Download Fig. 2

Journal of the American College of Cardiology
© 2003 by the American College of Cardiology Foundation
Published by Elsevier Inc.
Vol. 42, No. 7, 2003
ISSN 0735-1097/03/$30.00
doi:10.1016/S0735-1097(03)00992-6
BASIC SCIENCE STUDY
Effect of Tumor Necrosis Factor-Alpha
on Endothelial and Inducible Nitric Oxide
Synthase Messenger Ribonucleic Acid
Expression and Nitric Oxide Synthesis
in Ischemic and Nonischemic Isolated Rat Heart
Yosef Paz, MD,* Inna Frolkis, MD, PHD,* Dimitri Pevni, MD,* Itzhak Shapira, MD,* Yael Yuhas, PHD,‡
Adrian Iaina, MD,† Yoram Wollman, PHD,† Tamara Chernichovski, MSC,† Nahum Nesher, MD,*
Chaim Locker, MD,* Rephael Mohr, MD,* Gideon Uretzky, MD*
Tel-Aviv and Petah-Tikva, Israel
The present study aimed to investigate the influence of endogenous tumor necrosis
factor-alpha (TNF-␣) that was synthesized during ischemia and exogenous TNF-␣ on
endothelial and inducible nitric oxide synthase (eNOS and iNOS) messenger ribonucleic acid
(mRNA) expression and nitric oxide (NO) production in the isolated rat heart.
BACKGROUND Tumor necrosis factor-␣ is recognized as being a proinflammatory cytokine with a significant
cardiodepressant effect. One of the proposed mechanisms for TNF-␣-induced cardiac
contractile dysfunction is increased NO production via iNOS mRNA upregulation, but the
role of NO in TNF-␣-induced myocardial dysfunction is highly controversial.
METHODS
Isolated rat hearts studied by a modified Langendorff model were randomly divided into
subgroups to investigate the effect of 1-h global cardioplegic ischemia or the effect of 1-h
perfusion with exogenous TNF-␣ on the expression of eNOS mRNA and iNOS mRNA and
on NO production.
RESULTS
After 1 h of ischemia, there were significant increases in TNF levels in the effluent (from
hearts), and eNOS mRNA expression had declined (from 0.91 ⫾ 0.08 to 0.68 ⫾ 0.19, p ⬍
0.001); but there were no changes in iNOS mRNA expression, and NO was below detectable
levels. Perfusion of isolated hearts with TNF-␣ had a cardiodepressant effect and decreased
eNOS mRNA expression to 0.67 ⫾ 0.04 (p ⬍ 0.002). Inducible nitric oxide synthase mRNA
was unchanged, and NO was below detectable levels.
CONCLUSIONS We believe this is the first study to directly show that TNF-␣ does not increase NO synthesis
and release but does downregulate eNOS mRNA in the ischemic and nonischemic isolated
rat heart. (J Am Coll Cardiol 2003;42:1299 –305) © 2003 by the American College of
Cardiology Foundation
OBJECTIVES
Tumor necrosis factor-alpha (TNF-␣) is a trimeric 17-kDa
polypeptide produced by monocytes and macrophages,
which are known to be proinflammatory cytokines (1,2). Its
classic trilogy action on the body is the induction of
necrosis, shock, and cachexia. Tumor necrosis factor-alpha
has a potent negative inotropic effect (3,4), and the hemodynamic influence of TNF-␣ is characterized by decreased
myocardial contraction and reduced ejection fraction, hypotension, decreased systemic vascular resistance, and biventricular dilatation (5,6). Recent studies have demonstrated
that TNF-␣ is produced during ischemia-reperfusion injury
and activates nuclear factor kappa-␤, which initiates the
From the *Department of Thoracic and Cardiovascular Surgery and †Department
of Nephrology, Tel-Aviv Medical Center, Sackler Faculty of Medicine, Tel-Aviv
University, Tel-Aviv, Israel; and the ‡Felsenstein Medical Research Center, PetahTikva, Israel. This study was supported by the Research Fund of the Department of
Thoracic and Cardiovascular Surgery, Sourasky Tel-Aviv Medical Center, Israel.
Manuscript received February 3, 2003; revised manuscript received May 19, 2003,
accepted June 4, 2003.
cytokine cascade and facilitates the expression of chemokines and adhesion molecules (7,8). Experiments with mice
lacking TNF-␣ have demonstrated an improvement in
myocardial ischemia-reperfusion injury (9).
