and diabetes (9, 11, 25), due to imbalance between
oxidant generation and antioxidant defense systems. Systemic
and tissue oxidative stress is also often reported in CKD (5, 7,
15, 23, 30, 31, 39). CKD-associated oxidative stress is likely to
be, at least in part, independent of changes in body mass and fat
(5, 7, 15, 23, 30, 31, 39), and it could, in turn, increase with
progressive reduction of renal function with highest levels
reported in MHD (5, 7, 15, 23, 30, 31, 39). Rapid reversibility
of oxidative stress has also been reported after renal transplantation (38), further supporting its link with CKD and changes
in renal function. A link between oxidative stress and altered
adiponectin production has, in turn, recently emerged in experimental models (11, 14, 19, 35), as oxidative stress reduced
Address for reprint requests and other correspondence: R. Barazzoni,
Clinica Medica, Univ. of Trieste, Ospedale Cattinara, Strada di Fiume 443,
34100 Trieste, Italy (e-mail: [email protected]).
The costs of publication of this article were defrayed in part by the payment
of page charges. The article must therefore be hereby marked “advertisement”
in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
adipose tissue; hemodialysis
ADIPONECTIN IS THE MOST ABUNDANT
http://www.ajpregu.org
0363-6119/07 $8.00 Copyright © 2007 the American Physiological Society
R47
Downloaded from http://ajpregu.physiology.org/ by 10.220.33.1 on June 18, 2017
Barazzoni R, Bernardi A, Biasia F, Semolic A, Bosutti A, Mucci
MP, Dore F, Zanetti M, Guarnieri G. Low fat adiponectin expression
is associated with oxidative stress in nondiabetic humans with chronic
kidney disease—impact on plasma adiponectin concentration. Am J
Physiol Regul Integr Comp Physiol 293: R47–R54, 2007. First published
March 15, 2007; doi:10.1152/ajpregu.00745.2006.—In spite of association between high plasma adiponectin and high metabolic and
cardiovascular (CV) risk, highest adiponectin increments retain CV
and metabolic protective effects in advanced chronic kidney disease
(CKD). Passive accumulation can favor CKD-associated hyperadiponectinemia but potential additional regulation by adipose tissue
remains undefined. Oxidative stress (OS) is associated with metabolic
and CV disease and with CKD [increasing from conservative treatment (CT) to maintenance hemodialysis (MHD)], and OS can reduce
adiponectin expression in experimental models. OS (in the form of
plasma thiobarbituric acid-reactive substances: TBARS), subcutaneous adipose adiponectin mRNA, and plasma adiponectin were studied
in CKD patients (stages 4 and 5) on CT (n ⫽ 7) or MHD (n ⫽ 11).
Compared with CT and controls (C: n ⫽ 6) MHD had highest TBARS
and lowest adiponectin mRNA (P ⬍ 0.05) with lower adipose adiponectin protein (P ⬍ 0.05 vs. CT). MHD also had lower plasma
adiponectin than CT, although both had higher adiponectin than C
(P ⬍ 0.05). In renal transplant recipients (RT: CKD stage 3; n ⫽ 5)
normal TBARS were, in turn, associated with normal adiponectin
mRNA (P ⬍ 0.05 vs. MHD). In all CKD (n ⫽ 23), adiponectin
mRNA was associated positively with adiponectin plasma concentration (P ⬍ 0.01). In all subjects (n ⫽ 29), adiponectin mRNA was
related (P ⬍ 0.05) negatively with TBARS after adjusting for plasma
C-reactive protein (CRP) or CRP and creatinine. Thus altered OS,
adiponectin expression, and plasma concentration represent a novel
cluster of metabolic and CV risk factors in MHD that are normalized
in RT. The data suggest novel roles of 1) MHD-associated OS in
modulating adiponectin expression and 2) adipose tissue in contributing to circulating adiponectin in advanced CKD.
R48
OXIDATIVE STRESS AND FAT ADIPONECTIN IN CKD
MATERIALS AND METHODS
Study subjects and experimental protocol. We examined 18 Caucasian patients with advanced CKD [stages 4 and 5 based on estimated glomerular filtration rate (eGFR) according to the National
Kidney Foundation classification (29)] divided in two groups undergoing CT (n ⫽ 7) or MHD (n ⫽ 11) treatment. An additional group
of age-, BMI- and gender-matched patients treated with kidney
transplantation [CKD stage 3; renal transplant (RT), n ⫽ 5] was also
studied to assess potential reversibility of observed alterations. The
study was approved by the local Ethics Committee, and all participants gave informed consent to it. In CT patients cause of renal failure
was hypertension (n ⫽ 2), glomerulonephritis (n ⫽ 3), or not known
(n ⫽ 2). In MHD, the cause of renal failure was hypertension (n ⫽ 4),
glomerulonephritis (n ⫽ 4), polycystic kidney disease (n ⫽ 2), or
bilateral nephrectomy (n ⫽ 1). In RT, cause of renal failure before
transplantation was hypertension (n ⫽ 1), glomerulonephritis (n ⫽ 3),
and polycystic kidney disease (n ⫽ 1). All patients were taking
antihypertensive treatment that included ACE inhibitors in seven
MHD, five CT, and two RT patients and Ca-antagonists in five MHD,
four CT, and two RT patients. One MHD and one CT female patient
had hypothyroidism treated with thyroxin with excellent clinical and
biochemical control at the time of the study. None of the patients was
treated with fish oil. All patients were selected to be ambulatory,
nonobese, and nondiabetic with BMI above 20 and below 30 kg/m2 to
avoid the potential confounding associations of obesity, diabetes, and
cachexia with oxidative stress and altered adipocytokine levels (9, 11,
17, 36). Lack of diabetes was defined on the basis of fasting glucose
besides medical history and lack of antidiabetic medications at the
time of study or before it. No CKD patient in any group had had
cardiovascular events or had a positive history for coronary artery
disease on the basis of examination and detailed clinical history.
