Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Volume 15 Number 20 1987 Nucleic Acids Research A cell type specific factor recogizes the rat thyrglobulin promoter Anna Maria Mustil, Valeria Matilde Ursinil, Enrico Vittorio Avvedimentol, Vincenzo Zimarino2 and Roberto Di Laurol,2* 'Centro di Endocrinologia ed Oncologia sperimentale del CNR, c/o II Facolta di Medicina, 80131 Napoli, Italy, 2Laboratory of Biochemistry of the National Cancer Institute, National Institutes of Health, Bethesda, MD 20892, USA Received August 20, 1987;Accepted September 25, 1987 ABSTRACT We have fused a 900 base pair long DNA segment containing the transcriptional start site of the rat thyroglobulin (Tg) gene to the bacterial gene for chloramphenicol acetyltransferase (cat). The fusion gene has been introduced into three different cell lines derived from the rat thyroid gland and into a rat liver cell line. Expression of the fusion gene was detected only in the one thyroid cell line that is able to express the endogenous Tg gene. The minimum DNA sequence required for the cell type specific expression was determined by deletion analysis; it extends 170 nucleotides upstream of the transcription initiation site. The Tg promoter contains a readily detectable binding sites for a factor present in salt extracts of thyroid cell nuclei. This binding site is not recognized by the nuclear extracts of any other cell type that we have tested, suggesting that it may help mediate the cell type specific expression of the Tg gene. INTRODUCTION One of the results of cell differentiation is the specific temporal and spatial appearance of certain mRNAs. Recently it has been demonstrated for a few genes that the tissue or cell type specific expression can be reproduced in cell culture. In these systems it has also been clearly shown that the signals for the transcriptional control of developmentally regulated genes are contained in relatively short DNA segments that are linked to the genes themselves, either 5' or 3' of the transcription start site (1-8). Little is known about the mechanisms of the transcriptional control: an attractive hypothesis postulates that some transacting factor(s) interact with specific DNA sequences to control transcription. The distribution of such factors could already suggest a mechanism for their action: if a specific factor is present exclusively in the tissue or cell type expressing a particular © I R L Press Limited, Oxford, England. 8149 Nucleic Acids Research gene, this factor is most likely a positive activator of transcription. If, on the other hand, the factor(s) is only present in the cells where the gene is not expressed, then it may be a candidate for a repressor type molecule. We have been interested in the thyroglobulin (Tg) gene as a model to study the molecular mechanisms of differentiation. Tg, the glycoprotein precursor for thyroid hormone biosynthesis (9 and references therein), has been detected only in the follicular cells of the thyroid gland. The Tg mRNA is not detectable in tissues or cell lines not producing Tg (10) suggesting that transcriptional controls may be involved in the tissue specific appearance of the protein. Several cell lines derived from either normal thyroid tissue or from rat thyroid tumors have been characterized and shown to display differential Tg gene expression (11). In one of the cell lines derived from the normal thyroid tissue (FRTL-5), the level of Tg mRNA is only four fold less than in the rat thyroid gland. On the basis of the expression of the Tg gene and of the presence of other thyroid specific markers such as ability to concentrate iodine from the media and to respond to the action of the Thyroid Stimulating Hormone (12), we consider this cell line as an excellent model system to study the differentiated status of the thyroid tissue. Another cell line, derived from a rat thyroid tumor (FRA), does not present any thyroid specific function except the appearance of low but detectable levels of Tg mRNA. A third cell line (FRT), derived from normal thyroid glands and of epithelial morphology, does not show any thyroid specific function and contains undetectable levels of Tg mRNA. As an additional control of transcriptional specificity, we have used the BRL-3A2 cell line, derived from rat liver (13). We have recently isolated the entire rat Tg gene and its flanking region (9). This gene spans over 170,000 base pairs (bp) and represents one of the largest eukaryotic transcription units isolated so far. The study of Tg gene expression using the intact transcription unit is not