Download of developmentally regulated genes are contained in relatively short

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts
no text concepts found
Transcript
Volume 15 Number 20 1987
Nucleic Acids Research
A cell type specific factor recogizes the rat thyrglobulin promoter
Anna Maria Mustil, Valeria Matilde Ursinil, Enrico Vittorio Avvedimentol, Vincenzo Zimarino2 and
Roberto Di Laurol,2*
'Centro di Endocrinologia ed Oncologia sperimentale del CNR, c/o II Facolta di Medicina, 80131
Napoli, Italy, 2Laboratory of Biochemistry of the National Cancer Institute, National Institutes of
Health, Bethesda, MD 20892, USA
Received August 20, 1987;Accepted September 25, 1987
ABSTRACT
We have fused a 900 base pair long DNA segment containing the
transcriptional start site of the rat thyroglobulin (Tg) gene to the
bacterial gene for chloramphenicol acetyltransferase (cat). The fusion
gene has been introduced into three different cell lines derived from
the rat thyroid gland and into a rat liver cell line. Expression of the
fusion gene was detected only in the one thyroid cell line that is able
to express the endogenous Tg gene. The minimum DNA sequence required
for the cell type specific expression was determined by deletion
analysis; it extends 170 nucleotides upstream of the transcription
initiation site. The Tg promoter contains a readily detectable binding
sites for a factor present in salt extracts of thyroid cell nuclei. This
binding site is not recognized by the nuclear extracts of any other cell
type that we have tested, suggesting that it may help mediate the cell
type specific expression of the Tg gene.
INTRODUCTION
One of the results of cell differentiation is the specific temporal and
spatial appearance of certain mRNAs. Recently it has been
demonstrated for a few genes that the tissue or cell type specific
expression can be reproduced in cell culture. In these systems it has
also been clearly shown that the signals for the transcriptional control
of developmentally regulated genes are contained in relatively short
DNA segments that are linked to the genes themselves, either 5' or 3' of
the transcription start site (1-8). Little is known about the
mechanisms of the transcriptional control: an attractive hypothesis
postulates that some transacting factor(s) interact with specific DNA
sequences to control transcription. The distribution of such factors
could already suggest a mechanism for their action: if a specific factor
is present exclusively in the tissue or cell type expressing a particular
© I R L Press Limited, Oxford, England.
8149
Nucleic Acids Research
gene, this factor is most likely a positive activator of transcription. If,
on the other hand, the factor(s) is only present in the cells where the
gene is not expressed, then it may be a candidate for a repressor type
molecule.
We have been interested in the thyroglobulin (Tg) gene as a model to
study the molecular mechanisms of differentiation. Tg, the
glycoprotein precursor for thyroid hormone biosynthesis (9 and
references therein), has been detected only in the follicular cells of the
thyroid gland. The Tg mRNA is not detectable in tissues or cell lines not
producing Tg (10) suggesting that transcriptional controls may be
involved in the tissue specific appearance of the protein. Several cell
lines derived from either normal thyroid tissue or from rat thyroid
tumors have been characterized and shown to display differential Tg
gene expression (11). In one of the cell lines derived from the normal
thyroid tissue (FRTL-5), the level of Tg mRNA is only four fold less
than in the rat thyroid gland. On the basis of the expression of the Tg
gene and of the presence of other thyroid specific markers such as
ability to concentrate iodine from the media and to respond to the
action of the Thyroid Stimulating Hormone (12), we consider this cell
line as an excellent model system to study the differentiated status of
the thyroid tissue. Another cell line, derived from a rat thyroid tumor
(FRA), does not present any thyroid specific function except the
appearance of low but detectable levels of Tg mRNA. A third cell line
(FRT), derived from normal thyroid glands and of epithelial morphology,
does not show any thyroid specific function and contains undetectable
levels of Tg mRNA. As an additional control of transcriptional
specificity, we have used the BRL-3A2 cell line, derived from rat liver
(13).
We have recently isolated the entire rat Tg gene and its flanking region
(9). This gene spans over 170,000 base pairs (bp) and represents one of
the largest eukaryotic transcription units isolated so far. The study of
Tg gene expression using the intact transcription unit is not possible
with present technology. On the other hand, the availability of the cell
lines described above, of techniques which allow the introduction of
DNA into eukaryotic cells (14) and of vectors designed to detect the
promoter activity of DNA fragments (15), prompted us to search for
sequences responsible for the tissue specific expression of the rat
thyroglobulin gene.
8150
Nucleic Acids Research
MATERIALS AND METHODS
Construction of Deletion Mutants
The mutants were generated by cleaving at a unique site into a master
plasmid (see below), trimming with Bal3l, repairing the ends with the
Klenow fragment of DNA polymerase I and ligating to the repaired end a
synthetic oligonucleotide containing the appropriate restriction site.
