Download PfPI3K, a phosphatidylinositol-3 kinase from

From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
RED CELLS, IRON, AND ERYTHROPOIESIS
PfPI3K, a phosphatidylinositol-3 kinase from Plasmodium falciparum, is exported
to the host erythrocyte and is involved in hemoglobin trafficking
*Ankush Vaid,1 *Ravikant Ranjan,1 Wynand A. Smythe,2 Heinrich C. Hoppe,3 and Pushkar Sharma1
1Eukaryotic
Gene Expression Laboratory, National Institute of Immunology, New Delhi, India; 2Division of Pharmacology, Department of Medicine, University of
Cape Town Medical School, Cape Town, South Africa; and 3CSIR Biosciences, Pretoria, South Africa
Polyphosphorylated phosphoinositides
(PIPs) are potent second messengers,
which trigger a wide variety of signaling
and trafficking events in most eukaryotic
cells. However, the role and metabolism of
PIPs in malaria parasite Plasmodium have
remained largely unexplored. Our present
studies suggest that PfPI3K, a novel phosphatidylinositol-3-kinase (PI3K) in Plasmodium falciparum, is exported to the
host erythrocyte by the parasite in an
active form. PfPI3K is a versatile enzyme
as it can generate various 3ⴕ-phosphorylated PIPs. In the parasite, PfPI3K was
localized in vesicular compartments near
the membrane and in its food vacuole.
PI3K inhibitors wortmannin and LY294002
were effective against PfPI3K and were
used to study PfPI3K function. We found
that PfPI3K is involved in endocytosis
from the host and trafficking of hemoglobin in the parasite. The inhibition of PfPI3K
resulted in entrapment of hemoglobin in
vesicles in the parasite cytoplasm, which
prevented its transport to the food vacuole, the site of hemoglobin catabolism. As
a result, hemoglobin digestion, which is a
source of amino acids necessary for parasite growth, was attenuated and caused
the inhibition of parasite growth. (Blood.
2010;115:2500-2507)
Introduction
Plasmodium falciparum, a protozoan parasite, is the major causative agent of human malaria. The lack of a successful vaccine and
widespread drug resistance contribute heavily toward the failure in
eradication of this disease. A thorough understanding of molecular
mechanisms that regulate the life cycle of P falciparum may
provide information useful for designing novel strategies to control
malaria. Malarial parasites can propagate either asexually or
undergo sexual differentiation. It is the asexual development in the
erythrocytic phase of the life cycle that causes pathology of severe
malaria. Subsequent to erythrocyte invasion by merozoites, parasites first adopt a ring-like morphology and develop into trophozoites, which give rise to schizonts that contain several merozoites.
During the trophozoite stage, the parasite endocytoses large
quantities of the erythrocyte cytosol and digests its main constituent, hemoglobin.1 The endocytosis of erythrocyte cargo occurs via
cytostome invaginations and transport vesicles, which mediate the
delivery of the material to the food vacuole, where hemoglobin is
degraded by a battery of proteases and the residual heme is
converted to hemozoin.2
Phosphoinositides are important for regulating signaling and
trafficking events in most eukaryotic cells. These phospholipids are
generated as a result of phosphorylation of 3⬘, 4⬘, or 5⬘ hydroxyls of
phosphatidylinositol head group by specific phosphatidylinositol
(PI) kinases.3 Phosphatidylinositol-3-kinases (PI3K) are most well
characterized and catalyze the phosphorylation of phosphatidylinositol,
phosphatidylinositol-4 phosphate (PI4P), phosphatidylinositol-4,5
bisphosphate [PI(4,5)P2] at 3⬘ position of the inositol ring to generate
phosphatidylinositol-3 phosphate (PI3P), phosphatidylinositol-3,4
bisphosphate [PI(3,4)P2], and phosphatidylinositol-3,4,5 triphosphate
[PI(3,4,5)P3].3,4 In contrast to class I PI3Ks, which generate PI(3,4)P2
and PI(3,4,5)P3, class III PI3Ks are known to specifically phosphorylate
PI, resulting in the formation of PI3P.3 PI3P is present on vacuolar and
endosomal membranes in yeast and on membranes of early endosomes
and internal vesicles of multivesicular bodies in mammalian cells.5 PI3P
interacts with FYVE or PX domains of proteins and recruits them to
these intracellular locations and controls membrane and vesicular
trafficking.6
Given the importance of PIPs in most eukaryotes, it is probable
that these second messengers may also perform important functions in malaria parasite. However, the metabolism and the role of
PIPs in malaria parasite are not well understood. Recently, a PI4P5
kinase was reported in Plasmodium, which is regulated by ARF7
and catalyzes the formation of PI(4,5)P2. We have identified a
FYVE domain protein (FCP), which is a probable downstream
target of PfPI3K as it interacts with PI3P. Studies performed on this
protein resulted in identification of a novel food vacuole trafficking
pathway in the parasite.8 In the present study, we report the
identification of a PI3K ortholog from P falciparum, PfPI3K. This
enzyme is versatile as it catalyzes the formation of PI3P, PI(3,4)P2,
and PI(3,4,5)P3 from their respective precursors. PfPI3K is present
in the food vacuole and in vesicular compartments at the parasite
membrane (PM)/parasitophorous vacuole membrane (PVM). Surprisingly, PfPI3K is exported to the host erythrocyte by the parasite
and is located at its periphery. PI3K inhibitors wortmannin and
LY294002 inhibited PfPI3K activity. Using these inhibitors, we
demonstrate that PfPI3K may play a key role in hemoglobin
endocytosis and its trafficking in the parasite and its activity may be
important for parasite development.
Submitted August 17, 2009; accepted December 22, 2009. Prepublished
online as Blood First Edition paper, January 21, 2010; DOI 10.1182/blood2009-08-238972.
The online version of this article contains a data supplement.
*A.V. and R.R. contributed equally to this study.
© 2010 by The American Society of Hematology
2500
The publication costs of this article were defrayed in part by page charge
payment. Therefore, and solely to indicate this fact, this article is hereby
marked ‘‘advertisement’’ in accordance with 18 USC section 1734.
BLOOD, 25 MARCH 2010 䡠 VOLUME 115, NUMBER 12
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
BLOOD, 25 MARCH 2010 䡠 VOLUME 115, NUMBER 12
Methods
Most fine chemicals were purchased from Sigma-Aldrich. Wortmannin and
LY294002 were purchased from Calbiochem or BIOMOL Research
Laboratories. These inhibitors were dissolved in dimethyl sulfoxide (DMSO)
to yield a concentration of 1 to 3 mg/mL, and serial dilutions were made in
culture media or water before use. Anti-actin antibody was purchased from
Calbiochem. The amino acid-deficient RPMI 1640 was custom made by
HyClone. All studies were performed with the approval of the Institute’s
Animal Ethics Committee and Human Ethics Committee.