Additional exclusion criteria were liver disease and nephrotic syndrome (defined as daily proteinuria ⬎3.5 g/1.73 m2). All control
subjects were healthy, as assessed by medical history and clinical
examination, as well as lack of medications taken at the time of the
study. Control subjects were selected to be matched for age and
gender to the patient groups, as well as within the same BMI limits.
Patients underwent subcutaneous adipose tissue biopsy in the
morning after the overnight fast. In MHD patients, samples were
taken before the start of a dialysis session to minimize the potential
effect of previous dialysis session per se on the studied parameters (7,
30, 31) [although no major acute effects of dialysis have been reported
on plasma adiponectin (10)]. After obtaining a blood sample for
hormone and TBARS measurement, local anesthesia was induced in
the periumbilical skin region under sterile conditions. A superficial
incision was then performed followed by removal of 50 –100 mg of
subcutaneous fat that was immediately frozen in liquid nitrogen and
subsequently kept at ⫺80°C until analyses.
Body composition. Body composition was measured using multifrequency bioimpedence analysis (Sta-Bia Soft Tissue Analyzer,
Akern, Pontassieve, Italy) in a quiet environment, with proximal
electrodes placed on the dorsal side of wrist and ankle, and the distal
electrodes on the second metacarpal (metatarsal)-phalangeal joint
(limbs contralateral to the a-v fistula were used in hemodialysis
patients) with limbs at 45° abduction (4, 20). Resistance and reactance
data were normalized for height and analyzed to calculate body
composition parameters (Bodygram Software).
Adipose tissue adiponectin mRNA and protein content. To assess
adiponectin transcriptional expression, total adipose tissue mRNA
was extracted from ⬃40 mg of adipose tissue using the RNeasy Mini
Kit (Qiagen, Cologne, Germany). One microgram of total RNA was
reverse-transcribed (RNA Reverse Transcription KIT, Applied Biosystems, Foster City, CA), and adiponectin transcripts were amplified
using the following primers and probes, selected using the Primer
Express Software (Applied Biosystems): Forward primer: TCAATGGCCCCTGCACTACT; Reverse primer: GGGATGAGTTCAGCACTTAGAGATG; Probe: CCTCTTACCTATGTCCCTTCTCATGCCTTTCC. 28S rRNA was used as reference gene using the
following primers and probe: Forward primer: TGGGAATGCAGCCCAAAG; Reverse primer: CCTTACGGTACTTGTTGACTATCG;
probe: TGGTAAACTCCATCTAAGGCTAAATACCGGCA. Target
and housekeeping genes were amplified separately using real-time
polymerase chain reaction, and their final quantitation was achieved
using a relative standard curve, as previously described (2). Adiponectin mRNA values were divided by the corresponding 28S rRNA value
and expressed as arbitrary units.
To further confirm changes in adiponectin gene expression at the
posttranscriptional level, we measured adiponectin protein content in
aliquots from the same adipose tissue sample. Because of low tissue
availability, this measurement was performed in 6 CT and 7 MHD,
while not in control or RT patients. Briefly, total protein was extracted
from 40 –50 mg of adipose tissue homogenized in sucrose buffer (0.25
mM sucrose, 10 mM HEPES, 0.2 mM EDTA) containing protease
inhibitors. The homogenate was centrifuged at 2,500 rpm for 10 min,
and the supernatant was transferred to a fresh tube and again centrifuged at 13,000 rpm at 4°C for 10 min. The supernatant was then
divided into two aliquots; equal volumes of 10% TCA were added and
incubated at ⫺20°C for 45 min. Samples were then centrifuged at
9,000 rpm at 4°C for 30 min. The pellet was washed with 90%
acetone, evaporated, and suspended in 30-␮l solubilization buffer
containing 40 mM Tris base and 2% SDS. After measurement of total
protein concentration from the purified sample, 10 ␮g total adipose
tissue protein were used to measure total adiponectin concentration
using a commercially available kit (ALPCO Diagnostics, Salem, NH)
following the manufacturer’s recommendations except for a lower
AJP-Regul Integr Comp Physiol • VOL
293 • JULY 2007 •
www.ajpregu.org
Downloaded from http://ajpregu.physiology.org/ by 10.220.33.1 on June 18, 2017
adipose tissue adiponectin transcript levels in vitro and in
animal studies (11, 14, 19, 35). No information is available on
the potential interactions between adipose tissue adiponectin
and oxidative stress in human disease and in CKD, in particular.
In the current study, we cross-sectionally investigated
changes in oxidative stress (plasma thiobarbituric acid reactive
substances: TBARS), subcutaneous adipose tissue adiponectin
expression, and plasma adiponectin, as well as their potential
relationships in patients with advanced CKD (stages 4 and 5)
undergoing MHD (n ⫽ 11) or conservative treatment (CT; n ⫽ 7).
It was hypothesized that 1) fat tissue adiponectin expression
declines with increasing oxidative stress in patients undergoing
MHD treatment and that 2) adiponectin expression is associated with parallel changes of its plasma concentration. It was
further hypothesized that oxidative stress and adiponectin expression would, in turn, be normal in an additional group of
nondiabetic renal transplant recipients. TBARS were selected
as an oxidative stress marker because they reflect lipid peroxidation (10, 13, 18, 34) and were reported to be directly linked
to adipose tissue adiponectin expression in animal models (11),
as well as to adiponectin plasma concentration in nonrenal
obese patients (11). In addition, TBARS were reported to be
increased in subcutaneous adipose tissue samples from CKD
patients (12). All patients were selected to be free of obesity
and diabetes to avoid the confounding effect of these potential
independent causes of oxidative stress and altered adiponectin
production (9, 11, 17). The potential involvement of inflammatory state as reflected by the validated index C-reactive
protein was also assessed since inflammation can occur in
advanced CKD, is commonly negatively associated with circulating adiponectin (1, 32), and could negatively affect its
adipose tissue expression (6).