possible with present technology. On the other hand, the availability of the cell lines described above, of techniques which allow the introduction of DNA into eukaryotic cells (14) and of vectors designed to detect the promoter activity of DNA fragments (15), prompted us to search for sequences responsible for the tissue specific expression of the rat thyroglobulin gene. 8150 Nucleic Acids Research MATERIALS AND METHODS Construction of Deletion Mutants The mutants were generated by cleaving at a unique site into a master plasmid (see below), trimming with Bal3l, repairing the ends with the Klenow fragment of DNA polymerase I and ligating to the repaired end a synthetic oligonucleotide containing the appropriate restriction site. The modified promoter fragments were subsequently fractionated on an agarose gel and reintroduced into appropriately cleaved p8-cat, a pEMBL8 derived plasmid where the Hindlil-BamHl fragment from pSV2 cat, containing the cat structural gene and SV40 derived processing signals, replaced the Hindlll-Clal fragment of pEMBL8 (16). The deletion end points were determined by double stranded sequencing on minipreps (17). 3' deletion mutants: the master plasmid pTgcat7 was cleaved at the junction between the Tg promoter and the cat transcriptional unit by HindlIl. After trimming, repair and ligation to an HindIll linker the plasmid was cleaved by BamHl, which is located in the polylinker just upstream of the promoter (Figure 1), and the resulting fragments cloned into pUC18. After sequencing, the mutants indicated were subcloned into p8-cat. 5' deletion mutants: the master plasmid for the first set of mutants was 3'-4 which was cleaved at the unique BamHl site upstream of the promoter. After trimming, repair and ligation to a BamHl linker the plasmid was cleaved with HindlIl and the purified fragments cloned into p8-cat. The deletions containing an S in their number were generated as above but starting with plasmid 5'-41 and using a Sall linker (8 base pairs long) to reintroduce them into p8-cat. A74 and A75 were generated starting with 5'-41 and trimming the plasmid linearized at the unique BstEIl site (Figure 1). The trimmed plasmids were recircularized in the presence of a Sall linker. A74 incorporated a linker which appears to be incorrect. A75 did not incorporate the linker. Measurement of Promoter Activity Plasmid DNA was prepared from lysozime-Triton X1 00-cleared lysates by two banding in cesium chloride-ethidium bromide equilibrium gradients. cell lines were grown as described (11). DNA was introduced into cell by the DEAE-Dextran procedure (14). After 48-60 hours the cells were collected and the CAT activity assayed (15). 8151 Nucleic Acids Research Primer Extension Total RNA was extracted from transfected cells 60 hours after transfection by the Guanidinium thiocyanate-CsCI method(18). 35 ug of RNA were hybridized to a 5'-32p labelled synthetic oligonucleotide(5'GCCATTGGGATATATCAACGGTGG) complementary to nucleotides 26-49 of the coding sequence of the CAT mRNA(19). Hybridization and primer elongation with reverse transcriptase were performed as described in reference 7. The reaction products were fractionated on a 6% sequencing gel(20). Exonuclease III and DNAsel Footprinting Nuclear proteins were extracted from the FRTL-5, FRA, FRT and BRL3A2 cell lines as described (21). Solid ammonium sulphate (0.2g/ml) was then added to the nuclear extracts. The precipitated proteins were dissolved in 25mM Hepes (pH7.9), 50 mM KCI, 0.1mM EDTA, 1mM DTT, 1mM PMSF, 10% Glycerol, dialyzed against 100 volumes of the same buffer for 5 hours and stored in aliquots at - 800C. 20,ug of proteins were used for each 50 RI binding assay. Exonuclease Ill footprinting were performed as described (21) except that 200 ng of supercoiled plasmid DNA was used as non specific competitor. Similar conditions were used for DNAsel footprints, with the following modifications:100 ng of nonspecific competitor were used and MnCI2 (0.5 mM final concentration) was added together with the enzyme. After digestion the DNA was purified by phenol extraction, ethanol precipitated and analyzed on a 6% sequencing gel (20). DNA sequencing reactions were used as size markers. RESULTS Construction and Expression of Tg-cat Fusion Plasmids We reported in a previous paper the isolation of a recombinant phage (X63) containing the transcription start site for the rat Tg mRNA, which was identified by primer extension (9). A 900 bp Pstl-Sacl fragment, spanning the transcription start site was isolated from X63 and cloned into the plasmid p8-cat (16, Figure 