P falciparum cultures
P falciparum strain 3D7 was cultured at 37°C in RPMI 1640 medium using
either AB⫹ human serum or 5% Albumax II (Invitrogen) as previously
described.9 Cultures were gassed with 5% CO2/3% O2/92% N2. Synchronization of parasites in culture was achieved by sorbitol treatment.10
Parasite growth inhibition assays
PfPI3K IN HOST RBCs AND MALARIA PARASITE
2501
Immunofluorescence assays (IFAs) were performed on thin blood
smears as previously described.8 Briefly, samples were fixed with methanol
for 10 minutes and permeabilized with 0.05% Triton X-100 for 5 minutes.
After blocking with either 3% bovine serum albumin or 2% gelatin
(prepared in phosphate-buffered saline), smears were incubated with
primary antibodies/antisera for 16 hours at 4°C. Control experiments were
performed using preimmune bleeds or using uninfected eythrocyte lysates.
After washing with phosphate-buffered saline, incubations with anti–mouse
or anti–rabbit IgG conjugated to either fluorescein isothiocyanate or Texas
red were performed. 4,6-Diamidino-2-phenylindole was used for nuclear
localization. Immunofluorescence localization of hemoglobin in saponintreated, aldehyde-fixed, and Triton X-100–permeabilized parasites was
carried out as described previously.13,14 The procedure followed for electron
microscopy is described in supplemental data.
Microscopy
For experiments reported in Figure 2Ai through B, cells were visualized
using a Zeiss LSM510 confocal microscope system equipped with a
63⫻/1.4 oil immersion objective. For Figure 2Aii, a Zeiss AxioImager
fluorescence microscope with a 100⫻/1.4 oil-immersion objective was
used. A Zeiss AxioCam MRm camera and Zeiss AxioVision software were
used to acquire images. For Figure 4A, a Nikon Eclipse E600W with Y-FL
epifluorescence attachment with 100⫻/1.30 NA oil objective was used. A
Media Cybernetics CoolSNAP-Pro monochrome-cooled charge-coupled
device camera and Media Cybernetics CoolSNAP-Pro cf digital kit version
4.1 were used for image acquisition. All images were finally processed
using Adobe Photoshop and Microsoft PowerPoint software.
Synchronized parasites were cultured in amino acid-free RPMI 1640
supplemented with isoleucine (Ile media) for 96 hours. Subsequently,
parasite cultures were diluted with either Ile medium or complete RPMI 1640
medium to approximately 1% parasitemia in 6-well (35-mm) culture plates.
Six hours after plating, when parasites were in late ring/early trophozoite
stage (corresponding to ⬃ 12 hours after invasion), pepstatin A (30␮M) or
desired concentration of wortmannin or LY294002 was added to the
cultures, whereas parasites were treated with DMSO/MeOH in control
experiments. The maximal DMSO concentration was either 0.02% (for
wortmannin experiments) or 0.05% (for LY294002 experiments), which
matched its concentration in experiments done with the highest inhibitor
doses. Thin blood smears were stained with Giemsa, and parasites were
visualized microscopically to determine the parasitemia.
Enriched schizont-stage parasites were added to HRP-loaded erythrocytes;
and after invasion, HRP content in the subsequent trophozoite-stage
parasites was determined colorimetrically as described previously13,14
(supplemental data).
Cloning, expression, and generation of antisera against PfPI3K
Immunoprecipitation and assay of lipid kinase activity
Total RNA was isolated from asynchronous P falciparum 3D7 parasites,
and reverse transcription was performed using random hexamers provided
in the Thermoscript RT-PCR kit (Invitrogen). Because the BLAST search of
Plasmodium proteins using PfPI3K helical domain did not result in any
significant hit other than PfPI3K, this domain was chosen to raise antisera
against PfPI3K. Based on the sequence information, the following PCR
primers were designed to amplify cDNA corresponding to the helical
domain of PfPI3K: PfPI3KHD1 (forward) ATGTTATCACCAACTATAAACGAGATTAAAAAC and PfPI3KHD1 (reverse) GATAATTTTATTTTTTCTAATATTAGAAGTCAT. PCR products were cloned directly in pQE-UA
(QIAGEN) bacterial expression vector. The helical domain was expressed
in Escherichia coli as a 6xHis tagged protein (supplemental data, available
on the Blood website; see the Supplemental Materials link at the top of the
online article). To raise antisera against PfPI3K helical domain (PfPI3KHD),
100 ␮g of recombinant protein was emulsified with complete Freund
adjuvant and used to raise antisera in rabbits and mice using standard
protocols.
Parasites in mid-trophozoite stage were collected by saponin lysis and washed
several times to remove red blood cell (RBC) contamination. Subsequently,
parasite lysates were prepared in buffer A (10mM Tris, pH 7.5, 100mM NaCl,
5mM ethylenediaminetetraacetic acid, 1% Triton X-100, 100␮M sodium orthovanadate, 20␮M sodium fluoride, 20␮M ␤-glycerophosphate, and 1⫻
protease inhibitor cocktail, Roche Diagnostics; 10% glycerol) and were clarified
by centrifugation at 20 000g at 4°C. Typically, 50 to 100 ␮g of parasite lysate was
incubated with anti-PfPI3K antisera with end-to-end shaking at 4°C for 12 hours.
Protein A/G agarose beads were added to this mix, and further incubation was
done for an additional 6 hours. The protein A/G agarose beads were washed
several times with buffer A and resuspended in kinase assay buffer. Typically,
10 ␮L of immunoprecipitate was used for performing kinase assays in a 20-␮L
reaction volume in a buffer containing 20mM N-2-hydroxyethylpiperazine-N⬘-2ethanesulfonic acid, pH 7.5, 5mM MgCl2, 0.45mM ethyleneglycoltetraacetic
acid, 70␮M adenosine triphosphate ([␥32P]- 6␮Ci /reaction), and 200␮M
substrate PI or PIP in the presence or absence of wortmannin. Reaction mix was
incubated at 30°C for 30 minutes, and the reaction was terminated by the addition
of 1M HCl. Lipid extraction was first done using 200 ␮L of CHCl3/MeOH (1:1)
and then with 80 ␮L of 1M HCl/MeOH (1:1). Phospholipids were separated by
thin-layer chromatography (TLC), which was performed on preactivated Silica
Gel 60 plates (Merck) in a CHCl3/methanol/2N NH4OH (9:7:2) solvent system.
Radiolabeled phosphoinositide products were detected using a Fuji FLA-5000
phosphorimager.
