Download A maedi–visna virus strain K1514 receptor gene is located in sheep

Journal
of General Virology (2002), 83, 1759–1764. Printed in Great Britain
..........................................................................................................................................................................................................
SHORT COMMUNICATION
A maedi–visna virus strain K1514 receptor gene is located in
sheep chromosome 3p and the syntenic region of human
chromosome 2
Isidro Ho$ tzel and William P. Cheevers
Department of Veterinary Microbiology and Pathology, Washington State University, Pullman, WA 99164-7040, USA
The maedi–visna lentivirus (MVV) induces encephalitis, interstitial pneumonia, arthritis and mastitis in sheep. While some MVV strains can enter cells
of ruminant species only, others can enter cells
from many species, including human, but not Chinese hamster cells. However, the identity of the
receptor(s) used by MVV for entry is unknown. The
MVV-K1514 receptor gene was localized in sheep
and human chromosomes using hamsterisheep
and hamsterihuman hybrid cell lines. Based on
entry by a vector pseudotyped with the MVV-K1514
envelope, the MVV-K1514 receptor gene was
mapped to sheep chromosome 3p and to a region
of human chromosome 2 (2p25 q13), which has
conserved synteny with sheep chromosome 3p.
These regions do not include any known lentivirus
receptor or coreceptor gene, indicating that MVVK1514 uses a new lentivirus receptor to infect
human cells.
The ovine maedi–visna lentivirus (MVV) causes encephalitis, interstitial pneumonia, mastitis and arthritis in sheep
(Narayan et al., 1993). Although productive MVV replication
in vivo is restricted to cells of the monocyte\macrophage
lineage and dendritic cells, many cell types express MVV
receptors in vitro and possibly in vivo (Brodie et al., 1995 ;
Gendelman et al., 1985, 1986 ; Georgsson et al., 1989 ; Gorrell
et al., 1992 ; Ryan et al., 2000). MVV strains can be segregated
into two groups according to recognition of receptors from
different species : the Icelandic and British MVV strains K1514
and EV1 can enter cells from a wide range of species, including
human, but not Chinese hamster (Cricetulus griseus) cells, while
entry of North American MVV strains is restricted to cells
of ruminant species (Bruett & Clements, 2001 ; Ho$ tzel &
Cheevers, 2001 ; Lyall et al., 2000 ; MacIntyre et al., 1972).
However, the identity of the MVV receptor(s) is not known.
Author for correspondence : Isidro Ho$ tzel.
Fax j1 509 335 8529. e-mail ihe!vetmed.wsu.edu
0001-8317 # 2002 SGM
Here, we mapped the MVV-K1514 receptor gene in sheep and
human chromosomes to determine whether it is located in the
same chromosome region as any other lentivirus receptor or
coreceptor gene.
As ruminants and humans share extensive synteny (regions
of conserved physical association of genes in chromosomes)
(Band et al., 2000), we first mapped the MVV-K1514 receptor
gene in chromosomes of sheep, the natural host of MVVK1514, and then tested if any of the syntenic regions of the
human genome also encoded a receptor for MVV-K1514.
A hamsterisheep somatic cell hybrid panel was tested
for susceptibility to infection by the caprine arthritis–
encephalitis virus (CAEV) vector CAEVneo (Ho$ tzel &
Cheevers, 2001) pseudotyped with the MVV-K1514 envelope
[CAEVneo(K1514)], which induces resistance of infected cells
to the antibiotic G418. The hamsterisheep hybrid cell panel
used in this study was produced by fusing Chinese hamster
CHO cell auxotrophs with sheep lymphocytes (Burkin et al.,
1998). Cells were obtained from Dr James DeMartini (Colorado
State University, Fort Collins, CO, USA) and grown in Hamhs
F12 medium with 5 % foetal bovine serum (FBS) (growth
medium) for only one passage after receipt to minimize sheep
chromosome loss. The hybrid panel available included all
sheep chromosomes (OAR) except OAR-20, -23 and -26.