Myocardial cells themselves can produce TNF-␣ in the
isolated perfused heart under endotoxin treatment (10). Our
group previously reported that TNF-␣ is released from the
isolated heart undergoing ischemia and that this cytokine
production is directly correlated with the degree of myocardial dysfunction (11,12). Moreover, the administration of
monoclonal antibodies to TNF-␣ eliminates this cytokine
in effluent and attenuates the postischemic myocardial
injury (13).
One of the mechanisms suggested for TNF-␣ cardiac
contractile dysfunction is increased nitric oxide (NO) production by the myocardium, which causes depression of
cardiac function. In the heart, NO is synthesized from
L-arginine by two types of nitric oxide synthases (NOS):
endothelial (eNOS) and inducible (iNOS). A constitutive
1300
Paz et al.
Effect of TNF-␣ on eNOS and iNOS mRNA Expression
Abbreviations
CF
⫽
eNOS ⫽
iNOS ⫽
KH
⫽
LV
⫽
mRNA ⫽
NO
⫽
NOS ⫽
PCR
⫽
TNF-␣ ⫽
and Acronyms
coronary flow
endothelial nitric oxide synthase
inducible nitric oxide synthase
Krebs-Henseleit
left ventricular
messenger ribonucleic acid
nitric oxide
nitric oxide synthase
polymerase chain reaction
tumor necrosis factor-alpha
isoform of NOS, eNOS, which is calcium/calmodulin
regulated and was originally described in endothelial cells,
causes continuous NO production and plays an important
role in vascular tone regulation (14). The second type of
NOS described in cardiac myocytes is calcium-independent
iNOS, which can be activated by cytokines, leading to NO
overproduction and causing a negative inotropic effect,
probably by activation of the enzyme guanylate cyclase
(15,16). Some studies have found that cardiac myocytes
express both eNOS and iNOS (16)
Finkel et al. (17) demonstrated that NOS inhibition
prevents the myocardial-depressant effect of TNF-␣ and
concluded that the negative inotropic effect is mediated by
NO. Wang and Zweier (18) observed increased NO and
peroxinitrite release from the isolated rat heart after 30 min
of global ischemia. Pretreatment with the NOS inhibitors
resulted in a fourfold increase in postischemic functional
recovery. The role of NO in TNF-␣-induced myocardial
dysfunction, however, is highly controversial. Avontuur et
al. (19) showed that inhibition of NO synthesis causes
myocardial ischemia in endotoxemic rats. Yocoyama et al.
(4) reported that increased levels of NO did not mediate
TNF-␣-induced myocardial contractile abnormalities. In
another study, TNF-␣ showed no significant effect on NO
production in cultured cardiac myocytes (20). Lastly, NOS
inhibitors did not prevent a decrease of either intracellular
calcium or the amplitude of cell shortening caused by
TNF-␣ in isolated ventricular myocytes (21). Most of these
above-cited studies incorporated evidence provided indirectly by NOS inhibitors.
The present study investigated whether endogenous
(paracrine) TNF-␣ that was synthesized during global
cardioplegic ischemia and exogenous TNF-␣ given in perfusion solution have a direct influence on eNOS and iNOS
messenger ribonucleic acid (mRNA) expression and NO
release in the isolated rat heart.
METHODS
Male Wistar rats were anesthetized by intraperitoneal injection of pentobarbital sodium (30 mg/kg). Their hearts
were rapidly excised, immersed in cold saline (4°C),
mounted on the stainless-steel cannula of a modified Langendorff apparatus, and perfused with Krebs-Henseleit
JACC Vol. 42, No. 7, 2003
October 1, 2003:1299–305
(KH) solution exactly as detailed in four of our previously
reported studies (11–13).
Left ventricular (LV) hemodynamic parameters (peak
systolic developed pressure) and coronary flow (CF) were
continuously measured at 10-min intervals, and the first
derivative of the rise in LV pressure (dP/dtmax) and timepressure integral were calculated.
Ethics. All animals received humane care as described in
“Principles of Laboratory Animal Care” formulated by the
National Society for Medical Research and the “Guide for
the Care and Use of Laboratory Animals” prepared by the
National Academy of Sciences and published by the National Institutes of Health (NIH Publication No. 80-23,
revised 1985).
Experimental protocol. The rats were randomly divided
into two subgroups to assess the effect of 1-h global
cardioplegic ischemia on TNF-␣ and NO synthesis and
production. Control measurements were recorded after a
15-min period of stabilization (baseline). All hearts were
perfused thereafter for a 30-min period. Left ventricular
hemodynamic parameters were measured at 10-min intervals. Effluent for TNF-␣ and NO levels was withdrawn at
the end of the 30-min period (n ⫽ 8). Warm cardioplegia
was then administered for 2 min (37°C, perfusion pressure
73 mm Hg, KCl ⫽ 16 mEq/l in KH solution) followed by
a 60-min period of global ischemia at 31°C to the arrested
hearts (group A, n ⫽ 8).