The modified promoter fragments were subsequently fractionated on an
agarose gel and reintroduced into appropriately cleaved p8-cat, a
pEMBL8 derived plasmid where the Hindlil-BamHl fragment from pSV2
cat, containing the cat structural gene and SV40 derived processing
signals, replaced the Hindlll-Clal fragment of pEMBL8 (16). The deletion
end points were determined by double stranded sequencing on minipreps
(17).
3' deletion mutants: the master plasmid pTgcat7 was cleaved at the
junction between the Tg promoter and the cat transcriptional unit by
HindlIl. After trimming, repair and ligation to an HindIll linker the
plasmid was cleaved by BamHl, which is located in the polylinker just
upstream of the promoter (Figure 1), and the resulting fragments
cloned into pUC18. After sequencing, the mutants indicated were
subcloned into p8-cat.
5' deletion mutants: the master plasmid for the first set of mutants
was 3'-4 which was cleaved at the unique BamHl site upstream of the
promoter. After trimming, repair and ligation to a BamHl linker the
plasmid was cleaved with HindlIl and the purified fragments cloned
into p8-cat. The deletions containing an S in their number were
generated as above but starting with plasmid 5'-41 and using a Sall
linker (8 base pairs long) to reintroduce them into p8-cat. A74 and A75
were generated starting with 5'-41 and trimming the plasmid
linearized at the unique BstEIl site (Figure 1). The trimmed plasmids
were recircularized in the presence of a Sall linker. A74 incorporated a
linker which appears to be incorrect. A75 did not incorporate the linker.
Measurement of Promoter Activity
Plasmid DNA was prepared from lysozime-Triton X1 00-cleared lysates
by two banding in cesium chloride-ethidium bromide equilibrium
gradients. cell lines were grown as described (11). DNA was introduced
into cell by the DEAE-Dextran procedure (14). After 48-60 hours the
cells were collected and the CAT activity assayed (15).
8151
Nucleic Acids Research
Primer Extension
Total RNA was extracted from transfected cells 60 hours after
transfection by the Guanidinium thiocyanate-CsCI method(18). 35 ug of
RNA were hybridized to a 5'-32p labelled synthetic oligonucleotide(5'GCCATTGGGATATATCAACGGTGG) complementary to nucleotides 26-49
of the coding sequence of the CAT mRNA(19). Hybridization and primer
elongation with reverse transcriptase were performed as described in
reference 7. The reaction products were fractionated on a 6%
sequencing gel(20).
Exonuclease III and DNAsel Footprinting
Nuclear proteins were extracted from the FRTL-5, FRA, FRT and BRL3A2 cell lines as described (21). Solid ammonium sulphate (0.2g/ml)
was then added to the nuclear extracts. The precipitated proteins were
dissolved in 25mM Hepes (pH7.9), 50 mM KCI, 0.1mM EDTA, 1mM DTT,
1mM PMSF, 10% Glycerol, dialyzed against 100 volumes of the same
buffer for 5 hours and stored in aliquots at - 800C. 20,ug of proteins
were used for each 50 RI binding assay. Exonuclease Ill footprinting
were performed as described (21) except that 200 ng of supercoiled
plasmid DNA was used as non specific competitor. Similar conditions
were used for DNAsel footprints, with the following modifications:100
ng of nonspecific competitor were used and MnCI2 (0.5 mM final
concentration) was added together with the enzyme. After digestion the
DNA was purified by phenol extraction, ethanol precipitated and
analyzed on a 6% sequencing gel (20). DNA sequencing reactions were
used as size markers.
RESULTS
Construction and Expression of Tg-cat Fusion Plasmids
We reported in a previous paper the isolation of a recombinant phage
(X63) containing the transcription start site for the rat Tg mRNA,
which was identified by primer extension (9). A 900 bp Pstl-Sacl
fragment, spanning the transcription start site was isolated from X63
and cloned into the plasmid p8-cat (16, Figure 11B) to obtain the
plasmid pTgcat7 in which the Tg promoter is inserted upstream of the
cat gene. The entire sequence of the Tg promoter fragment is shown in
Figure 3. The sequence shows some features common to many
8152
Nucleic Acids Research
A
100bp
i
(-827)
Pst 1
(-269)
BstElI
(+75)
Sacl(HindM)
TATA AUG
VV .....
B
Figure 1: Panel A shows the restriction fragment, derived from the
phage XrTg63 containing both the translational and the transcriptional
start site of the rat Tg gene. The Sacl end has been transformed to an
Hindlil end by blunt end ligation to a synthetic oligonucleotide
containing the HindlIl site, after repair with the Klenow fragment of
DNA polymerase I of E.ol . The modified fragment was introduced into
the plasmid p8-cat, cleaved with Pstl and Hindlil (panel B) to generate
the plasmid pTgCAT 7. The thin line represent plasmid DNA sequences,
the empty box the CAT transcriptional unit, derived from pSV2CAT and
the filled box the Tg promoter fragment. The BstEll site in the Tg
promoter fragment is a unique site in the plasmid and was subsequently
used to generate deletion mutants.