11B) to obtain the plasmid pTgcat7 in which the Tg promoter is inserted upstream of the cat gene. The entire sequence of the Tg promoter fragment is shown in Figure 3. The sequence shows some features common to many 8152 Nucleic Acids Research A 100bp i (-827) Pst 1 (-269) BstElI (+75) Sacl(HindM) TATA AUG VV ..... B Figure 1: Panel A shows the restriction fragment, derived from the phage XrTg63 containing both the translational and the transcriptional start site of the rat Tg gene. The Sacl end has been transformed to an Hindlil end by blunt end ligation to a synthetic oligonucleotide containing the HindlIl site, after repair with the Klenow fragment of DNA polymerase I of E.ol . The modified fragment was introduced into the plasmid p8-cat, cleaved with Pstl and Hindlil (panel B) to generate the plasmid pTgCAT 7. The thin line represent plasmid DNA sequences, the empty box the CAT transcriptional unit, derived from pSV2CAT and the filled box the Tg promoter fragment. The BstEll site in the Tg promoter fragment is a unique site in the plasmid and was subsequently used to generate deletion mutants. 8153 Nucleic Acids Research A TATA AUG AUG TgCAT 7... -827 J 3-4- .39 J 3- 21 i- -- .17 J3:-1 =CAT i----CAT .5 J 3- 91 -CAT -31 CA J3-81 -69 J 3- 7. =CAT -90 RELATIVE CAT ACTIVITY FRA BRL FRT FRTL-5 CONSTRUCT pilg CAT 7 1(0.2) 13 21 27 A 3'- 4 A 3'- 2 A l. 1 A 31-9 A 3 -8 A 3' 7 V.0. V.0. VI0. VI.. VIB. VIB. V.0. 3.0. V0. V.0. V.0. V.0. V.0. V.0. JO0. VI.0 VJ.D V.0. - - - CAT ACTI VITY (% Couwrsiew) FRA FR? FRTL -5 SRL CONTROL PLASMID 14 2.6 RSV CAT pSV 2 CAT 12 0.9 20 2.7 17 B AUG TATA .30 -827 J5-321 J5-37 CAT i - - - - - - - - - - - - 522 AT - - - - - -- - 434 A5-40. _ - - - - - - - - - - - - - -369 J5-41 - - - - - - - - - - - - - - - - - - - - - - =AT A - -T- -284 i5-17SA --- --- -- - - - - - - - - - - - - - - -- -- - -T-167 JS-13-1. -------------------------------- 6CAT - W51S,F - -- - - - - - - J - 74SF --- - - - - - - - - - - J75S3, _- __ - - - - - - - --- - - - ._- 237 CONSTRIUCT 8154 _ __--fC A aICT -120 *- -179 -148 ----- - - -65 RELATIVE CAT ACTIVITY FRTL *5 ML - FRT- FRA A 3'- 4 A S- 32 A S.- 37 1(2.6) AS'-40 1.7 2.4 A 5'- 41 A S'- 17S AS'- 13S AS' - ISS A74 -S A7S -S 160 __ 1.6 1.6 2.4 0.05-0.1 U.0. U.0. U.O. U.0. U.0. U.0. U.0. U.0. U.0. U.0. U.0. U.O. U.0. Nucleic Acids Research eukaryotic promoters, such as TATAAA and a CAA sequence 27 and 70 bp upstream of the transcription initiation site, respectively. A rather long purine rich stretch, located between position -294 and -400, is also present in an analogous position in the human Tg promoter (22). In addition, the inserted fragment contains the putative translational start site for Tg biosynthesis. In order to remove the Tg AUG, which is out of frame with the cat AUG (data not shown), we deleted a few nucleotides using the enzyme Bal31 from the HindlIl site of the plasmid pTgcat7 (Figure 2). The 3' deletion mutants were then isolated and recloned in p8-cat. They were tested for cat expression in the Tg producing FRTL-5 cell line and in the other three cell lines which contain either undetectable (BRL-3A2 and FRT) or very low detectable levels of Tg mRNA (FRA). While we detected cat activity in the extracts of transfected FRTL-5 cells, no cat enyzme could be measured in the control cell lines( Figure 2; U. D.= undetectable). Furthermore, a clear stimulatory effect was observed when the Tg AUG is removed (deletions 1,2,4) suggesting that it is a functional translation initiation site, interfering with proper translation initiation at the downstream AUG. Deletions that extend Figure 2: Deletion mutants of the Tg promoter. The upper part of the figure shows the structure of the various deletion mutants. A = 3' deletions: the starting plasmid(pTgCAT7) contains the promoter fragment of the thyroglobulin gene indicated in Figure 1, extending from -827 to + 76(+1 is the transcription initiation site). Deletions extend from +76 onwards. The dashed line indicates the deleted DNA. The number at the end of the dashed line indicates the deletion end point. B = 5' deletions: the starting plasmid contains as promoter fragment the deletion 3'-4. Deletion extend from -827 downwards.Deleted DNA and deletion end points are indicated as in panel A. In the lower part of the figure we report the in vivo activity of the deletion mutants, as deduced from the CAT activity measured in extract of the cell lines transfected with each DNA. For each set of mutants we have indicated the activities obtained as relative to the starting, undeleted plasmid. The absolute activity of the