Immunoblotting and immunofluorescence
Parasites were released from infected erythrocytes by 0.05% (wt/vol)
saponin treatment as described earlier.11 Unless indicated, cell-free protein
extracts from specific parasite stages were prepared by suspending parasite
pellets in 2% sodium dodecyl sulfate. After separation of lysate proteins on
SDS-polyacrylamide gel electrophoresis gels, proteins were transferred to a
nitrocellulose membrane. Immunoblotting was performed using antiPfPI3K antisera and horseradish peroxidase (HRP)–labeled anti–rabbit
IgG. West Dura enhanced chemiluminescence substrate (Pierce Chemical)
was used to develop blots following the manufacturer’s instructions.
Hemoglobin quantitation in parasites was carried out by Western blotting
with anti-hemoglobin antiserum as described previously.12,13
HRP endocytosis assay
Results
PfPI3K, a PI3K ortholog in P falciparum
BLAST search performed with sequences of mammalian and
yeast PI3Ks against P falciparum genome database resulted in
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
BLOOD, 25 MARCH 2010 䡠 VOLUME 115, NUMBER 12
VAID et al
Helical
Domain
C2
Kinase Domain
E
Pf
Substrate
Pf
PfPI3K
205
PI3P
kDa
D
P2
C
B
PI4P
PI(4
,5)
A
PI
2502
Wort
LY
-
+
-
+
1
2
1
2
PI3P
PfPI3K
PI(3,4)P2
PI(3,4)P2
120
100
PI(3,4,5)P3
antiPfPI3K
antipreimmune PfPI3K
origin
origin
Figure 1. PfPI3K, a PI3 kinase from P falciparum. (A) Schematic diagram showing domain architecture of PfPI3K. The helical and catalytic domain of PfPI3K is separated by
a linker. In addition, a C2 domain is present near its N-terminal end. (B) Equal amounts of cell lysates prepared either from either uninfected erythrocytes (E left panel) or
trophozoite stage parasites (Pf right panel) were electrophoresed on 7% SDS-polyacrylamide gel electrophoresis gel, and Western blot analyses were performed using
anti-PfPI3K antisera on both erythrocyte as well as the parasite lysate. A control Western blot with preimmune antisera was performed to probe the parasite lysate (middle panel).
(C) PfPI3K was immunoprecipitated from trophozoite lysates, and PfPI3K-IP was used in a lipid kinase assay wherein either PI or PI3P (left panel), PI4P, or PI(4,5)P2 (right panel) was used
as substrate. Phospholipids were separated on a TLC along with phosphoinositide standards, and radiolabeled lipid products were detected using a phosphorimager. (D) The activity of
PfPI3K-IP from trophozoite lysates was assayed using PI4P as substrate (as described in panel C) in the presence of 2.5␮M wortmannin (left panel), or 50␮M LY294002 (right panel) or
DMSO (⫺).
only 1 significant match on chromosome 5, which was named
PfPI3K. PfPI3K corresponds to PlasmoDB annotated gene
PFE0765w, which is predicted to encode a 2133-amino acid
protein. PfPI3K shares high homology with the catalytic and
signature helical domain of PI3Ks (supplemental Table 1).
PI3Ks are classified based on their domain architecture, mechanism of regulation, and substrate affinities.3 Comparison of
vacuolar protein-sorting protein 34 (vps34), a class III PI3K and
PI3K␥, a class I PI3K to PfPI3K, suggests that reasonable
sequence homology exists in the helical domain region and the
catalytic domain of these enzymes (supplemental Table 1). The
helical domain anchors the other important regions of PI3Ks in
an orientation conducive for the catalytic domain to function
properly.15 PfPI3K has a putative C2 domain, which is known to
interact with calcium and lipids (Figure 1A). PfPI3K lacks any
other obvious protein domains, such as the Ras binding domain
or pleckstrin homology domain, which are found in class I or
class II enzymes.3 PfPI3K contains NKNDDD repeats near its
N-terminal end, which is present in several Plasmodium proteins.16 The comparison of amino acid sequence and domain
organization suggests that PfPI3K may be closest to class III
PI3Ks, such as vps34.
The crystal structure of PI3K␥ exhibits a catalytic domain that
shares a fold similar to that of protein kinases, predominantly
␤-sheet containing N-terminal lobe and a helical C-terminal lobe.15
Structure-based sequence comparisons with PI3K␥ revealed that
all 10 ␤-sheets and 12 ␣-helices found in PI3K␥ catalytic domain
may be present in PfPI3K (supplemental Figure 1B). Interestingly,
the catalytic domain of PfPI3K is interrupted by 3 additional
insertions (supplemental Figure 1B).
The helical domain of PI3K␥ has 10 ␣-helices, which form
5 A/B type pairs. Although 7 of these helices may be conserved
(supplemental Figure 1A) in PfPI3K, the sequence of the last
3 helices of PI3K␥ does not pair up with the corresponding region.
Although helical and catalytic domains of PI3K␥ are almost
contiguous, they are separated by an approximately 110-amino acid
linker in PfPI3K. Despite the similarity between regions of PfPI3K
with other PI3Ks, there are interesting differences, which may
suggest a different mode of regulation of this enzyme.
PfPI3K expression in intraerythrocytic parasites
Attempts to express the full-length PfPI3K in either E coli or
mammalian cells were not successful. The helical domain was
expressed with a 6xHis tag (supplemental Figure 2) and was used
to raise antisera against PfPI3K (supplemental Figure 2). An
approximately 230-kDa band, which was close to the PlasmoDB
predicted size of PfPI3K, was observed in trophozoite lysates and
not in control uninfected erythrocyte lysates (Figure 1B).
Demonstration of PfPI3K activity in P falciparum
We were unable to express an active form of recombinant PfPI3K.
However, PfPI3K was immunoprecipitated successfully from the
parasite lysate, which allowed us to assay the activity of the native
PfPI3K. PfPI3K immunoprecipitate (PfPI3K-IP) was used to
phosphorylate PI, PI4P, or PI(4,5)P2 in a kinase assay mix. On
incubation with PI, a product corresponding to the size of PIP was
formed. Because this product was not observed when synthetic
PI3P was used in assays, it is reasonable to attribute this to PI3P
(Figure 1C left panel). When PI4P was used as a potential substrate,
a radiolabeled product with slower mobility corresponding to the
expected size of PI(3,4)P2 was observed. In addition, we found that
PI(4,5)P2 may also be converted to PI(3,4,5)P3 by PfPI3K (Figure
1C right panel). Mock immunoprecipitates prepared from RBC
lysates did not show any kinase activity (data not shown here).