Pseudotyped CAEVneo was produced and titrated as described
previously (Ho$ tzel & Cheevers, 2001). Briefly, human 293T
cells in 60 mm plates (10' cells per plate) growing in Dulbeccohs
modified Eaglehs medium with 10 % FBS were cotransfected
with plasmids pCAEVneo10 and pCMV1514 or pMEVSV-G
(6 µg each) using the calcium phosphate procedure. Culture
medium was changed 18 h post-transfection and the supernatants containing pseudotyped virus were harvested 40 h
post-transfection. Hybrid cells in 6-well plates (2i10& cells
per well) were infected with 100 µl of clarified virus supernatant
in 1 ml of growth medium, trypsinized 24 h post-infection and
plated in 100 mm plates at 1 : 2 and 1 : 10 dilutions in growth
medium containing 1 mg\ml G418 (Gibco BRL). Colonies
were stained with crystal violet 8 days post-plating and
counted. As CHO-K1 cells are resistant to CAEVneo(K1514)
infection (Ho$ tzel & Cheevers, 2001), susceptibility of a hybrid
clone to CAEVneo(K1514) infection indicates the presence of
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 02:12:02
BHFJ
I. Ho$ tzel and W. P. Cheevers
BHGA
Table 1. Infectivity of CAEVneo(K1514) to hamsterisheep somatic cell hybrids
Sheep chromosomes retained by hybrid cell lines are as described by Burkin et al. (1998). Chromosomes marked as ‘ delh and ‘ qh have undefined deletions or retain only the long arm,
respectively. Chromosomes shown in parentheses are present in a small subpopulation of cells only. Titres of CAEVneo(VSV) and CAEVneo without envelope were 10% and
20 c.f.u.\ml, respectively, in all hamsterisheep cell lines tested. Representative results of at least two titration experiments are shown. Titres varied by less than twofold in all
titrations.
Cell line
GSM
Q576-15BX
QT131-2
QT131-13F
R612-3H9
R612-3H39
R711-16P2A
R891-27R1B
R891-29
R891-29R8A
R891-5A1
R894-3B1
R894-25G
R904-17J14R
R914-10
R928-19F
RN5966B17E
CAEVneo
(K1514)
(c.f.u./ml)
3n2i10%
40
20
20
2n4i10$
20
20
40
3n8i10$
20
20
20
20
20
20
20
20
Sheep chromosomes retained by hybrid cell lines
1
2
3
4
5
6
7
8
9
10
9
10
11
12
13
14
15
16
17
18
19
21
22
24
25
X
Y
q
1
q
6
3
(7)
7
3
del
22
2
13
13
13
14
18
14
21
12
5
4
13
9
6
24
X
15
del
10
11
8
16
16
17
Y
25
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 02:12:02
Maedi–visna virus receptor gene mapping
Table 2. Infectivity of CAEVneo(K1514) to hamsterihuman somatic cell hybrids
Cell lines with the prefix GM refer to the Coriell Cell Repository catalogue number. Chinese hamster cell lines
(prefixed CHO) were used for hybrid cell production. Human chromosomes retained in hybrid cell lines are
shown. Symbols and abbreviated terms are according to the International System for Cytogenetic
Nomenclature. HSA-2 segments are underlined. The titre of CAEVneo(K1514) in cell lines in one of at least
two representative experiments is also shown. Titres of CAEVneo(VSV) and CAEVneo without envelope
were 10% and 4 c.f.u.\ml, respectively, in all cell lines. Titres varied by less than twofold in different
titrations.
Cell line
HeLa-S3
GM10826
GM10611
GM12072
GM10888
GM12515
GM12510
Background
Chromosome
CAEVneo(K1514)
(c.f.u./ml)
CHO UV24-TG
CHO UV-135
CHO Gly A
RJK88
RJK88
RJK88
2
9
12
22
Xqter q22 : : 2p25 q13
t(X ;17)(q22 ;p11.2), 8, 18
2n9i10$
60
2
4
4
3n2i10$
2
a receptor gene in the sheep chromosome retained by the cell
clone.