8153
Nucleic Acids Research
A
TATA AUG AUG
TgCAT 7...
-827
J 3-4-
.39
J 3- 21
i- --
.17
J3:-1
=CAT
i----CAT
.5
J 3- 91
-CAT
-31
CA
J3-81
-69
J 3- 7.
=CAT
-90
RELATIVE CAT ACTIVITY
FRA
BRL
FRT
FRTL-5
CONSTRUCT
pilg CAT 7
1(0.2)
13
21
27
A 3'- 4
A 3'- 2
A l. 1
A 31-9
A 3 -8
A 3' 7
V.0.
V.0.
VI0.
VI..
VIB.
VIB.
V.0.
3.0.
V0.
V.0.
V.0.
V.0.
V.0.
V.0.
JO0.
VI.0
VJ.D
V.0.
-
-
-
CAT ACTI VITY (% Couwrsiew)
FRA
FR?
FRTL -5
SRL
CONTROL PLASMID
14
2.6
RSV CAT
pSV 2 CAT
12
0.9
20
2.7
17
B
AUG
TATA
.30
-827
J5-321
J5-37
CAT
i
-
-
-
- - - - - - - - -
522
AT
- - - - - --
- 434
A5-40. _
- - - - - - - - - - - -
-
-369
J5-41
- - - - - - - - - - - - - - - - - - - - - -
=AT
A
- -T-
-284
i5-17SA
--- --- -- - - - - - - - - - - - - - - -- -- - -T-167
JS-13-1. -------------------------------- 6CAT
-
W51S,F - -- - - - - - - J
-
74SF
--- - - - - - - - - - -
J75S3, _-
__
-
- - - - - -
---
- - -
._- 237
CONSTRIUCT
8154
_
__--fC
A
aICT
-120
*- -179 -148
----- - -
-65
RELATIVE CAT ACTIVITY
FRTL *5
ML - FRT- FRA
A 3'- 4
A S- 32
A S.- 37
1(2.6)
AS'-40
1.7
2.4
A 5'- 41
A S'- 17S
AS'- 13S
AS' - ISS
A74 -S
A7S -S
160
__
1.6
1.6
2.4
0.05-0.1
U.0.
U.0.
U.O.
U.0.
U.0.
U.0.
U.0.
U.0.
U.0.
U.0.
U.0.
U.O.
U.0.
Nucleic Acids Research
eukaryotic promoters, such as TATAAA and a CAA sequence 27 and 70
bp upstream of the transcription initiation site, respectively. A rather
long purine rich stretch, located between position -294 and -400, is
also present in an analogous position in the human Tg promoter (22). In
addition, the inserted fragment contains the putative translational
start site for Tg biosynthesis.
In order to remove the Tg AUG, which is out of frame with the cat AUG
(data not shown), we deleted a few nucleotides using the enzyme Bal31
from the HindlIl site of the plasmid pTgcat7 (Figure 2). The 3' deletion
mutants were then isolated and recloned in p8-cat. They were tested
for cat expression in the Tg producing FRTL-5 cell line and in the other
three cell lines which contain either undetectable (BRL-3A2 and FRT)
or very low detectable levels of Tg mRNA (FRA). While we detected cat
activity in the extracts of transfected FRTL-5 cells, no cat enyzme
could be measured in the control cell lines( Figure 2; U. D.=
undetectable). Furthermore, a clear stimulatory effect was observed
when the Tg AUG is removed (deletions 1,2,4) suggesting that it is a
functional translation initiation site, interfering with proper
translation initiation at the downstream AUG. Deletions that extend
Figure 2: Deletion mutants of the Tg promoter. The upper part of the
figure shows the structure of the various deletion mutants.
A = 3' deletions: the starting plasmid(pTgCAT7) contains the promoter
fragment of the thyroglobulin gene indicated in Figure 1, extending
from -827 to + 76(+1 is the transcription initiation site). Deletions
extend from +76 onwards. The dashed line indicates the deleted DNA.
The number at the end of the dashed line indicates the deletion end
point.
B = 5' deletions: the starting plasmid contains as promoter fragment
the deletion 3'-4. Deletion extend from -827 downwards.Deleted DNA
and deletion end points are indicated as in panel A.
In the lower part of the figure we report the in vivo activity of the
deletion mutants, as deduced from the CAT activity measured in
extract of the cell lines transfected with each DNA. For each set of
mutants we have indicated the activities obtained as relative to the
starting, undeleted plasmid. The absolute activity of the undeleted
plasmid (as percentage of conversion of chloramphenicol to the
acetylated forms) is indicated in parenthesis. For the control plasmids,
used in all transfections with all cell lines to make sure that they
were all transfectable, we have indicated the absolute activities of a
sample transfection. U. D. = Undetectable; - = not done.
