Download Regulatory Mechanisms Of Pathogen-Mediated Cellular

REGULATORY MECHANISMS OF PATHOGEN-MEDIATED CELLULAR STRESS
SIGNALING IN ARABIDOPSIS THALIANA
by
J. LUCAS BOATWRIGHT
KAROLINA MUKHTAR, COMMITTEE CHAIR
JAMES COKER
SHAHID MUKHTAR
KATRINA RAMONELL
A THESIS
Submitted to the graduate faculty of The University of Alabama at Birmingham,
in partial fulfillment of the requirements for the degree of
Master of Science
BIRMINGHAM, ALABAMA
2013
ii
REGULATORY MECHANISMS OF PATHOGEN-MEDIATED CELLULAR STRESS
SIGNALING IN ARABIDOPSIS THALIANA
LUCAS BOATWRIGHT
BIOLOGY
ABSTRACT
SA is a vital signaling molecule responsible for activation of plant defenses
against various pathogen infections. Pathogen detection activates salicylic acid (SA)
biosynthesis which is paramount to local and systemic acquired resistance in addition to
pathogenesis-related (PR) protein accumulation. Recently, NPR1, NPR3 and NPR4 were
identified as SA binding proteins and signal transducers; however, conflicting results
have been obtained concerning the nature of NPR1 as a SA receptor. These, and other,
SA signaling pathways are often heavily influenced by phytohormone crosstalk, whether
by inhibiting or potentiating effects.
Pathogenic infection can additionally activate defense responses that require
increased protein synthesis and folding demands to be facilitated by the endoplasmic
reticulum (ER). These increased demands may result in an overload of unfolded or
misfolded proteins, which cause ER stress and activate signal transduction pathways.
Collectively, these responses compose the unfolded protein response (UPR) and are
responsible for restoring cellular homeostasis. In Arabidopsis, two homologs of Inositolrequiring enzyme 1, basic leucine zipper 17 and 28 (bZIP17, bZIP28) and GCN2 (general
control nonrepressed 2) appear to be key components of UPR stress-sensing pathways.
Many metazoan disorders have been linked to chronic ER stress; however, the plant
immune functions regulated by Inositol-requiring enzyme 1 (IRE1) and GCN2 are not
well understood.
iii
The role of UPR in the regulation of Arabidopsis hormone signaling pathways is
also not well understood. SA signaling has been linked to UPR in both Arabidopsis and
rice. However, Arabidopsis does not possess a known functional homologue to the
intermediary rice protein responsible for SA-UPR crosstalk. Thus, the integrated nature
of pathogen infection, ER stress, phytohormone signaling and cell death will be studied
in light of current research. We demonstrate that Arabidopsis UPR can be activated by
exogenous application of SA, indicating crosstalk between UPR and the plant hormone
SA. In rice, UPR has recently been shown to regulate cell death control via caspase
activation. Here, I demonstrate that Arabidopsis cell death control mechanisms may be
executed by Arabidopsis IRE1 and GCN2 as indicated by deficient ion leakage and
caspase-like activity after avirulent pathogen infection.
Key Words: Unfolded protein response—IRE1—bZIP60—Arabidopsis—Endoplasmic
reticulum—GCN2—Salicylic acid
iv
DEDICATION
To my loving and supporting wife, Christine Boatwright, parents, Cecil and Ellen
Boatwright, and in-laws, Mark and Sharon Taylor, who provide unconditional support
and guidance throughout my education.
v
ACKNOWLEDGEMENTS
First, I would like to thank my committee members: Drs. Karolina Mukhtar,
Shahid Mukhtar, James Coker and Katrina Ramonell. Their assistance and expertise were
indispensable to the success of my research. I would also like to acknowledge the funding
resources for these projects in all or part: the Hargitt Fellowship to Karolina Mukhtar,
University of Alabama Birmingham Gulf Oil Response Pilot Grants to Shahid and
Karolina Mukhtar, University of Alabama Birmingham Faculty Development Grant to
Karolina Mukhtar as well as the University of Alabama at Birmingham Department of
Biology. I would also like to thank Asim Bej for always being open to listen to questions,
as well as Steve Watts, for his guidance and the use of his lab equipment during my
graduate studies. Additionally, I would like to acknowledge all of members of the
Mukhtar lab and UAB Biology Department that assisted me on various projects and gave
both time and energy toward making this possible.
vi
TABLE OF CONTENTS
Page
ABSTRACT………………....……………………………………………………….......iii
DEDICATION…..….……………….………………………………………………….vi
ACKNOWLEDGEMENTS…………………………………………………………....vii
LIST OF TABLES………………………………………………………………..…….ix
LIST OF FIGURES……….…………………...…………………………………….…...x
GENERAL INTRODUCTION…….……………………………………………………...1
SALICYLIC ACID: AN OLD HORMONE UP TO NEW TRICKS.…............................5
EUKARYOTIC ENDOPLASMIC RETICULUM STRESS-SENSING
MECHANISMS………………………………………………………………….……....50
IRE1/bZIP60-MEDIATED UNFOLDED PROTEIN RESPONSE PLAYS DISTINCT
ROLES IN PLANT IMMUNITY AND ABIOTIC STRESS RESPONSES ...…….…...77
NOVEL FUNCTIONS OF IRE1 AND GCN2 IN CELL DEATH CONTROL……….127
FINAL DISCUSSION……………………………………………………………….…178
GENERAL REFERENCES……………………………………………………….....…179
APPENDIX A……………………………………………………………………….….184
APPENDIX B………………………………………………………………………..…202
vii
LIST OF TABLES
Table
Page
APPENDIX A
1
List of primers in Chapter 1………………..………………………………….200
APPENDIX B
1
Sample specifics for Illumina-based next-generation sequencing…………….204
viii
LIST OF FIGURES
Figure
Page
SALICYLIC ACID: AN OLD HORMONE UP TO NEW TRICKS
1
A model for SA perception in planta pathways………………………...………..31
2
An overview of the salicylic acid signalling pathways…………………………..33
EUKARYOTIC ENDOPLASMIC RETICULUM STRESS-SENSING
MECHANISMS
1
Eukaryotic Unfolded Protein Response pathways.………………..…………….59
IRE1/bZIP60-MEDIATED UNFOLDED PROTEIN RESPONSE PLAYS
DISTINCT ROLES IN PLANT IMMUNITY AND ABIOTIC STRESS
RESPONSES
1
IRE1 is involved in abiotic stresses………….…………………………...…..….97
2
UPR-responsive genes and PR1 secretion is affected in ire1
mutants….…….…….....……………………………………..……...…...….......99
3
IRE1 is required to mount effective systemic acquired
resistance..…………………………………………….....……………………...101
4
bZIP60 mRNA splicing is stimulated by chemicals that trigger the UPR…......103
ix
Figure
Page
5
T-DNA insertions in both IRE1 genes affectbZIP60 processing under ER stress
conditions…………………………………………….………………..………..105
6
Salicylic acid stimulates bZIP60 processing………..……………………...…..107
7
SA-induced up-regulation of UPR responding genes is altered in ire1 and bzip60
mutants…………………………………………………………………….....…109
8
bZIP60 is involved in plant defense…………………….....……………………111
NOVEL FUNCTIONS OF IRE1 AND GCN2 IN CELL DEATH CONTROL
1
IRE1: a life-or-death switch…………………………………………………….145
2
gcn2 Mutant Screen Spanning Exon 1 to Exon 2………………………………147
3
gcn2 Mutant Screen Spanning Exon 1 to Exon 3………………………………147
4
Qualitative analysis of A. brassicicola growth on Ler and gcn2-1 plants……..150
5
qPCR Analysis of A. brassicicola Proliferation………………………………..151
6
Enhanced Disease Resistance Assay of Ler and gcn2-1 plants…………...……152
7
Preliminary Ion Leakage Data on gcn2-1…………………………………........153
8
Caspase-like activity on Ac-YVAD-MCA substrate in the Arabidopsis gcn2-1
mutant…………………………………………………………………………..154
9
Preliminary Ion Leakage Data on ire1 lines……………………………………155
10 Caspase-like activity on Ac-YVAD-MCA substrate in the Arabidopsis IRE1
mutants…………………………………………………………………………156
x
Figure
Page
11 miR5658 is Specifically Induced During Cell Death Induced by Psm
avrRpm1…………………………………………………………………….…..158
12 Expression of bZIP60 and miR5658……………………………………………160
APPENDIX A
1
Schematic representation of the T-DNA insertion sites in the ire1a and ire1b
mutants………………………………………………………………………….184
2
IRE1b transcript accumulation in IRE1b RNAi lines in Col-0 and ire1a-2……186
3
Tunicamycin sensitivity of IRE1b RNAi lines…………………………………187
4
PR1 secretion in IRE1b RNAi lines…………………………………………….188
5
Enhanced disease susceptibility test on IRE1b RNAi lines…………………….189
6
Establishment of systemic acquired resistance in IRE1b RNAi lines………….190
7
Prediction of stem-loop structures observed in XBP-1, HAC1 and bZIP60
mRNA…………………………………………………………………………..191
8
Sequence prediction of spliced and unspliced bZIP60 forms…………………..192
9
Quantitative measurement of bZIP60 Tm-induced splicing activity in IRE1b
RNAi lines……………………………………………………………………...193
10 bZIP60 processing upon diverse abiotic and biotic stresses……………………194
11 bZIP60 processing upon SA treatment in wild-type and ire1a ire1b double mutant
plants……………………………………………………………………………195
12 Pathogen infection- and SA-dependent bZIP60 splicing activity………………196
xi
Figure
Page
13 bZIP60 transcript accumulation in Col-0 and various ire1 mutants upon SA or
pathogen treatment……………………………………………………………...197
14 Total and secreted PR1 protein accumulation in bzip60 plants………………...198
15 UPR stress tolerance in bzip60 seedlings……………………...………….....…199
xii
GENERAL INTRODUCTION
Stress-mediating Mechanisms in Arabidopsis
The evolution of plant defenses is of vital importance to understanding the plantpathogen arms race. Over time, these organisms have adapted to ever changing demands
for survival (Boller & He, 2009). Plant defense mechanisms restricting pathogen ingress
are divided into two main branches (Jones & Dangl, 2006). The first branch depends
upon the recognition of Pathogen-Associated Molecular Patterns (PAMPs) by
Nucleotide-Binding Leucine Rich Repeats (NB-LRR). NB-LRRs are responsible for
detecting PAMPs either directly or indirectly, by their modifications. Upon PAMP
recognition, NB-LRRs initiate a signaling cascade that activates plant defenses (He et al.,
2007). In response to these adaptations, pathogens have developed determinants to
suppress plant immunity, such as effectors. Pathogen effectors may be secreted into the
plant to inhibit defense pathways and promote plant susceptibility known as EffectorTriggered Susceptibility (ETS) (Dodds & Rathjen, 2010). Plants defend against effectors
with the second branch of plant defense, Effector-Triggered Immunity (ETI). In this
scenario, plants detect effectors using Resistance (R) proteins and activate a separate line
of defense that bypasses effector suppression and reestablishes plant defense (Chisholm
et al., 2006).
ETI is often characterized by an early defense response that regulates
Programmed Cell Death (PCD) as part of an attempt to restrict pathogen growth, known
as the hypersensitive response (HR) (Gohre & Robatzek, 2008). During HR, progression
1
to PCD moves through several preliminary stages. In the first stage of HR, ion leakage
occurs in the form of calcium and hydrogen influx along with hydroxide and potassium
efflux (Heath, 2000). The oxidative burst composes the second stage and is characterized
by the production of Reactive Oxygen Species (ROS) such as superoxide anions,
hydrogen peroxide, nitric oxide and hydroxyl radicals which ultimately cause lipid
peroxidation and other oxidative damage (Apel & Hirt, 2004). During the final stage of
HR, ROS cause the breakdown of cellular components, cross-linking between cell walls
and progression to cell death. Cell death is also characterized by necrotic lesions, which
isolate infected cells from healthy cells (Van Breusegem & Dat, 2006).
Plants will also up-regulate expression of the plant hormone salicylic acid (SA)
both locally and systemically in response to pathogen detection (Durrant & Dong, 2004).
The accumulation of SA locally leads to Local Acquired Resistance (LAR) with systemic
accumulation leading to Systemic Acquired Resistance (SAR). Both LAR and SAR
exhibit increased production and secretion of plant defense proteins such as PR proteins
with NPR1 acting as a key regulator of PR1 expression and SAR establishment (Fu &
Dong, 2013). Recently, multiple members of the NPR family of proteins have been
shown to facilitate SA binding and may jointly regulate pathogen-specific defense
responses (Fu et al., 2012, Wu et al., 2012).
Pathogenic infection may also activate defense responses which result in an
accumulation of unfolded or misfolded proteins (Vitale & Boston, 2008). Nascent protein
synthesis and folding demands exceeding endoplasmic reticulum (ER) capabilities exert
stress on the ER and activate stress-relieving responses, jointly referred to as the
Unfolded Protein Response (UPR). Activation of UPR signaling pathways is necessary
2
for cells to recover homeostatic functions (Martinez & Chrispeels, 2003). These UPR
pathways are ER membrane-spanning and suppressed under non-stress conditions by ER
chaperones which bind onto the ER luminal domains. Once unfolded proteins begin to
accumulate in the ER, these chaperones dissociate to facilitate protein folding, allowing
activation of the transmembranous signaling proteins (Schroder & Kaufman, 2005b). In
plants, these UPR proteins include two homologs of IRE1 (Inositol-requiring enzyme 1),
bZIP17, bZIP28 and GCN2. While metazoan homologues of the plant UPR proteins have
been linked to a multitude of disorders, their functions in plant immunity are only
recently receiving attention (Duffee et al., 2012).
The role of UPR in the regulation of other plant cellular responses is not well
understood; however, UPR has been recently linked to the SA pathway in Arabidopsis as
well as rice (Moreno et al., 2012, Hayashi et al., 2012). In Arabidopsis, this is
demonstrated by the induction of IRE1 expression in plants treated with SA (Moreno et
al., 2012); whereas, in rice, this is demonstrated by the simultaneous activation of ER and
SA stress responses which inhibited the expression of ER stress-responsive genes
(Shimono et al., 2007, Hayashi et al., 2012).
As research on Arabidopsis continues, we are finding more crosstalk between
various plant regulatory pathways (Gazzarrini & McCourt, 2003, Spoel & Dong, 2008b).
I hope to elucidate some of the regulatory mechanisms of pathogen-mediated cellular
stress signaling and how they affect plant survival.
3
4
Chapter 1
SALICYLIC ACID: AN OLD HORMONE UP TO NEW TRICKS
REVIEW
Jon Lucas Boatwright 1, Karolina Pajerowska-Mukhtar1
1
University of Alabama at Birmingham
Department of Biology
Birmingham, AL 35294
In revision at Molecular Plant Pathology
Format adapted for thesis
5
Abstract— Salicylic acid (SA) acts as a signalling molecule in plant defence
against biotrophic and hemibiotrophic phytopathogens. The biosynthesis of SA upon
pathogen detection is essential for local and systemic acquired resistance as well as
accumulation of pathogenesis-related (PR) proteins. SA biosynthesis can occur via
several different substrates, but is predominantly accomplished by isochorismate synthase
(ICS1) upon pathogen recognition. The roles of BTB domain-containing proteins: NPR1,
NPR3, and NPR4 in SA binding and signal transduction have recently been re-examined
and are elaborated upon in this review. The pathogen-mediated manipulation of SAdependent defences as well as the crosstalk between the SA signalling pathway, other
plant hormones and defence signals is also discussed in consideration of recent research.
Furthermore, the recent link established between SA, pathogen-triggered endoplasmic
reticulum stress and the unfolded protein response are highlighted.
Key Words: salicylic acid, plant defence, NPR1, NPR3, NPR4, phytohormones, jasmonic
acid, UPR, coronatine, crosstalk
6
Introduction
The medicinal effects of salicylic acid (SA) have been studied in humans for well
over two centuries. It is well known that chewing the leaves or bark of the willow tree
(Salix), rich in salicylic acid, can relieve fevers, pain and inflammation (Maclagan 1876;
Vlot et al. 2009). However, the roles of SA in the plant system were only described
about two decades ago. SA is one of many phenolic compounds produced by plants and
is involved in a multitude of regulatory pathways. While SA has been shown to regulate
cell growth, stomatal aperture, respiration, seed germination, seedling development,
thermotolerance, fruit yield, nodulation in legumes and the expression of senescencerelated genes, it is mostly known for its central role in defence responses (Spoel& Dong
2012; Vlot et al. 2009).
In the continued battle for dominance in the plant-pathogen struggle, pathogens
have devised multiple ways to overcome plant innate immunity (Bozkurt et al. 2012).
This commonly involves the delivery of effector proteins from pathogens into the host
plant. Effectors detrimentally affect plants by suppressing immunity or modifying
growth, metabolism or physiology. This often leads to Effector-Triggered Susceptibility
(ETS), a condition in which a plant is left vulnerable to pathogen parasitism (Bozkurt et
al. 2012; Jones & Dangl 2006; Win et al. 2012). The transfer of effectors into plant cells
may occur via several different methods. The bacterium Pseudomonas syringae utilises a
type III secretion system (T3SS) that provides a molecular route for the translocation of
effectors. These type III effectors (T3E) may target either the plant apoplast or cytoplasm
and generally act as immunosuppressors (Alfano 2009; Win et al. 2012). These effectors
7
have recently been shown to target SA-signaling pathway and will be discussed in brief
(Jelenska et al. 2010; Jelenska et al. 2007).To inhibit immunosuppression by effectors,
plants have evolved Resistance (R) proteins to detect effectors or their modified targets
(Jones& Dangl 2006; Lewis et al. 2009). Nearly all R proteins are composed of
nucleotide-binding leucine-rich repeats (NB-LRR) domains. These NB-LRRs proteins
can be further subdivided into the toll interleukin-1 receptor (TIR) and coiled-coil (CC)NB-LRRs. NB-LRR proteins act as plant immune receptors and are responsible for
initiating Effector-Triggered Immunity (ETI), often in terms of cell death known as
Hypersensitive Response (HR) (Win et al. 2012).
The HR is characterised by localised necrosis and tissue lesions as part of an
attempt to ensure pathogen containment (Mur et al. 2008). However, cell death does not
guarantee a pathogen will not spread beyond localised lesions. This is demonstrated by
strains of tobacco mosaic virus (TMV) resistant to N gene-mediated HR (Padgett&
Beachy 1993). In addition to local necrosis, pathogen detection leads to establishment of
both local acquired resistance (LAR) and systemic acquired resistance (SAR) (Fu& Dong
2013). Both defence responses are characterised by an increase in PR protein
accumulation and SA biosynthesis (Durrant& Dong 2004). SAR provides a long-lasting,
system-wide immunity to a broad spectrum of pathogens (Conrath 2006). In addition,
studies have indicated that SA-dependent defences may also be transgenerationally
primed by hypomethylated genes, resulting in improved resistance to pathogen infection
in subsequent generations (Fu& Dong 2013; Luna et al. 2012). Moreover, a number of
studies have indicated considerable crosstalk between the SA defence pathway with other
8
plant hormone pathways such as the jasmonic acid (JA), ethylene, and abscisic acid
pathways (Seo& Park 2010).
SA Biosynthesis: Chorismate versus Phenylalanine
The requirement for SA in plant defence has been verified for both
Eudicotyledonae and Monocotyledonae with higher background levels of SA obscuring
SA induction in monocots (Umemura et al. 2009). In these higher plants, SA biosynthesis
is derived from the shikimate-phenylpropanoid pathway, and may occur via two distinct
branches. One of these routes, known as the cinnamic acid pathway, requires the
compound phenylalanine, while the other occurs via isochorismate production (Chen et
al. 2009; Vlot et al. 2009).
Conversion of phenylalanine to cinnamic acid is catalyzed by phenylalanine
ammonia lyase (PAL). Cinnamic acid can undergo hydroxylation into ortho-coumaric
acid with subsequent oxidation of the side chain to produce SA. Production of SA from
phenylalanine may also occur by an initial oxidation of the cinnamic acid side chain to
produce benzoic acid, which subsequently undergoes hydroxylation at the ortho position
(Metraux 2002). In both pathways, PAL is responsible for the initial catalytic reaction
(Vlot et al. 2009).
However, the majority of pathogen-induced SA production occurs via a distinct
pathway. This is evident in plants with the SA-induction deficient (sid2) mutation. These
mutants only exhibit 5-10% of the pathogen-induced SA quantities of the wild-type
(Wildermuth et al. 2001). The sid2 mutation has been traced to the ICS1 gene encoding a
chloroplastic isochorismate synthase (Fig. 1), which, along with isochorismate pyruvate
9
lyase (IPL), is responsible for conversion of chorismate into isochorismate and ultimately
SA (Shah 2003; Vlot et al. 2009). Indeed, SA produced via ICS1 was shown to be
necessary for the establishment of both LAR and SAR (Wildermuth et al. 2001).
Additional experiments are required to tease apart the differential requirement for various
SA biosynthesis pathways under different types of biotic stress.
Zhang and colleagues (Zhang et al. 2010) determined that NPR1, which facilitates
a large part of SA downstream signaling, is involved in the down-regulation of ICS1
upstream of SA. In this negative feedback loop, activation of ICS1 leads to SA
production. SA accumulation results in NPR1 deoligomerisation and translocation to the
nucleus where NPR1 suppresses ICS1 gene expression. When NPR1 is unable to localise
to the nucleus, continued ICS1 expression results in ICS1 transcript over-accumulation
and toxic levels of SA, indicating that NPR1 acts as a negative regulator of SA
biosynthesis and ICS1 expression (Zhang et al. 2010).
SA Derivatives
While unmodified SA can be found within plants tissues, SA also exists in several
different conjugated forms. Many of these conjugates have been identified as forms
necessary for increased temporal and spatial manipulation of regulatory processes as well
as possible pathogen-specific defence responses. Conjugates formation occurs via
methylation, glucosylation and amino acid conjugation (Loake& Grant 2007). Indeed, a
majority of SA derived from pathogen recognition is glucosylated by UDPglucosyltransferase (UGT), also known as SA glucosyltransferase (SAGT) (Vlot et al.
2009), forming inactive SA 2-O-b-D-glucoside (SAG) (Loake& Grant 2007). SAG, a
10
theoretically functional form of SA upon hydrolysis, is collected into vacuoles where it is
stored until needed (Loake& Grant 2007).
Pathogen detection may also lead to increased production of the volatile ester
methyl salicylate (MeSA). The synthesis of MeSA is dependent upon a SABATH
methyltransferase known as SA carboxyl methyltransferase (SAMT), which utilises Sadenosyl-1-Methionine as a methyl donor and substrates containing a carboxyl group
(Loake& Grant 2007). The SABATH family of enzymes is named after three of the
earliest identified genes in this family and is not merely an acronym. Thus, letters were
used from the genes SAMT, BAMT (benzoic acid carboxyl methyltransferase), and
theobromine synthase to construct the SABATH family name (Eckardt 2007). Transgenic
Arabidopsis overexpressing OsBSMT1, a rice SA methyl transferase (Attaran et al.