R49
OXIDATIVE STRESS AND FAT ADIPONECTIN IN CKD
RESULTS
Anthropometric, clinical, and biochemical parameters in
control and CKD subjects. MHD, CT, and control subjects
were comparable for gender, age, body mass index and body
fat (Table 1). The groups also had comparable plasma insulin
and glucose concentrations, as well as similar blood pressure
recordings. Plasma creatinine concentration was higher by
design in CKD groups with intermediate values in CT and
highest levels in MHD. As expected, eGFR was lowest in
MHD and within stages 4 and 5 for CT patients. Plasma
high-sensitivity CRP was higher in MHD than in all other
groups.
Plasma adiponectin, adipose tissue adiponectin mRNA, and
plasma TBARS. Plasma concentrations of TBARS were higher
in MHD than in both CT and control subjects (Fig. 1A).
Subcutaneous adipose tissue adiponectin mRNA levels were
comparable to normal values in CT but substantially lower in
MHD (Fig. 1B). Plasma adiponectin concentration was higher
in both MHD and CT than in control subjects, but this increment was, however, less pronounced in MHD (Fig. 1C).
Adipose tissue adiponectin protein level was also lower in
MHD than in CT patients (7.2 ⫾ 0.8 vs. 18.3 ⫾ 5 pg/100 ng
total adipose tissue protein; P ⫽ 0.043).
Plasma adiponectin, adipose tissue adiponectin mRNA, and
plasma TBARS in renal transplant recipients. To assess the
potential impact of renal transplant on the observed alterations,
we studied an additional group of nonobese, nondiabetic (as
defined above for patients from other groups) RT recipients
(n ⫽ 5, 3M, treated with hemodialysis before transplantation,
time from transplantation 116 ⫾ 88 mo, range 47–228). Differences between RT and other groups were assessed using
ANOVA and Student’s t-test or Wilcoxon test. RT patients had
age (64 ⫾ 6 years, range 55– 67), body mass index (25.9 ⫾ 4,
range 22–29.6) and body fat (26.4 ⫾ 11%, range 15– 40)
comparable to the other experimental groups. Plasma glucose
and insulin concentrations were also not different from all
other groups (P ⬎ 0.05). RT patients had HS-CRP comparable
to that of control and CT groups and lower than MHD (0.2 ⫾
0.4 mg/dl, range 0.02– 0.9, P ⬍ 0.05 vs. MHD). Plasma
creatinine was lower than both CT and MHD but higher than
control subjects (1.5 ⫾ 0.2 mg/dl, range 1.3–1.7, P ⬍ 0.05 vs.
all other groups) with eGFR of 44.9 ⫾ 4.9 ml䡠min⫺1 䡠1.73 m⫺2
(P ⬍ 0.05 vs. all other groups). Compared with MHD, RT had
lower TBARS and higher adiponectin mRNA (Fig. 2) with
both values comparable to CT and control subjects. Plasma
adiponectin was conversely comparable in the MHD and RT
groups (Fig. 3). Plasma adiponectin was also higher in the
smaller RT than in the control group (P ⬍ 0.05, not shown).
Plasma adiponectin to adipose tissue adiponectin mRNA
ratio. The ratio between plasma adiponectin and adiponectin
mRNA was calculated in all subjects as a potential index of
hormone accumulation independent of its transcriptional ex-
Table 1. Various parameters in chronic kidney disease subjects
Sex (M/F)
Age, yr
BMI, kg/m2
Body fat, %
SBP, mmHg
DBP, mmHg
Insulin, ␮U/ml
Glucose, mMol
Total cholesterol, mg/dl
Triglycerides, mg/dl
hs-CRP, mg/dl
Creatinine, mg/dl
eGFR, ml 䡠 min⫺1 䡠 1.73m2
Dialysis, mo
Control
CT
MHD
3/3
64⫾11 (52–78)
26.2⫾3.1 (22–29.3)
33.1⫾8 (19–41)
135⫾15 (122–155)
82⫾8 (72–90)
12.6⫾8 (3.5–22.1)
5⫾0.4 (4.1–5.1)
201⫾11 (172–250)
125⫾26 (38–215)
0.11⫾0.1 (0.03–0.4)
0.8⫾0.1 (0.7–0.9)
87⫾8.9 (80–101)
/
4/3
68⫾7 (59–77)
26⫾3.7 (21–29.4)
30.6⫾9 (20–45)
140⫾22 (108–158)
87⫾12 (70–98)
14⫾10 (4.7–30)
4.8⫾0.5 (4–5.5)
207⫾13 (154–245)
195⫾22 (136–299)
0.44⫾0.6 (0.02–1.2)
4.2⫾1.3 (2.5–6.5)*
16.7⫾5.9 (9.5–27.9)*
/
6/5
69⫾11 (46–80)
24.2⫾2.5 (21.8–28.6)
28.8⫾11 (9–45)
137⫾18 (105–155)
82⫾10 (73–95)
11.8⫾6 (3.5–17.4)
4.6⫾0.6 (3.9–5.4)
163⫾12 (117–213)
144⫾18 (88–221)
1.99⫾1.3 (0.3–4)†
8.9⫾1.5 (6.5–10.3)†
5.8⫾1.2 (4.3–8)†
31⫾21 (6–78)
Values are presented as means (SD for range). Sex, age, body mass index (BMI), percent body fat, systolic (SBP) and diastolic (DBP) blood pressure, plasma
insulin and glucose concentrations, plasma total cholesterol and triglyceride concentrations, plasma high-sensitivity C-reactive protein (hs-CRP), plasma
creatinine, estimated glomerular filtration rate (eGFR) and dialysis duration in control subjects and in chronic kidney disease patients undergoing conservative
treatment (CT) or maintenance hemodialysis (MHD). *P ⬍ 0.05 vs. control and MHD; †P ⬍ 0.05 vs. Control and CT, ANOVA and Student’s unpaired t-test.