8155
Nucleic Acids Research
further upstream do not show any detectable cat activity, either
because they remove important transcriptional signals or because they
change the structure of the 5' end of the mRNA.
The absence of cat activity in the three cell lines unable to transcribe
their endogenous thyroglobulin gene (FRT, FRA, BRL-3A2) is not due to
poor transfection efficiency but rather to reduced capacity to promote
transcription from the transfected thyroglobulin promoter. All three
cell lines in fact do produce cat enzyme if transfected with plasmids
containing the cat transcriptional unit fused to either the Rous
Sarcoma Virus LTR (23) or to the SV40 early promoter (15) (Figure 2).
To determine the DNA region required for the observed cell-type
specific expression of the Tg promoter, we constructed the 5' deletion
mutants shown in Figure 2B. While a large region of DNA could be
deleted without significantly affecting the expression of the Tg
promoter, a significant decrease in promoter activity is observed in
deletion 5'-13. Note that deletion 5'-17, which is fully active, contains
only seven bases beyond the 5' end of 5'-13. This observation precisely
limits the 5' border of the essential region of the Tg promoter to
nucleotides 166-161 from the transcription initiation site. To further
confirm this observation, we constructed internal deletion mutants in
the plasmid 5'-41, taking advantage of the unique BstEll site present in
the Tg promoter (Figure 1). The plasmid 5'-41 was linearized with
BstEII, trimmed with Bal3l, recircularized and transformed into E.coi.
Of the resulting plasmids, two were selected for further study. A74 is
a 30 base pairs deletion extending from -179 to -148 in the Tg
promoter and shows no promoter activity. The result obtained with A74
rules out that the decrease in activity observed in the deletion 5'-13
results from the new plasmid-Tg promoter junction created by the
deletion. A75 deletes further down to 10 nucleotides upstream of the
CAA box and also shows no detectable promoter activity.
The in vivo transcription initiation site of the Tg gene has been mapped
five nucleotides upstream of the end point of deletion 3'-1 (9). In order
to test if in our constructs transcription was initiating at the same
nucleotide, we performed a primer extension experiment on the RNA
extracted from FRTL-5 cells transfected with the deletion 5'-41, which
demonstrated that the hybrid Tg-cat gene is still using the natural
initiation site of the Tg gene (Figure 4).
8156
Nucleic Acids Research
1 2 3 4 56
124120
~'
Figure 3: Primer extension. The primer used and the reaction conditions
are described in the Materials and Methods section. The RNA's were
extracted from FRTL-5 cells transfected with either RSV-cat (lane 1)
or TgCAT 5'-41 (lanes 2, 3, two independent experiments). In lanes 4, 5,
and 6 are shown the primer extensions obtained with RNA extracted
from BRL-3A2, FRT and FRA respectively, all transfected with TgCAT
5'-4 1.
A FRTL-5 specific factor binds to the Tg promoter
In order to detect sequence specific DNA binding proteins in nuclear
extract of the cell lines used in this study we used as DNA substrate
the BamHl-Hindlil insert of plasmid pTgcat-5'41 (Figure 2) labelled at
either the BamHl or the HindlIl end with polynucleotide kinase and y32P-ATP. The labelled fragments were then incubated with nuclear
extracts prepared from the four different cell lines and finally
digested with either Exonuclease Ill (Exolll)(21) or DNAsel (24). Exolll
is a double stranded specific exonuclease that digests DNA molecules
from a base paired 3' end toward the 5' end. The presence of a bound
protein should stop ExollI movement and it should be possible to detect
and map this stop if a 5' end labelled substrate is used and the reaction
products are visualized by autoradiography. This method has been used
to map the binding site of several prokariotic and eukaryotic DNA
binding proteins (see ref. 21 and references therein). Analysis of the
Exolll digestion pattern of the end labelled Tg promoter fragments
shows that the addition of nuclear extracts yields several Exolll
8157
Nucleic Acids Research
resistant DNA fragments that are barely visible or not detectable at all
in the absence of extract (see for example figure 5A, lanes 1-3 vs.
lanes 4-5). The appearance of new or of stronger bands upon addition of
extract could be due to a non-specific inhibition of the exonuclease
activity by the extract itself, a phenomenon that may just enhance
sequence specific pausing of the enzyme not related to the presence of
a sequence specific binding protein (data not shown). In order to
discriminate between specific stops and non specific, sequence
dependent, pausing of the enzyme we usually explored a range of
enzyme concentration in the digestions. In addition we decided to
interpret as specific only the blocks confirmed by Exolll protection on
the complementary DNA strand and that furthermore could be revealed
by an independent method, i.e. DNAsel footprinting (see below). Exolll
footprinting of the BamHl labelled promoter fragment shows an extract
induced, 230 nt long fragment (Figure 5, panel A, lanes 4, 5), which
conforms to the criteria of specificity stated above. In fact, Exolll
digestion of the HindlIl labelled fragment shows a fragment (115 nt
long), complementary to the one seen in the previously described
digest, which appears only in the presence of nuclear extracts (Figure
5, panel B, lanes 1, 2). The alignment of the Exolil stop on both strands
delineates a binding domains indicated as c and covering the promoter
regions -61 to -73 (Figure 3). The sequence requirements for the
binding to region c have been studied using deletion mutants (Figure 5,
panels C and D). The results of the binding experiments in deletion
mutants missing either the TATAA box or the upstream region of the
promoter show that the interaction at the c region is conserved in all
deletions tested, narrowing down the minimum region necessary for
binding to the sequences between -32 and -90 from the transcription
start site. Furthermore, this experiment rules out that the binding of
factors to the upstream region or to the TATAA box is an absolute
requirement for the binding of the c region factor. More detailed kinetic
experiments should demonstrate if there is any sort of cooperativity in
the binding of different factors to the Tg promoter.