2009), also accumulated higher levels of MeSA and MeBA (methyl benzoic acid)
(Loake& Grant 2007).
In Arabidopsis, MeSA synthesis induced by P. syringae carrying an avirulent
effector avrRpm1 requires a functional JA pathway. This may be due to JA acting as a
regulator and promoting the conversion of SA into the volatile MeSA. Interestingly, SAR
is not dependent upon either JA biosynthesis or downstream signalling. Additionally, in
the absence of MeSA, SAR may still be mounted. Thus, SAR in Arabidopsis does not
require the production of MeSA (Attaran et al. 2009).
During infection by P. syringae, the presence of the pathogen toxin, coronatine
(COR), is indirectly responsible for MeSA volatisation outside of the leaf tissue. It has
been speculated that COR may volatise MeSA from the leaves in an effort to decelerate
induction of the SA-mediated defence pathway by slowing the accumulation of SA
11
(Attaran et al. 2009). This volatisation is further exemplified by the discovery that
overexpressors of OsBSMT1 actually induce PR1 transcript production in adjacent wildtype plants in an ICS1-independent and NPR1-dependent manner upon P. syringae
infection (Koo et al. 2007). Thus, MeSA may participate in the induction of defences in
systemic tissue or even nearby plants (Spoel& Dong 2012).
It was recently determined that single mutants of AtBSMT1 (Benzoic
acid/Salicylic acid Carboxyl Methyltransferase 1) and AtSAGT1 (SA Glucosyltransferase
1) fail to establish enhanced local resistance while corresponding overexpressor lines
exhibit increased susceptibility to P. syringae and decreased accumulation of SA in the
local tissue (Zheng et al. 2012). Zheng and colleagues (2012) also demonstrated that
BSMT1, operating as a regulator of plant defence, can be exploited by pathogens to
promote virulence due to its ability to convert SA into the volatile MeSA.
Indeterminately, preliminary studies suggest that the converting ability of SAGT1 may be
similarly utilised by pathogens to promote susceptibility. Since BSMT1 can effectively
convert even low levels of SA into MeSA, induction of BSMT1 by COR can suppress SA
accumulation thereby limiting plant defences. Nonetheless, the direct role of COR in the
suppression of MeSA esterase activity or its expression has not been established (Zheng
et al. 2012).
SA is also known to conjugate with certain amino acids to activate defence
responses (Loake& Grant 2007). More recently, acyl acid amido synthetases of the GH3
family have been identified as crucial prereceptor modulators of plant hormone action. In
addition, a structural basis for the functions of these modulators has been elucidated
(Westfall et al. 2012). For example, the acyl-adenylate/thioester-forming enzyme
12
(GH3.5) has been shown to function in conjugate-dependent defence. GH3.5 conjugates
amino acids to SA and acetic acid and mutations in GH3.5 are known to detrimentally
affect disease resistance (Vlot et al. 2009). Additionally, jasmonate resistant 1 (JAR1),
another member of the GH3 acyl-adenylate/thioesterase family, is responsible for
catalyzing the conjugation of JA to isoleucine (Guranowski et al. 2007).
In Arabidopsis, PBS3 (GH3.12) has been shown to function in phytohormoneamino acid conjugation and is active in the absence of a thioester intermediate (Okrent et
al. 2009). PBS3 is required for resistance to P. syringae, SAG accumulation upon
pathogen induction and defence activation (Dempsey et al. 2011). SA can, however,
decrease this enzyme's activity in vitro and may act as a competitive inhibitor, as low
levels of SA inhibit PBS3 activity. This may allow for quick, reversible adjustments in
phytohormone activity or promote rapid crosstalk between various phytohormone
signalling pathways (Okrent et al. 2009). Interestingly, even though the pbs3 mutant
accumulates double the SA levels compared to the wild-type, it still displays enhanced
disease susceptibility. Thus, it appears that SA cannot adequately activate PR1 expression
alone or PR1 expression is dependent on particular levels of both free SA and SAG
(Nobuta et al. 2007).
SA Signalling
A considerable body of work has identified SA as an important signalling
molecule for activation of pathogen defences. The inability to synthesize SA and
tendency to exhibit enhanced susceptibility to pathogen infection is well correlated and
was demonstrated in several Arabidopsis mutants (such as phytoalexin deficient 4 [pad4],
13
enhanced disease susceptibility [eds] 1, -4, -5 and SA induction deficient 2 [sid2]) (Fig.
1), in addition to transgenic lines such as NahG, expressing the bacterial enzyme
salicylate hydroxylase that degrades SA into catechol (van Wees& Glazebrook 2003).
Similarly, non-expresser of pathogenesis-related 1 (npr1) mutants exhibit enhanced
disease susceptibility (Cao et al. 1994). NPR1 is a vital part of one of the SA-mediated
defence signalling pathways. As a central transcriptional regulator, NPR1 is responsible
for controlling approximately 95% of SA-dependent genes (Wang et al. 2006). Moreover,
a recent report suggests that NPR1 may also play a central role in SA perception as a
bona fide receptor protein (Wu et al. 2012). However, another recent study provided
evidence for a different SA sensing mechanism that takes place via NPR1-like proteins
NPR3 and NPR4 (Fu et al. 2012). The evidence supporting roles of NPR proteins as
possible SA receptors will be discussed in the subsequent sections of this review article.
Moreover, NPR1 has demonstrated the ability to interact differentially with multiple
members of the TGA family of basic leucine zipper transcription factors via direct
binding to an as-1 cis-regulatory element present in PR gene promoters (Jakoby et al.
2002).
Signalling Components Upstream of SA
To elucidate the SA signalling pathways in Arabidopsis, many genetic screens
were conducted to identify genes that are involved in SA synthesis and signal
transduction. These screens yielded the identification of numerous mutants, both
upstream and downstream of the SA signal. Examples of upstream SA signalling
components include the aforementioned PAD4, SID2, EDS1, EDS4 and EDS5 proteins
14
(Fig. 1). EDS1 is a lipase-like protein that interacts with PAD4, a TIR-NBS-LRR,
upstream of SA and functions in activated ETI and basal immunity against biotrophic
pathogens (Falk et al. 1999; Vlot et al. 2009). Notably, the presence of EDS1 and PAD4
is required for TIR-NB-LRR-triggered HR. Conversely, EDS1 and PAD4 must directly
interact to facilitate basal resistance to virulent pathogens. Direct interaction between
EDS1 and PAD4 also coincides with increased expression of PAD4 and activation of the
SA defence pathway (Rietz et al. 2011) (Fig. 1). These data suggest various associations
between EDS1 and PAD4 in regulating either basal immunity or pathogen containment
and localised PCD.
In a yeast three-hybrid assay, interactions between EDS1 and PAD4 were weak as
indicated by the inability of PAD4 to compete with EDS1-EDS1 or EDS1-SAG101
interactions. Interestingly, in another yeast three-hybrid assay, free PAD4 promoted
EDS1-SAG101 interactions. Since EDS1 did not experimentally facilitate formation of
ternary complexes between PAD4 and SAG101, it is believed to transition between
partners (Rietz et al. 2011). Both EDS1 and PAD4 are further postulated to work in a
positive feedback loop that is SA-regulated. This is demonstrated by SA’s ability to
rescue defence induction in the eds1 and pad4 mutants and activate EDS1 and PAD4
expression in wild-type plants (Vlot et al. 2009).
EDS1 was recently identified as a pivotal effector target that molecularly connects
RPS4 (recognition of bacterial effector AvrRps4), a TIR-NB-LRR disease resistance
protein, to plant defence pathways (Wirthmueller et al. 2007). Complexes of AvrRps4EDS1 and RPS4-EDS1 were detectable within Arabidopsis leaf extracts after activating
resistance as well as within the nuclei of tobacco cells subjected to transient expression
15
assays. Translocation of AvrRps4 to the host nucleus or cytoplasm by EDS1, as a RPS4EDS1 receptor complex, induces defence signalling pathways that are cell compartmentspecific. While bacterial growth is suppressed via nuclear processes, nucleo-cytoplasmic
coordination is necessary for both transcriptional regulation of enhanced resistance as
well as HR. In this manner, EDS1 functions as a TIR-NB-LRR signal transducer and
effector target that is responsible for activation of defence responses across cellular
compartments (Bhattacharjee et al. 2011; Heidrich et al. 2011).
Regulation of signalling downstream of the CC-NB-LRR subset of R proteins is
mainly regulated by Non-specific Disease Resistance 1 (NDR1) instead of EDS1. NDR1,
a glycophosphatidyl-inositol-anchored plasma membrane protein, is believed to act
upstream of SA (Century et al. 1997), since benzothiadiazole (BTH), a SA analogue, can
rescue the SAR-deficient ndr1 mutants (Vlot et al. 2009).
NPR1-dependent SA Signalling and SA Receptors
NPR1 is a key regulator of SA-dependent defence signalling pathways and a
suppressor of PCD. SA is known to regulate the alteration of oligomerised NPR1 into its
monomeric (Mou et al. 2003) or dimeric (Boyle et al. 2009) form and nucleocytoplasmic
localisation due to a putative nuclear localisation signal (Durrant& Dong 2004). Whereas,
the phosphorylation of NPR1 leads to its polyubiquitinylation via Cullin3 (CUL3) E3
ligase followed by subsequent degradation by the 26S proteasome (Spoel et al. 2009).
NPR1 signalling functions in association with transcription factors as a cofactor in
expression of plant defence genes. The ability of TGA TFs to interact with NPR proteins
has been documented, and TGAs, excluding TGA2, appear to facilitate redundant roles in
16
NPR1- and SA-mediated PR gene expression and subsequent activation of defence genes
(Boyle et al. 2009; Despres et al. 2000; Fu& Dong 2013).
While it has been repeatedly shown that SA has the ability to modify NPR1
activity and localisation, inconsistent results have arisen in regard to NPR1’s direct
response to SA. Maier and colleagues (2011) first reported NPR1 and some NPR1-like
proteins to be sensitive to SA treatment (Maier et al. 2011). Subsequently, a recent study
has described NPR3 and NPR4 as novel SA receptors (Fu et al. 2012) (Fig. 2a-d). Both
NPR3 and NPR4 were also identified as possible candidate CUL3 adaptors responsible
for NPR1 degradation due to their BTB (bric à brac, tramtrack, broad-complex) domains,
which are found in some CUL3 mediators, and distinctive ankyrin repeats, which are
responsible for protein-protein interactions and are typically found in various CUL3
substrate adapters (Fu et al. 2012).
Previously, an npr3 knockout line was shown to have increased basal PR1
expression along with enhanced resistance to oomycete Hyaloperonospora arabidopsidis
isolate Noco; however, no defect in resistance to P. syringae was demonstrated in these
plants (Zhang et al. 2006). Conversely, npr4 mutants have decreased PR gene expression
and compromised resistance to P. syringae pv. tomato DC3000 (Pst DC3000) (Liu et al.
2005). npr3 npr4 double mutants demonstrated constitutive PR1 gene expression and
enhanced disease resistance that was partially NPR1-dependent and not caused by
increased SA accumulation (Zhang et al. 2006).
In the scenario proposed by Fu and colleagues (2012), detection of pathogen
ingress activates SA accumulation, with higher concentrations occurring locally at the
infection site. At higher SA concentrations, NPR3, a protein with low SA affinity, binds
17
SA and facilitates NPR1 degradation (Fig. 2d). As NPR1 is suggested to be an antiapoptotic protein (Fu et al. 2012; Rate& Greenberg 2001), its degradation promotes local
ETI and PCD. In systemic tissues with lower SA concentrations, SA does not bind to the
low affinity NPR3. Instead, SA binds to NPR4, a high-affinity SA receptor, and blocks
degradation of NPR1, thereby promoting continued suppression of HR. This allows SAmediated defence gene expression and permits the establishment of SAR (Fu et al. 2012;
Gust& Nurnberger 2012) (Fig. 2 b and c). Incidentally, Fu and colleagues didn’t observe
a direct binding between NPR1 and SA under conditions tested (Fu et al. 2012).
In contrast to the report by Fu et al. (2012), Wu and colleagues (Wu et al. 2012)
suggested NPR1 is responsible for directly binding SA through Cys521/529 via the
transition metal copper (Fig. 2e). This binding instigates a conformational change in
NPR1 in addition to releasing the C-terminal transactivation domain from the N-terminal
autoinhibitory BTB/POZ domain. Wu and colleagues proposed that SA quickly reequilibrates with the mobile phase of NPR1, producing a highly labile NPR1-SA
intermediate. Biologically, high lability would promote rapid detection of SA and allow
NPR1 to quickly respond to changes in SA concentrations. Stoichiometric results from
untreated plants expressing NPR1’s C-terminal transactivation domain (∆513) as well as
the SA-dependent redistributed form of ∆513 support the presence of an active
NPR1dimer form. However, elution volumes of the dimer differed between the ∆513
samples, which may support the presence of differing NPR1 conformations (Wu et al.
2012).
In previous reports from the same laboratory, it has been proposed that NPR1 can
be detected in both the cytoplasm and the nucleus prior to the SA induction and that
18
nuclear NPR1 dimers associate with TGA2 dimers on the PR1 gene promoter in a SAdependent manner to promote gene expression (Boyle et al. 2009; Despres et al. 2000;
Rochon et al. 2006). Wu et al. (2012) additionally reveal that NPR1 is present as an
oligomer (likely composed of more than four NPR1 molecules) before SA induction and
that this oligomeric structure is stabilised by non-covalent interactions (Wu et al. 2012)
(Fig. 2e).
This model, however, is somewhat in disagreement with previous studies from
another laboratory that suggest SA manipulates the translocation of NPR1 to the nucleus
via cellular redox reactions (Mou et al., 2003). In the inactive state of this scenario,
NPR1 resides within the cytoplasm as an oligomer bound by redox-sensitive disulphide
bonds (Kinkema et al. 2000; Mou et al. 2003). Upon induction, S-nitrosothiol (SNO) and
cytosolic thioredoxins (TRX) catalyse redox changes in NPR1 from oligomer to
monomer forms with SA inducing TRX-5h to catalyse NPR1 monomer release and
possibly prevent re-oligomerisation (Tada et al. 2008). S-nitrosoglutathione (GSNO) is
responsible for donating nitric oxides and covalently attaching them to reactive cysteine
thiols forming SNOs and promoting monomerisation (Tada et al. 2008). These active
monomers are then translocated into the nucleus where NPR1 assists in the binding of
transcription factors, such as TGAs, to regulate the expression of defence genes.
While Fu et al. detected no SA binding activity to NPR1 based on a conventional
ligand binding assay (Fu et al. 2012), Wu and colleagues employed equilibrium dialysis,
which they claim is a better suited experimental approach as it prevents re-equilibration
of SA between mobile and solid phases (Wu et al. 2012). High lability of the SA-NPR1
intermediate would make detection via nonequilibrium approaches difficult, and could
19
potentially explain previously reported difficulties in isolating a NPR1-SA complex and
discrepancies between the results reported by Fu et al. (2012) and Wu et al. (2012). It is
possible that NPR1 activation, deoligomerisation, nuclear translocation, phosphorylation
and targeted degradation may function according to Fu and colleagues’ model, and yet
some aspects of activation and deoligomerisation may be catalysed by direct NPR1-SA
binding according to Wu et al. It appears additionally plausible that all three NPR
proteins function as SA sensors when assembled into various homo-and heteromeric
protein complexes. Since each of these probable SA receptors possesses a different
binding affinity, each NPR protein may allow for differential regulation of defence
responses under various SA concentrations. The proposed roles of NPR3 and NPR4 as
novel SA-receptors regulating the levels of NPR1 via targeted proteolysis could be
biologically complemented by a direct SA-NPR1 interaction, providing an additional
level of fine-tuning control to SA-dependent responses. In the future, it would also be
interesting to investigate the potential biological role of NPR1-NPR2 interaction that is
SA-independent as well as assay SA sensitivity of the npr3 npr4 double mutant (Fu et al.
2012).
NPR3, in addition to functioning as a SA-binding protein, was recently shown to
have repressor activity within both NPR1-dependent and independent pathways in floral
tissue. The npr3-3 mutants demonstrated accumulation of PR1 transcript upon bacterial
infection and enhanced resistance to pathogen infection in immature flowers (Shi et al.
2012). However, NPR1 gene expression was unchanged upon either infection by Pst
DC3000 or npr3 mutation. Thus, NPR1 appears to be differentially regulated in leaves
and flowers. Furthermore, the npr1 npr3 double mutant exhibits intermediate levels of
20
susceptibility to pathogen challenge, supporting NPR3 repressor activity (Shi et al. 2012).
Using bimolecular fluorescence complementation (BiFC) assays, Shi and colleagues
additionally demonstrated that NPR3 and TGA2 interacted within both the nucleus and
cytoplasm. Similarly, NPR1 and NPR3 were shown to associate within the cytoplasm in a
BiFC assay. Thus, they argued that NPR3 may act as a repressor of NPR1 activity during
TGA2 and NPR1 interaction (Shi et al. 2012). These additional cytosolic associations
present important future questions that will further address the structure and dynamics of
the NPR1 oligomer.
Crosstalk Between SA and Other Phytohormones
To date, numerous interactions have been detailed between the plant hormone
defence pathways (Robert-Seilaniantz et al. 2011). Some commonly studied pathways
include the jasmonic acid (JA), ethylene (ET), and abscisic acid (ABA) pathways, which
are known modulators of defence responses and pathogen resistance (Spoel& Dong
2008). In addition to these well-established signalling molecules, several other
phytohormones have demonstrated effects on plant defence signalling including
gibberellins, cytokinins, brassinosteroids and auxins (Leon-Reyes et al. 2010; Wang et al.
2007). While a definitive relationship between these plant signalling pathways and the
SA pathway still remains obscure, the importance of balancing phytohormones is
becoming increasingly apparent (de Torres Zabala et al. 2009; Robert-Seilaniantz et al.
2011). Both positive and negative regulators of various hormone signalling pathways are
crucial regulatory targets of hormonal crosstalk in disease and defence. It is vital,
therefore, to consider interactions between these, and other, defence signalling pathways.
21
SA-JA and SA-ET
While the antagonistic effects of the jasmonic acid (JA) pathway on SA signalling
are well recognized, emerging data suggest a more convoluted network of interactions
between the two pathways than previously thought (Loake& Grant 2007).
Pharmacological experiments in Arabidopsis have revealed strong antagonistic effects
exerted by SA on JA-responsive genes, such as Plant Defensin 1.2 (PDF1.2), as
demonstrated by a simultaneous infection with a biotrophic and necrotrophic pathogen.
Similarly, under these conditions, the Arabidopsis wild-type plants demonstrated
enhanced susceptibility to the necrotrophic pathogen, which indicates the ability of the
plant to prioritize the SA pathway over the JA pathway (Koornneef et al. 2008; Spoel et
al. 2007). In another instance, P. syringae infiltration locally facilitates increased
susceptibility to necrotrophic Alternaria brassicicola, but this effect was not observed in
systemic tissues (Spoel et al. 2007). However, trade-offs in defence are not always the
result of antagonistic crosstalk. In fact, low levels of SA and JA are known to act
synergistically, suggesting a requirement for threshold levels of hormones for
antagonistic effects (Spoel& Dong 2008).
NPR1 has also demonstrated a critical role in mediating crosstalk between the SA
and JA pathways, where SA-mediated suppression of JA-inducible genes is prevented in
the npr1 plants. Interestingly, nuclear localization of NPR1 is not required for SAmediated suppression of the JA-responsive genes. Thus, suppression of the JA response
by SA was proposed to occur via a novel function of NPR1 in the cytosol (Koornneef&
Pieterse 2008). The JA derivative methyl jasmonate has conversely demonstrated the
22
ability to work in concert with SA in the activation of PR genes expression (Klessig et al.
2000). Accordingly, moderate levels of both JA and SA applied concurrently result in
antagonistic interactions with progression to tissue necrosis. Lower concentrations of JA
and SA alternatively produce concerted expression of established JA defence markers
and PR1 (Mur et al. 2006). It has further been proposed that JA may play crucial roles in
SAR signalling. When applied exogenously, JA has been shown to induce SAR.
Additionally, SAR is compromised in the JA-biosynthesis mutant opr3, the JAinsensitive mutant sgt1b/jai4 and the JA-response mutant jin1. In contrast, JAbiosynthesis mutants dde2 and opr3 and the JA-signalling mutants coi1, jar1 and jin1
exhibited increased resistance to P. syringae infection and effectively mounted SAR
(Fu& Dong 2013).
Induction of the SA pathway via infection by P. syringae or application of
exogenous SA suppresses the JA signalling pathway; leaving plants more vulnerable to
necrotrophic fungi such as A. brassicicola (Leon-Reyes et al. 2010). A recent paper by
Wathugala and colleagues (2012) identified sensitive to freezing 6 which is a subunit of
the multiprotein transcriptional co-activator complex known as Mediator (SFR6/MED16)
and is required for both SA- and JA-mediated defences and resistance to P. syringae and
UV-C irradiation (Wathugala et al. 2012).
In addition to the extensively studied SA-JA crosstalk, current data also suggest
the existence of an elaborate network of interactions between the SA and ET pathways
(Loake& Grant 2007). While ET has been shown to work in synergy with SA in the
activation of PR genes expression, ET engages in its own, distinct defence signalling
pathway, as well (van Loon et al. 2006).
23
There are multiple points of convergence between the often synergistic JA and ET
signalling pathways, several of the most interesting being Apetala2/Ethylene Response
Factor (AP2/ERF), ERF1, Octadecanoid Responsive Arabidopsis 59 (ORA59) and
Constitutive Expressor of VSP1 (CEV1). The cev1 mutants demonstrate insensitivity to
SA-mediated suppression or a constitutive expression of multiple JA- and ET- dependent
marker genes. In this manner, strong induction of both ET and JA pathways prior to SA
treatment repressed SA-dependent suppression of the JA pathway. ORA59 has been
proposed to function as a mediator of this process (Leon-Reyes et al. 2010).