undeleted plasmid (as percentage of conversion of chloramphenicol to the acetylated forms) is indicated in parenthesis. For the control plasmids, used in all transfections with all cell lines to make sure that they were all transfectable, we have indicated the absolute activities of a sample transfection. U. D. = Undetectable; - = not done. 8155 Nucleic Acids Research further upstream do not show any detectable cat activity, either because they remove important transcriptional signals or because they change the structure of the 5' end of the mRNA. The absence of cat activity in the three cell lines unable to transcribe their endogenous thyroglobulin gene (FRT, FRA, BRL-3A2) is not due to poor transfection efficiency but rather to reduced capacity to promote transcription from the transfected thyroglobulin promoter. All three cell lines in fact do produce cat enzyme if transfected with plasmids containing the cat transcriptional unit fused to either the Rous Sarcoma Virus LTR (23) or to the SV40 early promoter (15) (Figure 2). To determine the DNA region required for the observed cell-type specific expression of the Tg promoter, we constructed the 5' deletion mutants shown in Figure 2B. While a large region of DNA could be deleted without significantly affecting the expression of the Tg promoter, a significant decrease in promoter activity is observed in deletion 5'-13. Note that deletion 5'-17, which is fully active, contains only seven bases beyond the 5' end of 5'-13. This observation precisely limits the 5' border of the essential region of the Tg promoter to nucleotides 166-161 from the transcription initiation site. To further confirm this observation, we constructed internal deletion mutants in the plasmid 5'-41, taking advantage of the unique BstEll site present in the Tg promoter (Figure 1). The plasmid 5'-41 was linearized with BstEII, trimmed with Bal3l, recircularized and transformed into E.coi. Of the resulting plasmids, two were selected for further study. A74 is a 30 base pairs deletion extending from -179 to -148 in the Tg promoter and shows no promoter activity. The result obtained with A74 rules out that the decrease in activity observed in the deletion 5'-13 results from the new plasmid-Tg promoter junction created by the deletion. A75 deletes further down to 10 nucleotides upstream of the CAA box and also shows no detectable promoter activity. The in vivo transcription initiation site of the Tg gene has been mapped five nucleotides upstream of the end point of deletion 3'-1 (9). In order to test if in our constructs transcription was initiating at the same nucleotide, we performed a primer extension experiment on the RNA extracted from FRTL-5 cells transfected with the deletion 5'-41, which demonstrated that the hybrid Tg-cat gene is still using the natural initiation site of the Tg gene (Figure 4). 8156 Nucleic Acids Research 1 2 3 4 56 124120 ~' Figure 3: Primer extension. The primer used and the reaction conditions are described in the Materials and Methods section. The RNA's were extracted from FRTL-5 cells transfected with either RSV-cat (lane 1) or TgCAT 5'-41 (lanes 2, 3, two independent experiments). In lanes 4, 5, and 6 are shown the primer extensions obtained with RNA extracted from BRL-3A2, FRT and FRA respectively, all transfected with TgCAT 5'-4 1. A FRTL-5 specific factor binds to the Tg promoter In order to detect sequence specific DNA binding proteins in nuclear extract of the cell lines used in this study we used as DNA substrate the BamHl-Hindlil insert of plasmid pTgcat-5'41 (Figure 2) labelled at either the BamHl or the HindlIl end with polynucleotide kinase and y32P-ATP. The labelled fragments were then incubated with nuclear extracts prepared from the four different cell lines and finally digested with either Exonuclease Ill (Exolll)(21) or DNAsel (24). Exolll is a double stranded specific exonuclease that digests DNA molecules from a base paired 3' end toward the 5' end. The presence of a bound protein should stop ExollI movement and it should be possible to detect and map this stop if a 5' end labelled substrate is used and the reaction products are visualized by autoradiography. This method has been used to map the binding site of several prokariotic and eukaryotic DNA binding proteins (see ref. 21 and references therein). Analysis of the Exolll digestion pattern of the end labelled Tg promoter fragments shows that the addition of nuclear extracts yields several Exolll 8157 Nucleic Acids Research resistant DNA fragments that are barely visible or not detectable at all in the