These data indicate that PfPI3K can generate PI3P, PI(3,4)P2, and
PI(3,4,5)P3 and highlight some differences between PfPI3K and
typical class III PI3Ks, which mainly form PI3P from PI.3,5
A recent study indicated that attempts to obtain P berghei
lacking PI3K gene failed and suggested that this kinase may be
essential for the parasite development.17 Although gene disruption
has not been done in P falciparum, based on observations made in
P berghei, it is probable that PfPI3K may also be indispensable for
P falciparum. We used a pharmacologic approach to evaluate
PfPI3K function. Wortmannin and LY294002, widely used inhibitors for PI3Ks, were tested against PfPI3K. Incubation with both
these inhibitors caused a significant decrease in PfPI3K-IP activity
(Figure 1D). Whereas approximately 3␮M wortmannin caused
almost complete inhibition of PfPI3K activity, the amount of
LY294002 needed was approximately 50␮M. Similar trends have
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
BLOOD, 25 MARCH 2010 䡠 VOLUME 115, NUMBER 12
A
i
PfPI3K IN HOST RBCs AND MALARIA PARASITE
C
B
PfPI3K
FCP
Merge
PC
PfPI3K
Overlay
PfPI3K/PC
PC
PI(3,4)P2
Untreated
ii
2503
BFA
PfPI3K
VARC
PC
Merge
S/SLO P/SLO S/SAP P/SAP
PfPI3K
PfHSP70
P/SAP S/SAP
P/SLO S/SLO
Figure 2. Intracellular localization of PfPI3K and its trafficking to the host. (A) IFA was performed for localizing PfPI3K, FCP (i) and VARC (ii). FCP (red) is located inside the food
vacuole of mature trophozoites. PfPI3K (green) exhibits “vesicular” staining on PVM/PM (black arrows) and the host erythrocyte (white arrows) and in the food vacuole, which can be
identified by the presence of black hemozoin. (ii) PfPI3K colocalizes with VARC at the erythrocyte surface. (B) Parasites were treated either with 5␮g/mL BFA or DMSO, and
immunofluorescence was performed using anti-PfPI3K antisera. BFA treatment blocked the transport of PfPI3K to the erythrocyte. (C) Trophozoite stage parasites were treated with either
streptolysin (SLO) or saponin (SAP). The soluble (S) and pellet (P) fractions were used for Western blot (bottom panel) and immunoprecipitation of PfPI3K. PfPI3K-IP was assayed for
activity using PI4P as the substrate; the radiolabeled product PI(3,4)P2 was detected by phosphorimaging of TLC plates. Anti-PfHSP70 was used for a control Western blot.
been observed for other PI3Ks; most PI3Ks are more senstitive to
wortmannin compared with LY294002.18,19 In this study, we have
used both wortmannin and LY294002 as tools to elucidate the role
of PfPI3K in the parasite life cycle.
Localization and trafficking of PfPI3K
The cellular localization of PfPI3K was determined by performing
IFAs. PfPI3K was detected inside the food vacuole (Figure 2A;
supplemental Figure 3), which fits well with the presence of an FCP
in this compartment. FCP interacts with PI3P8 and therefore is a
probable effector of PfPI3K signaling. In addition, PfPI3K staining
was detected in vesicular structures concentrated near the PVM/PM
and the food vacuole membrane (Figure 2Ai-ii). Strikingly, PfPI3K
was also found in the host erythrocyte (Figure 2A-B). It was
present near the erythrocyte periphery as confirmed by costaining
with an antibody against the conserved C-terminal of VAR gene
products (VARC; Figure 2Aii), which are part of knob structures.20
It is important to indicate that the PfPI3K ORF seems to lack an
obvious targeting sequence, such as the PEXEL/HTS, which have
been shown to target parasite proteins to the host.21,22
To determine whether PfPI3K transport to the host is dependent on
secretory pathways, parasites were treated with brefeldin A (BFA).
BFA, which inhibits post-Golgi events, such as vesicle budding in
secretion, blocks the classic secretory pathway as well as the alternate
secretory pathways that send the parasite proteins to the host erythrocyte.21,22 BFA caused a loss in PfPI3K staining on the PVM/PM and also
in the host erythrocyte (Figure 2B). In BFA-treated parasites, PfPI3K
was retained predominantly inside the parasite. These data indicate the
BFA-sensitive pathway may be responsible for exporting PfPI3K to
parasite surface and to the host erythrocyte.
PfPI3K, a source of PIPs in infected erythrocytes
It was important to assess whether PfPI3K retains its ability to produce
3⬘-PIPs in the host. To probe this, host erythrocyte cytoplasmic proteins
were separated from the parasite by streptolysin O, which may create
pores in the membrane of infected RBCs (iRBCs) and cleaves it without
modifying the PVM.23 In addition, PV and iRBC proteins were
separated from the parasite proteins by treatment with 0.15% saponin.23
Consistent with the IFA data, Western blotting on these fractions
revealed the presence of PfPI3K in iRBC as well as the parasite fraction
(Figure 2C). The presence of PfPI3K in the supernatant of streptolysintreated iRBC suggested that it is most probably anchored to the cytosolic
face of iRBC membrane, which is consistent with immunofluorescence
results. PfPI3K was immunoprecipitated from these fractions and
assayed for kinase activity using PI4P as the substrate. PfPI3K was
found to be active in the infected erythrocyte as well as the parasite
fractions (Figure 2C). These observations suggest that PfPI3K secreted
to the host may generate 3⬘-PIPs, which may be important for
controlling signaling/trafficking events in the erythrocyte. Interestingly,
it has been reported that the levels of PIP and PIP2 increase dramatically
in erythrocytes after infection with P falciparum, and parasite machinery was speculated to contribute to this process.24 Based on our present
findings, this increase in the levels of PIPs may be attributed to the
parasite exported PfPI3K.
PfPI3K inhibition leads to accumulation of hemoglobin in the
parasite
The endocytosis of hemoglobin from the host erythrocyte to the
malaria parasite is a key process, which is important for parasite
development. Morphologically, several cellular mechanisms have
been implicated in hemoglobin trafficking to the parasite.25,26
However, molecular mechanisms that regulate hemoglobin trafficking are still unclear. Because PI3K and its products are important
players in endocytosis and trafficking events in most eukaryotes, it
was worth studying the role of PfPI3K in hemoglobin transport to
the parasite. To investigate this, parasites were incubated with PI3K
inhibitors and the amount of hemoglobin present inside the parasite
was determined by Western blotting. Wortmannin- and LY294002treated parasites exhibited significantly increased hemoglobin
levels (Figure 3A) compared with the solvent control. In contrast,
mefloquine, a known hemoglobin endocytosis inhibitor, significantly reduced hemoglobin levels (data not shown) as previously
reported.12 Based on these observations, it is reasonable to suggest
that PI3K inhibitors either cause a stimulation of hemoglobin
endocytosis or attenuate hemoglobin digestion, which results in
increased levels of hemoglobin in the parasite.
PfPI3K may be involved in uptake of material from the host
First, efforts were made to explore whether PfPI3K is involved in
trafficking of material from the host. To this end, the uptake of HRP, a
standard nondigestible fluid-phase endocytic tracer, was evaluated.