SA-ABA
Bacterial instigation of pathogenesis via molecular determinants is traditionally
separated into three groups: T3Es, Pathogen Associated Molecular Patterns (PAMPs)
and toxins, such as coronatine (COR) (de Torres Zabala et al. 2009), with production of
phytotoxins being one of the main methods used to increase pathogen virulence (Feys et
al. 1994). Coronatine, a bacterial toxin that induces chlorosis, is produced by several P.
syringae pathovars (Feys et al. 1994) and is a structural mimic of jasmonyl- L-isoleucine
(JA-Ile). COR advances bacterial expansion by opening stomata, promoting growth in
the apoplast and suppressing SA accumulation, which leads to enhanced disease
susceptibility (Kazan& Manners 2012). SA synthesis is known to occur in response to
both T3Es and PAMPs, and is predominantly ICS1-dependent. Recent studies have
demonstrated that phytopathogens may utilize the ABA signalling pathways to promote
virulence (Seo& Park 2010). Indeed, COR demonstrates the ability to increase ABA
levels, which antagonise SA synthesis (de Torres Zabala et al. 2009). As such, ABA
24
synthesis coincides with increased COR levels, and mutants deficient in ABA production
demonstrate higher steady-state levels of ICS1 mRNA and elevated levels of SA. The
ability of pathogens to disrupt plant defences by manipulating hormonal signalling is not
limited to the JA, SA, and ET pathways (Seo& Park 2010). Antagonism between ABA
and SA has also been demonstrated in response to water stress (Mosher et al. 2010).
While adverse effects of abscisic acid (ABA) on the SA-mediated defence
pathway have been described, a more complex set of interactions is now coming to light.
Studies now suggest that positive interactions between the biotically induced SA, JA and
ET signalling pathways and the ABA signalling pathway improve responses to both
biotic and abiotic stresses. Seo and colleagues demonstrated that the transcription factor
MYB96 is responsible for interactions between the SA and ABA signals by functioning
as a signalling link as well as regulating synergistic interactions (Seo& Park 2010). In
fact, in sid2 mutants infected with virulent Pst DC3000, ABA synthesis was decreased
compared to wild-type plants. This suggests that SA may be responsible for positive
regulation of ABA levels (de Torres Zabala et al. 2009).
Negative Regulation of SA Signalling by Coronatine and Pathogenicity
Determinants
MAP Kinase 4 (MPK4) along with Suppressor of SA Insensitivity 2 (SSI2) and
Coronatine-Insensitive 1 (COI1) encode important JA-signalling proteins, all of which
are negative regulators of SA-mediated defence (Fig. 1). COI1, an F-box protein, is
theorized to negatively regulate suppressors of JA-mediated defences (Chini et al. 2007;
Kunkel& Brooks 2002; Thines et al. 2007). The coi1 mutants are insensitive to the
25
phytotoxin coronatine (Feys et al. 1994), as well as demonstrate heightened resistance to
P. syringae and inducible expression of SA-dependent defences. Contrary to coi1, the
mpk4 and ssi2 mutants demonstrate constitutive expression of SA-dependent defences
(Kunkel& Brooks 2002).
Coronatine-mediated virulence occurs by activating three NAC transcription
factor genes, ANAC019, ANAC055, and ANAC072 via the transcription factor MYC2
(Kazan& Manners 2012; Zheng et al. 2012). A recent study unravelled that these three
NAC transcription factors contribute to increased susceptibility by repressing ICS1 and
activating basal expression of BSMT1, a gene involved in conversion of SA into MeSA
(Zheng et al. 2012) (Fig. 1).
Additional pathogen counter-measures include the use of effectors in targeting
specific sections of SA signalling. The chloroplast localising, T3SS effector HopI1,
which has been found in all P. syringae strains to date, has recently been suggested to
regulate chloroplast-mediated defences. HopI1 targets pathways responsible for SA
biosynthesis, transport or antagonism through the activation of inhibitory pathways.
HopI1 is thought to do this via a J domain, which interacts with Hsp70 in the chloroplast.
This is further supported by data indicating that Hsp70 has been shown to catalytically
activate many cellular processes involved in client protein folding, assembly and
degradation after interacting with J proteins (Jelenska et al. 2010; Jelenska et al. 2007).
Effectors HopF2 and HopAI1 have also been shown to negatively regulate SA
biosynthesis. Rather than regulating SA production in the chloroplast, these effectors
target MAPK cascades responsible for activation of PTI, supporting research that
indicates MAPK activation is a key regulatory event in the PAMP-Triggered Immunity
26
(PTI). Further, HopF2 has been shown to interact with MAP Kinase Kinase 5 (MKK5) in
the inhibition of both PTI and mitogen-activated protein kinase (MPK) cascades (Wang
et al. 2010; Zhang et al. 2007); whereas, HopAI1 similarly suppresses MPK3 and MPK6
through direct interaction thereby inhibiting PTI and cell wall reinforcement (Zhang et al.
2007).
In addition to pathogen effector suppression of plant defence, some virus-encoded
proteins have demonstrated the ability to inhibit or enhance SA-dependent signalling. In
this scenario, the Cucumber Mosaic Virus (CMV) encoding the 2b counter-defence
protein (CMV 2b) exhibits a complex regulatory effect by interfering with JA-dependent
signalling, RNA silencing, SA biosynthesis and SA-mediated gene expression. Some of
this activity may be explained through effects of CMV 2b on two AGO family proteins,
which compose the Arabidopsis RISC complex. Inhibition of AGO1 activity would
disrupt miRNA-directed cleavage of mRNAs, such as AGO2 mRNA by miR403,
consequently leading to AGO2 transcript accumulation. CMV 2b also demonstrates
sRNA binding, which may disrupt RNA silencing and phytohormone signalling. It is also
plausible that CMV 2b facilitation of SA biosynthesis may inhibit JA signalling in a more
direct manner (Lewsey et al. 2010).
Lastly, the Cauliflower Mosaic Virus (CaMV) encodes a protein, P6, which
functions as pathogenicity determinant and inhibitor of SA-dependent defences. P6
functions in RNA silencing and can affect regulation of both SA- and JA-dependent
responses, often by suppression of SA signalling and enhancement of JA signalling.
Interestingly, inactive NPR1 becomes more concentrated in the nucleus in the presence of
P6. However, a direct interaction between P6 and NPR1 has not yet been established, and
27
it has therefore been suggested that P6 may regulate NPR1 nuclear localisation indirectly
via siRNAs or miRNAs. Since NPR1 is a key regulator of SA accumulation and the JAsignalling pathway acts antagonistically to the SA pathway, it is possible that P6
increases biotrophic susceptibility through promotion of inactive NPR1 nuclear
localisation and enhancement of the JA-signalling pathway (Love et al. 2012).
SA, the Endoplasmic Reticulum and the Unfolded Protein Response
NPR1 regulation of PR gene expression is a well documented part of the SAR
establishment. PR genes encode antimicrobial proteins that are either secreted or destined
for vacuoles. Folding of nascent PR peptides is facilitated by ER-resident chaperones
including BiP (luminal binding protein). Strikingly, NPR1 is also responsible for directly
controlling the expression of a number of protein secretory pathway genes, including
BiP2 (Wang et al. 2005). Arabidopsis bip2 mutants exhibit a moderate reduction in
secreted PR1 accumulation following BTH induction, and consequently, are impaired in
chemically induced SAR (Wang et al. 2005).
If the translation of pro-defence peptides in the cell exceeds the folding capacity,
a protective cellular signalling pathway termed the Unfolded Protein Response (UPR) is
activated (Ye et al. 2011). During UPR, proper protein folding, modification and
secretion are necessary to ameliorate the accumulation of unfolded proteins within the
ER.
In an uninduced state, BiPs bind onto UPR regulatory proteins, such as N-termini
of IRE1 (a transmembrane kinase/endonuclease) and effectively prevent activation of the
UPR (Iwata& Koizumi 2012) (Fig. 1). However, upon ER stress induction, BiP proteins
28
dissociate from the membrane-bound proteins to assist in protein folding (Wang et al.
2005). The IRE1 branch of the UPR exhibits roles in plant immunity as ire1 and bip2
mutants are, to various extents, hypersusceptible to P. syringae and defective in SAR
(Moreno et al. 2012; Wang et al. 2005).
An additional gap in the SA-UPR puzzle was recently closed when a novel heat
shock-like transcription factor, TBF1, was identified as a direct regulator of secretory
pathway genes in a SA-dependent manner (Fig. 1). TBF1 and NPR1, although not shown
to physically interact, are involved in an intricate transcriptional relationship since both
molecules reciprocally influence each other’s expression (Pajerowska-Mukhtar et al.
2012).
Deficient ER quality control (QC) gene expression in developing rice seeds leads
to defects in secretory pathways associated with protein storage (Hayashi et al. 2012).
Similarly, defective ER QC leads to impaired expression of secretory proteins that are
required for plant defence. A recent study by Hayashi and colleagues (2012) proposed a
model connecting ER stress responses to the SA pathway. In this model, under non-stress
conditions, PR proteins are continuously synthesized and secreted at low concentrations.
Upon early stress induction, OsIRE1-OsbZIP50, OsbZIP39 and OsbZIP60 pathways
induce ER QC factors to alleviate ER stress (Hayashi et al. 2012). PR gene expression
was reduced in an OsIRE-1-dependent manner while OsWRKY45 expression was
upregulated in an OsbZIP50-dependent manner. The SA response, occurring in tandem
with ER stress induction, promotes accumulation and activation of OsWRKY45 which,
in turn, induces SA-responsive gene expression (Hayashi et al. 2012). Notably,
Arabidopsis does not possess an OsWRKY45 equivalent since OsWRKY45 acts
29
upstream of the rice NPR1 orthologue NH1, and all of the potential functional
orthologues of OsWRKY45 in Arabidopsis are placed downstream of NPR1 (Shimono et
al. 2007). Thus, in this case, parallels cannot be drawn between monocots and dicots, and
the mechanistic underpinnings of the connections between SA pathway and UPR in
Arabidopsis will need to be addressed separately (Hayashi et al. 2012).
30
Fig. 1 An overview of the salicylic acid signalling pathways. Pathogen secretion of the
phytotoxin coronatine indirectly promotes MYC2 activation of NAC genes, which inhibit
SA accumulation through ICS1 inhibition. Indirect activation of BSMT1 expression by
the NAC genes may additionally result in BSMT1 conversion of SA into MeSA.
Pathogens may also indirectly promote ABA production to inhibit SA production through
ICS1. Pathogen detection elicits plant production of SA via PAD4 and EDS1 interactions
with ICS1 and EDS5, while pathogens may activate other antagonistic phytohormone
pathways via effectors. The accumulation of SA facilitates NPR1 deoligomerisation; after
which, monomerisation of NPR1 occurs via thioredoxins (TRXs) and re-oligomerisation
via S-nitrosothiol (SNO), which transmits nitric oxide. A recent study indicates that
NPR3 and NPR4 act as SA receptors and regulate NPR1 functions. NPR1 and TGAs
31
directly regulate PR1 expression, which results in PR1 protein production and secretion
into the apoplast where it exerts its antimicrobial activity on the proliferating pathogens.
NPR1 also positively regulates TBF1 expression and, in turn, TBF1 promotes SAdependent BiP2 expression. The resulting BiP2 protein binds onto UPR regulatory
proteins, such as IRE1 to prevent activation of the UPR in the absence of biotic stress.
IRE1, an ER-bound, transmembrane protein with kinase/endonuclease activity,
orchestrates coordinated expression of UPR genes upon SA or pathogen treatment.
Examples of inhibitory effects between JA and SA pathways include the indirect negative
regulation of the JA pathway by SA, such as indirect inhibition of COI1 by cytosolic
NPR1, and JA interaction with COI1, which indirectly inhibits the SA pathway.
Additionally, JA signaling proteins MPK4 and SSI2 indirectly regulate SA-mediated
defence.
Yellow boxes indicate proteins. Red boxes indicate phytohormones. Solid lines indicate
direct causation/interaction. Dotted lines indicate indirect causation/interaction. S—S –
disulfide bridges, TRX – thioredoxins, SNO – S-nitrosothiol, Ps – Pseudomonas
syringae.
32
Fig. 2. A model for SA perception in planta. (a-d): Fu and colleagues’ data indicate that
NPR3 and NPR4 function as SA receptors. (a) Binding of NPR1 by NPR4 in the absence
of SA leads to NPR1 degradation via the 26S proteasome. The CUL3 adaptor protein is
omitted for simplicity. (b) Basal SA levels allow for binding of SA to NPR4, thereby
limiting the ability of NPR4 to act as a CUL3 substrate adapter and binding NPR1 for
degradation. Low levels of NPR1 accumulate and subsequently activate basal resistance
responses while some NPR4-dependent NPR1 degradation continues. (c) Moderate SA
levels experienced in ETI-neighbouring cells (systemic tissue) allow for SA binding to
NPR4, limit NPR4-NPR1 interaction and, in turn, permit NPR1-dependent expression of
SAR genes. A pool of NPR1 undergoes degradation via NPR3 interaction. (d) Cells
33
subjected to direct avirulent pathogen attack experience high SA accumulation leading to
subsequent NPR3-dependent NPR1 degradation and ETI/PCD inhibition.
(e) Wu and colleagues postulate that NPR1 functions as the SA receptor. The NPR1
oligomer contains transitional metal ions, such as copper, to facilitate binding of SA.
Reducing conditions in the cell begin de-oligomerisation of NPR1, but SA is required for
the complete oligomer disassembly. The nuclear NPR1 oligomer interacts with the PR1
promoter via an unknown transcription factor (TF X) and binds with a TGA2 dimer upon
SA induction.
Abbreviations: Ub – ubiquitin; M – transitional metal, TF – transcription factor, Ps –
Pseudomonas syringae.
34
Conclusions
While great strides have been made in understanding the SA signalling pathway
over the last two decades, much still remains to be elucidated. Significant progress has
been made concerning the biosynthesis of SA; however, the extended importance of SA
conjugation is continuously expanding. The convoluted nature of the SA signalling
cascades with other defence pathways and the oxidative burst in response to pathogen
infection indicate a central importance of the SA pathway to plant survival. As progress
has been made in clarifying the molecular underpinnings of the SA pathway, our
understanding of the central signalling components, such as NPR1, has been brought into
question. Three members of the NPR family, NPR1, NPR3 and NPR4 have emerged as
potential SA receptors, making SA the final phytohormone, for which cognate binding
protein(s) have been firmly identified in planta. The link between the SA pathway and
UPR, recently established in Arabidopsis and rice, still requires more in depth studies.
Collectively, the SA signalling pathway constitutes a massive body of molecular
regulators and myriad other biological connections. Future studies on the extent of the SA
pathway would be greatly facilitated by applications of modern techniques integrating
wet lab work with bioinformatics-aided analyses, using network biology and systemslevel approaches.
Acknowledgements
We gratefully acknowledge support from the UAB Biology Department to JLB, the UAB
Gulf Oil Response Pilot Grant and the UAB Faculty Development Grant to K.P.M. The
35
authors thank Dr. Shahid Mukhtar and Mrs. Kristin Rockett for critical reading of the
manuscript. The authors declare no conflict of interests.
36
Literature Cited
Alfano J.R. (2009) Roadmap for future research on plant pathogen effectors. Mol. Plant
Pathol. 10, 805-813.
Attaran E., Zeier T.E., Griebel T., Zeier J. (2009) Methyl salicylate production and
jasmonate signaling are not essential for systemic acquired resistance in
Arabidopsis. Plant Cell 21, 954-971.
Bhattacharjee S., Halane M.K., Kim S.H., Gassmann W. (2011) Pathogen effectors target
Arabidopsis EDS1 and alter its interactions with immune regulators. Science 334,
1405-1408.
Boyle P., Le Su E., Rochon A., Shearer H.L., Murmu J., Chu J.Y., Fobert P.R., Despres
C. (2009) The BTB/POZ domain of the Arabidopsis disease resistance protein
NPR1 interacts with the repression domain of TGA2 to negate its function. Plant
Cell 21, 3700-3713.
Bozkurt T.O., Schornack S., Banfield M.J., Kamoun S. (2012) Oomycetes, effectors, and
all that jazz. Curr. Opin. Plant Biol. 15, 483-492.
Cao H., Bowling S.A., Gordon A.S., Dong X. (1994) Characterization of an Arabidopsis
Mutant That Is Nonresponsive to Inducers of Systemic Acquired Resistance.
Plant Cell 6, 1583-1592.
Century K.S., Shapiro A.D., Repetti P.P., Dahlbeck D., Holub E., Staskawicz B.J. (1997)
NDR1, a pathogen-induced component required for Arabidopsis disease
resistance. Science 278, 1963-1965.
37
Chen Z., Zheng Z., Huang J., Lai Z., Fan B. (2009) Biosynthesis of salicylic acid in
plants. Plant Signal. Behav. 4, 493-496.
Chini A., Fonseca S., Fernandez G., Adie B., Chico J.M., Lorenzo O., Garcia-Casado G.,
Lopez-Vidriero I., Lozano F.M., Ponce M.R., Micol J.L., Solano R. (2007) The
JAZ family of repressors is the missing link in jasmonate signalling. Nature 448,
666-U664.
Conrath U. (2006) Systemic acquired resistance. Plant Signal. Behav. 1, 179-184.
de Torres Zabala M., Bennett M.H., Truman W.H., Grant M.R. (2009) Antagonism
between salicylic and abscisic acid reflects early host-pathogen conflict and
moulds plant defence responses. Plant J . 59, 375-386.
Dempsey D.A., Vlot A.C., Wildermuth M.C., Klessig D.F. (2011) Salicylic Acid
biosynthesis and metabolism. Arabidopsis Book 9, e0156.
Despres C., DeLong C., Glaze S., Liu E., Fobert P.R. (2000) The Arabidopsis
NPR1/NIM1 protein enhances the DNA binding activity of a subgroup of the
TGA family of bZIP transcription factors. Plant Cell 12, 279-290.
Durrant W.E., Dong X. (2004) Systemic acquired resistance. Annu.Rev. Phytopathol. 42,
185-209.
Eckardt N.A. (2007) Gibberellins are modified by methylation in planta. Plant Cell 19, 36.
Falk A., Feys B.J., Frost L.N., Jones J.D., Daniels M.J., Parker J.E. (1999) EDS1, an
essential component of R gene-mediated disease resistance in Arabidopsis has
homology to eukaryotic lipases. Proc. Natl. Acad. Sci. USA 96, 3292-3297.
38
Feys B., Benedetti C.E., Penfold C.N., Turner J.G. (1994) Arabidopsis Mutants Selected
for Resistance to the Phytotoxin Coronatine Are Male Sterile, Insensitive to
Methyl Jasmonate, and Resistant to a Bacterial Pathogen. Plant Cell 6, 751-759.
Fu Z.Q., Dong X. (2013) Systemic Acquired Resistance: Turning Local Infection into
Global Defense. Annu. Rev. Plant Biol., DOI: 10.1146/annurev-arplant-042811105606
Fu Z.Q., Yan S., Saleh A., Wang W., Ruble J., Oka N., Mohan R., Spoel S.H., Tada Y.,
Zheng N., Dong X. (2012) NPR3 and NPR4 are receptors for the immune signal
salicylic acid in plants. Nature 486, 228-232.
Guranowski A., Miersch O., Staswick P.E., Suza W., Wasternack C. (2007) Substrate
specificity and products of side-reactions catalyzed by jasmonate:amino acid
synthetase (JAR1). FEBS Lett. 581, 815-820.
Gust A.A., Nurnberger T. (2012) Plant immunology: A life or death switch. Nature 486,
198-199.
Hayashi S., Wakasa Y., Takaiwa F. (2012) Functional integration between defence and
IRE1-mediated ER stress response in rice. Sci. Rep. 2, 670.
Heidrich K., Wirthmueller L., Tasset C., Pouzet C., Deslandes L., Parker J.E. (2011)
Arabidopsis EDS1 connects pathogen effector recognition to cell compartmentspecific immune responses. Science 334, 1401-1404.
Iwata Y., Koizumi N. (2012) Plant transducers of the endoplasmic reticulum unfolded
protein response. Trends Plant Sci. 17, 720-727.
39
Jakoby M., Weisshaar B., Droge-Laser W., Vicente-Carbajosa J., Tiedemann J., Kroj T.,
Parcy F., b Z.I.P.R.G. (2002) bZIP transcription factors in Arabidopsis. Trends
Plant Sci. 7, 106-111.
Jelenska J., van Hal J.A., Greenberg J.T. (2010) Pseudomonas syringae hijacks plant
stress chaperone machinery for virulence. Proc. Natl. Acad. Sci. USA 107, 1317713182.
Jelenska J., Yao N., Vinatzer B.A., Wright C.M., Brodsky J.L., Greenberg J.T. (2007) A
J domain virulence effector of Pseudomonas syringae remodels host chloroplasts
and suppresses defenses. Curr. Biol. 17, 499-508.
Jones J.D., Dangl J.L. (2006) The plant immune system. Nature 444, 323-329.
Kazan K., Manners J.M. (2012) JAZ repressors and the orchestration of phytohormone
crosstalk. Trends Plant Sci. 17, 22-31.
Kinkema M., Fan W., Dong X. (2000) Nuclear localization of NPR1 is required for
activation of PR gene expression. Plant Cell 12, 2339-2350.
Klessig D.F., Durner J., Noad R., Navarre D.A., Wendehenne D., Kumar D., Zhou J.M.,
Shah J., Zhang S., Kachroo P., Trifa Y., Pontier D., Lam E., Silva H. (2000)
Nitric oxide and salicylic acid signaling in plant defense. Proc. Natl. Acad. Sci.
USA 97, 8849-8855.
Koo Y.J., Kim M.A., Kim E.H., Song J.T., Jung C., Moon J.K., Kim J.H., Seo H.S., Song
S.I., Kim J.K., Lee J.S., Cheong J.J., Choi Y.D. (2007) Overexpression of
salicylic acid carboxyl methyltransferase reduces salicylic acid-mediated
pathogen resistance in Arabidopsis thaliana. Plant Mol. Biol. 64, 1-15.
40
Koornneef A., Pieterse C.M. (2008) Cross talk in defense signaling. Plant Physiol. 146,
839-844.
Koornneef A., Verhage A., Leon-Reyes A., Snetselaar R., Van Loon L., Pieterse C.M.
(2008) Towards a reporter system to identify regulators of cross-talk between
salicylate and jasmonate signaling pathways in Arabidopsis. Plant Signal. Behav.
3, 543-546.
Kunkel B.N., Brooks D.M. (2002) Cross talk between signaling pathways in pathogen
defense. Curr. Opin. Plant Biol. 5, 325-331.
Leon-Reyes A., Du Y., Koornneef A., Proietti S., Korbes A.P., Memelink J., Pieterse
C.M., Ritsema T. (2010) Ethylene signaling renders the jasmonate response of
Arabidopsis insensitive to future suppression by salicylic Acid. Mol. PlantMicrobe Interact. 23, 187-197.
Lewis J.D., Guttman D.S., Desveaux D. (2009) The targeting of plant cellular systems by
injected type III effector proteins. Semin. Cell Dev. Biol. 20, 1055-1063.
Lewsey M.G., Murphy A.M., Maclean D., Dalchau N., Westwood J.H., Macaulay K.,
Bennett M.H., Moulin M., Hanke D.E., Powell G., Smith A.G., Carr J.P. (2010)
Disruption of two defensive signaling pathways by a viral RNA silencing
suppressor. Mol. Plant-Microbe Interact. 23, 835-845.