Tissue Specificity of the Protection at the -70 Region
In order to determine whether a correlation exists between the
binding activity described above and an active
presence of the
transcription of the endogenous thyroglobulin gene we compared both
the DNAsel and Exolll footprints obtained in the presence of FRTL-5
8158
Nucleic Acids Research
-810
CTGCAGACAAGCAGGCATGCATGGCCACTGTCTTCTCAGCTTTGTGTGGAAGGAAGTGGG
-760
-710
CTCAGGAATAAGGATAATTTTCATAGATTATTCAGGGGCAGCTGGGAAGGAGAGAAGCTG
-660
ATCCTGATAGTGCAGGGGCATGTCGACCTTATGTGTAAAAGAATATTCTTGCCACTTCCT
-610
GCCCCTGGTAGCTTAGCGTGGCAGGGTTTAGTCCCCAGAAAAGGGGGGTTAGAGAGAGGT
-560
ACGCATATGTGCCATGTGTGTTCATGCATGTGAGAATAGGTATGTGAGGTATACTTGGAT
-510
TCCTTCCAGTACCAATTCTGTGTTCAATATTAATTGGAGCAGAATTTTCCAATTTGTTTC
-460
-410
CTGCCATGGCTTCATTTTCAAGAATAGTGTCTACAGCTGAATTGCTCTAAAGCAATACTG
-360
AAAGAAGGAAGGAAGGAAAGAAGAAAGGAAGGAATGAATGAAGCAAGGAAAAAAAGGAAA
-310
AGAAAGGGGAACGAAGGAAGGAAGAAGAGGGGGAGGAATCAGGAGGAAGAGGAGATATTT
-260
TATCTTTCACAGTTTTACAATCGAACTGTCACCCCTAAGGGTACAAAGCTCTGGCATTTG
-210
CCTGTAAAGGGAAATTTTAGTGCTAGCCTCACATTTCTTGTCCCCATGTCCTGGAGTGGT
-160
-110
CACCCTACTGATTACTCAACTATTCTTAGCGGGAGCAGACTCAAGTAGAGGGAGTTCC TG
-60
TGACTAGCAGAGAAAACAAAGTGAGCCACTGCCCACTCAACTCTTCTTGAACAGTAGAGC
-10
-
+10
ACTGCTTGCCACTGTGCEITX XGCTTCCTGATAAGGGGACTCAGATGGGACACTGCTC
+60
CTACCCCATCATTTGAGTAGGGGACAGG93MATGACCTTGGTCTTGTGGGTCTCGACTTT
TTTG
Figure 4: Sequence of the promoter region of the rat thyroglobulin gene.
The start of transcription (nucleotide +1) is indicated by an arrow. The
three repeats present between position -50 and -170 are written in
italics. Underlined and labelled c is the region recognized by FRTL-5
nuclear factor.
nuclear extract with those obtained with extracts from the cell lines
which do not transcribe either the endogenous Tg gene or the cat gene
fused to the Tg promoter. DNAsel footprints performed on the same
Hindlll-BamHl fragment described in Figure 4, panel E show that the
binding domain c is protected only by the FRTL-5 nuclear extract
(Figure 6A, lanes 3-6). Exolll footprints of the same DNA fragment
8159
Nucleic Acids Research
Figure 5: Exonuclease Ill footprints of the Tg promoter. Panel E shows
fragments used. 5'-41 is the source of the wild
type promoter. All the restriction sites present in identical position in
the deletion mutants are indicated only by a vertical line. The
continuous horizontal line represents Tg promoter sequence. The box
represents the cat transcriptional unit. The line with a filled circle
indicates the size and the position of the protected DNA fragment. The
filled circle indicates the site that was labelled with y-32p-ATP and
polynucleotide kinase
Panel A: The fragment used was the BamHl-Hindlll from 5'-41 labelled
at the BamHl site. The digestion was for 10' at 300C with 25 (lane 1),
50 (lane 2), 100 (lane 3), 200 (lane 4) or 400 units (lane 5) of
Exonuclease Ill in the absence.(lanes 1-3) or in the presence (lanes 4,5)
a scheme of the DNA
of FRTL-5 nuclear extracts.