Group B was similar to group A, but these rats received
polyclonal rabbit anti-rat TNF-␣ antibodies (anti-TNF-␣
Ab, n ⫽ 8). Concentration of anti-TNF-␣ Ab was selected
according to specific activity: approximately 1 ␮g of these
antibodies completely neutralized 25 pg of rat TNF-␣. We
found that the TNF-␣ level in effluent was 805 ⫾ 230
pg/ml after a 60-min period of global ischemia. We used 1.5
␮g/ml of anti-TNF-␣ antibodies (total dose 45 ␮g) for total
neutralization of TNF-␣ in the heart tissue, after which
TNF-␣ was not found in the effluent from the coronary
sinus of ischemic hearts.
The first milliliter of reperfusion effluent was withdrawn
at the end of ischemia to determine TNF-␣ and NO levels
in both groups. Additional hearts were assayed at baseline
(n ⫽ 7) and immediately at the end of ischemia (n ⫽ 7 for
each group) to determine LV TNF-␣, eNOS, and iNOS
mRNA expression.
Two additional subgroups (groups C and D) formed by
other rats were used to investigate the direct effect of
exogenous TNF-␣ on nonischemic perfused hearts. Control
measurements were recorded after a 15-min period of
stabilization. Thereafter, the hearts were perfused for a
60-min period with KH solution to which either saline
(group C, n ⫽ 10, “controls”) or 16 ng/ml (pathophysiological relevant concentration) TNF-␣ (group D, n ⫽ 7)
were added to KH solution using an infusion pump (0.5
ml/min). The dose of TNF-␣ was selected according the
results of group A’s postischemic TNF-␣ level measurements. Hemodynamic measurements were recorded every
Paz et al.
Effect of TNF-␣ on eNOS and iNOS mRNA Expression
JACC Vol. 42, No. 7, 2003
October 1, 2003:1299–305
1301
Table 1. Specification of the Primer Sets Used to Analyze Messenger Ribonucleic Acid Expression
Size
TNF-␣
Sense
Antisense
eNOS
Sense
Antisense
iNOS
Sense
Antisense
GAPDH
Sense
Antisense
Number of
Cycles
Annealing Temperature
(°C)
PCR Product
(bp)
CACGCTCTTCTGTCTACTGA
GGACTCCGTGATGTCTAAGT
30
57
546
CCGGAATTCGAATACCAGCCTGATCCATGGAA
GCCGGATCCTCCAGGAGGGTGTCCACCGCATG
45
65
614
GTGTTCCACCAGGAGATGTTG
CTCCTGCCCACTGAGTTCGTC
35
60
576
AATGCATCCTGCACCACCAA
GTAGCCATATTCATTGTCAT
30
60
515
Primer Set
eNOS ⫽ endothelial nitric oxide synthase; GAPDH ⫽ glyceraldehyde-phosphate dehydrogenase; iNOS ⫽ inducible nitric oxide synthase; PCR ⫽ polymerase chain reaction;
TNF-␣ ⫽ tumor necrosis factor–alpha.
10 min, and effluent was withdrawn to determine TNF-␣
and NO levels. Five hearts in each group were removed for
LV iNOS and eNOS mRNA assays immediately at the end
of the 60-min perfusion period.
TNF-␣ determination. Tumor necrosis factor-␣ levels
were detected in the effluent from the coronary sinus of the
isolated rat hearts. Tumor necrosis factor-␣ activity was
measured using the commercially available enzyme-linked
immunoassay kit Cytoscreen TM rat kit TNF-␣, Immunoassay kit (Biosource, Camarillo, California). The limit of
detection was 4 pg/ml.
NO measurement. Effluent nitrite (NO2)- and nitrate
(NO3)-stable metabolites of NO representing NO production were detected in the heart perfusate samples and
cardiac myocyte culture supernatant as described previously
(22). The limit of detection was 2 ␮mol/l.
Myocardial tissue TNF-␣, eNOS, and iNOS mRNA
determination. Immediately after stabilization (baseline)
or after 1 h of global cardioplegic ischemia, the LV
myocardium was excised and placed in cold Hank’s balanced
solution. Total RNA was extracted from myocardial samples using the guanidinium thiocyanate method (23). Ribonucleic acid pellets were maintained at ⫺20°C with 75%
ethanol until assay. Dried sediments were dissolved in sterile
RNAse free water and quantitated spectrophotometrically
at ␭ ⫽ 260 nm.