Liu G., Holub E.B., Alonso J.M., Ecker J.R., Fobert P.R. (2005) An Arabidopsis NPR1like gene, NPR4, is required for disease resistance. Plant J. 41, 304-318.
Loake G., Grant M. (2007) Salicylic acid in plant defence--the players and protagonists.
Curr. Opin. Plant Biol. 10, 466-472.
41
Love A.J., Geri C., Laird J., Carr C., Yun B.W., Loake G.J., Tada Y., Sadanandom A.,
Milner J.J. (2012) Cauliflower mosaic virus protein P6 inhibits signaling
responses to salicylic acid and regulates innate immunity. PLoS One 7, e47535.
Luna E., Bruce T.J., Roberts M.R., Flors V., Ton J. (2012) Next-generation systemic
acquired resistance. Plant Physiol 158, 844-853.
Maclagan T. (1876) The Treatment of Rheumatism by Salicin and Salicylic Acid. Br Med
J 1, 627.
Maier F., Zwicker S., Huckelhoven A., Meissner M., Funk J., Pfitzner A.J.P., Pfitzner
U.M. (2011) NONEXPRESSOR OF PATHOGENESIS-RELATED PROTEINS1
(NPR1) and some NPR1-related proteins are sensitive to salicylic acid. Mol. Plant
Pathol. 12, 73-91.
Metraux J.P. (2002) Recent breakthroughs in the study of salicylic acid biosynthesis.
Trends Plant Sci. 7, 332-334.
Moreno A.A., Mukhtar M.S., Blanco F., Boatwright J.L., Moreno I., Jordan M.R., Chen
Y., Brandizzi F., Dong X., Orellana A., Pajerowska-Mukhtar K.M. (2012)
IRE1/bZIP60-mediated unfolded protein response plays distinct roles in plant
immunity and abiotic stress responses. PLoS One 7, e31944.
Mosher S., Moeder W., Nishimura N., Jikumaru Y., Joo S.H., Urquhart W., Klessig D.F.,
Kim S.K., Nambara E., Yoshioka K. (2010) The lesion-mimic mutant cpr22
shows alterations in abscisic acid signaling and abscisic acid insensitivity in a
salicylic acid-dependent manner. Plant Physiol. 152, 1901-1913.
Mou Z., Fan W., Dong X. (2003) Inducers of plant systemic acquired resistance regulate
NPR1 function through redox changes. Cell 113, 935-944.
42
Mur L.A., Kenton P., Atzorn R., Miersch O., Wasternack C. (2006) The outcomes of
concentration-specific interactions between salicylate and jasmonate signaling
include synergy, antagonism, and oxidative stress leading to cell death. Plant
Physiol. 140, 249-262.
Mur L.A., Kenton P., Lloyd A.J., Ougham H., Prats E. (2008) The hypersensitive
response; the centenary is upon us but how much do we know? J. Exp. Bot. 59,
501-520.
Nobuta K., Okrent R.A., Stoutemyer M., Rodibaugh N., Kempema L., Wildermuth M.C.,
Innes R.W. (2007) The GH3 acyl adenylase family member PBS3 regulates
salicylic acid-dependent defense responses in Arabidopsis. Plant Physiol. 144,
1144-1156.
Okrent R.A., Brooks M.D., Wildermuth M.C. (2009) Arabidopsis GH3.12 (PBS3)
conjugates amino acids to 4-substituted benzoates and is inhibited by salicylate. J.
Biol. Chem. 284, 9742-9754.
Padgett H.S., Beachy R.N. (1993) Analysis of a tobacco mosaic virus strain capable of
overcoming N gene-mediated resistance. Plant Cell 5, 577-586.
Pajerowska-Mukhtar K.M., Wang W., Tada Y., Oka N., Tucker C.L., Fonseca J.P., Dong
X. (2012) The HSF-like transcription factor TBF1 is a major molecular switch for
plant growth-to-defense transition. Curr. Biol. 22, 103-112.
Rate D.N., Greenberg J.T. (2001) The Arabidopsis aberrant growth and death2 mutant
shows resistance to Pseudomonas syringae and reveals a role for NPR1 in
suppressing hypersensitive cell death. Plant J. 27, 203-211.
43
Rietz S., Stamm A., Malonek S., Wagner S., Becker D., Medina-Escobar N., Vlot A.C.,
Feys B.J., Niefind K., Parker J.E. (2011) Different roles of Enhanced Disease
Susceptibility1 (EDS1) bound to and dissociated from Phytoalexin Deficient4
(PAD4) in Arabidopsis immunity. New Phytol. 191, 107-119.
Robert-Seilaniantz A., Grant M., Jones J.D. (2011) Hormone crosstalk in plant disease
and defense: more than just jasmonate-salicylate antagonism. Annu. Rev.
Phytopathol. 49, 317-343.
Rochon A., Boyle P., Wignes T., Fobert P.R., Despres C. (2006) The coactivator function
of Arabidopsis NPR1 requires the core of its BTB/POZ domain and the oxidation
of C-terminal cysteines. Plant Cell 18, 3670-3685.
Seo P.J., Park C.M. (2010) MYB96-mediated abscisic acid signals induce pathogen
resistance response by promoting salicylic acid biosynthesis in Arabidopsis. New
Phytol. 186, 471-483.
Shah J. (2003) The salicylic acid loop in plant defense. Curr. Opin. Plant Biol. 6, 365371.
Shi Z., Maximova S., Liu Y., Verica J., Guiltinan M.J. (2012) The Salicylic Acid
Receptor NPR3 Is a Negative Regulator of the Transcriptional Defense Response
during Early Flower Development in Arabidopsis. Mol Plant. DOI:
10.1093/mp/sss091
Shimono M., Sugano S., Nakayama A., Jiang C.J., Ono K., Toki S., Takatsuji H. (2007)
Rice WRKY45 plays a crucial role in benzothiadiazole-inducible blast resistance.
Plant Cell 19, 2064-2076.
44
Spoel S.H., Dong X. (2008) Making sense of hormone crosstalk during plant immune
responses. Cell Host Microbe 3, 348-351.
Spoel S.H., Dong X. (2012) How do plants achieve immunity? Defence without
specialized immune cells. Nat. Rev. Immunol. 12, 89-100.
Spoel S.H., Johnson J.S., Dong X. (2007) Regulation of tradeoffs between plant defenses
against pathogens with different lifestyles. Proc. Nat.l Acad. Sci. USA 104,
18842-18847.
Spoel S.H., Mou Z., Tada Y., Spivey N.W., Genschik P., Dong X. (2009) Proteasomemediated turnover of the transcription coactivator NPR1 plays dual roles in
regulating plant immunity. Cell 137, 860-872.
Tada Y., Spoel S.H., Pajerowska-Mukhtar K., Mou Z., Song J., Wang C., Zuo J., Dong
X. (2008) Plant immunity requires conformational changes [corrected] of NPR1
via S-nitrosylation and thioredoxins. Science 321, 952-956.
Thines B., Katsir L., Melotto M., Niu Y., Mandaokar A., Liu G.H., Nomura K., He S.Y.,
Howe G.A., Browse J. (2007) JAZ repressor proteins are targets of the SCFCO11
complex during jasmonate signalling. Nature 448, 661-U662.
Umemura K., Satou J., Iwata M., Uozumi N., Koga J., Kawano T., Koshiba T., Anzai H.,
Mitomi M. (2009) Contribution of salicylic acid glucosyltransferase, OsSGT1, to
chemically induced disease resistance in rice plants. Plant J. 57, 463-472.
van Loon L.C., Geraats B.P.J., Linthorst H.J.M. (2006) Ethylene as a modulator of
disease resistance in plants. Trends Plant Sci. 11, 184-191.
45
van Wees S.C.M., Glazebrook J. (2003) Loss of non-host resistance of Arabidopsis NahG
to Pseudomonas syringae pv. phaseolicola is due to degradation products of
salicylic acid. Plant J. 33, 733-742.
Vlot A.C., Dempsey D.A., Klessig D.F. (2009) Salicylic Acid, a multifaceted hormone to
combat disease. Annu. Rev. Phytopathol. 47, 177-206.
Wang D., Amornsiripanitch N., Dong X. (2006) A genomic approach to identify
regulatory nodes in the transcriptional network of systemic acquired resistance in
plants. PLoS Pathog. 2, e123.
Wang D., Pajerowska-Mukhtar K., Culler A.H., Dong X.N. (2007) Salicylic acid inhibits
pathogen growth in plants through repression of the auxin signaling pathway.
Curr. Biol. 17, 1784-1790.
Wang D., Weaver N.D., Kesarwani M., Dong X. (2005) Induction of protein secretory
pathway is required for systemic acquired resistance. Science 308, 1036-1040.
Wang Y., Li J., Hou S., Wang X., Li Y., Ren D., Chen S., Tang X., Zhou J.M. (2010) A
Pseudomonas syringae ADP-ribosyltransferase inhibits Arabidopsis mitogenactivated protein kinase kinases. Plant Cell 22, 2033-2044.
Wathugala D.L., Hemsley P.A., Moffat C.S., Cremelie P., Knight M.R., Knight H. (2012)
The Mediator subunit SFR6/MED16 controls defence gene expression mediated
by salicylic acid and jasmonate responsive pathways. New Phytol. 195, 217-230.
Westfall C.S., Zubieta C., Herrmann J., Kapp U., Nanao M.H., Jez J.M. (2012) Structural
basis for prereceptor modulation of plant hormones by GH3 proteins. Science
336, 1708-1711.
46
Wildermuth M.C., Dewdney J., Wu G., Ausubel F.M. (2001) Isochorismate synthase is
required to synthesize salicylic acid for plant defence. Nature 414, 562-565.
Win J., Chaparro-Garcia A., Belhaj K., Saunders D.G., Yoshida K., Dong S., Schornack
S., Zipfel C., Robatzek S., Hogenhout S.A., Kamoun S. (2012) Effector Biology
of Plant-Associated Organisms: Concepts and Perspectives. Cold Spring Harb.
Symp. Quant. Biol. DOI: 10.1101/sqb.2012.77.015933
Wirthmueller L., Zhang Y., Jones J.D., Parker J.E. (2007) Nuclear accumulation of the
Arabidopsis immune receptor RPS4 is necessary for triggering EDS1-dependent
defense. Curr. Biol. 17, 2023-2029.
Wu Y., Zhang D., Chu J.Y., Boyle P., Wang Y., Brindle I.D., De Luca V., Despres C.
(2012) The Arabidopsis NPR1 Protein Is a Receptor for the Plant Defense
Hormone Salicylic Acid. Cell Rep. 1, 639-647.
Ye C., Dickman M.B., Whitham S.A., Payton M., Verchot J. (2011) The unfolded protein
response is triggered by a plant viral movement protein. Plant Physiol. 156, 741755.
Zhang J., Shao F., Cui H., Chen L.J., Li H.T., Zou Y., Long C.Z., Lan L.F., Chai J.J.,
Chen S., Tang X.Y., Zhou J.M. (2007) A Pseudomonas syringae effector
inactivates MAPKs to suppress PAMP-Induced immunity in plants. Cell Host
Microbe 1, 175-185.
Zhang X., Chen S., Mou Z. (2010) Nuclear localization of NPR1 is required for
regulation of salicylate tolerance, isochorismate synthase 1 expression and
salicylate accumulation in Arabidopsis. J Plant Physiol. 167, 144-148.
47
Zhang Y., Cheng Y.T., Qu N., Zhao Q., Bi D., Li X. (2006) Negative regulation of
defense responses in Arabidopsis by two NPR1 paralogs. Plant J. 48, 647-656.
Zheng X.Y., Spivey N.W., Zeng W., Liu P.P., Fu Z.Q., Klessig D.F., He S.Y., Dong X.
(2012) Coronatine promotes Pseudomonas syringae virulence in plants by
activating a signaling cascade that inhibits salicylic acid accumulation. Cell Host
Microbe 11, 587-596.
48
49
CHAPTER 2
EUKARYOTIC ENDOPLASMIC RETICULUM STRESS-SENSING MECHANISMS
REVIEW
Lillian E. Duffee1, Jon L. Boatwright 1, Faris H. Pacha1,2, James M. Shockley1, Karolina
M. Pajerowska-Mukhtar1, M. Shahid Mukhtar1
1
Department of Biology, University of Alabama at Birmingham
Birmingham, AL, 35294
2
Birmingham-Southern College, Birmingham, AL 35254, USA
Published, Advances in Life Sciences 2012, 2(6): 148-155, DOI:
10.5923/j.als.20120206.02
Format adapted for thesis
50
Abstract.—The endoplasmic reticulum (ER) is responsible for proper folding of
secretory and membrane-bound proteins as well as the degradation of improperly folded
proteins. Fluctuations in protein folding demand exceeding folding capacity result from
events such as cellular stress and mutations affecting protein folding. Detrimental
accumulation of unfolded proteins within the ER is alleviated through activation of
evolutionarily conserved, intracellular signaling proteins by the unfolded protein response
(UPR). Binding of membrane-bound signaling proteins by inactive, ER-resident
chaperones typically results in suppression of UPR. However, upon nascent protein
accumulation, chaperone recruitment allows for activation of stress relieving pathways.
UPR, classically studied in budding yeast and later in metazoan and plant cells, relies
almost exclusively on the signal proteins, known as Ire1p. Homologs for the metazoan
UPR sensors include Ire1α and Ire1β as well as two additional signal proteins, PERK and
ATF6. Plant UPR branches identified to date include IRE1a, IRE1b, bZIP17 and bZIP28.
In this review, we present the first comprehensive view of both conserved and differing
aspects of UPR across kingdoms, with special emphasis on some unique features of
recently discovered plant UPR pathways.
Key Words: Endoplasmic Reticulum Stress, Unfolded Protein Response, IRE1, PERK,
ATF6
51
Introduction
The folding of nascent proteins is essential to reaching their correct threedimensional conformation and eventual proper function. In the eukaryotic system, the
endoplasmic reticulum (ER) is responsible for housing the necessary chaperones that
facilitate proper folding (Bernales et al., 2000). Throughout a cell’s life, demand for
folding fluctuates. Periodically, the ER acquires an excess of unfolded proteins and fails
to meet the folding requirements, resulting in ER stress (Tsai and Weissman, 2010).
Unfolded protein accumulation and ER stress also occur in a number of medical
conditions. The unfolded protein response (UPR) is a cellular response that resolves ER
stress through translational inhibition, increased expression of genes encoding ERresident chaperones, ER expansion and increased activation of ER-Associated
Degradation (ERAD) elements. However, if the cell cannot regain homeostasis through
these activities, apoptotic pathways are activated.
Initiation of stress mediation begins with activation of membrane-bound ER
signaling components (Tsai and Weissman, 2010). During an unstressed state, their
cytosolic domains are occupied by inactive ER chaperones, preventing activation of
stress pathways (Tsai and Weissman, 2010). Upon nascent protein accumulation,
chaperones dissociate from the ER-resident proteins, triggering activation of the UPR
pathways. These membrane-bound proteins are each uniquely responsible for initializing
signal transduction through pathways consisting of phosphorylation events and
dimerization, dissociation from the ER membrane followed by proteolytic cleavage, or
even phosphorylation, dimerization and a subsequent endoribonuclease domain activation
resulting in an atypical, cytoplasmic splicing event. These pathways ultimately result in
52
recovering ER homeostasis; however, if the ER stress is too profound and irreversible,
the cell will initiate the apoptotic program (Noh et al., 2002).
Glycosylation and deglycosylation cycles give misfolded proteins a way to remain
in the ER to undergo proper folding. If proper folding does not occur, ER-associated
degradation (ERAD) pathway provides a mechanism for removing such proteins.
Terminal mannose residues are removed by ER α-mannosidase I, subsequently bound to
ER degradation enhancing α-mannosidase like proteins (EDEM) and transported to the
cytosol, where the unfolded proteins are degraded by the ubiquitin-proteasome pathway
(Bernales et al., 2000, Walter and Ron, 2011, Ron and Walter, 2007).
In addition to glycosylation and deglycosylation cycles, correct folding is aided
by chaperones, which bind to unfolded proteins in ways that increase both the likelihood
of correct folding and the length of time these proteins reside in the ER. ER luminal
binding protein (BiP) is a member of the critical Hsp70 family of molecular chaperones.
In addition to serving as a folding chaperone, BiP binds to exposed hydrophobic regions
of unfolded proteins prompting dissociation from and activation of UPR receptors.
Additionally, BiP serves as an ER stress regulator by buffering calcium levels and
preventing the activation of pro-apoptosis signals by binding to caspase proteins
(Bernales et al., 2000, Walter and Ron, 2011, Ron and Walter, 2007).
Characterization of the UPR signaling elements began in baker’s yeast,
Saccharomyces cerevisiae, almost two decades ago. The yeast genome encodes a protein
kinase, Ire1p (inositol-requiring enzyme 1) that is responsible for UPR signal
transduction. The mammalian suite of UPR components comprises: Ire1α/Ire1β,
homologs of the yeast Ire1p; ATF6, activated transcription factor 6; and PERK, a PKR-
53
like ER-resident eIF2α kinase(Tsai and Weissman, 2010). Lastly, known regulators of
plant UPR include IRE1a/IRE1b, constituting IRE1 homologs, and bZIP17/bZIP28
transcription factors, equivalents of the ATF6 pathway in mammals. In addition to
possessing additional UPR signaling pathways, the existence of multiple copies of
sensors in higher organisms has been suggested to enable more sophisticated and
selective function, such as the presence of Ire1α and Ire1β proteins in mammals
compared to only one copy of IRE1 in C. elegans and D. melanogaster (Mori, 2009).
Furthermore, the expansion of IRE1a and IRE1b, as well as the presence of the
bZIP17/bZIP28 proteins and a GCN2 (General control non-derepressible-2) homolog in
plants (discussed below), appears to allow for expanded detection of both abiotic and
biotic stress through a more selective stress sensing by each protein (Liu et al., 2007a, Liu
et al., 2007b, Liu et al., 2008, Moreno et al., 2011).
Current research also suggests that UPR signal transducers affect a greater
number of targets than originally thought. Specifically, the ability of IRE1α to bind to
and cleave various mRNAs has been recently explored. Using a combination of cleavage
assays and exon array analysis, 13 novel mRNAs were identified as candidate IRE1α
targets (Oikawa et al., 2010). This finding also supports the interpretation of a weak
immune-related phenotype observed in the absence of functional bZIP60 as indicative of
the existence of other, currently unidentified IRE1 targets in Arabidopsis (Moreno et al.,
2011).
Of increasing interest is UPR’s role in pathophysiology. UPR activation has been
observed in a multitude of diseases and disorders including cancer, diabetes and
neurodegenerative diseases. Proliferation of tumor cells leads to oxidative stress and
54
hypoxia that is alleviated via the IRE1 pathway (Tsai and Weissman, 2010). UPR also
functions in glucose homeostasis during energy deprivation and diabetic states, acting to
conserve cell energy and improve cell survival. Without the UPR, pancreatic β-cells
would not survive oscillating blood glucose levels (Tsai and Weissman, 2010).
Additionally, dysfunction of the ER can be caused by expanding polyglutamine repeats
or neurodegenerative diseases and results in accumulation of atypical proteins, potentially
leading to Alzheimer and Parkinson disease (Zhang and Kaufman, 2006). Yeast ire1
mutant is sensitive to ER stress, while Arabidopsis plants lacking functional IRE1 genes
display diminished capacity to trigger effective defense responses to a broad range of
pathogens (Moreno et al., 2011).
In this review we elucidate the specific interactions involved in regulation of ER
stress via the UPR among eukaryotes and the varying levels of conservation among the
systems. We review the current state of knowledge on UPR in yeast and other fungi, and
provide insights into the more complex UPR sensing mechanisms found in mammals
and, recently, also in plants. Starting with UPR activation, we will detail the specific
molecular processes necessary for ER homeostasis and cell survival as well as reveal
gaps in current knowledge.
2. UPR in Yeast and Other Fungi
UPR in Saccharomyces cerevisiae is now known to consist of a comparatively
simple set of pathways, in which only one protein kinase, namely Ire1p, mediates UPR.
2.1. Ire1p
The initial trigger of UPR in yeast, Ire1p is a transmembrane kinase and
endonuclease protein activated by ligand-triggered dimerization and subsequent trans-
55
autophosphorylation. An accumulation of unfolded proteins is sensed by its core luminal
domain (cLD) leading to activation. Once activated, Ire1p demonstrates endoribonuclease
activity, cleaving HAC1 mRNA into a form, which translates into a basic leucine zipper
(bZIP) transcription factor protein known as Hac1p (Kimata and Kohno, 2011).
Although it is well understood that dissociation from BiP plays a role in Ire1
activation, the exact mechanism of Ire1 regulation has been unclear. A recently published
study (Pincus et al., 2010) suggests that, rather than a simple ON/OFF switch, BiP is
more of a buffer regulating the concentrations of uninhibited Ire1, which can be
activated. This conclusion was reached in part by findings that Ire1 regulation was not
completely lost in yeast ire1 mutant strains unable to bind to BiP. Given this, a two-step
model was proposed, in which first BiP dissociation from Ire1p allows for Ire1p
oligomerization, and second, Ire1p binding to unfolded proteins leads to activation
(Pincus et al., 2010). By sequestering inactive Ire1 molecules, BiP provides a threshold
ensuring access to high concentrations of Ire1p only during severe stress. This conclusion
was further supported by findings of increased clustering - but not activation - among
mutant ire1 strains unable to bind to BiP. Moreover, computational modeling
demonstrated increased sensitivity to triggering an UPR in the absence of BiP binding
(Pincus et al., 2010).
As expected, ire1 or hac1-knockout yeast cells demonstrate increased sensitivity
to ER stress. Although yeast cells do not possess PERK proteins, they have been found to
contain a functional Gcn2p. An evolutionary ancestor to mammalian GCN2 and PERK,
Gcn2p causes translation attenuation upon starvation stress by phosphorylating the
eukaryotic initiation factor 2α (eIF2α) (Mori, 2009). Moreover, ER chaperones and
56
ERAD components are simultaneously transcriptionally induced via the Ire1p-Hac1p
pathway owing to the absence of ATF6 in yeast (Mori, 2009).
Despite multiple universal aspects of fungal UPR, variance has been found to
exist between the changes made to HAC1 mRNA in yeast and other fungi. In S.
cerevisiae, a 252 nucleotide intron is spliced from HAC1 mRNA resulting in replacement
of the carboxy-terminal amino acids in unspliced Hac1p (termed Hac1up) with a new 19
amino-acid segment (Hac1ip) (Sidrauski and Walter, 1997). Other types of fungi, such as
Trichoderma reesei and Aspergillus nidulans, exhibit removal of a much smaller, 20nucleotide intron from their HAC1 homologs. Furthermore, the 5’ untranslated regions
(UTR) of these fungi are truncated and a unique type of transcriptional down-regulation
has been observed (Mulder and Nikolaev, 2009).