All clones tested were susceptible to CAEVneo pseudotyped with the vesicular stomatitis virus (VSV) envelope (data
not shown), indicating a lack of post-entry blocks for CAEVneo
in hybrid cell lines. In addition, none of the cell lines tested was
susceptible to CAEVneo without the envelope (data not
shown). Clones R612-3H9 and R891-29 were susceptible to
CAEVneo(K1514), with titres about tenfold lower than the
titre of CAEVneo(K1514) in goat synovial membrane (GSM)
cells (Table 1). CAEVneo(K1514) titres in other clones were
low, similar to the background levels of infectivity of this
pseudotype in CHO-K1 cells (Ho$ tzel & Cheevers, 2001), or
below the level of detection. That the susceptibility of clones
R612-3H9 and R891-29 was conferred by sheep chromosomes
and not due to susceptibility of the parental auxotroph cell
lines was indicated by the inability of CAEVneo(K1514) to
infect clones R612-3H39, R891-5A1, R891-29R8A and R89127R1B, which were derived from the same parental auxotrophs
as susceptible clones R612-3H9 and R891-29 (Burkin et al.,
1998). The only chromosomes shared by susceptible hybrid
clones R612-3H9 and R891-29 are OAR-3 and -7 (Table 1).
However, clone R612-3H39 retaining OAR-7, but not OAR3, in the same background as susceptible cell line R612-3H9
was resistant to CAEVneo(K1514) infection (Table 1), indicating that the MVV-K1514 receptor gene is located in OAR-3.
This is supported by the fact that clone R612-3H9 is nearly as
permissive to CAEVneo(K1514) infection as clone R891-29,
despite having OAR-7 in only a minority of cells (Burkin et al.,
1998). In addition, clone Q576-15BX, retaining OAR-3q
(the long arm of OAR-3), was resistant to CAEVneo(K1514)
(Table 1), indicating that the MVV-K1514 receptor gene is
located in OAR-3p (the short arm of OAR-3).
Many markers are shared between OAR-3p and human
chromosomes (HSA)-2 and -9. This has been determined both
directly, by mapping markers in sheep chromosomes, and
indirectly, by mapping markers in bovine chromosome 11, the
bovine equivalent of OAR-3p (Band et al., 2000 ; Broad et al.,
1995 ; Lopez-Corrales et al., 1998, 1999). Hamsterihuman
hybrid cell lines retaining HSA-2 and -9, as well as HSA-12 and
-22, the human equivalents of OAR-3q (Band et al., 2000 ;
Broad et al., 1993), were obtained from Coriell Cell Repositories (Camden, NJ, USA) and tested for susceptibility to
CAEVneo(K1514). Again, all cell lines were susceptible to
CAEVneo(VSV), none of the cell lines had spontaneous G418resistant clones and none of the cell lines was infected by
CAEVneo without viral envelope glycoproteins (data not
shown). Of the four cell lines tested, only cell line GM10826,
retaining HSA-2, was permissive to CAEVneo(K1514) entry
(Table 2), indicating the presence of an MVV-K1514 receptor
gene in HSA-2.
To confirm the presence of an MVV-K1514 receptor gene
in HSA-2, we tested hybrid cell line GM12515, also from
Coriell, for susceptibility to CAEVneo(K1514). GM12515 is a
Chinese hamster RJK88ihuman hybrid cell line that retains
HSA-2p25 q13 fused to HSA-Xqter q22, selectively
maintained in medium containing azaserine and hypoxanthine.