Reverse-transcription polymerase chain reaction (PCR)
amplification and quantitative analysis were prepared as
previously described (12). The primer sequences, annealing
temperature, number of cycles, and PCR product size are
listed in Table 1.
All TNF-␣, eNOS, and iNOS band intensities were
normalized by respective for glyceraldehyde-phospate dehydrogenase values. Each PCR reaction was performed at least
twice, and four to five hearts were used for each experimental group.
Drugs. Polyclonal rabbit anti-rat TNF-␣ Ab was purchased from R&D Systems (Minneapolis, Minnesota).
Specific activity was as follows: approximately 1 ␮g of these
antibodies completely neutralized 25 pg of rat TNF-␣.
Recombinant human TNF-␣ was purchased from Reprogen Ltd. (Rehovot, Israel).
Statistics. The results are presented as mean ⫾ SD. All
hemodynamic measurements were subjected to two-way
analysis of variance with repeated measures. This design
includes one between-subject factor (the experimental
group) and one within-subject factor (the time of measurement). Whenever a significant time trend was demonstrated, we used contrast analysis to compare each measurement to its successive one (SIMPLE; SPSS Inc., Chicago,
Illinois). Only one contrast was used to eliminate the
problem of multiple comparisons. Student t tests were used
to assess significant differences between relative optical
densities of the mRNA bands in groups and between
groups. Significance was established at p ⬍ 0.05. All
statistical analyses were performed by the Statistical Department at our Medical Center.
RESULTS
The baseline values (groups A and B) for different LV
hemodynamic parameters are given in Table 2. No significant differences were found between the experimental
groups. A two-way analysis of variance (comparing group
means and group-time interaction) was conducted to reveal
possible differences in LV hemodynamic parameters for the
experimental groups before cardioplegic ischemia (baseline
values, 10, 20, and 30 min perfusion); none of the p values
attained statistical significance.
Table 2. Baseline Measurements
Group A
Peak systolic pressure
dP/dtmax (mm Hg/s)
Time-pressure integral
Coronary flow (ml/min)
121 ⫾ 4
4015 ⫾ 381
8.3 ⫾ 0.5
17.6 ⫾ 0.7
Group B
123 ⫾ 5 (mm Hg)
4176 ⫾ 174
8.5 ⫾ 0.7 (mm Hg ⫻ s)
18.6 ⫾ 1.2
Data presented as mean values ⫾ SE. All variables were identical for all groups of
hearts (p ⫽ nonsignificant).
dP/dt max ⫽ first derivative of the rise of left ventricular pressure.
1302
Paz et al.
Effect of TNF-␣ on eNOS and iNOS mRNA Expression
Effect of global cardioplegic ischemia on TNF-␣, eNOS,
and iNOS mRNA expression. The baseline TNF-␣
mRNA expression that had been detected in LV specimens
after a period of stabilization and that did not change after
a 90-min period of nonischemic perfusion served as an
additional control (n ⫽ 7) to the postischemic TNF-␣,
iNOS, and eNOS mRNA measurements. Intensities of the
bands at baseline and at the end of perfusion were 0.55 ⫾
0.2 and 0.53 ⫾ 0.1, respectively (p ⫽ NS, Fig. 1A). One
hour of global cardioplegic ischemia led to a 1.6-fold
increase of TNF-␣ mRNA expression, which was significantly higher than the levels detected in nonischemic,
normally perfused hearts (p ⬍ 0.003, Fig. 1A).
Baseline eNOS and iNOS mRNA expression was detected in LV samples after a period of stabilization and did
not change after a 90-min period of nonischemic perfusion
(Fig. 1B and 1C). No upregulation of iNOS mRNA
expression was registered in postischemic LV myocardial
tissue compared with baseline values or after a 90-min
period of nonischemic perfusion. There was, however, a
significant downregulation of eNOS mRNA expression (p
⬍ 0.01, Fig. 1C) after 1 h of global cardioplegic ischemia.
Effect of global cardioplegic ischemia on TNF-␣ and
NO release. Tumor necrosis factor-␣ was not detected in
the myocardial effluent after 15 min of stabilization, before
ischemia (after 30 min of perfusion), or after 90 min of
normal nonischemic perfusion. Significant amounts of
TNF-␣ were detected in the effluent after 1 h of global
cardioplegic ischemia upon the first minute of reperfusion
(805 ⫾ 230 pg/ml). The NO2 and NO3 values in the
effluent from isolated perfused hearts in all groups were
below detectable levels.