Panel B: Same DNA fragment as in Panel A but labelled at the Hindll
end. Digestion was as above with 25 (lane 3), 50 (lane 4), 200 (lanel)
8160
Nucleic Acids Research
and 400 (lane 2) units of Exonuclease Ill in the absence (lanes 3,4) or in
the presence (lanes 1,2) of FRTL-5 nuclear extracts.
Panel C: The Hindlll-BamHl fragment, labelled at the Hindill end, from
5'-41 (lane 1), A75 (lane 2) or 5'-15 (lane 3) was incubated with FRTL5 nuclear extract and digested with 200 units of exonuclease Ill. The
same fragment of 115 nucleotides is protected in all three cases.
Panel D: the BstEll-Rsal fragment , labelled at the BstEll end, from
deletion 3'-9 (lanes 1-4) or from 5'-41 (lanes 5-8) was preincubated
without (lanes 1,2,5,6) or with (lanes 3,4,7,8) FRTL-5 nuclear extract
and subsequently digested with 25 (lanes 1,5), 50 (lanes 2,6), 200
(lanes 3,7) or 400 (lanes 4,8) units of exonuclease Ill. The same
fragment of 105 nucleotides is protected in both cases.
(Figure 6B) show again that the binding domain c is specifically
protected by the FRTL-5 nuclear extract. On the basis of the intensity
of the 115 long Exolll resistant band detected in Figure 5B, and of the
extract dilution experiment of fig. 5 , lane 3-6, we estimate that there
is about 5 to 10 fold more c-binding activity in the FRTL-5 cell line as
compared to the other extracts tested.
DISCUSSION
Transcription of the thyroglobulin gene is one of the differentiated
function of the thyroid gland. The availability of the cloned gene and of
rat thyroid cell lines makes the thyroid a convenient sytem to study the
biochemical basis of cell type specific gene transcription. We have
shown in this paper that a segment of DNA derived from the 5' end of
the Tg gene fused to the cat gene is able to reproduce in vitro the
tissue specific transcription observed in vivo. In fact, the only cell
type where the transfected Tg promoter is active is also the only one
where the endogenous gene is actively transcribed (FRTL-5). In order to
prove that the transcription of the transfected Tg promoter is tightly
related to the differentiated status of the thyroid tissue, we
transfected the Tg-cat constructs into another epithelial, non thyroid,
cell line (BRL-3A2). In addition we introduced the same construct into
two control cell lines derived from the same tissue, one not expressing
(FRT) and the other (FRA) expressing at very low level the endogenous
Tg gene. In the three control lines the transfected Tg promoter is
inactive while two viral promoter display comparable activity in all
the cell lines used in this study (Figure 2). The inactivity of the
8161
Nucleic Acids Research
A
B
12 3456 7 89
1 2 3 4 5 6
a.-000
.4
tw:::
115
103
Figure 6: cell type specificity of the binding domains. The DNA
fragment used throughout was the BamHl-Hindlll fragment of Figure 4
labelled at the Hindlil site.
Panel A: The DNA fragment was preincubated in the absence (lane 1,2)
or in the presence (lane 3,9) of nuclear proteins. Digestion was
performed with 2.5ng (lane 1), 5ng (lanes 2) or 50 ng (lanes 3-9) of
DNAsel for 1' (lane 1,2) or 3' (lanes 3-9) in the presence of 50ng
pBR322 DNA. All reactions shown were fractionated on the same 6%
sequencing gel. The following type and amount of nuclear extracts were
added: lanes 3-6: FRTL-5 extract, 7, 12, 25 and 50 9g respectively. lane
7, 8, 9 : 50 g±g of nuclear proteins from BRL-3A2, FRT and FRA
respectively.
Panel B: An exonuclease Ill footprint experiment was carried out on the
same fragment as in Panel A, preincubated without (lanes 1,2) or with
FRTL-5 (lane 3), FRT (lane 4), FRA (lane 5) and BRL-3A2 (lane 6) nuclear
extracts.
transfected Tg promoter in these lines strongly suggests that the
reduced expression of the endogenous Tg gene is not due to
alteration(s) of the gene itself, but rather to a defect in transacting
factor(s). The FRA cell line which expresses at very low level the Tg
8162
Nucleic Acids Research
promoter but not the transfected one may be the one of choice to
attempt the isolation of such factor(s) by selecting for the expression
of the Tg promoter fused to a selectable marker (25).