AJP-Regul Integr Comp Physiol • VOL
293 • JULY 2007 •
www.ajpregu.org
Downloaded from http://ajpregu.physiology.org/ by 10.220.33.1 on June 18, 2017
sample dilution (1:2,500: determined with preliminary tests) for final
spectrophotometrical reading.
Plasma biochemical profile. Plasma TBARS concentration was
measured using a commercially available kit (Oxitek, Zeptometrix
Co, Buffalo, NY) following the manufacturer’s recommendations
(intraassay coefficient of variation: 4%, interassay coefficient of
variation: 5.1%). A commercially available ELISA kit was also used
to measure plasma total adiponectin (B-Bridge International, Sunnyvale, CA) (intraassay coefficient of variation: 4.2%, interassay coefficient of variation: 5.6%). Total adiponectin was chosen since it has
been directly demonstrated to modulate metabolic and cardiovascular
risk in advanced CKD (3, 27, 40). Plasma insulin concentrations were
measured by radioimmunoassay (Linco, St Louis, MO). Blood glucose concentration was measured by reflectometer (Roche Diagnostics, Indianapolis, IN). High-sensitivity C-reactive protein (HS-CRP)
plasma concentration, a marker of systemic inflammation, was measured using a commercially available ELISA kit (Diagnostics Biochem, London, Ontario, Canada). Plasma creatinine concentration
was measured using standard methods, and glomerular filtration rate
(GFR) was calculated using validated formula based on plasma
creatinine according to Modification of Diet in Renal Disease Study
Group equations (22).
Statistical analysis. ANOVA followed by Student’s t-test or nonparametric Wilcoxon test (analyses of TBARS and adiponectin
mRNA, as well as plasma adiponectin to mRNA ratio), were used to
compare variables between the experimental groups. Log transformation was applied in linear regression analyses and for stepwise
multiple regression analyses of plasma TBARS and adiponectin
mRNA due to nonnormal data distribution. P values of 0.05 or less
were considered statistically significant.
R50
OXIDATIVE STRESS AND FAT ADIPONECTIN IN CKD
DISCUSSION
Fig. 1. A: plasma thiobarbituric acid-reactive substances (TBARS) concentration. B: adipose tissue adiponectin mRNA. C: plasma adiponectin concentration in nonuremic control subjects and in chronic kidney disease (CKD)
patients undergoing conservative (CT) or maintenance hemodialysis (MHD)
treatment. *P ⬍ 0.05 vs. Control and CT; $P ⬍ 0.05 vs. Control and MHD
groups, ANOVA and Student’s unpaired t-test or Wilcoxon test.
pression (Fig. 3). This ratio increased from control to MHD
group and was significantly higher in the latter than in all other
groups. RT and CT also had higher adiponectin to adiponectin
mRNA values than the control group.
Association of oxidative stress with adipose tissue adiponectin expression. In linear regression analysis in all subjects (n ⫽
29), adipose tissue adiponectin mRNA was related negatively
(P ⬍ 0.05) with plasma CRP (r ⫽ ⫺0.57), plasma creatinine
(r ⫽ ⫺0.64) and log plasma TBARS (r ⫽ ⫺0.68, Table 2 and
Fig. 4). In multiple regression analysis (Table 3), log plasma
TBARS remained associated with adipose tissue adiponectin
The current data demonstrate a novel link between increased
oxidative stress and declining fat tissue adiponectin expression
in patients with advanced CKD undergoing MHD compared
with conservative treatment. Lower adiponectin mRNA was, in
turn, notably associated with lower plasma adiponectin concentration, as well as lower tissue adiponectin protein content.
Increased oxidative stress and reduced adiponectin expression
and plasma concentration represent a novel cluster of cardiovascular risk factors that could contribute to excess metabolic
and cardiovascular risk in MHD patients compared with patients undergoing CT (3, 27, 40). To the best of our knowledge,
this is the first evidence of the above associations in renal
disease models or in human disease in vivo. The above findings
also support a novel active role of adipose tissue in the
regulation of circulating adiponectin in advanced chronic kidney disease.
Oxidative stress and adipose tissue adiponectin expression.
Causes of oxidative stress in advanced renal failure are multifactorial, including both enhanced production of oxidant compounds and impaired antioxidant defense systems (5, 7, 15, 23,
30, 31, 39). Uremia per se could promote oxidant production as
indirectly confirmed by a positive relationship between creatinine levels and oxidative stress markers observed in previous
studies (39) and confirmed by the current results (not shown).
Hemodialysis has been proposed to enhance systemic oxidative
stress both acutely (in a time-dependent fashion) and chronically, although these effects remain, in part, controversial (7,
30, 31) and were not directly addressed in the current study. In
the absence of known anthropometric confounding factors, we
demonstrated changes in subcutaneous adipose tissue adiponectin expression opposite to those in lipid oxidative stress
in three major stages of kidney disease, such as advanced CKD
on CT, advanced CKD on hemodialysis treatment, and kidney
transplantation. Negative relationships were accordingly observed between subcutaneous adipose tissue adiponectin ex-
AJP-Regul Integr Comp Physiol • VOL
293 • JULY 2007 •
www.ajpregu.org
Downloaded from http://ajpregu.physiology.org/ by 10.220.33.1 on June 18, 2017
mRNA (F ⫽ 9.41; P ⬍ 0.01), after adjusting for plasma
hs-CRP and also after adjusting for both plasma hs-CRP and
creatinine (F ⫽ 5.1; P ⬍ 0.05). Similar results were observed
when the three groups of CKD patients (n ⫽ 23) were included
without control subjects. On the other hand, hs-CRP or creatinine were no longer significantly associated with adiponectin
mRNA after adjusting for plasma TBARS (not shown).