Erythrocytes infected with mature parasites were enriched and incubated with HRP-loaded erythrocytes in culture to allow invasion of the
latter. HRP uptake from the infected preloaded erythrocytes by parasite
fluid-phase endocytosis was quantitated by colorimetrically measuring
HRP enzymatic activity in isolated trophozoites. Wortmannin caused a
significant decrease in HRP levels in parasites, indicating an inhibition
of endocytosis (Figure 3B).
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
2504
A
BLOOD, 25 MARCH 2010 䡠 VOLUME 115, NUMBER 12
VAID et al
i
DMSO Wort
DMSO LY
Hb
Hb
Normalized Hb levels
ii
Actin
Normalized Hb levels
Actin
500
400
300
200
100
200
100
0
0
DMSO
B
300
DMSO
Wortmannin
10 μM
LY
10μM
Figure 3. Hemoglobin accumulation in malaria parasites as
result of PfPI3K inhibition. (A) Late ring stage parasites were
incubated with DMSO (control), wortmannin, or LY294002 for
approximately 5 hours. After releasing the parasite from the
erythrocytes, parasite lysates were prepared and Western blotting performed using antihemoglobin antiserum or anti-actin
antibody. (i) A representative Western blot from each experiment
is shown. Actin was used as a loading control. (ii) The hemoglobin band intensity from Western blots performed on 3 independent experiments in which the parasite was treated with 10␮M
wortmannin or LY294002 was quantified by densitometry using
Kodak 1D image analysis software and is represented by bar
graphs. The intensity levels were normalized to the control set at
100, and comparisons were made. The error bars represent
SEM. (B) Erythrocytes were preloaded with HRP, infected with
parasites, and treated with 10␮M wortmannin for 14 hours. After
releasing parasites from infected erythrocytes by saponin treatment, HRP levels associated with parasites were determined
with a colorimetric enzyme assay. Absorbance values were
normalized to the solvent controls set at 100. Error bars represent SEM.
100
Normalized HRP
-absorbance levels
75
50
25
0
DMSO
wortmannin
PI3K inhibitors block food vacuole trafficking of hemoglobin
PfPI3K inhibition blocks endocytosis of HRP from the host (Figure 3B).
Although this observation is indicative of PfPI3K involvement in host
cell endocytosis, it does not explain the increase in the levels of
hemoglobin levels on wortmannin treatment. To explore this further,
changes in hemoglobin trafficking in the parasite were followed. After
treatment with wortmannin, parasites were released from RBCs by
saponin treatment, immobilized on coverslips, and fixed with paraformaldehyde/glutaraldehyde. Subsequently, immunofluorescence assays were
performed with commercial anti-hemoglobin antiserum to determine
the subcellular localization of hemoglobin in the parasite. Expectedly,
hemoglobin staining was observed inside the food vacuole and occasional punctate structures in the cytoplasm, which most probably
C
W
PC
Hb
DAPI
B
Intra-parasitic
vesicle number
A
represent previously described hemoglobin-laden endocytic vesicles12,13
(Figure 4A). Treatment with wortmannin resulted in an apparent
decrease in food vacuole hemoglobin. More strikingly, the inhibitortreated parasites exhibited an increase in the number of hemoglobinpositive vesicles (Figure 4A). This was confirmed by counting the number of extra-digestive vacuolar fluorescent foci in randomly selected
parasites. Parasites treated with wortmannin contained approximately
5-fold more vesicles (Figure 4B). Similar observations were made when
LY294002 was used to inhibit PfPI3K activity (supplemental Figure 4).
In contrast to these results, mefloquine treatment resulted in a marked
decrease in the vesicle number (data not shown). The phasecontrast images indicated that hemozoin is still present in the
food vacuoles of wortmannin-treated parasites. The hemozoin
C
10.0
DMSO
Wortmannin
v
7.5
v
5.0
Fv
v
v
2.5
v
N
Fv
N
0.0
DMSO
wortmannin
Figure 4. The effect of PfPI3K inhibition on hemoglobin trafficking. (A) Parasites were treated with DMSO or wortmannin. Saponin treatment was used to release excess
nonparasitic hemoglobin, followed by attachment of parasites onto poly-lysine-coated glass cover slips. After fixation in paraformaldehyde/glutaraldehyde and Triton X-100
permeabilization, IFA was performed using anti-hemoglobin antibody, and 4,6-diamidino-2-phenylindole was used to stain the parasite nucleus. A single erythrocyte-free parasite can be
seen in each phase-contrast image (PC) with its food vacuole. The thick arrow represents the collection of hemozoin crystals, which indicates the position of the food vacuole.
Corresponding hemoglobin immunofluorescence images (Hb) contain punctate vesicle-like structures indicated by the thin arrow. (B) Average transport vesicle counts per parasite were
compared between wortmannin and DMSO control. Error bars represent SEM. (C) Transmission electron micrographs of DMSO and 10␮M wortmannin-treated trophozoite stage malaria
parasite. Each micrograph shows a single parasite located inside a host erythrocyte. The cytoplasm of the host cell is darkly stained because of the preponderance of electron-dense
hemoglobin. Labeled structures inside the parasites are the parasite nucleus (N), food vacuole (Fv), and hemoglobin transport vesicles (V).
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
BLOOD, 25 MARCH 2010 䡠 VOLUME 115, NUMBER 12
100
B
75
50
25
0
1.25
2.5
5
Peps
Complete Medium
C
25
0
1.25
2.5
5
Peps
Ile Medium
D
100
% parasitemia
compared to control
% parasitemia
compared to control
50
Wortmannin
(μM)
100
LY294002
(μM)
75
0
0
Wortmannin
(μM)
2505
100
% parasitemia
compared to control
A
% parasitemia
compared to control
Figure 5. PfPI3K inhibition stalls parasite growth. Parasite cultures in complete medium (A,C) or Ile medium (B,D)
were incubated with DMSO/MeOH (control), indicated concentrations of wortmannin (A-B), LY294002 (C-D), or 30␮M
pepstatin A (Peps). Parasite growth was monitored by
counting the parasite infected erythrocytes every 48 hours,
the data obtained after 4 (C-D) or 6 (A-B) days of treatment
are shown. The percentage growth of parasite in drugtreated cultures compared with control (100%) is indicated.
Error bars represent SEM.
PfPI3K IN HOST RBCs AND MALARIA PARASITE
75
50
25
0
0
may represent crystals formed before the addition of wortmannin. In addition, it may suggest that the block in hemoglobin
trafficking to the food vacuole is not complete and that
hemoglobin is still delivered to the food vacuole for digestion
and hemozoin formation, which may happen via additional
processes that may operate independent of PfPI3K.
These data suggest that the inhibition of PfPI3K may cause
defects in endocytic vesicle trafficking of hemoglobin to the food
vacuole, the site of hemoglobin digestion. Hemoglobin may
consequently be trapped in endocytic vesicles on PfPI3K inhibition, which prevents efficient transport to the food vacuole
resulting in impaired catabolism.