The HSA-2 fragment retained by GM12515 contains most of
the HSA-2 regions of extensive synteny with OAR-3p
(Fig. 1). The GM12515 cell line was highly susceptible to
CAEVneo(K1514), with titres of at least 1n9i10$ c.f.u.\ml in
different experiments, similar or higher than titres of the same
CAEVneo(K1514) stocks in human HeLa-S3 cells (Table 2). In
contrast, control cell line GM12510, also a Chinese hamster
RJK88-derived hybrid cell line retaining HSA-Xqter q22
and other human chromosome fragments, but not HSA-2, was
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 02:12:02
BHGB
I. Ho$ tzel and W. P. Cheevers
Fig. 1. Ideogram of HSA-2 showing the regions retained in the MVVK1514-susceptible cell line GM12515 (thick line). The short and long
arms of HSA-2 are marked by ‘ ph and ‘ qh, respectively. The dotted line
indicates the region of HSA-2 of conserved synteny with OAR-3p.
resistant to CAEVneo(K1514), with titres below the level of
detection (Table 2). The failure of CAEVneo(K1514) to infect
two independent RJK88-derived cell lines, GM12510 and
GM10888 (Table 2), indicates that the parental RJK88 cell line
is not susceptible to CAEVneo(K1514) and that the susceptibility of GM12515 to CAEVneo(K1514) is induced by a
gene in HSA-2p25 q13.
Mapping of the MVV-K1514 receptor gene to regions of
the sheep and human genomes of conserved synteny, HSABHGC
2p25 q13 and OAR-3p, respectively, indicates that MVVK1514 probably uses the same receptor for entry in human and
sheep cells. MVV-K1514 receptor genes did not map to any
other sheep chromosomes, except perhaps OAR-20, -23 and
-26, as these were not present in the hybrid cells tested.
Therefore, although we cannot exclude the possibility that
MVV-K1514 receptor genes are present in other sheep
chromosomes but not expressed in the hybrid cell lines, it is
unlikely that additional MVV-K1514 receptor genes are
present in other human chromosomes not tested here, except
in those regions of human chromosomes corresponding to
OAR-20, -23 and -26.
Most human and simian immunodeficiency virus (HIV and
SIV, respectively) strains use a two-component receptor for
entry : CD4, as the main receptor, and a coreceptor that varies
between strains (Peden & Farber, 2000 ; Sommerfelt, 1999). All
HIV and SIV strains use the chemokine receptors CCR5 and\or
CXCR4 as coreceptors. However, many other coreceptors can
also be used by different HIV or SIV strains in vitro (Peden &
Farber, 2000). A screening of surface molecules as possible
receptor candidates for feline immunodeficiency virus (FIV)
demonstrated that FIV also uses CXCR4 as a receptor (Willett
et al., 1997a, b). Shared use of CXCR4 occurs even though little
sequence similarity is shared between FIV and HIV envelope
surface glycoproteins. This indicates that distantly related
lentiviruses can share receptor usage and suggests the
possibility that one of the HIV\SIV coreceptors could also
function as an MVV receptor. In this regard, a previous report
mapped the MVV-EV1 receptor gene to mouse chromosomes
(MMU)-2 and\or -4 and, by assuming a one-component
receptor, excluded some HIV and SIV coreceptors, such as
CXCR2, CXCR4, CCR1, CCR2, CCR4, CCR5, CCR8 and
RDC1, as the receptor used by MVV-EV1 to infect mouse cells
(Lyall et al., 2000). The MVV-K1514 receptor gene mapped
here may represent a one-component receptor, one component
of a two-component receptor with the other component
expressed by a hamster gene, or two genes in OAR-3p and
HSA-2p25 q13, respectively, forming a two-component
receptor. Also assuming a one-component receptor for MVVK1514, our results suggest that MVV-K1514 uses a novel
lentivirus receptor for entry in human cells, as none of the
known HIV\SIV coreceptors (including CCR1, CCR2B, CCR3,
CCR4, CCR5, CCR8, CCR9\D6, CX CR1, CXCR2, CXCR4,
$
CXCR5, CXCR6\Bonzo, CCBP2, GPR1, GPR15, RDC1, APj,
BLTR and CMKLR1\ChemR23) are encoded by genes mapping to the HSA-2p25 q13 region (Peden & Farber, 2000 ;
Sommerfelt, 1999 ; http :\\www.ncbi.nlm.nih.gov\LocusLink).