absence of extract (see for example figure 5A, lanes 1-3 vs. lanes 4-5). The appearance of new or of stronger bands upon addition of extract could be due to a non-specific inhibition of the exonuclease activity by the extract itself, a phenomenon that may just enhance sequence specific pausing of the enzyme not related to the presence of a sequence specific binding protein (data not shown). In order to discriminate between specific stops and non specific, sequence dependent, pausing of the enzyme we usually explored a range of enzyme concentration in the digestions. In addition we decided to interpret as specific only the blocks confirmed by Exolll protection on the complementary DNA strand and that furthermore could be revealed by an independent method, i.e. DNAsel footprinting (see below). Exolll footprinting of the BamHl labelled promoter fragment shows an extract induced, 230 nt long fragment (Figure 5, panel A, lanes 4, 5), which conforms to the criteria of specificity stated above. In fact, Exolll digestion of the HindlIl labelled fragment shows a fragment (115 nt long), complementary to the one seen in the previously described digest, which appears only in the presence of nuclear extracts (Figure 5, panel B, lanes 1, 2). The alignment of the Exolil stop on both strands delineates a binding domains indicated as c and covering the promoter regions -61 to -73 (Figure 3). The sequence requirements for the binding to region c have been studied using deletion mutants (Figure 5, panels C and D). The results of the binding experiments in deletion mutants missing either the TATAA box or the upstream region of the promoter show that the interaction at the c region is conserved in all deletions tested, narrowing down the minimum region necessary for binding to the sequences between -32 and -90 from the transcription start site. Furthermore, this experiment rules out that the binding of factors to the upstream region or to the TATAA box is an absolute requirement for the binding of the c region factor. More detailed kinetic experiments should demonstrate if there is any sort of cooperativity in the binding of different factors to the Tg promoter. Tissue Specificity of the Protection at the -70 Region In order to determine whether a correlation exists between the binding activity described above and an active presence of the transcription of the endogenous thyroglobulin gene we compared both the DNAsel and Exolll footprints obtained in the presence of FRTL-5 8158 Nucleic Acids Research -810 CTGCAGACAAGCAGGCATGCATGGCCACTGTCTTCTCAGCTTTGTGTGGAAGGAAGTGGG -760 -710 CTCAGGAATAAGGATAATTTTCATAGATTATTCAGGGGCAGCTGGGAAGGAGAGAAGCTG -660 ATCCTGATAGTGCAGGGGCATGTCGACCTTATGTGTAAAAGAATATTCTTGCCACTTCCT -610 GCCCCTGGTAGCTTAGCGTGGCAGGGTTTAGTCCCCAGAAAAGGGGGGTTAGAGAGAGGT -560 ACGCATATGTGCCATGTGTGTTCATGCATGTGAGAATAGGTATGTGAGGTATACTTGGAT -510 TCCTTCCAGTACCAATTCTGTGTTCAATATTAATTGGAGCAGAATTTTCCAATTTGTTTC -460 -410 CTGCCATGGCTTCATTTTCAAGAATAGTGTCTACAGCTGAATTGCTCTAAAGCAATACTG -360 AAAGAAGGAAGGAAGGAAAGAAGAAAGGAAGGAATGAATGAAGCAAGGAAAAAAAGGAAA -310 AGAAAGGGGAACGAAGGAAGGAAGAAGAGGGGGAGGAATCAGGAGGAAGAGGAGATATTT -260 TATCTTTCACAGTTTTACAATCGAACTGTCACCCCTAAGGGTACAAAGCTCTGGCATTTG -210 CCTGTAAAGGGAAATTTTAGTGCTAGCCTCACATTTCTTGTCCCCATGTCCTGGAGTGGT -160 -110 CACCCTACTGATTACTCAACTATTCTTAGCGGGAGCAGACTCAAGTAGAGGGAGTTCC TG -60 TGACTAGCAGAGAAAACAAAGTGAGCCACTGCCCACTCAACTCTTCTTGAACAGTAGAGC -10 - +10 ACTGCTTGCCACTGTGCEITX XGCTTCCTGATAAGGGGACTCAGATGGGACACTGCTC +60 CTACCCCATCATTTGAGTAGGGGACAGG93MATGACCTTGGTCTTGTGGGTCTCGACTTT TTTG Figure 4: Sequence of the promoter region of the rat thyroglobulin gene. The start of transcription (nucleotide +1) is indicated by an arrow. The three repeats present between position -50 and -170 are written in italics. Underlined and labelled c is the region recognized by FRTL-5 nuclear factor. nuclear extract with those obtained with extracts from the cell lines which do not transcribe either the endogenous Tg gene or the cat gene fused to the Tg promoter. DNAsel footprints performed on the same Hindlll-BamHl fragment described in Figure 4, panel E show that the binding domain c is protected only by the FRTL-5 nuclear extract (Figure 6A, lanes 3-6). Exolll footprints of the same DNA fragment 8159 Nucleic Acids Research Figure 5: Exonuclease Ill footprints of the Tg promoter. Panel E shows fragments used. 5'-41 is the source of the wild type promoter. All the restriction sites present in identical position in the deletion mutants are indicated only by a vertical line. The continuous horizontal line represents Tg promoter sequence. The box represents the cat transcriptional unit. The line with a filled circle indicates the size and the position of the protected DNA fragment. The filled circle indicates the site that was labelled with y-32p-ATP and polynucleotide kinase Panel A: The fragment used was the BamHl-Hindlll from 5'-41 labelled at the BamHl site. The digestion was for 10' at 300C with 25 (lane 1), 50 (lane 2), 100 (lane 3), 200 (lane 4) or 400 units (lane 5) of Exonuclease Ill in the absence.