Download Instructions for contributions - Abstract

The Impact of Inhaled Formaldehyde Exposure on Bone Marrow Cells of
Balb/c Mice
Xin Ye, Juan Du, Hui-hui You, Jing-yun Zhao, Xu Yang*
Hubei Key Laboratory of Genetic Regulation and Integrative Biology
College of Life Science, Huazhong Normal University, Hubei, China
*
Corresponding email: [email protected]
Keywords: ROS; DPC; GSH; TGF- ; GM-CSFs.
1 Introduction
Formaldehyde (FA) is a very common air
pollutant in the environment, FA is also
naturally occurring in mammalian cells
(Conaway CC et al.1996). In the year 2002, FA
was
proved to induce genotoxicity,
immunological effects and respiratory irritancy
in human (WHO 2002), and in the year 2004,
WHO confirmed that FA can lead to
nasopharyngeal carcinoma and it is human
carcinogens (A1 group) duo to its DNA-protein
crosslink (DPC) and cell proliferation effect
(WHO 2004). This is a great progress for the
risk assessment of FA.
Now the mechanism which is very important
for reveal the FA’s damage are not clear ,though
we already can find FA’s toxicity in
mammalian.
So far the toxicity on bone marrow cells
induced by inhaled FA is not clear too, therefor
we investigated the relationship between inhaled
FA and bone marrow toxicity in mice in our
Lab.
2 Materials/Methods
A. Equipment
The primer were obtained from corporation of
Genscript, Taq DNA polymerase and dNTPs
were obtained from corporation of Sai
Baisheng.Other chemicals used in this study
were also of analytical grade. Glassware was
meticulously cleaned to reduce any background
contamination of phthalates.
B. Reagents
10% formalin solution; DCFH-DA and
hoechst 33258 obtained from Sigma
C. Materials
SPF level purely Balb/c male mice (Hubei
Medical Laboratory Animal Center), age: 5
weeks, weight: 24-26g.
D. Method
1) Inhaled FA exposured (0, 0.5, 1.0, 3.0 mg/m3)
were used for treating Balb/c mice (8 male mice
/group) in the conditions (8h/d, 7day), and the 0
FA exposured signd as the blank control (CK)
group.
2) A protection group with the i.g treatment of
glutathion(GSH) of 10mg/kg/day after FA
exposure (3.0 mg/m3).
3) Then the reactive oxygen species (ROS) and
DNA-protein crosslinking (DPC) were detected.
4) RT-PCR reaction test was also used for
indicating expression of transforming growth
factor (TGF- ) and colony stimulating factor
(GM-CSFs) in bone marrow cells.
The ROS production was monitored by a
fluorescence multiwell plate reader using the
oxidation-sensitive dye of DCFH-DA(Hsin et
al.,2008). The KCL-SDS assay was used test the
DNA–proteincrosslinks,the test used fluorescent
dye of Hoechst 33258 (Chakrabarti et al., 1999)
Use RT-PCR amplification was performed
using the primer for TGF-β:
forward: 5_‘GGACTCTCCACCTGCAAGAC’-3;
reverse: 5-‘GACTGGCGAGCCTTAGTTTG’-3)
And the primer for GM-CSFs:
forward: 5_’CATCAAAGAAGCCCTGAACC’-3;
reverse: 5 ‘CCGTAGACCCTGCTCGAATA’-3
3 Results and Discussion
The results show that: (1) ROS and DPC had
increase along with the inhaled FA increasing
form low to high concentration. In the
concentration 1.0mg we can find ROS and DPC
incresaed,then in the concentration 3.0mg both
ROS and DPC had significantly increase
(p<0.01). (2) In protection group with GSH, the
biomarkers of ROS and DPC had the same
tendency with blank control,and they also have a
sharply decline compared with the 3.0mg FA
exposured group. (3) Compared the CK group,
the RT-PCR show the gene TGF- and GMCSFs also had a additional expression in marrow
cells in the concentration 3.0mg FA exposured
group of the same exposured condition group;
the 0.5mg, 1.0mg and GSH protection FA
exposured group have no significant change
(Figure 1,2) .
differentiation of the hematopoietic stem cell
which linked leukemia development (Buske C,
et al.,1997). GM-CSF is a hemopoietic growth
factor which can impact acute leukemia
(Matsuguchi T, etal.,1998). So we deduce that
inhaled FA may increase the risk of leukemia by
marking over expression of T GFCSF genes.
and GM-
5 References
Figure 1: TheTGF- gene expression.
Figure 2: The GM-CSFs gene expression.
4 Conclusions
For the results we conclude: in a short-term
acute infected (1) FA can cause the oxidative
damage of marrow cells. (2) GSH can inhibit
FA-induced oxdative damage in vivo. (3) The
high concentration FA exposured can impact
the TGF-β and GM-CSFs gene’s expression.
The increase ROS in body will cause the
DNA damage, gene mutations, in serious even
lead to cancer and cancer production
(Dunyaporn, et al., 2009). TGF-β play a
importantrole in the proliferation and
Buske C., Beeker D., Feuring-Buske M. et a1.
TGF- 1 inhibits growth and induces
apoptosis in leukemie B cell precursors [J].
Leukemia. 1997, 1 1(3):86-392.
Conaway CC., Whysner J., Lynne K., et al,1996.
Formaldehyde mechanistic data and risk
assessment: endogenous protection from
DNA adducts formation. Pharmacol. Ther,
71:29~55.
Chakrabarti SK,BaiCJ,SubramanianKS.DNA–
protein crosslinks induced by nickel
compounds in isolated ratrenal cortical cells
and its antagonism by specific amino
acidsand
magnesiumion. Toxicol Appl
Phamacol. 1999; 154:245–55.
Dunyaporn Trachootham, Jerome Alexandre &
Peng Huang, Targeting cancer cells by
ROS-mediated mechanisms: a radical
therapeutic approach?Nature Reviews Drug
Discovery 8, 579-591 (July 2009) doi:
10.1038/nrd2803.
HsinYH,ChenCF,HuangS,ShiTS,LaiPS,ChuehP
J.The apoptotic effect of nano silver is
mediated by a ROS-and JNK-dependent
mechanism involving the mitochondrial
pathway in NIH3T3 cells. Toxicol Lett.
2008; 179:130–9.
Matsuguchi T,Lilly MB,Kraft AS.Cytoplasmic
domains of the human GM-CSF receptor c
responsible for human GM-CSF induced
myeloid cell differentiation[J].J Biol Chem,
1998, 273(31):19411-194118.
WHO,
2002.
Formaldehyde,
Concise
International
Chemical
Assessment
Document 40, World Health Organization,
Geneva
WHO, International Agency for Research on
Cancer
(2004).
IARC
Classified
formaldehyde as carcinogenic to humans.