Effect of TNF-␣ depletion on myocardial TNF-␣,
eNOS, and iNOS mRNA expression and release. AntiTNF-␣ Ab was added to the cardioplegic solution to
neutralize TNF-␣ in the ischemic heart. In hearts treated
with anti-TNF-␣ Ab, TNF-␣ mRNA expression was at
basal levels after 1 h of global ischemia (Fig. 1A), which was
significantly lower than the levels detected in untreated
ischemic hearts.
There was an increase of eNOS mRNA in the ischemic
heart pretreated with anti-TNF-␣ Ab compared with untreated ischemic hearts (1.07 ⫾ 0.1 and 0.67 ⫾ 0.2,
respectively, p ⬍ 0.01). There were no significant differences in iNOS mRNA band intensities between antiTNF-␣ Ab-treated and control hearts (Fig. 1B and 1C).
Tumor necrosis factor-␣ protein production and NO2 and
NO3 in the effluent from the ischemic hearts treated with
anti-TNF-␣ Ab were below detectable levels.
Effect of exogenous TNF-␣ on LV hemodynamic performances. No significant differences in baseline values for
LV hemodynamic parameters were found between groups
C and D (Fig. 2). Hearts treated with TNF-␣ demonstrated
a significant deterioration in all hemodynamic measurements after only 10 min of perfusion (Fig. 2) and, after 60
min of TNF-␣ treatment, peak-systolic pressure fell to 45.1
JACC Vol. 42, No. 7, 2003
October 1, 2003:1299–305
Figure 1. Effects of global cardioplegic ischemia on myocardial tumor
necrosis factor-␣ (TNF-␣) (A), endothelial nitric oxide synthase (eNOS)
(B), and inducible nitric oxide synthase (iNOS) (C) mRNA expression:
relative optical densities of polymerase chain reaction signals. Data were
normalized to the glyceraldehyde 3-phosphate dehydrogenase (GAPDH)
polymerase chain reaction signal. Shown are samples of left ventricular
myocardium withdrawn at the end of stabilization [1], after ischemia [2],
after ischemia with anti-TNF-␣ antibodies in the cardioplegia [3], and
after 90 min of normal nonischemic perfusion [4].
JACC Vol. 42, No. 7, 2003
October 1, 2003:1299–305
Paz et al.
Effect of TNF-␣ on eNOS and iNOS mRNA Expression
1303
Figure 2. Effect of exogenous tumor necrosis factor-␣ on hemodynamic performance of isolated rat hearts during 1 h of perfusion: control group (open
circles) and hearts treated with tumor necrosis factor-␣ (black circles), p ⬍ 0.0001 (analysis of variance) for all measurements vs. control.
⫾ 3.7%; dP/dtmax to 51.8 ⫾ 5.5%, time-pressure integral to
73.5 ⫾ 4.8%, and CF to 54.7 ⫾ 2.8% (p ⬍ 0.001 for all
measurements compared with baseline). The decrease of LV
function parameters in TNF-␣-treated hearts was significant compared wit untreated hearts (Fig. 2, p ⬍ 0.0001 for
all measurements).
Effect of exogenous TNF-␣ on eNOS and iNOS mRNA
expression. Endothelial nitric oxide synthase mRNA expression in LV specimens after a period of stabilization did
not change after a 60-min period of nonischemic perfusion,
but 60 min of TNF-␣ treatment led to significant downregulation of eNOS mRNA expression (Fig. 3A; p ⬍ 0.01).
There were no significant differences in iNOS mRNA band
intensities between TNF-␣-treated and control hearts
(Fig. 3B).
DISCUSSION
In the present study, we have demonstrated that endogenous (i.e., released during ischemia) and exogenous TNF-␣
cause depression of LV function associated with undetect-
able NO levels in the effluent from the heart, unchanged
iNOS mRNA expression, and eNOS mRNA downregulation.
The role of TNF-␣ in cardiac dysfunction. Tumor necrosis factor-␣ is an essential mediator of the profound
cardiovascular changes observed during the shocked state
associated with bacterial sepsis and its experimental counterpart, endotoxic shock (24,25). Recent investigations have
confirmed that the TNF-␣ levels were increased in patients
with congestive heart failure and demonstrated a direct
relationship between circulating levels of TNF-␣ and clinical features of the disease (26). Tumor necrosis factor-␣
also plays an important role in reperfusion injury after
myocardial revascularization (27). Tumor necrosis factor-␣
is synthesized and released from the isolated heart undergoing ischemia (11,12). The results of current experiments
support this previous observation. Immunohistochemical
studies localized TNF-␣ in ischemic hearts to cardiac
myocytes and endothelial cells (13). The myocardium has
been shown to be a major source of TNF-␣ in patients
undergoing cardiopulmonary bypass (in vivo acute global
1304
Paz et al.