(lanes 1-3) or in the presence (lanes 4,5) a scheme of the DNA of FRTL-5 nuclear extracts. Panel B: Same DNA fragment as in Panel A but labelled at the Hindll end. Digestion was as above with 25 (lane 3), 50 (lane 4), 200 (lanel) 8160 Nucleic Acids Research and 400 (lane 2) units of Exonuclease Ill in the absence (lanes 3,4) or in the presence (lanes 1,2) of FRTL-5 nuclear extracts. Panel C: The Hindlll-BamHl fragment, labelled at the Hindill end, from 5'-41 (lane 1), A75 (lane 2) or 5'-15 (lane 3) was incubated with FRTL5 nuclear extract and digested with 200 units of exonuclease Ill. The same fragment of 115 nucleotides is protected in all three cases. Panel D: the BstEll-Rsal fragment , labelled at the BstEll end, from deletion 3'-9 (lanes 1-4) or from 5'-41 (lanes 5-8) was preincubated without (lanes 1,2,5,6) or with (lanes 3,4,7,8) FRTL-5 nuclear extract and subsequently digested with 25 (lanes 1,5), 50 (lanes 2,6), 200 (lanes 3,7) or 400 (lanes 4,8) units of exonuclease Ill. The same fragment of 105 nucleotides is protected in both cases. (Figure 6B) show again that the binding domain c is specifically protected by the FRTL-5 nuclear extract. On the basis of the intensity of the 115 long Exolll resistant band detected in Figure 5B, and of the extract dilution experiment of fig. 5 , lane 3-6, we estimate that there is about 5 to 10 fold more c-binding activity in the FRTL-5 cell line as compared to the other extracts tested. DISCUSSION Transcription of the thyroglobulin gene is one of the differentiated function of the thyroid gland. The availability of the cloned gene and of rat thyroid cell lines makes the thyroid a convenient sytem to study the biochemical basis of cell type specific gene transcription. We have shown in this paper that a segment of DNA derived from the 5' end of the Tg gene fused to the cat gene is able to reproduce in vitro the tissue specific transcription observed in vivo. In fact, the only cell type where the transfected Tg promoter is active is also the only one where the endogenous gene is actively transcribed (FRTL-5). In order to prove that the transcription of the transfected Tg promoter is tightly related to the differentiated status of the thyroid tissue, we transfected the Tg-cat constructs into another epithelial, non thyroid, cell line (BRL-3A2). In addition we introduced the same construct into two control cell lines derived from the same tissue, one not expressing (FRT) and the other (FRA) expressing at very low level the endogenous Tg gene. In the three control lines the transfected Tg promoter is inactive while two viral promoter display comparable activity in all the cell lines used in this study (Figure 2). The inactivity of the 8161 Nucleic Acids Research A B 12 3456 7 89 1 2 3 4 5 6 a.-000 .4 tw::: 115 103 Figure 6: cell type specificity of the binding domains. The DNA fragment used throughout was the BamHl-Hindlll fragment of Figure 4 labelled at the Hindlil site. Panel A: The DNA fragment was preincubated in the absence (lane 1,2) or in the presence (lane 3,9) of nuclear proteins. Digestion was performed with 2.5ng (lane 1), 5ng (lanes 2) or 50 ng (lanes 3-9) of DNAsel for 1' (lane 1,2) or 3' (lanes 3-9) in the presence of 50ng pBR322 DNA. All reactions shown were fractionated on the same 6% sequencing gel. The following type and amount of nuclear extracts were added: lanes 3-6: FRTL-5 extract, 7, 12, 25 and 50 9g respectively. lane 7, 8, 9 : 50 g±g of nuclear proteins from BRL-3A2, FRT and FRA respectively. Panel B: An exonuclease Ill footprint experiment was carried out on the same fragment as in Panel A, preincubated without (lanes 1,2) or with FRTL-5 (lane 3), FRT (lane 4), FRA (lane 5) and BRL-3A2 (lane 6) nuclear extracts. transfected Tg promoter in these lines strongly suggests that the reduced expression of the endogenous Tg gene is not due to alteration(s) of the gene itself, but rather to a defect in transacting factor(s). The FRA cell line which expresses at very low level the Tg 8162 Nucleic Acids Research promoter but not the transfected one may be the one of choice to attempt the isolation of such factor(s) by