Considering CKD and control subjects together (n ⫽ 29), no
correlations were observed between plasma adiponectin and
adiponectin mRNA (r ⫽ 0.30; P ⫽ 0.14). Because different
adiponectin excretion can alter the association between its
mRNA and plasma concentration in renal failure compared
with control subjects, we also separately analyzed the whole
group of renal failure patients and the control groups (Fig. 5).
A positive correlation was observed between the variables in
all CKD patients (n ⫽ 23, P ⫽ 0.01, Fig. 5), while no
significant associations were, in turn, observed in the six
control subjects alone (P ⫽ not significant, Fig. 5). In multiple
regression analysis, adipose tissue adiponectin mRNA remained significantly associated with circulating adiponectin in
CKD patients (P ⬍ 0.05) also after adjusting for plasma
hs-CRP that could potentially alter adiponectin secretion (6)
(not shown).
R51
OXIDATIVE STRESS AND FAT ADIPONECTIN IN CKD
Fig. 2. Plasma TBARS (A), adipose tissue adiponectin mRNA (B), and plasma adiponectin concentration
(C) in MHD and renal transplant (RT) patients. *P ⬍
0.05 vs. Control, Student’s t-test or Wilcoxon test.
tissue in patients with advanced chronic kidney disease. Oxidative stress is notably a potential negative modulator of
cardiovascular risk in kidney disease (15, 23), and the current
data indicate that its clustering with low adiponectin expression
and plasma concentration could contribute to this negative
impact.
Adipose tissue adiponectin expression and adiponectin
plasma concentration. The active metabolic and cardiovascular
impact of adipose tissue has been established in recent years in
metabolic disease states (9, 11, 17). This potential role remains,
however, to be defined in uremia due to the relevant role of
passive accumulation in causing increased plasma concentrations of several hormones (13, 28). Increasing ratio of circulating adiponectin to its adipose tissue expression from healthy
subjects to end-stage renal disease in four different control or
patient groups, indeed, suggests increasing passive accumulation in renal failure. The latter could, in turn, contribute to
increasing plasma adiponectin concentration in the presence of
comparable adiponectin transcript levels in RT and CT groups,
while the highest relative contribution of passive accumulation
could further account for preserved adiponectin concentration
in spite of very low adiponectin transcript levels in MHD. On
the other hand, the marked decline in fat tissue adiponectin
expression in MHD could have played a major role in blunting
circulating adiponectin increments, resulting in circulating horTable 2. Linear correlation between adipose tissue
adiponectin mRNA and plasma TBARS, creatinine, hsCRP,
age, BMI, and body fat in all study subjects
Fig. 3. Ratio between plasma adiponectin and adipose tissue adiponectin
mRNA in nonuremic control subjects (Control) and in CKD patient groups
(CT, MHD, and RT). $P ⬍ 0.05 vs. Control and RT-CT groups; *P ⬍ 0.05 vs.
Control, ANOVA, and Wilcoxon test.
Subject Characteristics (n ⫽ 29)
r
P
TBARS, log nmol/ml
Creatinine, mg/dl
hsCRP, mg/dl
Age, yr
BMI, kg/m2
Fat, %
⫺0.68
⫺0.64
⫺0.57
0.09
0.16
0.15
⬍0.0001
0.002
0.014
⬎0.2
⬎0.2
⬎0.2
TBARs, thiobarbituric acid-reactive substances; hsCRP, high-sensitivity
C-reactive protein.
AJP-Regul Integr Comp Physiol • VOL
293 • JULY 2007 •
www.ajpregu.org
Downloaded from http://ajpregu.physiology.org/ by 10.220.33.1 on June 18, 2017
pression and lipid peroxidation markers in all study subjects.
Because proinflammatory mediators have been recently reported to negatively modulate adiponectin expression in subcutaneous adipose tissue in nonrenal patients (6) and inflammation can occur in advanced stages of CKD, the validated
clinical marker of inflammation C-reactive protein was measured in all patients and included in statistical analysis. CRP
was negatively related with adiponectin expression [in agreement with the above observations (6)]. Adjustment for plasma
CRP concentration did not, however, modify the relationship
between adiponectin expression and circulating TBARS, suggesting that the latter is at least in part independent of inflammation. It should be pointed out that associations may suggest
but not prove cause-effect relationships. Lipid oxidative stress
has been, however, recently reported to negatively modulate
adiponectin expression in vitro and in animal models of metabolic disease (11, 14, 19, 35). On the basis of available
knowledge, the current findings therefore support a role of
oxidative stress to downregulate adiponectin expression in fat
R52
OXIDATIVE STRESS AND FAT ADIPONECTIN IN CKD
mone levels lower than those of patients undergoing conservative treatment and similar to those of patients with intermediate residual renal disease following transplantation. The
current data therefore provide the first direct evidence supporting an active role of adipose tissue adiponectin expression in
modulating its circulating levels in CKD. The functional impact of reduced adiponectin expression was notably further
supported by the lower adiponectin protein content in adipose
tissue of MHD compared with conservative treatment patients
and by the positive association between adiponectin transcript
levels and plasma concentration in all CKD patients. The data
suggest that modulation of oxidative stress and adipose tissue
adiponectin expression could represent a potential target for
therapeutic strategies aimed at enhancing plasma adiponectin
and reducing CKD-associated metabolic and cardiovascular
risk (3, 27, 34, 40).