Effect of TNF-␣ on eNOS and iNOS mRNA Expression
Figure 3. Effect of exogenous tumor necrosis factor-␣ on myocardial
endothelial nitric oxide synthase (eNOS) (A) and inducible nitric oxide
synthase (iNOS) (B) messenger ribonucleic acid expression: relative optical
densities of polymerase chain reaction signals. Data were normalized to
glyceraldehyde 3-phosphate dehydrogenase (GAPDH) polymerase chain
reaction signal. Samples of left ventricular myocardium withdrawn at the
end of stabilization [1], after 1-h perfusion with normal Krebs-Henseleit
solution [2], and after 1 h of perfusion with tumor necrosis factor-␣ [3].
ischemia) (28). A blood-free model was intentionally used
in this study to exclude the possibility of involvement of
systemic blood factors in endogenous TNF-␣ and NO
formation and in exogenous TNF-␣ action on the heart. A
model of cardioplegic ischemia was chosen because of the
extensive use of cardioplegic solutions in cardiopulmonary
bypass.
The cardiac depressant effect of TNF-␣ on an isolated
myocardium was previously shown with relatively high
concentrations of this cytokine (17,29). In the present study,
perfusion with TNF-␣ in a low, pathophysiologically relevant concentration led to a significant decrease of LV
peak-systolic pressure, dP/dtmax, and time-pressure integral.
Mechanisms of TNF-␣ action. The exact mechanisms
responsible for TNF-␣-induced cardiac damage are controversial (30). Several mechanisms have been suggested to
cause TNF-␣-induced myocardial dysfunction. Tumor necrosis factor-␣ decreases the intracellular free calcium and
leads to dysfunctional excitation-contraction coupling, causing systolic/diastolic dysfunction (4,21). Several in vitro and
in vivo studies have shown involvement of sphingosine in
JACC Vol. 42, No. 7, 2003
October 1, 2003:1299–305
TNF-␣-mediated cardiac depression (29,31). Tumor necrosis factor-␣ induces apoptosis (programmed cell death) in
various cell types, including cardiac myocytes (2,31). Other
possible mechanisms are direct cytotoxicity and oxidant
stress (30).
Current hypothesis. Some previous studies using NO
synthesis inhibitors confirm that NO is responsible for
TNF-␣-induced negative inotropism (17,18). It is proposed
that TNF-␣ stimulates iNOS which, in turn, controls the
conversion of L-arginine to NO. Excessive production of
NO by cardiomyocytes causes contractile dysfunction and
depression of cardiac function.
Recent investigations, however, have shown that the
NOS inhibitors do not ameliorate the decreased contractility of isolated perfused hearts observed with TNF-␣ (29).
Tumor necrosis factor-␣ had no significant effect on NO
and cGMP production in cultured cardiac myocytes (20). In
a model of isolated cardiac myocytes, NOS inhibitors do not
attenuate the negative inotropic effect of TNF-␣, and
incubation with TNF-␣ did not increase NO and cGMP
production (4). NOS inhibitors did not prevent a decrease
in either intracellular calcium or the amplitude of cell
shortening caused by TNF in isolated ventricular myocytes
(21). In addition, it has been shown that the massive
cardiospecific overexpression of iNOS in transgenic mice is
not associated with deleterious effects on cardiac hemodynamics and energetics (32). The participation of eNOS
mRNA expression in cardiodepressant action of TNF-␣ has
not been investigated in depth.
New insights. The present study clearly has demonstrated
that endogenous (paracrine) TNF-␣ synthesized during 1 h
of global cardioplegic ischemia or exogenous TNF-␣ added
for 1 h to perfusion solution does not increase iNOS mRNA
expression and NO release in the isolated rat heart. In the
present study, we have demonstrated that the endogenous
and exogenous TNF-␣ caused a decrease in eNOS mRNA
expression. Moreover, depletion of TNF-␣ with antiTNF-␣ Ab resulted in an increase in eNOS mRNA in the
ischemic heart compared with untreated ischemic hearts,
recovering eNOS mRNA expression to baseline levels.