Variance has also been observed between the mechanisms of the HAC1
translational block in fungi. In S. cerevisiae, a translational block acts on HAC1 due to
base pairing between the 5’ UTR and the unconventional intron; upon excision of this
intron, the translational block is removed, allowing for increased production of Hac1p. In
contrast, the translational block on HAC1 in Aspergillus niger is mediated by a GC-rich
inverted repeat; upon activation the 5’ UTR is truncated, removing part of this repeat and
allowing for translation (Mulder and Nikolaev, 2009).
HAC1 transcription is also unique in that it has been shown to be autoregulated,
as Hac1p itself binds to an Unfolded Protein Response Element (UPRE), a cis-regulatory
motif present in HAC1 promoter, to increase its own transcription. The regulation of
Hac1p by a conditional splicing event followed by binding to its own promoter is
advantageous as it permits translation only under conditions under which it is needed and
57
allows for a quick increase in Hac1p levels to sufficiently relieve ER stress (Ogawa and
Mori, 2004).
The fungal pathogen, Aspergillus fumigatus, has also been shown to employ the
same IreA-HacA pathway as other fungi, in order to trigger UPR. However, outside of
this cellular state, Ire1p in A. fumigatus has been shown to play a role in multiple
adaptive roles, such as thermotolerance, growth under hypoxia, membrane composition
and nutritional versatility (Feng et al., 2011).
A recent report further supported a model of Ire1p activation, in which unfolded
proteins serve as ligands facilitating Ire1 activation by oligomerization (Walter and Ron,
2011). The core ER luminal domain (cLD) of Ire1p was found to bind to peptides by two
interfaces, the first of which facilitates dimer formation and the second promotes further
oligomerization. cLD was also found to bind to basic residues, with a particularly high
affinity to arginine (Walter and Ron, 2011).
58
Figure 1. Eukaryotic Unfolded Protein Response pathways. Distinct UPR pathways in
yeast, mammals and plants are demonstrated. In yeast, UPR relies almost exclusively on
the signal proteins, known as Ire1p. ER stress in mammals is mediated by three ERresident transmembrane proteins (IRE1α/ IRE1 β, ATF6α/ATF6 β and PERK). Plant
UPR depends upon IRE1a/IRE1b and bZIP17/bZIP28). Downstream signaling in steady
state, cell survival and cell death stages are presented. Intensity of the ER stress in terms
of malfolded proteins over the course of time is shown. Circled “P” denotes for transautophosphorylation in its cytosolic kinase domain, while “*” symbolizes the activated
form of mammalian ATF6 or plant bZIP proteins.
59
3. Mammalian UPR
3.1. IRE1
The most evolutionarily conserved component of UPR, IRE1 exhibits both
endoribonuclease and kinase activities across species. As seen in other organisms, of the
two IRE1 homologs, IRE1α (IRE1a) and IRE1β (IRE1b), IRE1α plays a more central
role than IRE1β. Moreover, in mammals, IRE1α is expressed in a diversity of tissues
while IRE1β is only found in intestinal epithelia (Lee et al., 2003, Lee et al., 2002,
Yoshida et al., 2003).
In resting cells, the IRE1 is bound to luminal binding protein (BiP), also referred
to as GRP78 (Walter and Ron, 2011). Upon interaction with unfolded proteins, BiP
dissociates from these receptors. Malfolded peptides accumulating in the ER lumen lead
to ER stress that, in turn, causes dissociation of BiP from the luminal IRE1 domains.
Specifically, the exposed hydrophobic residues stimulate the ATPase domain of BiP,
resulting in an ADP-bound form with a high affinity for hydrophobic regions. BiP is then
dissociated from unfolded/misfolded proteins by nucleotide exchange factors (NEFs)
such as BiP-Associated Protein (BAP). IRE1, once freed from BiP, undergoes
dimerization and transauto- phosphorylation. Activated IRE1 catalyses the excision of a
26 nucleotides long, unconventional intron from XBP-1 (X-Box Binding Protein) mRNA,
in a manner mechanistically similar to pre-tRNA splicing. Removal of this intron causes
a frame shift in the XBP-1 coding sequence resulting in the translation of a 371 amino
acid, 54 kDa, XBP-1s isoform rather than the 261 amino acid, 33 kDa, XBP-1u isoform
(Yoshida, 2007).
60
The resulting XBP-1s dimerizes and, in conjunction with co-regulators, controls
expression of various chaperones and degradation-related proteins
. XBP1-s also upregulates p58, which has been shown to negatively regulate PERK
activity and is an example of the interconnected nature of UPR sensor pathways and
overall cellular signaling seen in mammals (Mori et al., 2009, Lee et al., 2002, Yoshida et
al., 2003).
Activation of IRE1a can also engage “alarm” genes by recruiting the adaptor
protein TNFR-associated factor 2 (TRAF2). This results in the activation of the apoptosis
signal-regulating kinase 1 (ASK1; also known as MAP3K5) pathway and its downstream
target c-JUN N-terminal kinase JNK28. In addition, IRE1a also engages alarm pathways
such as p38, extracellular signal-regulated kinase (ERK) and nuclear factor κ B (NF κB)
through the binding of distinct adaptor proteins (Hetz, 2012).
Despite a high level of Ire1 conservation between species, the cLD of human
Ire1α, unlike yeast, was found to have a groove too narrow for peptide binding. One
interpretation of this finding is that this represents a closed confirmation of the protein
and that upon peptide binding, an open confirmation similar in shape to yeast Ire1p is
triggered (Gardner and Walter, 2011). Multiple proteins have been shown to play a role
in IRE1 regulation, including tyrosine phosphatase 1B (PTP-1B), ASK1-interacting
protein 1 (AIP1) and members of the Bcl-2 protein family (Luo et al. 2008, Hetz et al.,
2006, Gupta et al., 2010). Although no direct interaction between PTP-1B and IRE1 has
been found, in the absence of PTP-1B decreased IRE1 activity has been shown in the
forms of decreased JNK28 activation, XBP-1 splicing and EDEM transcription (Gu et al.,
2004). AIP1 has also been shown to interact with both TRAF2 and IRE1α; it is currently
61
thought that AIP1 facilitates IRE1α dimerization and IRE1α-TRAF2 complex formation,
leading to ASK1-JNK signaling activation (Luo et al., 2008). Furthermore, IRE1a has
been shown to directly bind to Bax and Bak, two pro-apoptotic members of the Bcl-2
family. It is also thought that Bax inhibitor 1 (BI-1), an anti-apoptotic protein, increases
cell survival by down-regulating IRE1α, through inhibition of its endoribonuclease
activity, as well as down-regulating ATF6 (described below) (Luo et al., 2008, Hetz et
al., 2006, Gupta et al., 2010). Lastly, members of the heat shock protein (HSP) family
have been shown to exhibit IRE1α regulatory functions. For example, HSP90 has been
shown to bind to the cytosolic domain of IRE1α in such a way that it becomes insulated
from degradation by the proteasome. Additionally, HSP72, when bound to the cytosolic
domain of IRE1α, increases the endoribonuclease activity of IRE1α (Hetz, 2012).
3.2. ATF6
A second ER transmembrane protein, activating transcription factor 6 (ATF6) is a
bZIP-like protein that upregulates pro-survival transcription signals to alleviate ER stress
by acting as a mediator in the process. Two homologs of ATF6 have been identified in
mammals: ATF6α and ATF6β (Haze et al., 2001).
As shown in the IRE1 pathway, ER stress leads to dissociation of BiP from the
three UPR signal inducers, PERK, ATF6 and IRE1, allowing for their activation. ATF6,
unlike PERK and IRE1, uniquely translocates to the Golgi apparatus where it is modified
into its active form by two proteolytic cleavage events. Although not certain, it is thought
that Golgi localization sequences, GLS1 and GLS2, take effect with the dissociation from
BiP, mediating translocation (Haze et al., 2001, Haze et al., 1999, Ye et al., 2000). Also
unique among the UPR sensors, ATF6 is not activated by phosphorylation but by
62
regulated intramembrane proteolysis (RIP) in the Golgi system. A first cleavage on the
luminal domain by serine protease site-1 protease (S1P) triggers a second cleavage by
metalloprotease site-2 protease (S2P). This releases the transcriptional domain for import
into the nucleus, where it induces transcription of genes with ATF/cAMP response
elements (CREs) and ER stress elements (ERSEs) (Mori et al., 2009, Haze et al., 2001,
Haze et al., 1999, Ye et al., 2000, Yoshida et al., 2001).
In conjunction with bZIP transcription factors and co-regulators, ATF6
upregulates chaperone activity and unfolded protein degradation. ATF6 likewise
upregulates transcription of BiP, protein disulfide isomerase (PDI) and ER degradationenhancing alpha-mannosidase like protein 1 (EDEM1) and induces expression of XBP-1
via activation of the ER stress element (ERSE) in their promoters. XBP-1 constitutes an
important intersection between UPR sensors given that after induction by ATF6, XBP-1
is processed by IRE1α allowing for further induction of chaperones, as well as p58, a
negative regulator of PERK (Mori et al., 2009, Haze et al., 1999, Ye et al., 2000). ATF6
exhibits anti-apoptotic effects through induction of a calcineurin regulator, which
ultimately leads to the sequestering of Bcl2, a pro-apoptotic protein.
The mechanism by which ATF6 is deactivated is not currently known. It has been
suggested that an unspliced form of XBP-1 (XBP-1u), shown to be a negative regulator
of ATF6, is involved. XBP-1u is thought to play a dual role in the recovery phase of
UPR, binding to and degrading both spliced XBP-1 (XBP-1s) and ATF6, slowing UPRrelated transcription(Mori, 2009).
3.3. PERK
63
Evolutionarily youngest among transmembrane ER receptors, PERK (PKR-like
Endoplasmic Reticulum eIF2α Kinase) is primarily responsible for translation attenuation
contributing to cells’ adaptive response to ER stress. Under non-stress conditions in the
cell, PERK is also bound to luminal binding protein (BiP)(Walter and Ron, 2011). It is
currently theorized that BiP dissociates from PERK and ATF6 before IRE1 (Bernales et
al., 2000, Walter and Ron, 2011, Ron and Walter, 2007).
The N-terminus of PERK contains an ER luminal stress signal which, upon
dissociation from BiP, leads to dimerization and transautophosphorylation of cytosolic
protein kinase domains in the PERK dimer. Activated PERK then phosphorylates the
alpha subunit of the eukaryotic translation initiation factor-alpha (eIF2α) at Serine 51,
deactivating it (Hollien and Weissman, 2006).
As eIF2α is essential for translation initiation, particularly start site recognition,
phosphorylated eIF2α decreases overall levels of protein translation and thus, the rate of
new, unfolded proteins entering the ER, thus allowing the ER time to process the existing
load of unfolded proteins. However, certain mRNAs, which contain internal ribosome
entry site (IRES) sequences, bypass the eIF2α translation inhibition. One such transcript,
ATF4, encodes a cAMP response element-binding transcription factor (C/EBP),
facilitating both pro-survival factors, i.e. amino acid transport and synthesis, redox
reactions and protein secretion, as well as pro-apoptotic factors, such as expression of
transcription factor C/EBP homologous protein (CHOP) (Novoa et al., 2003).
The PERK pathway is largely regulated by p58 and CHOP interactions. p58
expression is induced by ATF6 and inhibits PERK activity through binding to its kinase
domain. p58 activity has been shown to take effect a number of hours after PERK
64
activation and is currently thought to serve as a mechanism for shutting off PERK after a
period of activity. Other observed functions of p58 include co-translational protein
degradation and serving as a co-chaperone with BiP. Moreover, PERK is also regulated
through a negative feedback loop in which PERK-activated CHOP dephosphorylates
eIF2α, removing the block on overall translation (Mori, 2009). Containing a
transcriptional activation domain and a basic-leucine zipper (bZIP) domain, CHOP
inhibits Bcl2 expression and increases recognition of ER-stress inducing cells (Bernales
et al., 2000, Walter and Ron, 2011, Ron and Walter, 2007).
It has been shown that PERK is not solely responsible for regulating cyclin D1
accumulation after the activation of the UPR pathway. Hamanaka and colleagues
demonstrated that fibroblast cells lacking functional PERK display residual eIF2α
phosphorylation. However, in cells harboring targeted deletions of both PERK and
GCN2, another serine/threonine-protein kinase that also phosphorylates eIF2α, the loss of
cyclin D1 is attenuated (Hamanaka et al., 2005). This genetic evidence suggests that both
PERK and GCN2 cooperatively function to regulate eIF2α phosphorylation and cyclin
D1 translation after UPR activation.
The IRE1 pathway has also been shown to be influenced by the PERK pathway
through the activity of microRNA, miR-30c-2* (recently designated miR-30c-2-3p).
PERK- mediated induction of miR-30c-2* regulates the expression of XBP-1,
specifically inhibiting XBP-1-mediated gene transcription and increasing the likelihood
that the cell will undergo apoptosis (Byrd et al., 2012).
4. UPR in Plants
65
To date, two distinct UPR signaling pathways have been identified in plants. The
first involves proteolytic cleavage of two ER transmembrane transcription factors,
bZIP17 and bZIP28, upon translocation to the Golgi system (Liu et al., 2007a, Liu et al.,
2007b), which mechanistically and functionally resembles ATF6-mediated pathway in
mammals. The second consists of an unconventional splicing event in bZIP60 by IRE1a
and IRE1b, analogous to the splicing of HAC1 by Ire1p in yeast and XBP-1 by IRE1α in
mammalian cells.
The Arabidopsis genome encodes two IRE1 homologs, IRE1a (At2g17520,
formerly AtIre1-2) and IRE1b (At5g24360, formerly AtIre1-1) that share 41% amino
acid identity. Both members of IRE1 are shown to have largely overlapping expression
patterns (Noh et al., 2002). However, IRE1b transcript appears to be more abundant in
the floral tissue (Koizumi et al., 2001).
Recently, a number of reports suggest that IRE1a and IRE1b may have different
physiological roles (Moreno et al., 2011, Nagashima et al., 2011, Deng et al., 2011).
IRE1a appears to play a predominant role in plant immunity, whereas IRE1b is involved
in abiotic stresses. In Arabidopsis, maize and other monocots, a segment of bZIP60
mRNA has been shown to fold into a structure, which serves as a recognition site for
Ire1, consisting of two hairpin loops with three conserved bases in each loop (Moreno et
al., 2011, Li et al., 2012). Recent findings have demonstrated that the unspliced form of
bZIP60 contains a transmembrane domain (TMD) that, when spliced out, allows the
gaining of a nuclear localization signal (NLS), which facilitates translocation into the
nucleus to induce the expression of UPR genes (Moreno et al., 2011, Li et al., 2012).
Similar to HAC1, which in its unspliced form codes for a weakly active (ten-fold-less
66
potent) transcriptional activator, translation of an unspliced bZIP60 leads to production of
a transcription factor that cannot activate expression of ER chaperone genes (Iwata and
Koizumi, 2005).
Moreover, a protein homologous to GCN2, the regulatory protein kinase in
yeast, was found in Arabidopsis (Zhang et al., 2008) and termed AtGCN2. AtGCN2 has
been shown to play a role in plant starvation responses and is capable of phosphorylating
the plant equivalent of eIF2α (Lageix et al., 2008, Pajerowska-Mukhtar et al., 2012).
Additionally, a pathway component reminiscent of ATF4 was recently discovered in
Arabidopsis, whereby a transcription factor termed TBF1 is controlled on the
translational level by two upstream open reading frames (uORFs) in its 5’ UTR and its
translational de-repression appears to be dependent on eIF2α phosphorylation
(Pajerowska-Mukhtar et al., 2012). However, unlike in the well characterized dicot
Arabidopsis, comparatively little is known about UPR in monocots. The monocot rice,
Oryza sativa, has only one known IRE1 homolog, OsIRE1, whose downstream effects
are largely unknown. A recent study demonstrates the conservation of the IRE1-bZIP
pathway through identification of a protein homologous to Arabidopsis bZIP60, O. sativa
protein, OsbZIP74, which exhibits a similar unconventional splicing event in response to
ER stress (Lu et al., 2012).
5. Conclusions
In this review, we present the first comprehensive overview of both plant and
animal UPR signaling pathways. Across the kingdoms and throughout various levels of
life’s complexity, the evolution of UPR demonstrates increasing convolution in both form
and function. As discussed above, the most conserved structure of UPR is the IRE1, a
67
universal pro-survival sensor and initiator of UPR across species. Other proteins
homologous to various components of mammalian UPR’s web-like system have been
increasingly identified in other organisms suggesting a greater degree of complexity
among lower eukaryotes than originally thought.
The existence of PERK in mammals and not lower eukaryotes is currently thought
to be due to the evolutionary origin of PERK derived from exon shuffling between IRE1
and GCN2(Byrd et al., 2012). Furthermore, there are currently multiple plausible views
on the relationship between PERK and IRE1. It is currently unknown whether the PERKinduced miRNA found to inhibit XBP-1 expression represents one of multiple miRNAs,
which may exert such an effect. Also of consideration is whether PERK further inhibits
IRE1-mediated survival signaling through its actions of specific transcription activation
or global translation attenuation (Byrd et al., 2012).
Despite the high level of UPR conservation, variation exists between broad
groups of species, as well as similar species such as fungi, supporting previous claims
that UPR is intertwined with multiple additional homeostasis regulatory pathways and
functions. Given this, basic studies on UPR signal transduction, as well as the
relationship between aberrant UPR and disease, constitute very promising areas to offer
therapeutical targets. The current limitation of our understanding of the ER stress sensing
is the inability to identify small molecules that can enhance or suppress a specific branch
of UPR. Future research needs to be dedicated towards that understudied area using highthroughput chemical genomics approaches.
ACKNOWLEDGEMENTS
68
We gratefully acknowledge support from UAB Gulf Oil Response Pilot Grants to
M.S.M. and K.P.M., and the UAB Faculty Development Grant to K.P.M. We also
gratefully acknowledge Ms. Cassandra Garbutt for assistance with preparation of the
figure.
69
Literature Cited
Bernales S, Papa FR, Walter P. Intracellular signaling by the unfolded protein response.
Annu Rev Cell Dev Biol, vol. 6, no. 22, pp.487-508, 2000.
Byrd AE, Aragon IV, Brewer JW. MicroRNA-30c-2* limits expression of proadaptive
factor XBP1 in the unfolded protein response. J Cell Biol, vol. 196, pp. 689-698,
2012.
Deng Y, Humbert S, Liu JX, Srivastava R, Rothstein SJ, Howell SH. Heat induces the
splicing by IRE1 of a mRNA encoding a transcription factor involved in the
unfolded protein response in Arabidopsis. Proc Natl Acad Sci U S A, vol. 108, pp.
7247-7252, 2011.
Feng X, Krishnan K, Richie DL, Aimanianda V, Hartl L, Grahl N, et al. HacAindependent functions of the ER stress sensor IreA synergize with the canonical
UPR to influence virulence traits in Aspergillus fumigatus. PLoS Pathogens, vol.
7, pp. e1002330, 2011.
Gardner BM, Walter P. Unfolded proteins are Ire1-activating ligands that directly induce
the unfolded protein response. Science, vol. 333, pp.1891-1894, 2011.
Gu F, Nguyen DT, Stuible M, Dube N, Tremblay ML, Chevet E. Protein-tyrosine
phosphatase 1B potentiates IRE1 signaling during endoplasmic reticulum stress. J
Biol Chem, vol. 279, pp. 49689-49693, 2004.
Gupta S, Deepti A, Deegan S, Lisbona F, Hetz C, Samali A. HSP72 protects cells from
ER stress-induced apoptosis via enhancement of IRE1alpha-XBP1 signaling
through a physical interaction. PLoS Biol, vol. 8, pp.e1000410, 2010.
Hamanaka RB, Bennett BS, Cullinan SB, Diehl JA. PERK and GCN2 contribute to
70
eIF2alpha phosphorylation and cell cycle arrest after activation of the unfolded
protein response pathway. Mol Biol Cell, vol. 16, pp. 5493-5501, 2005.
Haze K, Okada T, Yoshida H, Yanagi H, Yura T, Negishi M, et al. Identification of the
G13(cAMP-response-element-binding protein-related protein) gene product
related to activating transcription factor 6 as a transcriptional activator of the
mammalian unfolded protein response. Biochem J, vol. 355, pp. 19-28, 2001.
Haze K, Yoshida H, Yanagi H, Yura T, Mori K. Mammalian transcription factor ATF6 is
synthesized as a transmembrane protein and activated by proteolysis in response
to endoplasmic reticulum stress. Mol Biol Cell, vol. 10, pp. 3787-3799, 1999.
Hetz C. The unfolded protein response: controlling cell fate decisions under ER stress
and beyond. Nat Rev Mol Cell Biol, vol.13, pp.89-102, 2012.
Hetz C, Bernasconi P, Fisher J, Lee AH, Bassik MC, Antonsson B, et al. Proapoptotic
BAX and BAK modulate the unfolded protein response by a direct interaction
with IRE1alpha. Science, vol. 312, pp. 572-576, 2006.
Hollien J, Weissman JS. Decay of endoplasmic reticulum-localized mRNAs during the
unfolded protein response. Science, vol. 313, pp. 104-107, 2006.
Iwata Y, Koizumi N. An Arabidopsis transcription factor, AtbZIP60, regulates the
endoplasmic reticulum stress response in a manner unique to plants. Proc Natl
Acad Sci U S A, vol. 102, pp. 5280-5285, 2005.
Kimata Y, Kohno K. Endoplasmic reticulum stress-sensing mechanisms in yeast and
mammalian cells. Current Opinion in Cell Biology, vol. 23, pp.135-142, 2011.
Koizumi N, Martinez IM, Kimata Y, Kohno K, Sano H, Chrispeels MJ. Molecular
characterization of two Arabidopsis Ire1 homologs, endoplasmic reticulum-
71
located transmembrane protein kinases. Plant Physiology, vol. 127, pp. 949-962,
2001.
Lageix S, Lanet E, Pouch-Pelissier MN, Espagnol MC, Robaglia C, Deragon JM, et al.
Arabidopsis eIF2alpha kinase GCN2 is essential for growth in stress conditions
and is activated by wounding. BMC Plant Biology, vol. 8, no. 8, pp.134, 2008.
Lee AH, Iwakoshi NN, Glimcher LH. XBP-1 regulates a subset of endoplasmic reticulum
resident chaperone genes in the unfolded protein response. Mol Cell Biol, vol. 23,
pp.7448-7459, 2003.
Lee K, Tirasophon W, Shen X, Michalak M, Prywes R, Okada T, et al. IRE1-mediated
unconventional mRNA splicing and S2P-mediated ATF6 cleavage merge to
regulate XBP1 in signaling the unfolded protein response. Genes Dev, vol.16,
pp.452-466, 2002.