Previous reports notably agree with the current data in
indicating lack of increments of circulating adiponectin in renal
patients undergoing hemodialysis compared with conservative
treatment, in spite of presumable extreme reductions of renal
function in the hemodialysis groups (8, 37). In the above
studies, it is well possible that lack of plasma adiponectin
increments in hemodialysis resulted from a decline in adipose
Table 3. Multiple regression analyses (F value) of plasma
TBARS and adiponectin mRNA in all subjects
Adjusted Value
Independent variable: Plasma TBARS
Adiponectin mRNA, au
a
9.41†
b
5.10*
a: adjusted for plasma hs-CRP; b: adjusted for plasma hs-CRP and plasma
creatinine. *P ⬍ 0.05; †P ⬍ 0.01.
Fig. 5. Positive correlation between log subcutaneous adipose tissue adiponectin mRNA and plasma adiponectin concentration in CKD patients (CT, MHD,
RT; n ⫽ 23). No correlation was observed in the smaller control group
considered alone.
tissue contribution with a parallel relative increment of passive
accumulation (8, 37). The only available report of adipose
tissue adiponectin expression in chronic kidney disease (with
no information on oxidative stress) showed reduced adipose
tissue adiponectin mRNA in end-stage renal disease patients
compared with healthy control subjects, and it was concluded
that adipose tissue does not actively contribute to regulate
circulating adiponectin in CKD (26). The above study most
importantly did not extend to different degrees or treatments of
renal failure (26). Plasma adiponectin was not available in the
majority of patients or in any control subjects (26). In addition,
collection of adipose tissue samples in control subjects occurred during surgery and anesthesia, which could also have
potentially directly or indirectly (i.e., via the underlying disease) affected adiponectin expression (26). It is therefore likely
that the above differences and the less comprehensive study
design and population (26) contributed to different conclusions.
Patients with obesity or diabetes were excluded from this
study, since we aimed at excluding known sources of oxidative
stress and adiponectin suppression (as well as inflammation)
independent of kidney failure or its treatment per se (9, 11, 17).
The current results provide a strong rationale for future studies
to directly investigate the potential independent role of diabetes
in the regulation of adiponectin adipose tissue expression and
plasma concentration in advanced CKD. In this study, total
adiponectin was measured since it has been so far reported to
be associated with positive metabolic and cardiovascular end
points in advanced CKD (3, 27, 34, 40). Altered adiponectin
AJP-Regul Integr Comp Physiol • VOL
293 • JULY 2007 •
www.ajpregu.org
Downloaded from http://ajpregu.physiology.org/ by 10.220.33.1 on June 18, 2017
Fig. 4. Negative log correlations between plasma TBARS and subcutaneous adipose tissue adiponectin mRNA in all subjects (control, CT, MHD,
RT; n ⫽ 29).
OXIDATIVE STRESS AND FAT ADIPONECTIN IN CKD
ACKNOWLEDGMENTS
We thank A. de Santis for skillful technical assistance. We are most grateful
to Prof. Lucio Torelli, Statistics Department, University of Trieste, Italy, for
advice and support in statistical analyses.
REFERENCES
1. Axelsson J, Heimburger O, Lindholm B, Stenvinkel P. Adipose tissue
and its relation to inflammation: the role of adipokines. J Ren Nutr 15:
131–136, 2005.
2. Barazzoni R, Zanetti M, Bosutti A, Biolo G, Vitali-Serdoz L, Stebel M,
Guarnieri G. Moderate caloric restriction, but not physiological hyperleptinemia per se, enhances mitochondrial oxidative capacity in rat liver
and skeletal muscle–tissue-specific impact on tissue triglyceride content
and AKT activation. Endocrinology 146: 2098 –2106, 2005.
3. Becker B, Kronenberg F, Kielstein JT, Haller H, Morath C, Ritz E,
Fliser D. Renal insulin resistance syndrome, adiponectin and cardiovascular events in patients with kidney disease: the mild and moderate kidney
disease study. J Am Soc Nephrol 16: 1091–1098, 2005.
4. Chumlea WC, Guo SS, Kuczmarski RJ, Flegal KM, Johnson CL,
Heymsfield SB, Lukaski HC, Friedl K, Hubbard VS. Body composition
estimates from NHANES III bioelectrical impedence data. Int J Obes
Relat Metab Disord 26: 1596 –1609, 2002.
5. Canaud B, Cristol JP, Morena M, Leray-Moragues H, Bosc JY,
Vaussenat F. Imbalance of oxidants and antioxidants in haemodialysis
patients. Blood Purif 17: 99 –106, 1999.
6. Degawa-Yamauchi M, Moss KA, Bovenkerk JE, Shankar SS, Morrison CL, Lelliott CJ, Vidal-Puig A, Jones R, Considine RV. Regulation
of adiponectin expression in human adipocytes: effects of adiposity,
glucocorticoids, and tumor necrosis factor. Ob Res 13: 662– 669, 2005.
7. Descamps-Latscha B, Drueke T, and Witko-Sarsat V. Dialysis-induced
oxidative stress: biological aspects, clinical consequences, and therapy.
Semin Dial 14: 193–199, 2001.
8. Diez JJ, Iglesias P, Fernandez-Reyes MJ, Aguilera A, Bajo MA,
Alvarez-Fidalgo P, Codoceo R, Selgas R. Serum concentrations of
leptin, adiponectin and resistin, and their relationship with cardiovascular
disease in patients with end-stage renal disease. Clin Endocrinol (Oxf) 62:
242–249, 2005.
9. Evans JL, Goldfine ID, Maddux BA, Grodsky GM. Are oxidative stress
activated signaling pathways mediators of insulin resistance and beta-cell
dysfunction? Diabetes 52: 1– 8, 2003.