To confirm the hemoglobin IFA results, wortmannin-treated
parasites were further visualized by electron microscopy. As
suggested by the IFA images (Figure 4A), treated parasites
contained increased numbers of hemoglobin transport vesicles,
often strikingly so in individual parasites (Figure 4C). The average
vesicle number per parasite profile increased from 1.58 (⫾ 0.12) to
3.83 (⫾ 0.23). There appeared to be a concurrent increase in
vesicle diameter, from an average of 322 nm (⫾ 33 nm) in controls
to 543 nm (⫾ 26 nm) in treated parasites. Vesicle size increase was
also suggested by the IFA images (Figure 4A, compare “C” with
“W”). Closer inspection of the electron microscope images presented here shows that the food vacuoles in the parasites are
completely filled with densely packed, parallel elongated hemozoin
crystals. The presence of less electron dense or relatively void
vesicles in the wortmannin-treated parasites is an interesting
phenomenon that was also observed in parasites treated with
actin-disrupting compounds (cytochalasin) that similarly impede
vesicle delivery to the food vacuole.13 One possible explanation is
that hemoglobin digestion is already initiated in hemoglobin
vesicles and proceeds in individual wortmannin-induced stationary
vesicles to the extent where hemoglobin content is visibly reduced.
Inhibition of PfPI3K-mediated transport blocks parasite growth
The endocytosis of hemoglobin to the food vacuole and its
catabolism is important for parasite growth because it is a major
source of most amino acids for the parasite. When hemoglobin
5
10
25
50
LY294002
(μM)
75
50
25
0
0
5
10
25
50
proteolysis is blocked, the parasite can get the supply of amino
acids from extracellular milieu.27 Isoleucine is the only amino acid
that is not present in human hemoglobin, and the parasite relies
almost completely on extracellular medium for its acquisition.27,28
Because hemoglobin endocytosis is a prerequisite for its degradation in the parasite food vacuole and PfPI3K regulates hemoglobin
uptake, we checked whether wortmannin and LY294002 alter the
parasite growth. These experiments were done simultaneously in
2 sets; in one set, the parasite was cultured in complete RPMI 1640
medium; in the other, a medium lacking all amino acids except Ile
(Ile medium) was used. In the latter situation, parasite was largely
dependent on hemoglobin as a source for other amino acids.27 The
parasites were cultured in the presence of wortmannin, LY294002,
or pepstatin A, an aspartic protease inhibitor that is known to stall
parasite growth.27 It was evident that the growth of parasites, when
cultured in the complete medium for 6 days in the presence of
wortmannin, was inhibited significantly (Figure 5A); approximately 2.5␮M wortmannin caused approximately 50% reduction in
parasite growth. When parasites were treated with wortmannin in
Ile medium, a strikingly higher sensitivity toward wortmannin was
observed. The parasite growth was almost completely blocked by
approximately 2.5␮M wortmannin (Figure 5B). Similar trends
were observed with LY294002, and approximately 25␮M of this
inhibitor could cause approximately 60% inhibition in parasite
growth in Ile medium (Figure 5C-D). The amount of LY294002
needed to inhibit parasite growth was higher, which corroborates
with its lower affinity toward PfPI3K (Figure 1D). As observed for
wortmannin, LY294002 was also more potent in Ile medium.
Treatment with protease inhibitor pepstatin A resulted in similar
trends and indicated that this inhibitor was also more effective in Ile
medium as reported previously.27 The parasite relies on hemoglobin degradation for amino acid supply in Ile medium, which may be
a plausible reason for higher inhibitor sensitivity exhibited by the
parasite in this medium. Based on these data, we conclude that
PfPI3K may control trafficking pathway(s) that are involved in
hemoglobin transport to the parasite food vacuole (Figure 6), a
crucial step for its catabolism and therefore may be necessary for
parasite growth.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
BLOOD, 25 MARCH 2010 䡠 VOLUME 115, NUMBER 12
VAID et al
Ho
s
Tra t sign
ffic
a
k i n ling
g?
2506
PIPs
Pf
FV
RBC
Hb-vesicles
PfPI3K
FCP
Figure 6. A model for the role and regulation of PfPI3K in malaria parasite.
PfPI3K is trafficked to vesicular compartments at PM/PVM and the food vacuole, and
exported to the host RBCs. It may regulate the function of FCP, a PI3P binding
protein, which is present in the food vacuole.8 PfPI3K inhibition blocks endocytosis of
hemoglobin to the food vacuole and blocks parasite growth. Because PfPI3K
exported to the host erythrocyte is active, it may trigger signaling and trafficking
pathways that may regulate additional events.
Discussion
The presence of enzymes, such as PI synthase,24 PfPI4P5K,7
PfPI3K, and other PIP kinases, in Plasmodium suggests that PIPs
may have a major role to play in parasite signaling and trafficking
as is the case in most eukaryotes. 3⬘-Phosphorylated PIPs generated
by the action of PI3Ks on PI, PI4P, and/or PI(4,5)P2 are major
players in this process.3,29 PfPI3K seems to be the only PI3K in
P falciparum and shares characteristics with class III PI3Ks, such
as vps34. In contrast to vps34, which generates mainly PI3P from
PIP,3,5 PfPI3K phosphorylates both PI and PI4P to yield PI3P,
PI(3,4)P2. It was recently reported that attempts to disrupt PfPI3K
homolog gene in P berghei were not successful, and it was
suggested to be essential for the parasite growth.17 Based on this, it
is reasonable to assume that PfPI3K may have a similar role in
P falciparum, which was supported by the inhibition of parasite
growth and hemoglobin trafficking by wortmannin and LY294002.
It was reported that PI3P is almost absent in uninfected erythrocytes; however, its levels increase significantly in infected erythrocytes,17,24 which was attributed to the parasite but not the host
machinery.24 Our results indicate that PfPI3K is exported to
erythrocytes, and the detection of PfPI3K activity in the host
erythrocyte may provide a probable explanation for this observation.
In Dictyostelium, PI3K is required for macromolecule uptake by
macropinocytosis,30 whereas wortmannin and LY294002 have
been reported to inhibit fluid-phase endocytosis within mammalian
cells.31 PI3Ks also act as regulators of phagocytosis and are
essential players in phagosome formation and maturation.32 Based
on the reported participation of PI3K endocytic events in other
eukaryotes, we investigated whether PI3K inhibition would downregulate endocytosis of host cytoplasm in malaria parasites.