Li Y, Humbert S, Howell SH. ZmbZIP60 mRNA is spliced in maize in response to ER
stress. BMC Res Notes, vol. 5, pp. 144, 2012.
Liu JX, Srivastava R, Che P, Howell SH. An endoplasmic reticulum stress response in
Arabidopsis is mediated by proteolytic processing and nuclear relocation of a
membrane-associated transcription factor, bZIP28. The Plant Cell, vol. 19, pp.
4111-4119, 2007.
Liu JX, Srivastava R, Che P, Howell SH. Salt stress responses in Arabidopsis utilize a
signal transduction pathway related to endoplasmic reticulum stress signaling.
The Plant Journal vol. 51, pp.897-909, 2007.
Liu JX, Srivastava R, Che P, Howell SH. Salt stress signaling in Arabidopsis thaliana
involves a membrane-bound transcription factor AtbZIP17 as a signal transducer.
72
Plant signaling & behavior, vol. 3, pp.56-57, 2008.
Lu SJ, Yang ZT, Sun L, Sun L, Song ZT, Liu JX. Conservation of IRE1-Regulated
bZIP74 mRNA Unconventional Splicing in Rice (Oryza sativa L.) Involved in ER
Stress Responses. Molecular Plant, vol. 5, pp.504-514, 2012.
Luo D, He Y, Zhang H, Yu L, Chen H, Xu Z, et al. AIP1 is critical in transducing IRE1mediated endoplasmic reticulum stress response. J Biol Chem, vol. 283,
pp.11905-11912, 2008.
Moreno AA, Mukhtar MS, Blanco F, Boatwright JL, Moreno I, Jordan MR, et al.
IRE1/bZIP60-mediated unfolded protein response plays distinct roles in plant
immunity and abiotic stress responses. PLoS One vol. 2, no. 7, pp.e31944, 2011.
Mori K. Signalling pathways in the unfolded protein response: development from yeast to
mammals. J Biochem, vol. 146, pp. 743-750, 2009.
Mulder HJ, Nikolaev I. HacA-dependent transcriptional switch releases hacA mRNA
from a translational block upon endoplasmic reticulum stress. Eukaryot Cell, vol.
8, pp. 665-675, 2009.
Nagashima Y, Mishiba K, Suzuki E, Shimada Y, Iwata Y, Koizumi N. Arabidopsis IRE1
catalyses unconventional splicing of bZIP60 mRNA to produce the active
transcription factor. Scientific Reports, vol. 1, pp. 29, 2011.
Noh SJ, Kwon CS, Chung WI. Characterization of two homologs of Ire1p, a
kinase/endoribonuclease in yeast, in Arabidopsis thaliana. Biochim Biophys Acta,
vol.1575, pp.130-134, 2002.
Novoa I, Zhang Y, Zeng H, Jungreis R, Harding HP, Ron D. Stress-induced gene
expression requires programmed recovery from translational repression. EMBO J,
73
vol. 22, pp. 1180-1187, 2003.
Ogawa N, Mori K. Autoregulation of the HAC1 gene is required for sustained activation
of the yeast unfolded protein response. Genes Cells, vol. 9, pp.95-104, 2004.
Oikawa D, Tokuda M, Hosoda A, Iwawaki T. Identification of a consensus element
recognized and cleaved by IRE1 alpha. Nucleic Acids Research, vol. 38, pp.
6265-6273, 2010.
Pajerowska-Mukhtar KM, Wang W, Tada Y, Oka N, Tucker CL, Fonseca JP, et al. The
HSF-like transcription factor TBF1 is a major molecular switch for plant growthto-defense transition. Current Biology, vol. 22, pp.103-112, 2012.
Pincus D, Chevalier MW, Aragon T, van Anken E, Vidal SE, El-Samad H, et al. BiP
binding to the ER-stress sensor Ire1 tunes the homeostatic behavior of the
unfolded protein response. PLoS Biology, vol. 8, pp.e1000415, 2010.
Ron D, Walter P. Signal integration in the endoplasmic reticulum unfolded protein
response. Nat Rev Mol Cell Biol, vol. 8, pp.519-529, 2007.
Sidrauski C, Walter P. The transmembrane kinase Ire1p is a site-specific endonuclease
that initiates mRNA splicing in the unfolded protein response. Cell, vol. 90, pp.
1031-1039, 1997.
Tsai YC, Weissman AM. The Unfolded Protein Response, Degradation from
Endoplasmic Reticulum and Cancer. Genes Cancer, vol. 1, pp.764-778, 2010.
Walter P, Ron D. The unfolded protein response: from stress pathway to homeostatic
regulation. Science, vol. 334, pp.1081-1086, 2011.
Ye J, Rawson RB, Komuro R, Chen X, Dave UP, Prywes R, et al. ER stress induces
cleavage of membrane-bound ATF6 by the same proteases that process SREBPs.
74
Mol Cell, vol. 6, pp.1355-1364, 2000.
Yoshida H. Unconventional splicing of XBP-1 mRNA in the unfolded protein response.
Antioxid Redox Signal, vol. 9, pp.2323-2333, 2007.
Yoshida H, Matsui T, Hosokawa N, Kaufman RJ, Nagata K, Mori K. A time-dependent
phase shift in the mammalian unfolded protein response. Dev Cell, vol. 4, pp.
265-271, 2003.
Yoshida H, Matsui T, Yamamoto A, Okada T, Mori K. XBP1 mRNA is induced by
ATF6 and spliced by IRE1 in response to ER stress to produce a highly active
transcription factor. Cell, vol. 107, pp. 881-891, 2001.
Zhang K, Kaufman RJ. The unfolded protein response: a stress signaling pathway critical
for health and disease. Neurology, vol. 66, pp. S102-109, 2006.
Zhang Y, Wang Y, Kanyuka K, Parry MA, Powers SJ, Halford NG. GCN2-dependent
phosphorylation of eukaryotic translation initiation factor-2alpha in Arabidopsis.
Journal of Experimental Botany, vol. 59, pp.3131-3141, 2008.
75
76
CHAPTER 3
IRE1/bZIP60-MEDIATED UNFOLDED PROTEIN RESPONSE PLAYS
DISTINCT ROLES IN PLANT IMMUNITY AND ABIOTIC STRESS
RESPONSES
RESEARCH ARTICLE
Adrian A. Moreno1, M. Shahid Mukhtar2, Francisca Blanco 1, Jon Lucas Boatwright 2,
Ignacio Moreno1, Melissa R. Jordan2, Yani Chen3, Federica Brandizzi3, Xinnian Dong4,
Ariel Orellana1,Karolina M. Pajerowska-Mukhtar2
1
FONDAP Center for Genome Regulation, Núcleo Milenio en Biotecnología Celular
Vegetal, Centro de Biotecnología Vegetal, Facultad de Ciencias Biológicas, Universidad
Andrés Bello, Santiago, Chile,
2
Department of Biology, University of Alabama at Birmingham,
Birmingham, AL, USA,
3
Michigan State University–DOE Plant Research Laboratory and Department of Plant
Biology, Michigan State University, East Lansing, MI, USA,
4
Department of Biology, Duke University, Durham, NC, USA
Published, PLoS ONE 7(2): e31944. doi:10.1371/journal.pone.0031944
Format adapted for thesis
77
Abstract— Endoplasmic reticulum (ER)-mediated protein secretion and quality
control have been shown to play an important role in immune responses in both animals
and plants. In mammals, the ER membrane-located IRE1 kinase/endoribonuclease, a key
regulator of unfolded protein response (UPR), is required for plasma cell development to
accommodate massive secretion of immunoglobulins. Plant cells can secrete the so-called
pathogenesis-related (PR) proteins with antimicrobial activities upon pathogen challenge.
However, whether IRE1 plays any role in plant immunity is not known. Arabidopsis
thaliana has two copies of IRE1, IRE1a and IRE1b. Here, we show that both IRE1a and
IRE1b are transcriptionally induced during chemically induced ER stress, bacterial
pathogen infection and treatment with the immune signal salicylic acid (SA). However,
we found that IRE1a plays a predominant role in the secretion of PR proteins upon SA
treatment. Consequently, the ire1a mutant plants show enhanced susceptibility to a
bacterial pathogen and are deficient in establishing systemic acquired resistance (SAR),
whereas ire1b is unaffected in these responses. We further demonstrate that the immune
deficiency in ire1a is due to a defect in SA- and pathogen-triggered, IRE1-mediated
cytoplasmic splicing of the bZIP60 mRNA, which encodes a transcription factor involved
in the expression of UPR-responsive genes. Consistently, IRE1a is preferentially required
for bZIP60 splicing upon pathogen infection, while IRE1b plays a major role in bZIP60
processing upon Tunicamycin (Tm)- induced stress. We also show that SA-dependent
induction of UPR-responsive genes is altered in the bzip60 mutant resulting in a
moderate susceptibility to a bacterial pathogen. These results indicate that the
IRE1/bZIP60 branch of UPR is a part of the plant response to pathogens for which the
78
two Arabidopsis IRE1 isoforms play only partially overlapping roles and that IRE1 has
both bZIP60-dependent and bZIP60-independent functions in plant immunity.
Key words: Arabidopsis; IRE1; bZIP60; Plant Immunity; Unfolded protein response
79
Introduction
Plants and their pathogens are engaged in a constant, co-evolutionary battle for
dominance. Unlike mammals, plants lack mobile phagocytic cells or somatic adaptive
immune systems. However, they have evolved highly sophisticated innate immune
systems to initiate effective defense responses (Jones & Dangl, 2006, Mukhtar et al.,
2011). Plants recognize pathogens through membrane-associated and intracellular
immune receptors. Upon pathogen recognition, plants trigger a robust disease resistance
at the site of infection (Nishimura & Dangl, 2010). Stimulation of defense responses
occurs not only locally but also in distal areas of the plant where the state of resistance is
heightened, a phenomenon known as systemic acquired resistance (SAR) (Durrant &
Dong, 2004). SAR confers immunity throughout the plant against a broad spectrum of
pathogens. Activation of the SAR pathway involves an increase in the cellular
concentration of the immune signal salicylic acid (SA), leading to dramatic induction of
pathogenesis-related (PR) genes. In Arabidopsis, the SA signal is transduced through the
central immune regulator NPR1 (Non-expressor of PR genes). Plants lacking functional
NPR1 are impaired in their abilities to express PR genes and are almost completely
defective in mounting SAR in response to pathogen infection (Cao et al., 1994, Cao et
al., 1997).
NPR1 is involved in the transcriptional changes of as many as ~10% of genes in
Arabidopsis upon treatment with SA (Mukhtar et al., 2009, Wang et al., 2006). Among
its direct transcriptional targets we found not only PR genes but also a large set of SARresponsive endoplasmic reticulum (ER)-resident genes (Wang et al., 2005). These ERresident genes are up-regulated to ensure proper folding and secretion of the PR proteins,
80
which are small polypeptides with antimicrobial activities, and to prevent accumulation
of unfolded proteins (Wang et al., 2005). Recently, it was proposed that a heat-shock like
transcription factor TBF1 coordinately upregulates ER-resident genes upon biotic stimuli
(Pajerowska-Mukhtar et al., 2012).
The cellular responses to unfolded proteins, collectively known as the unfolded protein
response (UPR), have been studied extensively in yeast and humans (Schroder &
Kaufman, 2005). The mammalian UPR signals through three ER-transmembrane
proteins: IRE1, which resembles yeast IRE1/ERN11 (inositol-requiring and ER to
nucleus signaling), ATF6 (activated transcription factor 6), and PERK (ER-resident PKRlike eIF2α kinase) (Ron & Walter, 2007). These proteins represent three arms of the
UPR. The UPR plays a fundamental role in maintaining cellular homeostasis and is
therefore at the center of many normal physiological responses and pathologies (Kimata
& Kohno, 2011). In recent years, UPR has been shown to be involved in plasma cell
differentiation in mammalian adaptive immunity as well as in innate immunity in
invertebrates (Iwakoshi et al., 2003, Reimold et al., 2001, Richardson et al., 2010, Sun et
al., 2011). However, it remains largely unknown whether UPR plays a role in plant
immune responses and if it does, what are the molecular mechanisms involved in this
process.
Genetic studies of the Arabidopsis bip2 (luminal binding protein 2) mutant (Wang et al.,
2005) suggest that the IRE1 branch of the UPR may play a role in plant immunity
because the mutant of BiP, a known regulator of IRE1 in yeast (Bertolotti et al., 2000), is
defective in SAR. In yeast cells, engagement of BiP, an ER chaperone, modulates the
81
activation and duration of UPR according to the magnitude of the cellular stress through
its dynamic interaction with IRE1 (Pincus et al., 2010). Upon significant stress, a pool of
IRE1 released from BiP can dimerize and cross-transphosphorylate to activate the IRE1
cytoplasmic endoribonuclease domains (Korennykh et al., 2009, Shamu & Walter, 1996).
The nuclease in turn cleaves two specific sites, defined by hairpins, in the mRNA
encoding a basic leucine zipper (bZIP) transcription factor, mammalian XBP-1 or yeast
HAC1, in an unconventional cytoplasmic splicing event (Yoshida, 2007). Consequently,
the modified mRNA is produced that gives rise to an active transcription factor for the
induction of ER-resident genes to enhance ER chaperone production (Ron & Walter,
2007).
The Arabidopsis genome encodes two IRE1s, IRE1a (At2g17520, formerly AtIre1-2) and
IRE1b (At5g24360, formerly AtIre1-1) that share 41% amino acid identity, and the genes
have largely overlapping expression patterns (Noh et al., 2002). The kinase activation
loop of IRE1a, but not IRE1b, is similar to the activation loop of mammalian IRE1
orthologs (Schröder & Kaufman, 2007). These findings suggest that IRE1a and IRE1b
may have different physiological roles. Moreover, two recent reports show somewhat
contrasting findings that describe either IRE1b alone (Deng et al., 2011) or both IRE1a
and IRE1b (Nagashima et al., 2011) being required for the splicing of mRNA encoding
bZIP60 (At1g42990), a basic leucine-zipper domain containing transcription factor, in
response to heat and Tunicamycin (Tm; an inhibitor of N-linked glycosylation and a
potent UPR inducer).The unspliced form of bZIP60 is translated into a protein containing
cytoplasmic and transmembrane domains. However, under stress conditions, the
82
processed bZIP60 mRNA is translated into a smaller protein that translocates to the
nucleus and is required to regulate the expression of multiple ER-function related genes
in a manner similar to HAC1 and XBP-1.
Here we show that plants lacking a functional IRE1 are hypersensitive to Tm. However,
even though SA-dependent induction of UPR-responsive genes is affected in both ire1a
and ire1b mutants, only ire1a has a significant effect on PR1 secretion in response to SA
induction. Correspondingly, ire1a shows a pronounced disease susceptibility and
deficient in SAR compared with ire1b, while ire1a ire1b plants show immune-related
phenotypes of even further severity. Furthermore, we found that IRE1a and IRE1b are
quantitatively required for Tm-, pathogen- and SA-induced bZIP60 splicing. Finally, we
demonstrate that bzip60 mutant is more sensitive to a virulent pathogen. Our results
indicate that the IRE1/bZIP60 branch of the UPR signaling pathway plays distinct roles
in plant immunity.
Methods
Mutants and transgenic lines used in this study
All mutants reported below were obtained from the Arabidopsis Biological Resource
Center and are in Col-0 background, with the exception of ire1b-4 that is in Col-3
background. We isolated a homozygous bzip60 (Col-0; SALK_050203) mutant line. For
IRE1a, we acquired three independent homozygous T-DNA insertion lines: ire1a-2
(SALK_018112), ire1a-3 (WiscDsLox420D09) and ire1a-4 (SAIL_1256_F04) and
showed that all three alleles were characterized by a complete loss of IRE1a transcript.
ire1a-1 line (SALK_010332) has been previously reported by Lu and Christopher (Lu &
83
Christopher, 2008) and shown to contain residual levels of IRE1a transcript; thus, we
chose not to use it in this study. For IRE1b, we also obtained three independent T-DNA
insertion lines (ire1b-2, SAIL_252_A05; ire1b-3, SALK_018150 and ire1b-4,
SAIL_238_F07). Nagashima et al. (2011) recently reported ire1b-1 (GABI_638B07),
thus we maintained a continuous nomenclature of the additional alleles in our report. We
were unable to procure ire1b-2 and ire1b-3 homozygous mutants. After self-fertilizing
plants heterozygous for a T-DNA insertion, populations of 1/3 wild-type plants and 2/3
heterozygous plants were recovered in multiple attempts. We tested pollen viability by
Alexander staining method, as well as seed set and seed germination rates but found no
defect in heterozygous IRE1b/ire1b plants compared to the wild-type. We reached the
conclusion that homozygous ire1b-2 and ire1b-3 plants are unviable but the reason for
this is unclear. A similar observation was described in two other reports (Lu &
Christopher, 2008, Nagashima et al., 2011). Nagashima et al. also reported failure to
complement ire1b-2 and ire1b-3 by a genomic IRE1b sequence, which indicates that the
truncated IRE1b-2 and IRE1b-3 proteins might be toxic to the cell and result in lethality.
We were able to obtain ire1b-4 homozygous mutant plants and we did not detect the
presence of a full-length transcript in these plants.
To acquire double ire1 mutants, we crossed ire1a-2 and ire1a-3 to ire1b-4 and obtained
two independent double mutant lines: ire1a-2 ire1b-4 and ire1a-3 ire1b-4.
In order to obtain additional genetic tools to study IRE1b function, we also created stable
RNAi transgenic plants. We identified a part of the IRE1b sequence, located within the 3’
region of the transcript that shared no homology with any other Arabidopsis gene. We
amplified a 370 bp-long fragment using Gateway-adapted PCR primers Ire1b-RNAi-F
84
and Ire1b-RNAi-R2 and cloned it into pDONR207. The resulting pENTR207-IRE1bRNAi clone was next confirmed by sequencing and recombined into the plant expression
vector pJawohl8 RNAi (kind gift of I. E. Somssich, MPI for Plant Breeding Research,
Cologne, Germany). Col-0 and ire1a-2 plants were transformed with the obtained
construct pJawohl8 IRE1b-RNAi using Agrobacterium-mediated floral dip method
(Clough & Bent, 1998). Resulting T1 and T2 seedlings were selected on BASTA. In the
T3 generation, 25-30 independent lines per genetic background were assessed for their
zygocity as well as basal and induced IRE1b transcript levels in leaves (Figure S2). Two
homozygous lines with the most profound reduction in IRE1b transcript levels were
selected for further analyses.
Plant growth conditions
For the RNA and protein sampling and pathogen infection, seeds were incubated for 72 h
at 4°C and grown on MetroMix 360 soil under long day conditions (16 h light/8 h dark)
at 65% humidity for three weeks.
For Tm recovery, seeds were briefly washed in 70% Ethanol and placed in 2% Plant
Preservative Mixture (PPM) for 72 h at 4ºC. Subsequently, PPM was discarded and
seeds were placed in sterile 0.1% Difco agar solution, and spread thinly on solid
Murashige Skoog (MS) medium supplemented with Tm (0.3 μg/mL; Sigma) for 72 h at
22°C. After Tm exposure, 25 seeds per genotype were transferred to 0.8% agar MS
medium supplemented with Ampicillin (50 μg/mL) and grown on horizontal plates.
After 10 days, recovery was recorded. Original Tm plates were kept and checked to
ensure that there was no recovery of the remaining seedlings. For all other chemical
85
treatments, 6-days-old seedlings grown in liquid 0.5 x MS were used and chemicals
added to media at indicated concentration for indicated times.
RT-PCR and bZIP60 splicing assay
Arabidopsis seedlings or detached leaves were harvested in liquid nitrogen. RNA was
extracted from each sample using TRIzol reagent (Invitrogen) and treated with DNase I.
cDNA was synthesized using a SuperScript II first-strand RT-PCR kit (Invitrogen). The
primers used in this study are listed in Table S1 (see Appendix A for all supplemental
materials).
For gel-based bZIP60 splicing assay, PCR conditions for amplification were: initial
denaturation: 5 min at 95°C; 45 s at 95°C, 15 s at 55°C and 30 s at 72°C during 35
cycles; final extension 5 min at 72 °C. Subsequently, PCR products were digested using
Fast Digest® Alw21I enzyme restriction (Thermo Scientific Fermentas) following
manufacturer instructions. Digested products were resolved by gel electrophoresis on
agarose-1000 (3.5% p/v) (Invitrogen) using TAE 1X as running buffer.
For q-PCR based assay, transcript abundance was quantified using bZIP60u or bZIP60s
specific primers (Table S1) using the SYBR GREEN PCR Master Mix (Applied
Biosystems) in a RealPlex S MasterCycler (Eppendorf). Wild-type, ire1a-2, ire1a-3,
ire1a-4, ire1b-4 and ire1a-3 ire1b-4 plants were treated with Tm for 0, 2 and 5 hours.
Since bZIP60 is readily activated by Tm treatment (Iwata & Koizumi, 2005), we next
calculated fold induction of the bZIP60u or bZIP60s transcripts over their basal levels.
We subsequently plotted ratios between the fold induction of the spliced vs. unspliced
bZIP60 forms by adjusting the wild-type ratio as 100% (Figures 5B, S9). bZIP60
transcript analysis presented in Figure S13 was performed with a different set of primers,
86
bZIP60_FWD and bZIP60_REV (Table S1) that amplify both unspliced and spliced
bZIP60 forms.
Stress Assays and Hormones Treatment
15-day-old Arabidopsis seedlings grown in solid MS medium were treated with liquid
MS medium alone and incubated at 37°C (heat stress) or 4°C (cold stress) for the
indicated time. To test salt and osmotic stress, seedlings were treated with liquid MS
medium containing 150 mM NaCl (salt stress) or 300 mM Mannitol (osmotic stress) for
indicated time. To evaluate the role of hormones and chemicals involved in biotic and
abiotic stresses, 6-day-old seedlings grown in liquid MS media were treated with SA (0.5
mM), MeJA (30 µM), Tm (5 µg/mL), DTT (5 mM), CPA (100 µg/mL) or Thapsigargin
(500 nM). Seedlings were treated for the indicated times.
Bacterial Strains, Plant Inoculation Procedures, and Bacteria Growth
Measurements
Infection of Arabidopsis plants with Pseudomonas syringae pv. maculicola (Psm)
ES4326 was performed as described previously (Durrant et al., 2007). To test for
enhanced disease susceptibility, a bacterial suspension of OD600 = 0.0002 was infiltrated
into 2-3 leaves per plant and 12 plants/genotype. Bacterial growth was quantified 3 days
later. To test for SAR, plants were pre-treated with 1 mM SA or mock (H2O) spray 16
hours prior to infection and subsequently inoculated with Psm ES4326 (OD600 =0.001)
into 2-3 leaves per plant and 12 plants/genotype/treatment. Sampling was performed 3
days post inoculation.