10. Filippidis G, Liakopoulos V, Mertens PR, Kiropoulos T, Stakias N,
Verikouki C, Patsidis E, Koukoulis G, Stefanidis I. Resistin serum
levels are increased but not correlated with insulin resistance in chronic
hemodialysis patients. Blood Purif 23: 421– 428, 2005.
11. Furukawa S, Fujita T, Shimabukuro M, Iwaki M, Yamada Y, Nakajima Y, Nakayama O, Makishima M, Matsuda M, Shimomura I.
Increased oxidative stress in obesity and its impact on metabolic syndrome. J Clin Invest 114: 1752–1761, 2004.
12. Gotoh M, Nagase S, Aoyagi K, Hirayama A, Takemura K, Ueda A,
Tomida C, Kikuchi C, Koyama A. Thiobarbituric acid reactive substances are increased in the subcutaneous fat tissue of patients with
end-stage renal disease. Nephrol Dial Transplant 12: 713–717, 1997.
13. Guebre-Egziabher F, Bernhard J, Funahashi T, Hadj-Aissa A, Fouque D. Adiponectin in chronic kidney disease is related more to metabolic
disturbances than to decline in renal function. Nephrol Dial Transplant 20:
129 –134, 2005.
14. Hattori Y, Akimoto K, Gross SS, Hattori S, Kasai K. Angiotensin-IIinduced oxidative stress elicits hypoadiponectinaemia in rats. Diabetologia 48: 1066 –1074, 2005.
15. Himmelfarb J, Stenvinkel P, Ikizler TA, Hakim RM. The elephant in
uremia: oxidant stress as an unifying concept of cardiovascular disease in
uremia. Kidney Int 62: 1524 –1538, 2002.
16. Kawanami D, Maemura K, Takeda N, Harada T, Nojiri T, Imai Y,
Manabe I, Utsunomiya K, Nagai R. Direct reciprocal effects of resistin
and adiponectin on vascular endothelial cells: a new insight into adipocytokine-endothelial cell interactions. Biochem Biophys Res Commun 314:
415– 419, 2004.
17. Kern PA, Di Gregorio GB, Lu T, Rassouli N, Ranganathan G.
Adiponectin expression from human adipose tissue: relation to obesity,
insulin resistance, and tumor necrosis factor-alpha expression. Diabetes
52: 1779 –1785, 2003.
18. Kobashi C, Urakaze M, Kishida M, Kibayashi E, Kobayashi H,
Kihara S, Funahashi T, Takata M, Temaru R, Sato A, Yamazaki K,
Nakamura N, Kobayashi M. Adiponectin inhibits endothelial synthesis
of interleukin-8. Circ Res 97: 1245–1252, 2005.
19. Kurata A, Nishizawa H, Kihara S, Maeda N, Sonoda M, Okada T,
Ohashi K, Hibuse T, Fujita K, Yasui A, Hiuge A, Kumada M,
Kuriyama H, Shimomura I, Funahashi T. Blockade of Angiotensin II
type-1 receptor reduces oxidative stress in adipose tissue and ameliorates
adipocytokine dysregulation. Kidney Int 70: 1717–1724, 2006.
20. Kyle UG, Bosaeus I, De Lorenzo AD, Deurenberg P, Elia M, Gomez
JM, Heitmann BL, Kent-Smith L, Melchior JC, Pirlich M, Scharfetter
H, Schols AMWJ, Pichard C. Composition of the ESPEN Working
Group: Bioelectrical impedance analysis—part I: review of principles and
methods. Clin Nutr 23: 1226 –1243, 2004.
21. Lara-Castro C, Luo N, Wallace P, Klein RL, Garvey WT. Adiponectin
multimeric complexes and the metabolic syndrome trait cluster. Diabetes
55: 249 –259, 2006.
22. Levey AS, Bosch JP, Lewis JB, Greene T, Rogers N, Roth D. A more
accurate method to estimate glomerular filtration rate from serum creatinine: a new prediction equation. Modification of Diet in Renal Disease
Study Group. Ann Intern Med 130: 461– 470, 1999.
23. Locatelli F, Canaud B, Eckardt KU, Stenvinkel P, Wanner C, Zoccali
C. Oxidative stress in end-stage renal disease: an emerging threat to
patient outcome. Nephrol Dial Transplant 18: 1272–1280, 2003.
24. Luke RG. Chronic renal failure—a vasculopathic state. N Engl J Med
339: 841– 843, 1998.
25. Madamanchi NR, Vendrov A, Runge MS. Oxidative stress and vascular
disease. Arterioscler Thromb Vasc Biol 25: 29 –38, 2005.
26. Marchlewska A, Stenvinkel P, Lindholm B, Danielsson A, PecoitsFilho R, Lönnqvist F, Schalling M, Heimbürger O, Nordfors L.
Reduced gene expression of adiponectin in fat tissue from patients with
end-stage renal disease. Kidney Int 66: 46 –50, 2004.
27. Menon V, Li L, Wang X, Greene T, Balakrishnan V, Madero M,
Pereira AA, Beck GJ, Kusek JW, Collins AJ, Levey AS, Sarnak MJ.
AJP-Regul Integr Comp Physiol • VOL
293 • JULY 2007 •
www.ajpregu.org
Downloaded from http://ajpregu.physiology.org/ by 10.220.33.1 on June 18, 2017
polymerization with reduced high-molecular weight forms is
emerging as a modulator of metabolic and vascular complications in metabolic diseases (21). It is possible that changes in
the ratio of adiponectin circulating forms could be influenced
by CKD stage and oxidative stress, and these issues could be
addressed in future investigations. It should also be pointed out
that renal transplant patients were treated with immunosuppressive therapy, including prednisone in two patients and
methylprednisolone in one, while dexamethasone was reported
to acutely and moderately reduce adiponectin secretion from
human adipocytes by ⬃10% (6). Although it is not known
whether this effect occurs in vivo following sustained administration, treatment could have caused a potential moderate
reduction of adiponectin transcript levels and plasma concentration with no impact on the study’s conclusions of positive
effects of renal transplantation on oxidative stress and adiponectin expression (which would be if anything underestimated).