selecting for the expression of the Tg promoter fused to a selectable marker (25). The DNA sequences responsible for the observed cell-type specific expression of the Tg promoter have been defined by deletion analysis and they extend from 5 nucleotides downstream to 167 nucleotides upstream from the transcription start site. This segment of DNA is able to reproduce the cell type specific expression of the gene and so must contain some signals conferring to it this property. On the other hand, one can expect that, as for many regulated promoter, also the Tg promoter may be a mosaic of regulatory (i.e. tissue specific) and constitutive signal. Because of the intrinsic limit of the analysis of promoter sequences by deletion, the only functional site that we could map is the one located between the end points of deletion 5'-17 and deletion 5'-13. In an attempt to identify the signal(s) important for tissue specific activation of the Tg promoter we searched for the differential distribution of proteins binding to the Tg promoter between the FRTL-5 and the control cell lines using two different nuclease protection assays. We have clearly detected, only in extracts of the FRTL-5 line and not in any of the control cell lines, an activity that protects the region from -61 to -73 (which we call the c region) from both Exonucleaselll and DNAsel digestion. Other factors also seem to recognize the Tg promoter but they are not as clearly and reproducibly detectable as the binding to the c region. A testable working hypothesis is that for transcription to initiate at the Tg promoter the binding of the factor recognizing the c region is an important requirement and the exclusive presence or the greater abundance of the factor in thyroid restricts the promoter activity to that tissue. A consequence of this hypothesis is that, at difference from other tissue specific promoters where signals for specific expression are present both in an enhancer type element and within the promoter itself (26-30), in the case of the Tg gene the promoter alone would be enough to specify thyroid specific expression. Support for the relevance of the c binding site is the positive correlation between active transcription of both the endogenous and the transfected gene and presence of the factor in nuclear extracts, as demonstrated in this paper. Additional evidence for the importance of the c binding activity for Tg gene transcription stems from the observation that in FRTL-5 8163 Nucleic Acids Research cells transformed by retroviruses, where the expression of the Tg promoter is practically abolished (31), the c binding activity disappears (Avvedimento et. al, submitted). Conclusive demonstration of the importance of the c binding activity should come from the characterization of promoter mutated in the c region. Preliminary evidences from one of these mutants suggest that our model is correct. A promoter mutant where the sequence of the c region has been changed to the sequence of the CCAAT box region of the chicken B-actin gene seems to be active in all cell types, even though it appears to retain some higher expression in the FRTL-5 line (Ghibelli, L., and R. D. L., unpublished observations). Inspection of the DNA sequence of the c region reveals the presence of two pentanucleotides (CCACT and CCAGT) closely related to the CCAAT sequence whose role in the transcriptional acytivity of several eukariotic promoters has been well documented (32-34). On the other hand the Tg promoter is not recognized by an activity found in NIH 3T3 cells that has been shown to interact with the CCAAT region of three eukariotic promoters (35) suggesting that is not the ubiquotous CCAAT binding protein which is recognizing the Tg promoter. Another interesting homology in the c region includes the sequence TGTTCT which is known to be part of the binding site for the glucocorticoid receptor (36). There is no evidence that the Tg gene is regulated by glucocorticoids but is still feasible that a member of the hormone receptor superfamily could be responsible for the observed footprint. Against the relevance of the observed homology is the absence of the TGTTC motif in the human thyroglobulin promoter (22). A role for a cell type specific DNA binding protein recognizing the -70 region of the promoter has been recently proposed also for the human (37) and rat growth hormone gene (38). Also in these promoters in the area recognized by the cell type specific factor there is a CCAAT related sequence. Differential binding of a factor recognizing the CCAAT box has also been invoked to explain the difference in expression of the a and D mouse globin promoters in several cell types (39). It is conceivable that the role of the -70 region in determining cell type specificity is not restricted to the Tg gene but it could have a general importance in the phenomenon of tissue specific transcription. 