In addition to lentivirus receptors and coreceptors, the only
other known retrovirus receptor genes mapping to HSA-2p25
q13 are the baboon endogenous retrovirus auxiliary
receptor ASCT1, encoded by the SLC1A4 gene in the 2p15
p13 region, and the gibbon ape leukaemia virus receptor
Pit1\Glvr, encoded by the SLC20A1 gene in HSA-2q11
q14 (Marin et al., 2000 ; Sommerfelt, 1999 ; http :\\
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 02:12:02
Maedi–visna virus receptor gene mapping
www.ncbi.nlm.nih.gov\LocusLink). However, the GM12515
cell line susceptible to CAEVneo(K1514) does not retain the
human SLC20A1 gene, as determined by PCR using primers
specific for the first exon of the human (5h ATGGCAACGCTGATTACCAGTACTACAG 3h and 5h CGGCCATCAGCAGCCCTTGAGTCGA 3h) and hamster (5h GTGGCACCGATTACTAATACTCTAGCTA 3h and 5h CCAGCCATGAGCAAGTCTTGAGTTTC 3h) genes (data not
shown), excluding Pit1 as a possible MVV-K1514 receptor.
The possible role of ASCT1 or any other solute carrier
encoded by HSA-2 in MVV-K1514 entry remains to be
determined.
Three proteins, with apparent molecular masses of 45, 30
and 15 kDa, have been implicated in the binding of MVVK1514 to susceptible cells (Crane et al., 1991). Although the
identity of these proteins is unknown, some of their biochemical properties have been described. The 30 kDa protein
is a chondroitin sulfate proteoglycan, whereas the 45 kDa
protein has serine\threonine kinase activity (Barber et al.,
2000 ; Bruett et al., 2000). Scanning of the public human
genome sequence database (http :\\genome.ucsc.edu\) for
genes encoding surface proteins of known function, matching
both apparent molecular mass and biochemical properties of
these MVV-K1514 binding proteins, failed to indicate any
candidate receptors. Therefore, the relationship between the
receptor gene mapped here and these binding proteins remains
unknown.
Whether MVV-K1514 and EV1 use the same receptor is
not known. In addition, the location of the MVV-EV1 receptor
gene in sheep or human chromosomes is not known. However,
if these two strains use the same receptor, the number of
candidate receptors would be greatly decreased, as not many
genes are shared between HSA-2p25 q13 and MMU-2 or
MMU-4. It is possible, however, that different receptors are
used by MVV-K1514 and EV1. In fact, the hamsterisheep
hybrid cell lines R612-3H9 and R891-29 permissive to MVVK1514 entry, as well as other hybrid cell lines, were completely
resistant ( 20 c.f.u.\ml) to CAEVneo pseudotyped with the
envelope of the North American ruminant-tropic MVV strain
85\34. The failure of CAEVneo(85\34) to infect hamsteri
sheep hybrid cell lines could be due to the poor expression of
the MVV-85\34 receptor in the hybrid cell lines or the
requirement of more than one receptor component for infection
by this strain. In addition, an MVV-85\34 receptor could be
present in sheep chromosomes 20, 23 or 26, which were not
present in any of the available cell lines. In any case, this is
consistent with the differential host range of MVV-85\34 and
MVV-K1514 (Ho$ tzel & Cheevers, 2001) and with previous
results showing that North American MVV strains and MVVK1514 belong to two distinct interference groups in sheep cells
(unpublished data), indicating a differential receptor usage of
MVV-85\34 and MVV-K1514. Although the receptor used
by MVV-K1514 may be a consequence of the long passage
history of this strain and selection for neurovirulence
(Andresson et al., 1993), it is possible that other European
MVV strains with a wide host cell tropism and more closely
related to MVV-K1514 also use the MVV-K1514 receptor.