PR1 Protein Secretion
87
Three-week-old plants were treated with 1 mM SA for 16 hours before infiltration under
vacuum in a 20 mM phosphate buffer (KH2PO4 and K2HPO4, pH=7.4). Intercellular wash
fluid was collected from equal amounts of tissue by centrifuging the infiltrated leaf
samples, which were packed in a syringe, for 3 min at 1500 g. As a control, total protein
was also extracted from 50 mg of leaf tissue (from 3independent plants) using a buffer
described previously (Wang et al., 2005). Secreted and total protein were run on 14%
SDS-PAGE gels, transferred to a nitrocellulose membrane, and probed with a polyclonal
rabbit antibody raised against a synthetic peptide matching the carboxy terminus of the
Arabidopsis PR1 protein (1:5000 dilution, 4°C, O/N) followed by goat anti-rabbit
secondary antibody (Santa Cruz Biotechnology) (1:20000 dilution, 1 hour). To confirm
equal loading of total protein, Ponceau S was used to stain the total protein blot.
Statistical analyses
Significant differences between genotypes were tested using one-tailed Student’s t-test or
ANOVA followed by the post hoc test Tukey’s Honestly Significant Difference (HSD).
Calculations were made using the SAS 9.2 software package (SAS Institute, Cary, NC).
Results
Genes encoding IRE1 are involved in UPR induced by ER stresses
To investigate the role that UPR plays in response to stress, we employed a genetic
approach. We obtained three independent mutants for ire1a (ire1a-2, ire1a-3 and ire1a4) and one mutant for ire1b (ire1b-4) (Figure S1) (see Materials and Methods).
Additionally, we generated stable RNAi silencing lines for IRE1b in Col-0 and ire1a-2
backgrounds, which show a severe depletion of both basal and induced IRE1b transcripts
88
(Figure S2). Finally, we generated two independent double mutants (ire1a-2 ire1b-4 and
ire1a-3 ire1b-4) (see Materials and Methods). All of these mutants and transgenic plants
were morphologically indistinguishable from wild-type under our growth conditions.
To elucidate the function of IRE1 in UPR, we first examined the expression of both IRE1
genes upon treatment with Tm and observed a marked induction of IRE1a and IRE1b
transcripts in wild-type Col-0 at 2 and 5 hours time points (Figure 1A). An experiment
conducted in the ire1 mutants showed that IRE1a and IRE1b are induced independently
as the IRE1a expression in ire1b-4 and the IRE1b transcript in ire1a-2, ire1a-3 and ire1a4 mutants are comparable to Col-0.
During Tm-induced ER stress, as many as 259 genes are differentially expressed as a part
of the UPR (Iwata et al., 2010). To examine the effects of ire1 mutations on these UPR
genes, we performed real-time PCR on two such ER stress markers genes, SRO2 (Similar
to RCD One 2) and GLP1 (Germin-like protein 1) (Iwata et al., 2010). Consistent with
the previous finding, we showed that Tm induces SRO2 expression, but represses GLP1
transcript levels in Col-0 plants (Figure 1B). The induction of SRO2 in ire1a-2, ire1a-3,
ire1a-4, ire1b-4 and ire1a-3 ire1b-4 was significantly diminished, particularly at 5 hours
post treatment. Importantly, we also observed a marked increase in the basal levels of
SRO2 only in the ire1a-3 ire1b-4 double knock-out mutant. This suggests that SRO2 is
under transcriptional repression in an IRE1-dependent manner that is alleviated upon ER
stress. Conversely, the basal transcript level of GLP1 was increased in all single ire1a
and ire1b mutants and the effect was further pronounced in the ire1a-3 ire1b-4 double
mutant implying that both IRE1a and IRE1b are required in Tm-induced UPR.
89
To further illuminate the function of IRE1, we performed a recovery assay by growing
ire1 mutant seedlings in the presence of Tm for three days, followed by 10 days of
growth on media without Tm. We were able to rescue over 60% wild-type seedlings
(Figure 1C). In comparison with the wild-type and the untreated controls, ire1a-2, ire1a3, ire1a-4 and ire1b-4 mutants exhibited noticeable growth retardation and chlorosis.
This effect was further increased in the ire1a-3 ire1b-4 double mutant with a significantly
reduced recovery rate. The IRE1b RNAi lines showed phenotypic responses consistent
with the insertional mutants (Figure S3). Taken together, these data suggest that both
members of IRE1 additively function in Tm-induced ER stress.
IRE1 plays an integral role in the secretion of PR1 in response to biotic stress
SA, a major phytohormone, regulates over 2000 genes in Arabidopsis (Wang et al.,
2006). We investigated the induction of IRE1a and IRE1b upon SA treatment and
pathogen infection with Pseudomonas syringae pv. maculicola strain ES4326 expressing
the avrRpt2 type III effector, hereafter referred to as Psm ES4326(avrRpt2). Expression
levels of both IRE1a and IRE1b were considerably increased upon both SA and Psm
ES4326(avrRpt2) application at 4 hours in wild-type Col-0 plants (Figure 2A). Moreover,
both SA and pathogen markedly induced IRE1a expression in ire1b-4 and IRE1b
transcript in ire1a-2, ire1a-3 and ire1a-4 mutants. We then tested the two key genes
encoding UPR-responsive markers in the ire1 mutants in response to SA and Psm
ES4326(avrRpt2) induction (Figure 2B). The 0h samples were shared between the Tm,
SA and Psm ES4326(avrRpt2) treatments to better compare the results obtained from
biotic and abiotic stresses. We observed the suppression of SRO2 transcripts in single
ire1a-2, ire1a-3, ire1a-4, ire4b and double ire1a-3ire1b-4 mutants upon SA treatment as
90
well as Psm ES4326(avrRpt2) infection. We detected an increase in GLP1 basal
transcript level in all single ire1a and ire1b mutants and this effect was further enhanced
in the ire1a-3 ire1b-4 double mutant.
These data suggested that ire1a and ire1b have a defect in SA- and pathogen-induced
transcription of genes encoding the ER machinery, and this defect might further translate
into impairment in secretion. To test this hypothesis, we examined the secretion of
pathogenesis-related 1 (PR1) protein, a hallmark of inducible immune response in
Arabidopsis. We collected intercellular wash fluid (IWF) from the leaves of wild-type,
ire1a-2, ire1a-3, ire1b-4 and ire1a-3 ire1b-4 mutants that were treated with SA for 16
hours. We observed a marked reduction of secreted PR1 accumulation in ire1a-2 and
ire1a-3 mutants, but not in the ire1b-4, when compared to the wild-type (Figure 2C). PR1
secretion was further reduced in the ire1a-3 ire1b-4 double mutants. Examination of total
PR1 levels further supported our conclusion that IRE1 are required for PR1 secretion, but
not protein expression (Figure 2C). This result was further validated in IRE1b RNAi lines
in ire1a-2 background (Figure S4). These data demonstrate that IRE1s, especially IRE1a,
play an important role in plant defense by controlling the secretion of antimicrobial
proteins.
Plants lacking functional IRE1 genes are impaired in establishing SAR
Since the SA-dependent regulation of UPR genes is affected and the secretion of PR1 is
diminished in ire1 mutants, we reasoned that loss-of-function of IRE1 might result in
compromised disease resistance responses. Thus, we performed an enhanced disease
susceptibility (EDS) test in wild-type, various single and double ire1 knock-out plants
and npr1 mutants using a low dose of virulent bacterial pathogen Psm ES4326
91
(OD=0.0002). At this dose of inoculant, the immune-deficient npr1 mutant showed a
1000-fold more bacterial growth than the wild-type (Figure 3A). Under the same
conditions, we observed a 10-fold increase in bacterial population in ire1a-2, ire1a-3, and
ire1a-4 compared to Col-0 plants. In contrast, no EDS phenotype was observed in ire1b4 plants. However, plants lacking both IRE1 genes (ire1a-3 ire1b-4 and IRE1b RNAi
lines) exhibited up to 100 fold higher bacterial growth compared to wild-type (Figures
3A, S5).
We next tested whether IRE1 genes are also required to establish effective SAR by
spraying plants with SA, followed by infection with a higher dose of Psm ES4326
(OD=0.001) 16 hours later. In wild-type plants a 100-fold reduction in bacterial
population was observed whereas in npr1 mutant no SAR was detected (Figure 3B). In
comparison, SA-treated ire1a-2, ire1a-3 and ire1a-4 had an approximately 100-fold
higher bacterial population compared to similarly treated wild-type plants. Interestingly,
loss-of-function of IRE1b was not defective in establishing SAR. However, SA-treated
ire1a-3 ire1b-4 supported 1000 times more bacterial growth compared to SA-treated
wild-type. We concluded that ire1a-3 ire1b-4 failed to induce effective SAR, most likely
due to mis-regulation of ER-resident genes, and subsequently a defect in secretion of PR1
into the apoplast. Similar results were also obtained using the IRE1b RNAi lines in Col-0
and ire1a-2 backgrounds (Figures S5, S6).
Quantitative requirement of functional IRE1a and IRE1b in bZIP60 mRNA
processing upon abiotic stresses
92
Activation of IRE1 in yeast and humans leads to cytoplasmic splicing of HAC1 and
XBP-1 mRNAs, respectively, and induction of downstream UPR genes. The candidate
for this IRE1-regulated transcription factor in Arabidopsis, bZIP60, was identified
through a search for hairpins similar to those required for HAC1 and XBP-1 mRNA
splicing (Deng et al., 2011, Nagashima et al., 2011) (Figure S7). However, it was not
known whether bZIP60 is indeed a target of IRE1 nuclease activity in response to biotic
stresses such as pathogen infection. Moreover, the quantitative contribution of each IRE1
homolog in response to biotic and abiotic stresses was not clear. Treating plants with
DTT and Tm, two known inducers of UPR, we observed the appearance of an additional
bZIP60 amplicon smaller in size (bZIP60s) in the RT-PCR experiment (Figure 4).
Sequence analysis confirmed that bZIP60s corresponds to a processed form of bZIP60,
lacking 23 nucleotides, compared to the unspliced bZIP60 (bZIP60u) (Figure S8). We
also found that the ER calcium pump blocker cyclopiazonic acid (CPA) can induce the
processing of bZIP60. In addition, we used thapsigargin, another blocker of calcium
ATPase pumps, and showed that it has no effect on bZIP60 splicing.
Given the position and structure of the processing site in the bZIP60 mRNA, we and
others proposed that bZIP60s is generated through unconventional splicing mediated by
IRE1 (Figure S7) (Deng et al., 2011, Nagashima et al., 2011). This hypothesis is clearly
supported by the significantly reduced and abolished bZIP60 mRNA processing upon Tm
treatment in the ire1b-4 single and the ire1a-2 ire1b-4 double mutant, respectively
(Figure 5A). Interestingly, this Tm-induced bZIP60 splicing seems to predominantly
require IRE1b as the ire1a-2 mutant showed a near-wild-type level of bZIP60 processing.
93
Recently, two reports describe the requirement of only IRE1b (Deng et al., 2011) or both
IRE1a and IRE1b (Nagashima et al., 2011) for bZIP60 processing during heat- and/or
Tm-induced UPR. These studies were based on the presence or absence of the bZIP60s
amplicon. To gain deeper insight into the requirement of IRE1 proteins in bZIP60
processing, we developed a quantitative transcript measurement assay using real-time
quantitative RT-PCR that can distinguish between the bZIP60u and bZIP60s forms
(Figure 5B) (see Materials and Methods). A similar method was recently employed to
demonstrate the quantitative changes of IRE1-dependent XBP-1 processing in
Caenorhabditis elegans upon infection with Pseudomonas aeruginosa (Richardson et al.,
2010) and in a human acute monocytic leukemia cell line (Hirota et al., 2006). We
showed that all ire1a mutants maintain 50-65% of the bZIP60 splicing activity, while
ire1b reduces bZIP60 processing by 95%. bZIP60 splicing was completely abolished in
ire1a-3 ire1b-4. This is consistent with the results from the regular RT-PCR analysis and
with another recently published report (Deng et al., 2011). Our data was further supported
by the reduction of bZIP60 splicing activities in IRE1b RNAi lines (Figure S9).
We also tested whether the exposure of Arabidopsis plants to other abiotic stresses had an
effect on bZIP60 processing. We showed that heat can promote bZIP60 mRNA splicing,
but salt, cold and osmotic stresses failed to induce bZIP60 processing (Figure S10).
Pathogen infection- and SA-dependent bZIP60 processing preferentially requires
IRE1a.
Given that SA can induce UPR and IRE1 is required for efficient PR1 secretion as well as
mounting effective SAR, we further investigated whether SA is a signal capable of
94
activating the IRE1/bZIP60 signaling pathway. We examined bZIP60 mRNA processing
(Figure 6A) in wild-type plants treated with 0.5 mM SA over the course of 5 hours. Such
treatment also stimulates the transcription of GRXC9, a gene known to be early induced
by SA (Blanco et al., 2009). We demonstrated that bZIP60 processing can be detected as
early as one hour post SA treatment and the bZIP60s form persisted up to 5 hours.
However, bZIP60s was completely absent in SA-treated ire1a-2 ire1b-4 plants (Figure
S11). Next, we examined the quantitative requirement of IRE1a and IRE1b for bZIP60
splicing 4 hours after SA treatment and Psm ES4326(avrRpt2) (OD=0.002) infection,
using the qRT-PCR (see Materials and Methods). We demonstrated that pathogen- and
SA-dependent bZIP60 processing is impaired in all ire1a mutants up to 80% and 95%,
respectively (Figure 6B). In contrast, ire1b-4 displays only a minimal reduction in
bZIP60 processing (up to 5%). bZIP60 splicing was further diminished in ire1a-3 ire1b-4
and IRE1B RNAi plants, compared to their corresponding single mutants (Figures 6B,
S12). Similarly to the Tm treatment, both SA and Psm ES4326(avrRpt2) can readily
induce bZIP60 transcript accumulation in wild-type plants, and this induction is partly
affected in the ire1a-3 ire1b-4 double mutant (Figure S13).Finally, we tested whether
methyl jasmonate (MeJA), an active form of jasmonic acid, can also stimulate bZIP60
splicing. Jasmonate (JA) is considered to be another major hormone involved in plant
immune responses. However, JA signaling pathway is mutually antagonistic to SA and
required for resistance to necrotrophic pathogens (Spoel & Dong, 2008). Our results
showed that MeJA failed to activate bZIP60 mRNA processing (Figure S10).
bZIP60 is involved in plant immunity
95
Previously, we illustrated that SA can promote the up-regulation of UPR responsive
genes (Wang et al., 2006, Wang et al., 2005). Does this induction require the
IRE1/bZIP60 branch of the UPR signaling pathway? We demonstrated that SAdependent induction of BiP1/2, CRT2 and UTr1 was abolished in the plants lacking both
members of functional IRE1 (Figure 7). However, bzip60 plants showed a clear effect
only on the CRT2 transcript. In addition, both total and secreted PR1 were unaffected in
the bzip60 mutant plants (Figure S14). These results suggest that IRE1 proteins play a
role in response to SA in a manner that involves not only bZIP60 but also additional
unknown clients, perhaps other transcription factors.
The partial involvement of bZIP60 in SA-induced UPR genes leads to the question about
its role in plant immunity. To shed light on this matter, we infected bzip60 mutant with
Psm ES4326 and monitored bacterial growth over the course of three days. The bzip60
mutant plants exhibited an enhanced susceptibility compared to wild-type plants (Figure
8A), even though it was lower than the effect observed on the IRE1 mutants. Finally, we
tested whether bzip60 can mount effective SAR by infiltrating Psm ES4326 in plants 16
hours after SA treatment. We observed a five-fold higher bacterial growth in the bzip60
mutant compared to wild-type plants (Figure 8B). Taken together, these data show that
bZIP60 plays a role in plant immunity but is not a sole IRE1 client involved in defense
responses.
96
Figure 1. IRE1 is involved in abiotic stresses.
A, The transcript accumulation of IRE1a and IRE1b and B, SRO2 and GLP1 in response
to Tm treatment for 0, 2 and 5 hours in the listed genotypes measured by real-time RT97
PCR. Induction of IRE1a, IRE1b, SRO2 and suppression of GLP1 can be visualized in
the treated wild-type Col-0. IRE1a and IRE1b gene expression was analyzed to confirm
the absence of mRNA in their respective T-DNA insertional mutants. Data represent the
mean and SE of three technical replicates per treatment. Statistical analysis was
performed using Student’s t-test, *, p < 0.05, **, p < 0.01, ***, p ≤ 0.001. Experiments
with at least two independent biological replications demonstrate similar results. C,
Abiotic-dependent UPR was induced in the wild-type and indicated mutant seedlings by
growing them on MS medium containing 0.3 μg/mL Tm for three days. Percentage of
recovery was plotted by calculating alive/dead seedlings recovered ten days post Tm
treatment. Statistical analysis was performed using Student’s t-test, *, p < 0.05, ***, p ≤
0.001. Experiments were repeated at least three times with similar results.
98
Figure 2. UPR-responsive genes and PR1 secretion is affected in ire1 mutants.
A, The expression of IRE1a and IRE1b and B, SRO2 and GLP1were quantified in
response to SA and Psm ES4326(avrRpt2) for 4 hours in the indicated genotypes using
99
real-time RT-PCR. Increased expression of IRE1a, IRE1b, SRO2 and reduced transcript
of GLP1 can be observed in the treated wild-type Col-0. Data represent the mean and SE
of three technical replicates per treatment. Statistical analysis was performed using
Student’s t-test, *, p < 0.05, **, p < 0.01, ***, p ≤ 0.001. Experiments with at least two
independent biological replications demonstrate similar results. C, PR1 protein
accumulation in the ire1 mutants was compared with wild-type. Intercellular wash fluid
(IWF) was collected from 20 leaves derived from 10 plants per indicated genotype
treated with SA for 16 hours. Total protein was extracted from five leaves derived from
three plants per indicated genotype treated with SA for 16 hours. Accumulation of PR1
was detected by Western blotting with anti-PR1 antibody in IWF and total leaf extract
from the indicated genotypes. Ponceau S stain verifies equal loading. Experiments were
repeated at least four times with similar results.
100
Figure 3. IRE1 is required to mount effective systemic acquired resistance.
A, Bacterial growth (colony forming unit – cfu/leaf disc, expressed on a log scale) of
leaves of the indicated genotypes infected with Psm ES4326 (OD=0.0002). Bacterial
101
growth was assessed at 3 dpi. Hypersusceptible npr1 mutant was used as control. Error
bars: 95% confidence interval of the mean (n = 8). Bars connected by the same letter did
not differ from each other at p < 0.05 (Tukey’s HSD tests). B, Chemical SAR was
established by treating indicated genotypes with 1mM SA, while uninduced plants were
sprayed with water 16 hours prior to Psm ES4326 (OD=0.001). Bacterial growth was
monitored 3 days post infection. Hypersusceptible npr1 mutant was used as control. Error
bars represent 95% confidence interval of the mean (n = 8). Bars within a class connected
by the same letter (lowercase for water treatment; uppercase for SA treatment) did not
differ from each other at p < 0.05 (Tukey’s HSD tests). All the experiments were
performed at least three times with similar results.
102
Figure 4. bZIP60 mRNA splicing is stimulated by chemicals that trigger the UPR.
A, Schematic representation of two approaches used to detect the bZIP60 mRNA spliced
forms. Primers sets flanking the putative splicing regions (solid arrows) are indicated
(Top) to amplify bZIP60u and bZIP60s forms using RT-PCR. Alternative, RT-PCR
products are subsequently digested using Alw21I restriction enzyme (Bottom). The latter
approach will highlight the length differences between bZIP60u and bZIP60s since the
103
Alw21I restriction site is present in bZIP60u and absent in bZIP60s. bZIP60u and
bZIP60s PCR products upon digestion are shown. B, Processing of bZIP60 mRNA was
analyzed by gel electrophoresis in agarose (3.5% p/v). RT-PCR products (Top) or RTPCR products digested with Alw21I (bottom) were obtained from RNA samples of
Arabidopsis seedlings (6-day-old) treated for 2 hours with several chemicals that trigger
the UPR (Tm 5 µg/mL; DTT 5 mM; CPA 100 µg/mL; Thapsigargin 500 nM). DMSO
and water-treated samples served as mock controls for chemicals. Asterisk indicates a
hybrid band formed by the bZIP60u and bZIP60s PCR products. Such hybrid band has
been also observed and documented in RT-PCR analysis of XBP-1 processing (Shang &
Lehrman, 2004). Elongation factor 1 alpha (EF1α) expression served as a control. All the
experiments were performed at least three times with similar results.
104
Figure 5. T-DNA insertions in both IRE1 genes affectbZIP60 processing under ER
stress conditions.
A, RT-PCR products derived from bZIP60 mRNA were digested with Alw21I and
resolved by gel electrophoresis in agarose (3.5% p/v). RNA samples were obtained from
wild-type or ire1b-4, ire1a-2 and ire1a-2 ire1b-4 mutant seedlings (6-day-old) treated
105
with Tm for 2 hours. IRE1b and IRE1a gene expression was analyzed to confirm the
absence of mRNA in their respective T-DNA insertional mutants. Elongation factor 1
alpha (EF1α) gene expression served as a control. B, Quantitative measurement of
bZIP60 splicing activity. cDNA was made from the leaf tissue of 3-week-old plants of
the indicated genotypes, untreated or infiltrated with 0.5 μg/mL Tm for 2 hours and 5
hours. Ratios of fold induction of spliced and unspliced bZIP60 are plotted, while setting
ratio of Col-0 as 100%. Statistical analysis was performed using Student’s t-test, *, p <
0.05, ***, p ≤ 0.001. All the experiments were performed at least three times with similar
results.
106
Figure 6. Salicylic acid stimulates bZIP60 processing.
A, RT-PCR products derived from bZIP60 mRNA were digested with Alw21I and
resolved by gel electrophoresis in agarose (3.5% p/v). RNA samples were obtained from
seedlings (6-days-old) of wild-type plants treated with salicylic acid (SA) for the
107
indicated time. As a positive control we used a RNA sample obtained from seedlings
treated with DTT (5 mM) for 2 hours. GRXC9 gene expression served as control for the
action of SA at transcriptional level (Blanco et al., 2009, Sasaki et al., 2001). Elongation
factor 1 alpha (EF1α) gene expression served as a control. B, Pathogen infection and SA
induce bZIP60 splicing in IRE1a-dependent manner. cDNA was made from the leaf
tissue of 3-week-old plants of the indicated genotypes infected with Psm
ES4326(avrRpt2) or sprayed with SA for 4 hours. Ratios of fold induction of spliced and
unspliced bZIP60 in the listed genotypes are plotted, while ratio of Col-0 was set as
100%. Statistical analysis was performed using Student’s t-test, **, p < 0.01, ***, p ≤
0.001. All the experiments were performed at least three times with similar results.
108
109
Figure 7. SA-induced up-regulation of UPR responding genes is altered in ire1 and
bzip60 mutants.