The DNA sequences responsible for the observed cell-type specific
expression of the Tg promoter have been defined by deletion analysis
and they extend from 5 nucleotides downstream to 167 nucleotides
upstream from the transcription start site. This segment of DNA is able
to reproduce the cell type specific expression of the gene and so must
contain some signals conferring to it this property. On the other hand,
one can expect that, as for many regulated promoter, also the Tg
promoter may be a mosaic of regulatory (i.e. tissue specific) and
constitutive signal. Because of the intrinsic limit of the analysis of
promoter sequences by deletion, the only functional site that we could
map is the one located between the end points of deletion 5'-17 and
deletion 5'-13. In an attempt to identify the signal(s) important for
tissue specific activation of the Tg promoter we searched for the
differential distribution of proteins binding to the Tg promoter
between the FRTL-5 and the control cell lines using two different
nuclease protection assays. We have clearly detected, only in extracts
of the FRTL-5 line and not in any of the control cell lines, an activity
that protects the region from -61 to -73 (which we call the c region)
from both Exonucleaselll and DNAsel digestion. Other factors also seem
to recognize the Tg promoter but they are not as clearly and
reproducibly detectable as the binding to the c region. A testable
working hypothesis is that for transcription to initiate at the Tg
promoter the binding of the factor recognizing the c region is an
important requirement and the exclusive presence or the greater
abundance of the factor in thyroid restricts the promoter activity to
that tissue. A consequence of this hypothesis is that, at difference
from other tissue specific promoters where signals for specific
expression are present both in an enhancer type element and within the
promoter itself (26-30), in the case of the Tg gene the promoter alone
would be enough to specify thyroid specific expression. Support for the
relevance of the c binding site is the positive correlation between
active transcription of both the endogenous and the transfected gene
and presence of the factor in nuclear extracts, as demonstrated in this
paper. Additional evidence for the importance of the c binding activity
for Tg gene transcription stems from the observation that in FRTL-5
8163
Nucleic Acids Research
cells transformed by retroviruses, where the expression of the Tg
promoter is practically abolished (31), the c binding activity
disappears (Avvedimento et. al, submitted). Conclusive demonstration
of the importance of the c binding activity should come from the
characterization of promoter mutated in the c region. Preliminary
evidences from one of these mutants suggest that our model is correct.
A promoter mutant where the sequence of the c region has been
changed to the sequence of the CCAAT box region of the chicken B-actin
gene seems to be active in all cell types, even though it appears to
retain some higher expression in the FRTL-5 line (Ghibelli, L., and R. D.
L., unpublished observations).
Inspection of the DNA sequence of the c region reveals the presence of
two pentanucleotides (CCACT and CCAGT) closely related to the CCAAT
sequence whose role in the transcriptional acytivity of several
eukariotic promoters has been well documented (32-34). On the other
hand the Tg promoter is not recognized by an activity found in NIH 3T3
cells that has been shown to interact with the CCAAT region of three
eukariotic promoters (35) suggesting that is not the ubiquotous CCAAT
binding protein which is recognizing the Tg promoter. Another
interesting homology in the c region includes the sequence TGTTCT
which is known to be part of the binding site for the glucocorticoid
receptor (36). There is no evidence that the Tg gene is regulated by
glucocorticoids but is still feasible that a member of the hormone
receptor superfamily could be responsible for the observed footprint.
Against the relevance of the observed homology is the absence of the
TGTTC motif in the human thyroglobulin promoter (22).
A role for a cell type specific DNA binding protein recognizing the -70
region of the promoter has been recently proposed also for the human
(37) and rat growth hormone gene (38). Also in these promoters in the
area recognized by the cell type specific factor there is a CCAAT
related sequence. Differential binding of a factor recognizing the
CCAAT box has also been invoked to explain the difference in
expression of the a and D mouse globin promoters in several cell types
(39). It is conceivable that the role of the -70 region in determining
cell type specificity is not restricted to the Tg gene but it could have a
general importance in the phenomenon of tissue specific transcription.
8164
Nucleic Acids Research
We would like to thank G. Felsenfeld, B.M. Paterson, C. Queen, M. Singer
and C. Wu for critical reading of the manuscript. We are grateful to C.
Wu for suggesting the use of the ExollI footprinting method and for
communicating protocols and results before publication and to H.G. Coon
for providing cell lines and for many stimulating discussions. We also
thank Gail Gray and Heide Seifert for editing the manuscript and Charlie
Mock for expert assistance in the art work. The oligonucleotide used in
the primer extension experiment was a generous gift of M. Brownstein.
*To whom correspondence should be addressed at: European Molecular Biology Laboratory, Postfach
10.2209, 6900 Heidelberg, FRG
REFERENCES
1. Banerji, J., Olson, L. and Schaffner, W. 1983. Cell 33: 729-740.
2. Chepelinsky, A.B., King, C.R., Zelenzka, P.S. and Piatigorsky, J. 1985.
Proc. NatI Acad. Sci. USA 82:2334-2338.
3. Ciliberto, G., Dente, L. and Cortese, R. 1985. Cell 41: 531-540.
4. D'Onofrio, C., Colantuoni, V. and Cortese, R. 1985. EMBO J. 4:19811989.
5. Gillies, S.D., Morrison, S.L., Oi, V.T. and Tonegawa, S. 1983. Cell
33:717-728.