In conclusion, the current data demonstrate that increased
oxidative stress is associated with declining adiponectin transcriptional expression in fat tissue in patients undergoing MHD
compared with conservative treatment. Oxidative stress and
adiponectin expression are, in turn, normalized in renal transplant recipients. Reduced adiponectin expression appears to
have a negative impact on plasma adiponectin concentration in
MHD. Increased oxidative stress with reduced adiponectin
expression and plasma concentration represent a novel cluster
of risk factors potentially contributing to enhance metabolic
and cardiovascular disease in MHD patients. On the basis of
available knowledge, the data support a novel role of oxidative
stress in the modulation of adiponectin expression and of
adipose tissue as an active player in the regulation of circulating adiponectin in advanced CKD.
R53
R54
28.
29.
30.
31.
32.
34.
35.
Adiponectin and mortality in patients with chronic kidney disease. J Am
Soc Nephrol 17: 2599 –2606, 2006.
Merabet E, Dagogo-Jack S, Coyne DW, Klein S, Santiago JV, Hmiel
SP, Landt M. Increased plasma leptin concentration in end-stage renal
disease. J Clin Endocrinol Metab 82: 847– 850, 1997.
National Kidney Foundation. K/DOQI clinical practice guidelines for
chronic kidney disease: evaluation, classification, and stratification. Am J
Kidney Dis 39 Suppl 1: S1–S266, 2002.
Oberg BP, McMenamin E, Lucas FL, McMonagle E, Morrow J,
Ikizler TA, Himmelfarb J. Increased prevalence of oxidant stress and
inflammation in patients with moderate to severe chronic kidney disease.
Kidney Int 65: 1009 –1016, 2004.
Pupim LB, Himmelfarb J, McMonagle E, Shyr Y, Ikizler TA. Influence of initiation of maintenance hemodialysis on biomarkers of inflammation and oxidative stress. Kidney Int 65: 2371–2379, 2004.
Rajala MW, Scherer PE. Minireview: The adipocyte—at the crossroads
of energy homeostasis, inflammation, and atherosclerosis. Endocrinology
144: 3765–3773, 2003.
Shetty GK, Economides PA, Horton ES, Mantzoros CS, Veves A.
Circulating adiponectin and resistin levels in relation to metabolic factors,
inflammatory markers, and vascular reactivity in diabetic patients and
subjects at risk for diabetes. Diabetes Care 27: 2450 –2457, 2004.
Shinohara K, Shoji T, Emoto M, Tahara H, Koyama H, Ishimura E,
Miki T, Tabata T, Nishizawa Y. Insulin resistance as an independent
predictor of cardiovascular mortality in patients with end-stage renal
disease. J Am Soc Nephrol 13: 1894 –1900, 2002.
Soares AF, Guichardant M, Cozzone D, Bernoud-Hubac N, BouzaidiTiali N, Lagarde M, Geloen A. Effects of oxidative stress on adiponectin
36.
37.
38.
39.
40.
41.
AJP-Regul Integr Comp Physiol • VOL
secretion and lactate production in 3T3–L1 adipocytes. Free Radic Biol
Med 38: 882– 889, 2005.
Stenvinkel P, Barany P, Heimburger O, Pecoits-Filho R, Lindholm B.
Mortality, malnutrition, and atherosclerosis in ESRD: what is the role of
interleukin-6? Kidney Int 61 Suppl 80: 103–108, 2002.
Tentolouris N, Doulgerakis D, Moyssakis I, Kyriaki D, Makrilakis K,
Kosmadakis G, Stamatiadis D, Katsilambros N, Stathakis C. Plasma
adiponectin concentrations in patients with chronic renal failure: relationship with metabolic risk factors and ischemic heart disease. Horm Metab
Res 36: 721–727, 2004.
Vural A, Yilmaz MI, Caglar K, Aydin A, Sonmez A, Eyileten T, Acikel
C, Gulec B, Kozak O, Oner K. Assessment of oxidative stress in the
early posttransplant period: comparison of cyclosporine A and tacrolimusbased regimens. Am J Nephrol 25: 250 –255, 2005.
Witko-Sarsat V, Friedlander M, Khoa TN, Capeille’re-Blandin C,
Nguyen AT, Canteloup S, Dayer J-M, Jungers P, Drueke T, and
Descamps-Latscha B. Advanced oxidation protein products as novel
mediators of inflammation and monocyte activation in chronic renal
failure. J Immunol 161: 2524 –2532, 1998.
Zoccali C, Mallamaci F, Tripepi G, Benedetto FA, Cutrupi S, Parlongo S, Malatino LS, Bonanno G, Seminara G, Rapisarda F, Fatuzzo
P, Buemi M, Nicocia G, Tanaka S, Ouchi N, Kihara S, Funahashi T,
Matsuzawa Y. Adiponectin, metabolic risk factors, and cardiovascular
events among patients with end-stage renal disease. J Am Soc Nephrol 13:
134 –141, 2002.
Zoccali C. Cardiovascular risk in uraemic patients—is it fully explained
by classical risk factors? Nephrol Dial Transplant 15: 454 – 457, 2000.
293 • JULY 2007 •
www.ajpregu.org
Downloaded from http://ajpregu.physiology.org/ by 10.220.33.1 on June 18, 2017
33.
OXIDATIVE STRESS AND FAT ADIPONECTIN IN CKD