We have shown that CF significantly decreased after 1 h
of perfusion with a TNF-␣-containing solution. Previous
experiments demonstrated that TNF-␣ caused coronary
constriction in the rat heart, which might accentuate direct
negative inotropic action of TNF-␣ (29). In the current
study, we found that eNOS mRNA downregulation in
hearts undergoing ischemia or TNF-␣ perfusion may lead
to a decrease in endothelial NO production, coronary
vasoconstriction, and a decrease of CF. This might be one
of the possible mechanisms of TNF-␣-induced cardiodepressant action. It is theoretically possible that a more
prolonged (3 to 6 h) TNF-␣ influence could lead to a
change in iNOS mRNA expression, but this duration would
be considered excessive in a model such as ours.
Study limitations. Our study had several limitations. First,
it was performed in vitro. Second, nonblood perfusion
JACC Vol. 42, No. 7, 2003
October 1, 2003:1299–305
excluded an influence of blood immunological and proinflammatory factors and also excluded the influence of several
types of blood cells that are an important source of TNF-␣
and NO. Caution must be exercised when drawing direct
clinical conclusions from the use of anti-TNF-␣ Ab in a
clinical setting because our study was performed on an
isolated rat heart model.
Conclusions. This study demonstrated that endogenous
(i.e., released during ischemia) and exogenous TNF-␣ do
not influence iNOS mRNA expression and that they do not
enhance NO release. This study did reveal eNOS mRNA
downregulation in the isolated rat heart. Depletion of
endogenous TNF-␣ caused by anti-TNF-␣ Ab led to the
decrease of TNF-␣ mRNA expression, the elimination of
TNF-␣ protein from effluent solution, and an increase in
eNOS mRNA expression to baseline levels in ischemic
hearts. These findings suggest that eNOS downregulation
occurs as a result of endogenous TNF-␣ synthesis. We
hypothesize that the TNF-␣-related eNOS mRNA downregulation that is associated with CF decreases and that LV
dysfunction may be one of the mechanisms of TNF-␣mediated myocardial depression.
Acknowledgments
The authors thank Esther L. Shabtai, MSc, for statistical
assistance and Esther Eshkol, MA, for editorial assistance.
Reprint requests and correspondence: Dr. Inna Frolkis, Department of Thoracic and Cardiovascular Surgery, Tel Aviv Sourasky
Medical Center, 6 Weizmann Street, Tel Aviv 64239, Israel.
E-mail: [email protected].
REFERENCES
1. Aggarwal B, Natarjan K. Tumor necrosis factor: development during
the decade. Eur Cytokine Netw 1996;7:93–124.
2. Meldrum DR. Tumor necrosis factor in the heart. Am J Physiol
1998;274:R577–95.
3. Pagani FD, Baker LS, His C, Knox M, Fink MP, Visner MS. Left
ventricular systolic and diastolic dysfunction after infusion of tumor
necrosis factor-alpha in conscious dogs. J Clin Invest 1992;90:389 –98.
4. Yokoyama T, Vaca L, Rossen RD, Durante W, Hazarika P, Mann
DL. Cellular basis for the negative inotropic effect of tumor necrosis
factor-alpha. J Clin Invest 1993;92:2303–12.
5. Parker MM, McCarty KE, Ognibene FP, Parrillo JE. Right ventricular dysfunction and dilatation, similar to left ventricular changes,
characterize the cardiac depression of septic shock in humans. Chest
1990;97:126 –31.
6. Ellrodt AG, Riedinger MS, Kimchi A, et al. Left ventricular performance in septic shock: reversible segmental and global abnormalities.
Am Heart J 1985;110:402–9.
7. Frangogiannis NG, Lindsey ML, Michael LH, et al. Resident cardiac
mast cells degranulate and release preformed TNF-alpha, initiating the
cytokine cascade in experimental canine myocardial ischemia/
reperfusion. Circulation 1998;98:699 –710.
8. Kupatt C, Habazettl H, Goedecke A, et al. Tumor necrosis factoralpha contributes to ischemia- and reperfusion-induced endothelial
activation in isolated hearts. Circ Res 1999;84:392–400.
9. Maekawa N, Wada H, Kanda T, et al. Improved myocardial ischemia/
reperfusion injury in mice lacking tumor necrosis factor-␣. J Am Coll
Cardiol 2002;39:1229 –35.
Paz et al.
Effect of TNF-␣ on eNOS and iNOS mRNA Expression
1305
10. Kapadia S, Lee J, Torre AG, Birdsall HH, Ma TS, Mann DL. Tumor
necrosis factor-alpha gene and protein expression in adult feline
myocardium after endotoxin administration. J Clin Invest 1995;96:
1042–52.
11. Gurevitch J, Frolkis I, Yuhas Y, et al. Tumor necrosis factor-alpha is
released from the isolated heart undergoing ischemia and reperfusion.