Mapping of the MVV-K1514 receptor gene in sheep and
human chromosomes should aid in the identification of MVV
strains that use the MVV-K1514 receptor and the identity of
this receptor.
We thank Dr James DeMartini (Colorado State University, Fort
Collins, CO, USA) and the Eleanor Roosevelt Research Institute (Denver,
CO, USA) for the hamsterisheep somatic cell hybrid panel. We also
thank Kathy Pretty On Top for technical assistance. This work was
supported by NIH grants RO1 AR 43718 and R21 AI 42690.
References
Andresson, O. S., Elser, J. E., Tobin, G. J., Greenwood, J. D., Gonda,
M. A., Georgsson, G., Andre! sdo! ttir, V., Benediktsdo! ttir, E., Carlsdo! ttir,
H. M., Ma$ ntyla$ , E. O., Rafnar, B., Pa! lsson, P. A., Casey, J. W. & Pe! tursson, G. (1993). Nucleotide sequence and biological properties of a
pathogenic proviral molecular clone of neurovirulent visna virus. Virology
193, 89–105.
Band, M. R., Larson, J. H., Rebeiz, M., Green, C. A., Heyen, D. W.,
Donovan, J., Windish, R., Steining, C., Mahyuddin, P., Womack, J. E. &
Lewin, H. A. (2000). An ordered comparative map of the cattle and
human genomes. Genome Research 10, 1359–1368.
Barber, S. A., Bruett, L. & Clements, J. E. (2000). Involvement of a
membrane-associated serine\threonine kinase complex in cellular binding
of visna virus. Virology 274, 321–330.
Broad, T. E., Burkin, D. J., Jones, C., Lewis, P. E., Ansari, H. A. &
Pearce, P. D. (1993). Mapping of MYF5, C1R, MYHL, TPI1, IAPP,
A2MR and RNR onto sheep chromosome 3q. Animal Genetics 24,
415–419.
Broad, T. E., Burkin, D. J., Cambridge, L. M., Jones, C., Lewis, P. E.,
Morse, H. G., Geyer, D., Pearce, P. D., Ansari, H. A. & Maher, D. W.
(1995). Six loci mapped on to human chromosome 2p are assigned to
sheep chromosome 3p. Animal Genetics 26, 85–90.
Brodie, S. J., Pearson, L. D., Zink, M. C., Bickle, H. M., Anderson, B. C.,
Marcom, K. A. & DeMartini, J. C. (1995). Ovine lentivirus expression
and disease. Virus replication, but not entry, is restricted to macrophages
of specific tissues. American Journal of Pathology 146, 250–263.
Bruett, L. & Clements, J. E. (2001). Functional murine leukemia virus
vectors pseudotyped with the visna envelope show expanded visna virus
cell tropism. Journal of Virology 75, 11464–11473.
Bruett, L., Barber, S. A. & Clements, J. E. (2000). Characterization of a
membrane-associated protein implicated in visna virus binding and
infection. Virology 271, 132–141.
Burkin, D. J., Broad, T. E., Lambeth, M. R., Burkin, H. R. & Jones, C.
(1998). New gene assignments using a complete, characterized sheep–
hamster somatic cell hybrid panel. Animal Genetics 29, 48–54.
Crane, S. E., Buzy, J. & Clements, J. E. (1991). Identification of cell
membrane proteins that bind visna virus. Journal of Virology 65,
6137–6143.