8164 Nucleic Acids Research We would like to thank G. Felsenfeld, B.M. Paterson, C. Queen, M. Singer and C. Wu for critical reading of the manuscript. We are grateful to C. Wu for suggesting the use of the ExollI footprinting method and for communicating protocols and results before publication and to H.G. Coon for providing cell lines and for many stimulating discussions. We also thank Gail Gray and Heide Seifert for editing the manuscript and Charlie Mock for expert assistance in the art work. The oligonucleotide used in the primer extension experiment was a generous gift of M. Brownstein. *To whom correspondence should be addressed at: European Molecular Biology Laboratory, Postfach 10.2209, 6900 Heidelberg, FRG REFERENCES 1. Banerji, J., Olson, L. and Schaffner, W. 1983. Cell 33: 729-740. 2. Chepelinsky, A.B., King, C.R., Zelenzka, P.S. and Piatigorsky, J. 1985. Proc. NatI Acad. Sci. USA 82:2334-2338. 3. Ciliberto, G., Dente, L. and Cortese, R. 1985. Cell 41: 531-540. 4. D'Onofrio, C., Colantuoni, V. and Cortese, R. 1985. EMBO J. 4:19811989. 5. Gillies, S.D., Morrison, S.L., Oi, V.T. and Tonegawa, S. 1983. Cell 33:717-728. 6. Ott, M.O., Sperling, L., Herbomel, P., Yaniv, M. and Weiss, M.C. 1984 EMBO J. 3: 2505-2510. 7. Walker, M.D., Edlund, T., Boulet, A.M. and Rutter, W.J. 1983. Nature 306: 557-561. 8. Queen, C. and Baltimore, D. 1983 Cell 33: 741-748. 9. Musti, A.M., Avvedimento, V.E., Polistina, C., Ursini, M.V., Obici, S., Nitsch, L., Cocozza, S. and Di Lauro, R. 1986 Proc. Natl. Acad. Sci. USA 83: 323-327. 10. Di Lauro, R., Obici, S., Acquaviva, A.M. and Alvino, C.G. 1982. Gene 19:117-1 25. 11. Avvedimento, V.E., Monticelli, A., Tramontano, D., Polistina, C., Nitsch, L. and Di Lauro, R. 1985. . Eur. J. Biochem. 149:467-472. 12. Avvedimento, V.E., Tramontano, D., Ursini, M.V., Monticelli, A. and Di Lauro, R. 1984. Biochem. Biophys. Res. Commun. 122: 472-477. 13. Nissley, S. P., Short, P. A., Rechler, M. M., Podskalny, J. M. and Coon, H. G. 1977. Cell. 11: 441-446. 14. Sompayrac, L.M. and Danna, K.J. 1981. Proc. Natl. Acad. Sci. USA 78: 7575-7578. 8165 Nucleic Acids Research 15. Gorman, C.M., Moffat, L.F. and Howard, B.H. 1982. Mol. Cell. Biol. 2:1044-1051. 16. Riccio, A., Grimaldi, G., Verde, P., Sebastio, G., Boast, S. and Blasi, F. 1985. Nucl. Acids Res. 13: 2759-2771. 17. Hattori, M. and Sakaki, Y. 1986. Analytical Biochem. 152: 232-238. 18. Chirgwin, J.M., Przybyla, A.E., MacDonald, R.J. and Rutter, W.J. 1979. Biochemistry 18: 5294-5299. 19. Alton, N.K. and Vapnek, D. 1979. Nature 282: 864-869.2 20. Maxam, A.M. and Gilbert, W. 1980. Methods Enzymol. 65: 499-560. 21. Wu, C. 1985. Nature 317: 84-87. 22. Cristophe, D., Cabrer, B., Bacolla, A., Targovnik, H., Pohl, V. and Vassart, G. 1985. Nucl. Acids Res. 113: 5127-5144. 23. Gorman, C. M., Merlino, G. T., Willingham, M. C., Pastan, 1. and Howard, B. H. 1982. Proc. Natl. Acad. Sci. U. S. A. 79, 6777-6781. 24. Galas, D. and Schmitz, A. 1978. Nucl. Acids Res. 5: 3157-3170. 25. Episkopou, V., Murphy, A.J.M. and Esfradiatis, A. 1984. Proc. Natl. Acad. Sci. 81: 4657-4661. 26. Edlund, T., Walker, M.D., Barr, P.J. and Rutter, W.J. 1985. Science 250: 912-916. 27. Foster, J., Stafford, J. and Queen, C. 1985. Nature 315: 423-425. 28. Gopal, T.V., Shimada, T., Baur, A.W. and Nienhuis, A.W. 1985. Science 229: 1102-1104. 29. Grosschedl, R., and Baltimore, D. 1985. Cell. 41: 885-897. 30. Mason, J.O., Williams, G.T. and Neuberger, M.S. 1985. Cell 41: 479487. 31. Fusco, A., Portella, G., Di Fiore, P. P., Berlingieri, M. T., Di Lauro, R., Schneider, A. B., and Vecchio, G. 1985. J. Virol. 56: 284-292. 32. Charnay, P.,Mellon, P., and Maniatis, T. 1985. Mol. Cell. Biol. 5: 1498-1151. 33. Graves, B., Johnson, P.F. and McKnight, S.L. 1986. Cell 44: 565-576. 34. Jones, K. A., Yamamoto, K. R., and Tjian, R. 1985. Cell. 42: 559-572. 35. Hatamochi, A., Paterson, B., and de Crombrugghe, B. 1986. J. Biol. Chem. 261: 11310-11314. 36. Scheidereit, c., Geisse, S., Westphal, H. M. & Beato, M. 1983. Nature. 304: 749-752. 37. Lefevre, C., Imagawa, M., Dana, S., Grindlay, J., Bodner, M., and Karin, Michael. 1987. EMBO J. 6: 971-981. 38. Ye, Z., and Samuels, H. H. 1987. J. Biol. Chem. 262: 6313-6317. 39. Cohen, R.B., Sheffery, M. and Kim, C.G. 1985. Molec. Cell. Biol. 6: 821 -832. 8166