Consistent with this hypothesis, parasite HRP accumulation through
fluid-phase endocytosis from infected host erythrocytes was decreased by wortmannin. However, earlier Western blotting results
had indicated an increase in hemoglobin content in parasites
exposed to the inhibitors, suggesting additional effects on the
parasite endocytic pathway and/or digestion of endocytosed material in the food vacuole. Immunofluorescence localization of
hemoglobin in wortmannin-treated parasites showed a significant
increase in endocytic hemoglobin transport vesicles, suggestive of
a block in endocytic trafficking. LY294002, another inhibitor of
PI3Ks, which also inhibits PfPI3K, caused similar defects on
hemoglobin trafficking, providing further support to these observations (supplemental Figure 4). However, localization of PfPI3K
itself did not seem to alter significantly on treatment with wortmannin (supplemental Figure 3). It is possible that the inhibition of
hemoglobin transport and delivery to the food vacuole impair the
digestion of internalized hemoglobin in the latter compartment and
produce the increase in hemoglobin levels in the treated parasites.
This conclusion is consistent with the reported function of PI3Ks in
postendosomal sorting and degradation in mammalian cells,33
genetic evidence for the role of PI3Ks in sorting to yeast
vacuoles,34 and PI3K involvement in phagosome maturation.32 In
addition, the association of PfPI3K and downstream effectors, such
as FCP, with the parasite food vacuole may have direct bearing on
the inability of inbound hemoglobin transport vesicles to fuse with
this compartment in the presence of PI3K inhibitors.
Interestingly, previous studies have reported a similar role for actin in
hemoglobin trafficking in malaria parasites, evidenced by an increase in
volume and number of hemoglobin-filled vesicles in parasites treated
with actin disruptors.13 PfPI3K also appears to affect hemoglobin
trafficking. The principal mode of hemoglobin endocytosis in trophozoites is via cytostomes, invaginations of the parasite plasma membrane
characterized by an electron-dense collar at the neck. In a manner
reminiscent of classic clathrin-dependent endocytosis in mammalian
cells, the cytostomes presumably pinch off to form endocytic vesicles
that traffic hemoglobin to the digestive vacuole in an actin and
PfPI3K-dependent manner. A detailed ultrastructural study of endocytosis identified 3 additional modes of hemoglobin uptake that supplement
the cytostome pathway: a “big gulp” in the ring stage that forms a
nascent digestive vacuole, large hemoglobin-filled “phagotrophs” that
are probably formed by a cytostome-independent mechanism and
elongated “cytostomal tubes” that are morphologically distinct from the
more spherical standard hemoglobin transport vesicles.25 We have not
attempted to distinguish between these modes in addressing the
effects of PfPI3K, but overt evidence of cytostomal tubes and
phagotrophs in addition to the hemoglobin transport vesicles in our
IFA and electron-microscopic images was not found. In contradiction to the aforementioned ultrastructural study, an alternative
model of the hemoglobin endocytic pathway was proposed, in
which the cytostomes do not pinch off to form independent vesicles
but elongate and fuse directly with the digestive vacuole.26 By
extension, an increase in “vesicle” number in parasites compromised in actin or PfPI3K activity would represent an increase in the
convolutions of individual cytostomes. It is possible that additional
PI3K or actin-independent pathways for hemoglobin trafficking
may exist. It will be interesting to identify which of the aforementioned mechanisms of hemoglobin uptake is dependent on PfPI3K.
In addition to actin, hemoglobin trafficking may also be
dependent on Rab5a, a known mediator of mammalian early
endosome function, although the detailed underlying molecular mechanisms remain unknown.25 It is known that Rab GTPases
participate in PI3K-mediated vesicular trafficking in several cell
types, and several members of the Rab family are encoded in
Plasmodium genome.35,36 Therefore, it will be worth testing
whether PfPI3K controls hemoglobin endocytosis via Rabs.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
BLOOD, 25 MARCH 2010 䡠 VOLUME 115, NUMBER 12
PfPI3K IN HOST RBCs AND MALARIA PARASITE
Hemoglobin catabolism, which is important for the parasite growth,
is carried out by aspartic proteases plasmepsins and cysteine protease
falcipains.37 Interestingly, gene disruption of several of these enzymes
only marginally slowed the parasite growth.27 It was demonstrated that
the parasite could propagate in a medium containing only a single amino
acid, Ile, which is missing from human hemoglobin.27 In this situation, it
is dependent on hemoglobin degradation for supply of amino acids.
Several protease “knockout” lines and protease inhibitor treatment
exhibited marked impairment of parasite growth in this medium.
Because wortmannin and LY294002 inhibit parasite growth with
significantly higher efficacy in Ile medium, the hemoglobin trafficking
may be a prominent PfPI3K-dependent process. Indeed, it is possible
that PfPI3K may play additional roles in parasite development (summarized in Figure 6), which will be worth investigating.
Acknowledgments
The authors thank Dr Amit Sharma and Prof Nirbhay Kumar for
VARC and PfHSP70 antisera, respectively, as well as Garima
Verma and Justin Vijay.
2507
This work was supported in part by the Swaranajayanti
fellowship and the Wellcome Trust Senior Research Fellowship
(P.S.). This work was also supported in part by the National
Institutes of Health, National Institute of Allergy and Infectious
Diseases (grant R01AI075459). A.V. and R.R. were supported by
the Junior/Senior Research Fellowship by the Council for Scientific
and Industrial Research, India.
Authorship
Contribution: A.V., R.R., and W.A.S planned and performed
experiments and analyzed the data; and H.C.H. and P.S. planned
the experiments, analyzed the data, and wrote the manuscript.
Conflict-of-interest disclosure: The authors declare no competing financial interests.
Correspondence: Pushkar Sharma, Eukaryotic Gene Expression
Laboratory, National Institute of Immunology, Aruna Asaf Ali
Marg, New Delhi 110067, India; e-mail: [email protected].
References
1. Goodyer ID, Pouvelle B, Schneider TG, Trelka
DP, Taraschi TF. Characterization of macromolecular transport pathways in malaria-infected
erythrocytes. Mol Biochem Parasitol. 1997;
87(1):13-28.
2. Francis SE, Sullivan DJ Jr, Goldberg DE. Hemoglobin metabolism in the malaria parasite
Plasmodium falciparum. Annu Rev Microbiol.
1997;51:97-123.
3. Vanhaesebroeck B, Leevers SJ, Ahmadi K, et al.
Synthesis and function of 3-phosphorylated inositol lipids. Annu Rev Biochem. 2001;70:535-602.
4. Lemmon MA. Phosphoinositide recognition domains. Traffic. 2003;4(4):201-213.
5. Schu PV, Takegawa K, Fry MJ, et al. Phosphatidylinositol 3-kinase encoded by yeast VPS34
gene essential for protein sorting. Science. 1993;
260(5104):88-91.
6. Kutateladze TG, Ogburn KD, Watson WT, et al.
Phosphatidylinositol 3-phosphate recognition by the
FYVE domain. Mol Cell. 1999;3(6):805-811.
7. Leber W, Skippen A, Fivelman QL, et al. A unique
phosphatidylinositol 4-phosphate 5-kinase is
activated by ADP-ribosylation factor in Plasmodium falciparum. Int J Parasitol. 2009;39(6):
645-653.