Gendelman, H. E., Narayan, O., Molineaux, S., Clements, J. E. &
Ghotbi, Z. (1985). Slow, persistent replication of lentiviruses : role of
tissue macrophages precursors in bone marrow. Proceedings of the National
Academy of Sciences, USA 82, 7086–7090.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 02:12:02
BHGD
I. Ho$ tzel and W. P. Cheevers
Gendelman, H. E., Narayan, O., Kennedy-Stoskopf, S., Kennedy,
P. G. E., Ghotbi, Z., Clements, J. E., Stanley, J. & Pezeshkpour, G.
(1986). Tropism of sheep lentiviruses for monocytes : susceptibility to
infection and virus gene expression increase during maturation of
monocytes to macrophages. Journal of Virology 58, 67–74.
Georgsson, G., Houwers, D. J., Pa! lsson, P. A. & Pe! tursson, G. (1989).
Expression of viral antigens in the central nervous system of visnainfected sheep : an immunohistochemical study on experimental visna
induced by virus strains of increased neurovirulence. Acta Neuropathologica 77, 299–306.
Gorrell, M. D., Brandon, M. R., Sheffer, D., Adams, R. J. & Narayan, O.
(1992). Ovine lentivirus is macrophagetropic and does not replicate
productively in T lymphocytes. Journal of Virology 66, 2679–2688.
Ho$ tzel, I. & Cheevers, W. P. (2001). Host range of small-ruminant
lentivirus cytopathic variants determined with a selectable caprine
arthritis–encephalitis virus pseudotype system. Journal of Virology 75,
7384–7391.
Lopez-Corrales, N. L., Sonstegard, T. S. & Smith, T. P. (1998).
Comparative gene mapping : cytogenetic localization of PROC, EN1,
ALPI, TNP1, and IL1B in cattle and sheep reveals a conserved
rearrangement relative to the human genome. Cytogenetics and Cell
Genetics 83, 35–38.
Lopez-Corrales, N. L., Sonstegard, T. S. & Smith, T. P. (1999). Physical
mapping of the bovine, caprine and ovine homologues of the paired box
gene PAX8. Cytogenetics and Cell Genetics 84, 179–181.
Lyall, J. W., Solansky, N. & Tiley, L. S. (2000). Restricted species
tropism of maedi–visna virus strain EV-1 is not due to limited receptor
distribution. Journal of General Virology 81, 2919–2927.
BHGE
MacIntyre, E. H., Wintersgill, C. J. & Thormar, H. (1972). Morpho-
logical transformation of human astrocytes by visna virus with complete
virus production. Nature New Biology 237, 111–113.
Marin, M., Tailor, C. S., Nouri, A. & Kabat, D. (2000). Sodiumdependent neutral amino acid transporter type 1 is an auxiliary receptor
for baboon endogenous retrovirus. Journal of Virology 74, 8085–8093.
Narayan, O., Zink, M., Gorrell, M., Crane, S., Huso, D., Jolly, P.,
Saltarelli, M., Adams, R. & Clements, J. (1993). The lentiviruses of
sheep and goats. In The Retroviridae. pp. 229–256. Edited by J. A. Levy.
New York : Plenum.
Peden, K. W. C. & Farber, J. M. (2000). Coreceptors for human
immunodeficiency virus and simian immunodeficiency virus. Advances in
Pharmacology 48, 409–478.
Ryan, S., Tiley, L., McConnell, I. & Blacklaws, B. (2000). Infection of
dendritic cells by the maedi–visna lentivirus. Journal of Virology 74,
10096–10103.
Sommerfelt, M. A. (1999). Retrovirus receptors. Journal of General
Virology 80, 3049–3064.
Willett, B. J., Hosie, M. J., Neil, J. C., Turner, J. D. & Hoxie, J. A.
(1997a). Common mechanism of infection by lentiviruses. Nature 385,
587.
Willett, B. J., Picard, L., Hosie, M. J., Turner, J. D., Adema, K. &
Clapham, P. R. (1997b). Shared usage of the chemokine receptor
CXCR4 by the feline and human immunodeficiency viruses. Journal of
Virology 71, 6407–6415.
Received 4 January 2002 ; Accepted 18 March 2002
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 02:12:02