6. Ott, M.O., Sperling, L., Herbomel, P., Yaniv, M. and Weiss, M.C. 1984
EMBO J. 3: 2505-2510.
7. Walker, M.D., Edlund, T., Boulet, A.M. and Rutter, W.J. 1983. Nature
306: 557-561.
8. Queen, C. and Baltimore, D. 1983 Cell 33: 741-748.
9. Musti, A.M., Avvedimento, V.E., Polistina, C., Ursini, M.V., Obici, S.,
Nitsch, L., Cocozza, S. and Di Lauro, R. 1986 Proc. Natl. Acad. Sci. USA
83: 323-327.
10. Di Lauro, R., Obici, S., Acquaviva, A.M. and Alvino, C.G. 1982. Gene
19:117-1 25.
11. Avvedimento, V.E., Monticelli, A., Tramontano, D., Polistina, C.,
Nitsch, L. and Di Lauro, R. 1985. . Eur. J. Biochem. 149:467-472.
12. Avvedimento, V.E., Tramontano, D., Ursini, M.V., Monticelli, A. and Di
Lauro, R. 1984. Biochem. Biophys. Res. Commun. 122: 472-477.
13. Nissley, S. P., Short, P. A., Rechler, M. M., Podskalny, J. M. and Coon,
H. G. 1977. Cell. 11: 441-446.
14. Sompayrac, L.M. and Danna, K.J. 1981. Proc. Natl. Acad. Sci. USA 78:
7575-7578.
8165
Nucleic Acids Research
15. Gorman, C.M., Moffat, L.F. and Howard, B.H. 1982. Mol. Cell. Biol.
2:1044-1051.
16. Riccio, A., Grimaldi, G., Verde, P., Sebastio, G., Boast, S. and Blasi, F.
1985. Nucl. Acids Res. 13: 2759-2771.
17. Hattori, M. and Sakaki, Y. 1986. Analytical Biochem. 152: 232-238.
18. Chirgwin, J.M., Przybyla, A.E., MacDonald, R.J. and Rutter, W.J. 1979.
Biochemistry 18: 5294-5299.
19. Alton, N.K. and Vapnek, D. 1979. Nature 282: 864-869.2
20. Maxam, A.M. and Gilbert, W. 1980. Methods Enzymol. 65: 499-560.
21. Wu, C. 1985. Nature 317: 84-87.
22. Cristophe, D., Cabrer, B., Bacolla, A., Targovnik, H., Pohl, V. and
Vassart, G. 1985. Nucl. Acids Res. 113: 5127-5144.
23. Gorman, C. M., Merlino, G. T., Willingham, M. C., Pastan, 1. and Howard,
B. H. 1982. Proc. Natl. Acad. Sci. U. S. A. 79, 6777-6781.
24. Galas, D. and Schmitz, A. 1978. Nucl. Acids Res. 5: 3157-3170.
25. Episkopou, V., Murphy, A.J.M. and Esfradiatis, A. 1984. Proc. Natl.
Acad. Sci. 81: 4657-4661.
26. Edlund, T., Walker, M.D., Barr, P.J. and Rutter, W.J. 1985. Science
250: 912-916.
27. Foster, J., Stafford, J. and Queen, C. 1985. Nature 315: 423-425.
28. Gopal, T.V., Shimada, T., Baur, A.W. and Nienhuis, A.W. 1985. Science
229: 1102-1104.
29. Grosschedl, R., and Baltimore, D. 1985. Cell. 41: 885-897.
30. Mason, J.O., Williams, G.T. and Neuberger, M.S. 1985. Cell 41: 479487.
31. Fusco, A., Portella, G., Di Fiore, P. P., Berlingieri, M. T., Di Lauro, R.,
Schneider, A. B., and Vecchio, G. 1985. J. Virol. 56: 284-292.
32. Charnay, P.,Mellon, P., and Maniatis, T. 1985. Mol. Cell. Biol. 5:
1498-1151.
33. Graves, B., Johnson, P.F. and McKnight, S.L. 1986. Cell 44: 565-576.
34. Jones, K. A., Yamamoto, K. R., and Tjian, R. 1985. Cell. 42: 559-572.
35. Hatamochi, A., Paterson, B., and de Crombrugghe, B. 1986. J. Biol.
Chem. 261: 11310-11314.
36. Scheidereit, c., Geisse, S., Westphal, H. M. & Beato, M. 1983. Nature.
304: 749-752.
37. Lefevre, C., Imagawa, M., Dana, S., Grindlay, J., Bodner, M., and Karin,
Michael. 1987. EMBO J. 6: 971-981.
38. Ye, Z., and Samuels, H. H. 1987. J. Biol. Chem. 262: 6313-6317.
39. Cohen, R.B., Sheffery, M. and Kim, C.G. 1985. Molec. Cell. Biol. 6:
821 -832.
8166