8. McIntosh MT, Vaid A, Hosgood HD, et al. Traffic
to the malaria parasite food vacuole: a novel
pathway involving a phosphatidylinositol
3-phosphate-binding protein. J Biol Chem.
2007;282(15):11499-11508.
9. Trager W, Jensen JB. Human malaria parasites in
continuous culture. Science. 1976;193(4254):
673-675.
10. Lambros C, Vanderberg JP. Synchronization of
Plasmodium falciparum erythrocytic stages in
culture. J Parasitol. 1979;65(3):418-420.
11. Vaid A, Thomas DC, Sharma P. Role of Ca2⫹/
calmodulin-PfPKB signaling pathway in erythrocyte invasion by Plasmodium falciparum. J Biol
Chem. 2008;283(9):5589-5597.
12. Roberts L, Egan TJ, Joiner KA, Hoppe HC. Differential effects of quinoline antimalarials on endocytosis in Plasmodium falciparum. Antimicrob
Agents Chemother. 2008;52(5):1840-1842.
13. Smythe WA, Joiner KA, Hoppe HC. Actin is required for endocytic trafficking in the malaria
parasite Plasmodium falciparum. Cell Microbiol.
2008;10(2):452-464.
14. Hoppe HC, Van Schalkwyk DA, Wiehart UI, et al.
Antimalarial quinolines and artemisinin inhibit endocytosis in Plasmodium falciparum. Antimicrob Agents
Chemother. 2004;48(7):2370-2378.
25.
15. Walker EH, Perisic O, Ried C, Stephens L,
Williams RL. Structural insights into phosphoinositide 3-kinase catalysis and signalling.
Nature. 1999;402(6759):313-320.
26.
16. Singh GP, Chandra BR, Bhattacharya A, et al.
Hyper-expansion of asparagines correlates with
an abundance of proteins with prion-like domains
in Plasmodium falciparum. Mol Biochem Parasitol. 2004;137(2):307-319.
27.
17. Tawk L, Parastra B, Vial H, Roy C, Wengelnik K.
Phosphatidylinositol 3- phosphate in Plasmodium
blood stage development. Molecular Parasitology
Meeting 2007, Woods Hole, MA, September 1620, 2007.
28.
29.
18. Knight ZA, Gonzalez B, Feldman ME, et al. A
pharmacological map of the PI3-K family defines
a role for p110alpha in insulin signaling. Cell.
2006;125(4):733-747.
30.
19. Vlahos CJ, Matter WF, Hui KY, Brown RF. A specific
inhibitor of phosphatidylinositol 3-kinase,
2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one
(LY294002). J Biol Chem. 1994;269(7):5241-5248.
20. Hora R, Bridges DJ, Craig A, Sharma A. Erythrocytic casein kinase II regulates cytoadherence of Plasmodium falciparum-infected
red blood cells. J Biol Chem. 2009;284(10):
6260-6269.
31.
32.
21. Marti M, Good RT, Rug M, Knuepfer E, Cowman
AF. Targeting malaria virulence and remodeling
proteins to the host erythrocyte. Science. 2004;
306(5703):1930-1933.
33.
22. Hiller NL, Bhattacharjee S, van Ooij C, et al. A
host-targeting signal in virulence proteins reveals
a secretome in malarial infection. Science. 2004;
306(5703):1934-1937.
34.
23. Klemba M, Gluzman I, Goldberg DE. A Plasmodium falciparum dipeptidyl aminopeptidase I participates in vacuolar hemoglobin degradation.
J Biol Chem. 2004;279(41):43000-43007.
24. Elabbadi N, Ancelin ML, Vial HJ. Characterization
of phosphatidylinositol synthase and evidence of
a polyphosphoinositide cycle in Plasmodium-
35.
36.
37.
infected erythrocytes. Mol Biochem Parasitol.
1994;63(2):179-192.
Elliott DA, McIntosh MT, Hosgood HD III, et al. Four
distinct pathways of hemoglobin uptake in the malaria parasite Plasmodium falciparum. Proc Natl
Acad Sci U S A. 2008;105(7):2463-2468.
Lazarus MD, Schneider TG, Taraschi TF. A new
model for hemoglobin ingestion and transport by the
human malaria parasite Plasmodium falciparum.
J Cell Sci. 2008;121(11):1937-1949.
Liu J, Istvan ES, Gluzman IY, Gross J, Goldberg DE.
Plasmodium falciparum ensures its amino acid
supply with multiple acquisition pathways and
redundant proteolytic enzyme systems. Proc
Natl Acad Sci U S A. 2006;103(23):8840-8845.
Martin RE, Kirk K. Transport of the essential nutrient isoleucine in human erythrocytes infected
with the malaria parasite Plasmodium falciparum.
Blood. 2007;109(5):2217-2224.
Katso R, Okkenhaug K, Ahmadi K, et al. Cellular
function of phosphoinositide 3-kinases: implications for development, homeostasis, and cancer.
Annu Rev Cell Dev Biol. 2001;17:615-675.
Maniak M. Fluid-phase uptake and transit in axenic Dictyostelium cells. Biochim Biophys Acta.
2001;1525(3):197-204.
Araki N, Johnson MT, Swanson JA. A role for
phosphoinositide 3-kinase in the completion of
macropinocytosis and phagocytosis by macrophages. J Cell Biol. 1996;135(5):1249-1260.
Gillooly DJ, Simonsen A, Stenmark H. Phosphoinositides and phagocytosis. J Cell Biol. 2001;
155(1):15-17.
Fernandez-Borja M, Wubbolts R, Calafat J, et al.
Multivesicular body morphogenesis requires
phosphatidyl-inositol 3-kinase activity. Curr Biol.
1999;9(1):55-58.
Mukherjee S, Ghosh RN, Maxfield FR. Endocytosis. Physiol Rev. 1997;77(3):759-803.
Langsley G, van Noort V, Carret C, et al. Comparative genomics of the Rab protein family in
Apicomplexan parasites. Microbes Infect. 2008;
10(5):462-470.
Quevillon E, Spielmann T, Brahimi K, et al. The
Plasmodium falciparum family of Rab GTPases.
Gene. 2003;306:13-25.
Goldberg DE. Hemoglobin degradation. Curr Top
Microbiol Immunol. 2005;295:275-291.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
2010 115: 2500-2507
doi:10.1182/blood-2009-08-238972 originally published
online January 21, 2010
PfPI3K, a phosphatidylinositol-3 kinase from Plasmodium falciparum, is
exported to the host erythrocyte and is involved in hemoglobin
trafficking
Ankush Vaid, Ravikant Ranjan, Wynand A. Smythe, Heinrich C. Hoppe and Pushkar Sharma
Updated information and services can be found at:
http://www.bloodjournal.org/content/115/12/2500.full.html
Articles on similar topics can be found in the following Blood collections
Red Cells, Iron, and Erythropoiesis (796 articles)
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society
of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.