J Am Coll Cardiol 1996;28:247–52.
12. Frolkis I, Gurevitch J, Yuhas Y, et al. Interaction between paracrine
tumor necrosis factor-alpha and paracrine angiotensin II during
myocardial ischemia. J Am Coll Cardiol 2001;385:729 –33.
13. Gurevitch J, Frolkis I, Yuhas Y, et al. Anti-tumor necrosis factor-alpha
improves myocardial recovery after ischemia and reperfusion. J Am
Coll Cardiol 1997;30:1554 –61.
14. Buockley BS, Mirza Z, Whorton AR. Regulation of Ca2⫹ dependent
nitric oxide synthase in bovine aortic endothelial cells. Am J Physiol
1995;269:C757–65.
15. Joe IK, Schussheim AE, Longrois D, et al. Regulation of cardiac
myocytes contractile function by inducible nitric oxide synthase
(iNOS): mechanisms of contractile depression by nitric oxide. J Mol
Cell Cardiol 1998;30:303–15.
16. Balligand JL, Kobzik L, Han X, et al. Nitric oxide-dependent
parasympathetic signaling is due to activation of constitutive endothelial (type III) nitric oxide synthase in cardiac myocytes. J Biol Chem
1995;270:14582–6.
17. Finkel MS, Oddis CV, Jacob TD, Watkins SC, Hattler BG, Simmons
RL. Negative inotropic effect of cytokines on the heart mediated by
nitric oxide. Science 1992;257:387–9.
18. Wang P, Zweier JL. Measurement of nitric oxide and peroxinitrite
generation in the postischemic heart: evidence of peroxinitritemediated reperfusion injury. J Biol Chem 1996;271:29223–30.
19. Avontuur JAM, Bruining HA, Ince S. Inhibition of nitric oxide
synthesis causes myocardial ischemia in endotoxemic rats. Circ Res
1995;76:418 –25.
20. Shindo T, Ikeda U, Ohkawa F, Kawahara Y, Yokoyama M, Shimada
K. Nitric oxide synthesis in cardiac myocytes and fibroblasts by
inflammatory cytokines. Cardiovasc Res 1995;29:813–9.
21. Sugishita K, Kinugawa K, Shimizu T, et al. Cellular basis for the acute
inhibitory effect of IL-6 and TNF-alpha on excitation-contraction
coupling. J Mol Cell Cardiol 1999;31:1457–67.
22. Pevni D, Frolkis I, Iaina A, et al. Protamine cardiotoxicity and nitric
oxide. Eur J Cardiothorac Surg 2001;20:147–52.
23. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: extraction of
RNA with guanidinium thiocyanate followed by centrifugation in
serum chloride solution. In: Nolan SH, editor. Laboratory Manual.
Book 1, Cold Spring Harbor Laboratory Series. New York, NY: Cold
Spring Harbor, 1989:719 –32.
24. Tracay KJ, Beutler B, Lowry SF, et al. Shock and tissue injury induced
by recombinant human cachectin. Science 1986;234:470 –4.
25. Mathison JS, Wolfson E, Ulevitch RJ. Participation of tumor necrosis
factor in the mediation of gram negative bacterial lipopolysaccharideinduced injury in rabbits. J Clin Invest 1988;81:1925–37.
26. Packer M. Is tumor necrosis factor an important neurohormonal
mechanism in chronic heart failure? Circulation 1995;92:1382–97.
27. Wei M, Kuukasjarvi P, Laurikka E, et al. Inflammatory cytokines and
soluble receptors after coronary artery bypass grafting. Cytokines
2001;15:223–8.
28. Meldrum DR, Meng X, Dinarello CA, et al. Human myocardial tissue
TNF-alpha expression following acute global ischemia in vivo. J Mol
Cell Cardiol 1998;30:1683–9.
29. Edmuds NJ, Lal H, Woodward B. Effect of tumor necrosis factor-␣
on left ventricular function in the rat isolated perfused heart: possible
mechanisms for a decline in cardiac function. Br J Pharmacol 1999;
126:189 –96.
30. Retter AS, Frishman WH. The role of tumor necrosis factor in cardiac
disease. Heart Disease 2001;3:319 –25.
31. Hakan O, Dorn GW, Mann DL. Sphingosine mediates the immediate negative inotropic effect of tumor necrosis factor-␣ in the adult
cardiac myocyte. J Biol Chem 1997;272:4836 –42.
32. Heger J, Gödecke A, Flögel U, et al. Cardiac-specific overexpression of
inducible nitric oxide synthase does not result in severe cardiac
dysfunction. Circ Res 2002;90:93–9.