Plants (Col-0, bzip60 and ire1a-2 ire1b-4) were treated with SA for 3 and 5 hours. RNA
was extracted and quantitative PCR was performed for BiP1/2, calreticulin 2 (CRT2) and
the UDP-glucose transporter (UTr1). The results were normalized against a housekeeping
gene (putative clathrin adaptor). Experiment was performed at least three times with
similar results.
110
Figure 8. bZIP60 is involved in plant defense.
A, Col-0, bzip60, ire1a-3 ire1b-4 and hypersusceptible npr1 mutant were infected with
Psm ES4326 (OD=0.0002). Bacterial growth (colony forming units – cfu/leaf disc,
111
expressed on a log scale) was quantified in the leaves of indicated genotypes at 3 dpi.
Error bars represent 95% confidence intervals of the mean (n = 8). Bars connected by the
same letter did not differ from each other at p < 0.05 (Tukey’s HSD tests). B, Chemical
SAR was established by treating Col-0, bzip60, ire1a-3 ire1b-4 and hypersusceptible
npr1 mutant with 1mM SA or mock (water) 16 hours prior to Psm ES4326 (OD=0.001)
infection. Bacterial growth was monitored 3 days post inoculation. Error bars represent
95% confidence intervals of the mean (n = 8). Bars within a class connected by the same
letter (lowercase for water treatment; uppercase for SA treatment) did not differ from
each other at p < 0.05 (Tukey’s HSD tests). All the experiments were performed at least
three times with similar results.
Discussion
Understanding the specific roles of UPR in plant immune responses is a great challenge
as plant cells are pluripotent and have sophisticated mechanisms to prioritize and balance
the different physiological processes when facing external challenges. In the current
study we genetically dissected the additive as well as specific functions of both IRE1
genes upon biotic and Tm-induced ER stresses. We showed that the SA-mediated
induction of downstream ER-responsive genes and UPR marker genes as well as the
secretion of antimicrobial PR proteins are more severely affected in ire1a mutants as
compared to ire1b (Figure 2). Furthermore, while both IRE1 genes are required in
establishing effective SAR, IRE1a appears to play a predominant role in this process
under the conditions tested (Figure 3). However, in response to Tm-induced ER stress,
we demonstrated additive functions of IRE1a and IRE1b (Figures 1, 5) with IRE1b being
112
the more substantial contributor. The differential functions of IRE1a and IRE1b may be a
consequence of their dissimilar protein kinase activation loops (Schröder & Kaufman,
2007). In contrast to the plant proteins, the mammalian IRE1α and IRE1β, while having
very similar protein kinase activation loops, appear to have endonuclease domains
cleaving distinct RNA targets (Patil & Walter, 2001). IRE1α can autoregulate its own
mRNA abundance through an endonucleolytic event (Tirasophon et al., 2000), while
IRE1β attenuates its own translation through inducing degradation of 28S ribosomal
RNA by an endonucleolytic event (Iwawaki et al., 2001). In mice, deletion of IRE1α is
embryo lethal, while deletion of IRE1β is viable, but results in increased sensitivity to
colitis induced by dextran sodium sulfate (Bertolotti et al., 2001). Together with our
results from this study, it is reasonable to postulate that mechanisms of mammalian and
Arabidopsis UPR are more complex than those in yeast (Deng et al., 2011, Gao et al.,
2008), since these organisms evolved an additional IRE1 gene as well as other UPR
sensors to perform diverse functions. Moreover, it has been shown that the Arabidopsis
IRE1a and IRE1b genes have largely overlapping expression patterns (Noh et al., 2002),
but IRE1b transcript appears to be more abundant in the floral tissue (Koizumi et al.,
2001). Similarly, the mammalian IRE1α is ubiquitously expressed (Tirasophon et al.,
1998), whereas expression of IRE1β is limited to the epithelium of the gastrointestinal
tract (Bertolotti et al., 2001).
The Arabidopsis bZIP60 was found due to the conserved hairpins in its mRNA, which
are known to be critical for the IRE1-mediated unconventional splicing of HAC1 and
XBP-1 mRNA (Figures S7, S8) (Deng et al., 2011, Nagashima et al., 2011). Interestingly,
while the human IRE1 enzymes are able to splice the yeast HAC1 mRNA in vitro
113
(Tirasophon et al., 1998), it is not spliced in Arabidopsis protoplasts upon Tm treatment
(Noh et al., 2002).
bZIP60 functions in abiotic and biotic stresses have been previously demonstrated. Overexpression of bZIP60 yields tolerance to salt stress in Arabidopsis (Fujita et al., 2007). In
addition, an up-regulation in the expression of bZIP60 and BiP2 is observed when plants
are exposed to salt-induced UPR (Wang et al., 2010, Wang et al., 2011). However,
bZIP60 mRNA processing is not induced upon salt stress (Figure S10) (Deng et al.,
2011). Recent reports have also suggested that there is a link between bZIP60 and
pathogen attacks as Arabidopsis and N. benthamiana plants infected with viruses showed
an induction of bZIP60 (Mitsuya et al., 2009, Ye et al., 2011). Silencing of NbbZIP60, an
ortholog of bZIP60 in Nicotiana benthamiana that plays a role in ER stress, resulted in
enhanced susceptibility to a non-host pathogen (Tateda et al., 2008). Finally, analyses of
public transcriptomic data in the Genevestigator database (see
https://www.genevestigator.com, (Zimmermann et al., 2004)) show a significant
accumulation of bZIP60 mRNA in plants infected with different pathogens.
Previously, Iwata et al. 2009 speculated that AtbZIP60 might be activated by a
proteolytic cleavage. However, recently published work from the same laboratory
(Nagashima et al., 2011), another report (Deng et al., 2011) and our study all confirmed
that the active form of the bZIP60 protein is synthesized from the mRNA spliced by
IRE1 endonucleases. We demonstrate that the induction and splicing of bZIP60 can also
be activated in response to the immune signal SA and to a bacterial pathogen challenge.
Previously, it has been shown that both IRE1a and IRE1b can splice bZIP60 mRNA in
vitro (Deng et al., 2011). We employed a range of biotic (pathogen infection and SA) and
114
abiotic (DTT, Tunicamycin, heat and CPA) stresses to understand the differential roles of
IRE1a and IRE1b in bZIP60 splicing. Our quantitative splicing data lend some evidence
for a potential preferential requirement of IRE1a in the immune-induced bZIP60
processing. Conversely, IRE1b participates almost exclusively in bZIP60 splicing during
UPR induced by Tm- or DTT-induced ER stresses. IRE1-mediated bZIP60 splicing is
different than the action of other bZIP family members involved in UPR sensing and
signaling, such as bZIP17 and bZIP28. Both of these bZIP factors possess two protease
cleavage sites (S1P and S2P) and undergo UPR stress-triggered proteolytic cleavage to
produce an active protein that is in turn translocated to the nucleus (Gao et al., 2008, Liu
et al., 2007b, Liu et al., 2007a).
It is not completely clear how bZIP60 is mechanistically involved in plant immunity and
what other IRE1 clients may function in concert with bZIP60. Since SA-induced bZIP60
mRNA processing occurs prior to secretion of PR1, it is reasonable to hypothesize that
bZIP60 is, at least partially, involved in the upregulation of the secretory machinery
during plant immune response to accommodate to the massive production of
antimicrobial proteins (Wang et al., 2005). Similarly, the mammalian XBP-1 has been
found to be required for the development of plasma cells from which large amounts of
immunoglobulin proteins are secreted (Iwakoshi et al., 2003, Reimold et al., 2001).
Recently, IRE1-spliced XBP-1 transcript in nematode C. elegans was detected within 4
hours of exposure to P. aeruginosa (Richardson et al., 2010). Infection of the xbp-1
mutant with P. aeruginosa leads to disruption of ER morphology and larval lethality.
Interestingly, this lethal phenotype is not due to excessive proliferation of P. aeruginosa
but rather activation of a receptor PMK-1 (Richardson et al., 2010). Thus, it was
115
proposed that XBP-1 suppresses the detrimental effect of PMK-1 activation during the
immune response but does not facilitate the elimination of the pathogen.
The IRE1-XBP-1/Hac1/bZIP60 is the most conserved branch of the UPR and has been
suggested to play crucial roles in a wide range of biological processes including
development, metabolism, inflammation and immunity (Kaufman & Cao, 2010, Martinon
& Glimcher, 2011). Our results show that IRE1/bZIP60 play distinct roles in both abiotic
and biotic stresses. Our quantitative recovery assay showed a significant decrease in the
survival of bzip60 seedlings on Tm as compared to wild-type. However, this rescue rate
was still higher than that of ire1a-3 ire1b-4 double knock-out plants (Figure S15). These
data are in agreement with the recent expression profiling study that demonstrated a
large, but not complete, overlap in genes differentially regulated by bZIP60 and
IRE1a/IRE1b (Nagashima et al., 2011). Similarly, the immune defect in neither ire1a
ire1b double mutant nor bzip60 plants is as profound as that observed in the npr1 mutant.
It is possible that other branches of the UPR may also participate in plant immunity. In
this regard, some of the differences observed between the phenotypes of ire1a ire1b and
bzip60 suggest the existence of other IRE1 functions, which are independent of bZIP60
signaling, under both abiotic and biotic stresses.
Interestingly, similar observations have been previously made in other systems. Although
the mammalian IRE1α acts mainly via XBP-1 splicing, in pancreatic B-cells, glucose can
enhance IRE1α phosphorylation and augment insulin biosynthesis without increase in
XBP-1 splicing (Lipson et al., 2006). In Drosophila, IRE1 can degrade specific mRNAs
undergoing translation at the ER membrane and halt protein synthesis (Hollien &
Weissman, 2006). Recently, Feng et al. demonstrated that in the absence of ER stress,
116
Aspergillus fumigatus Ire1 controls dual signaling circuits that are both Hac1-dependent
and Hac1-independent (Feng et al., 2011). Our study in plants highlights a complex
regulatory mechanism of UPR which may have been evolved to suit the sessile nature of
plants in response to a variety of stimuli.
Acknowledgements
We thank Drs. Jeff Dangl, Gabriel León and Ricardo Nilo for useful comments on the
manuscript and Ms. M. Froneberger for helping with the experiments.
117
Literature Cited
Bertolotti, A., Wang, X., Novoa, I., Jungreis, R., Schlessinger, K., Cho, J. H., et al.
(2001) Increased sensitivity to dextran sodium sulfate colitis in IRE1betadeficient mice. The Journal of clinical investigation, 107, 585-593.
Bertolotti, A., Zhang, Y., Hendershot, L. M., Harding, H. P. and Ron, D. (2000) Dynamic
interaction of BiP and ER stress transducers in the unfolded-protein response.
Nature cell biology, 2, 326-332.
Blanco, F., Salinas, P., Cecchini, N. M., Jordana, X., Van Hummelen, P., Alvarez, M. E.,
et al. (2009) Early genomic responses to salicylic acid in Arabidopsis. Plant
molecular biology, 70, 79-102.
Cao, H., Bowling, S. A., Gordon, S. and Dong, X. (1994) Characterization of an
Arabidopsis mutant that is nonresponsive to inducers of systemic acquired
resistance. The Plant cell, 6, 1583-1592.
Cao, H., Glazebrook, J., Clark, J. D., Volko, S. and Dong, X. (1997) The Arabidopsis
NPR1 gene that controls systemic acquired resistance encodes a novel protein
containing ankyrin repeats. Cell, 88, 57-63.
Clough, S. J. and Bent, A. F. (1998) Floral dip: a simplified method for Agrobacteriummediated transformation of Arabidopsis thaliana. Plant Journal, 16, 735-743.
Deng, Y., Humbert, S., Liu, J. X., Srivastava, R., Rothstein, S. J. and Howell, S. H.
(2011) Heat induces the splicing by IRE1 of a mRNA encoding a transcription
factor involved in the unfolded protein response in Arabidopsis. Proc Natl Acad
Sci U S A, 108, 7247-7252.
118
Durrant, W. E. and Dong, X. (2004) Systemic acquired resistance. Annu Rev
Phytopathol, 42, 185-209.
Durrant, W. E., Wang, S. and Dong, X. N. (2007) Arabidopsis SNI1 and RAD51D
regulate both gene transcription and DNA recombination during the defense
response. Proceedings of the National Academy of Sciences of the United States
of America, 104, 4223-4227.
Feng, X., Krishnan, K., Richie, D. L., Aimanianda, V., Hartl, L., Grahl, N., et al. (2011)
HacA-Independent Functions of the ER Stress Sensor IreA Synergize with the
Canonical UPR to Influence Virulence Traits in Aspergillus fumigatus. PLoS
Pathog, 7, e1002330.
Fujita, M., Mizukado, S., Fujita, Y., Ichikawa, T., Nakazawa, M., Seki, M., et al. (2007)
Identification of stress-tolerance-related transcription-factor genes via mini-scale
Full-length cDNA Over-eXpressor (FOX) gene hunting system. Biochemical and
biophysical research communications, 364, 250-257.
Gao, H., Brandizzi, F., Benning, C. and Larkin, R. M. (2008) A membrane-tethered
transcription factor defines a branch of the heat stress response in Arabidopsis
thaliana. Proceedings of the National Academy of Sciences of the United States of
America, 105, 16398-16403.
Hirota, M., Kitagaki, M., Itagaki, H. and Aiba, S. (2006) Quantitative measurement of
spliced XBP1 mRNA as an indicator of endoplasmic reticulum stress. The
Journal of toxicological sciences, 31, 149-156.
Hollien, J. and Weissman, J. S. (2006) Decay of endoplasmic reticulum-localized
mRNAs during the unfolded protein response. Science, 313, 104-107.
119
Iwakoshi, N. N., Lee, A. H., Vallabhajosyula, P., Otipoby, K. L., Rajewsky, K. and
Glimcher, L. H. (2003) Plasma cell differentiation and the unfolded protein
response intersect at the transcription factor XBP-1. Nature immunology, 4, 321329.
Iwata, Y. and Koizumi, N. (2005) An Arabidopsis transcription factor, AtbZIP60,
regulates the endoplasmic reticulum stress response in a manner unique to plants.
Proceedings of the National Academy of Sciences of the United States of America,
102, 5280-5285.
Iwata, Y., Sakiyama, M., Lee, M.-H. and Koizumi, N. (2010) Transcriptomic response of
Arabidopsis thaliana to tunicamycin-induced endoplasmic reticulum stress. Plant
Biotechnology, 27, 161-171.
Iwawaki, T., Hosoda, A., Okuda, T., Kamigori, Y., Nomura-Furuwatari, C., Kimata, Y.,
et al. (2001) Translational control by the ER transmembrane kinase/ribonuclease
IRE1 under ER stress. Nature cell biology, 3, 158-164.
Jones, J. D. and Dangl, J. L. (2006) The plant immune system. Nature, 444, 323-329.
Kaufman, R. J. and Cao, S. (2010) Inositol-requiring 1/X-box-binding protein 1 is a
regulatory hub that links endoplasmic reticulum homeostasis with innate
immunity and metabolism. EMBO Mol Med, 2, 189-192.
Kimata, Y. and Kohno, K. (2011) Endoplasmic reticulum stress-sensing mechanisms in
yeast and mammalian cells. Current opinion in cell biology, 23, 135-142.
Koizumi, N., Martinez, I. M., Kimata, Y., Kohno, K., Sano, H. and Chrispeels, M. J.
(2001) Molecular characterization of two Arabidopsis Ire1 homologs,
120
endoplasmic reticulum-located transmembrane protein kinases. Plant physiology,
127, 949-962.
Korennykh, A. V., Egea, P. F., Korostelev, A. A., Finer-Moore, J., Zhang, C., Shokat, K.
M., et al. (2009) The unfolded protein response signals through high-order
assembly of Ire1. Nature, 457, 687-693.
Lipson, K. L., Fonseca, S. G., Ishigaki, S., Nguyen, L. X., Foss, E., Bortell, R., et al.
(2006) Regulation of insulin biosynthesis in pancreatic beta cells by an
endoplasmic reticulum-resident protein kinase IRE1. Cell metabolism, 4, 245-254.
Liu, J. X., Srivastava, R., Che, P. and Howell, S. H. (2007a) An endoplasmic reticulum
stress response in Arabidopsis is mediated by proteolytic processing and nuclear
relocation of a membrane-associated transcription factor, bZIP28. The Plant cell,
19, 4111-4119.
Liu, J. X., Srivastava, R., Che, P. and Howell, S. H. (2007b) Salt stress responses in
Arabidopsis utilize a signal transduction pathway related to endoplasmic
reticulum stress signaling. The Plant journal : for cell and molecular biology, 51,
897-909.
Lu, D. P. and Christopher, D. A. (2008) Endoplasmic reticulum stress activates the
expression of a sub-group of protein disulfide isomerase genes and AtbZIP60
modulates the response in Arabidopsis thaliana. Mol Genet Genomics, 280, 199210.
Martinon, F. and Glimcher, L. H. (2011) Regulation of innate immunity by signaling
pathways emerging from the endoplasmic reticulum. Curr Opin Immunol, 23, 3540.
121
Mitsuya, Y., Takahashi, Y., Berberich, T., Miyazaki, A., Matsumura, H., Takahashi, H.,
et al. (2009) Spermine signaling plays a significant role in the defense response of
Arabidopsis thaliana to cucumber mosaic virus. Journal of plant physiology, 166,
626-643.
Mukhtar, M. S., Carvunis, A. R., Dreze, M., Epple, P., Steinbrenner, J., Moore, J., et al.
(2011) Independently evolved virulence effectors converge onto hubs in a plant
immune system network. Science, 333, 596-601.
Mukhtar, M. S., Nishimura, M. T. and Dangl, J. (2009) NPR1 in Plant Defense: It's Not
over 'til It's Turned over. Cell, 137, 804-806.
Nagashima, Y., Mishiba, K., Suzuki, E., Shimada, Y., Iwata, Y. and Koizumi, N. (2011)
Arabidopsis IRE1 catalyses unconventional splicing of bZIP60 mRNA to produce
the active transcription factor. Scientific Reports, 1.
Nishimura, M. T. and Dangl, J. L. (2010) Arabidopsis and the plant immune system. The
Plant journal : for cell and molecular biology, 61, 1053-1066.
Noh, S. J., Kwon, C. S. and Chung, W. I. (2002) Characterization of two homologs of
Ire1p, a kinase/endoribonuclease in yeast, in Arabidopsis thaliana. Biochim
Biophys Acta, 1575, 130-134.
Pajerowska-Mukhtar, K. M., Wang, W., Tada, Y., Oka, N., Tucker, C. L., Fonseca, J. P.,
et al. (2012) The HSF-like Transcription Factor TBF1 Is a Major Molecular
Switch for Plant Growth-to-Defense Transition. Curr Biol.
Patil, C. and Walter, P. (2001) Intracellular signaling from the endoplasmic reticulum to
the nucleus: the unfolded protein response in yeast and mammals. Current
opinion in cell biology, 13, 349-355.
122
Pincus, D., Chevalier, M. W., Aragon, T., van Anken, E., Vidal, S. E., El-Samad, H., et
al. (2010) BiP binding to the ER-stress sensor Ire1 tunes the homeostatic behavior
of the unfolded protein response. PLoS Biol, 8, e1000415.
Reimold, A. M., Iwakoshi, N. N., Manis, J., Vallabhajosyula, P., Szomolanyi-Tsuda, E.,
Gravallese, E. M., et al. (2001) Plasma cell differentiation requires the
transcription factor XBP-1. Nature, 412, 300-307.
Richardson, C. E., Kooistra, T. and Kim, D. H. (2010) An essential role for XBP-1 in
host protection against immune activation in C. elegans. Nature, 463, 1092-1095.
Ron, D. and Walter, P. (2007) Signal integration in the endoplasmic reticulum unfolded
protein response. Nat Rev Mol Cell Biol, 8, 519-529.
Sasaki, Y., Asamizu, E., Shibata, D., Nakamura, Y., Kaneko, T., Awai, K., et al. (2001)
Monitoring of methyl jasmonate-responsive genes in Arabidopsis by cDNA
macroarray: self-activation of jasmonic acid biosynthesis and crosstalk with other
phytohormone signaling pathways. DNA research : an international journal for
rapid publication of reports on genes and genomes, 8, 153-161.
Schroder, M. and Kaufman, R. J. (2005) The mammalian unfolded protein response.
Annu Rev Biochem, 74, 739-789.
Schröder, M. E. and Kaufman, R. J. (2007) IRE1. UCSD Nature Molecule Pages,
doi:10.1038/mp.a003134.003101.
Shamu, C. E. and Walter, P. (1996) Oligomerization and phosphorylation of the Ire1p
kinase during intracellular signaling from the endoplasmic reticulum to the
nucleus. The EMBO journal, 15, 3028-3039.
123
Shang, J. and Lehrman, M. A. (2004) Discordance of UPR signaling by ATF6 and Ire1pXBP1 with levels of target transcripts. Biochemical and biophysical research
communications, 317, 390-396.
Spoel, S. H. and Dong, X. (2008) Making sense of hormone crosstalk during plant
immune responses. Cell Host Microbe, 3, 348-351.
Sun, J., Singh, V., Kajino-Sakamoto, R. and Aballay, A. (2011) Neuronal GPCR controls
innate immunity by regulating noncanonical unfolded protein response genes.
Science, 332, 729-732.
Tateda, C., Ozaki, R., Onodera, Y., Takahashi, Y., Yamaguchi, K., Berberich, T., et al.
(2008) NtbZIP60, an endoplasmic reticulum-localized transcription factor, plays a
role in the defense response against bacterial pathogens in Nicotiana tabacum.
Journal of plant research, 121, 603-611.
Tirasophon, W., Lee, K., Callaghan, B., Welihinda, A. and Kaufman, R. J. (2000) The
endoribonuclease activity of mammalian IRE1 autoregulates its mRNA and is
required for the unfolded protein response. Genes & development, 14, 2725-2736.
Tirasophon, W., Welihinda, A. A. and Kaufman, R. J. (1998) A stress response pathway
from the endoplasmic reticulum to the nucleus requires a novel bifunctional
protein kinase/endoribonuclease (Ire1p) in mammalian cells. Genes &
development, 12, 1812-1824.
Wang, D., Amornsiripanitch, N. and Dong, X. (2006) A genomic approach to identify
regulatory nodes in the transcriptional network of systemic acquired resistance in
plants. PLoS Pathog, 2, e123.
124
Wang, D., Weaver, N. D., Kesarwani, M. and Dong, X. (2005) Induction of protein
secretory pathway is required for systemic acquired resistance. Science, 308,
1036-1040.
Wang, M., Xu, Q., Yu, J. and Yuan, M. (2010) The putative Arabidopsis zinc transporter
ZTP29 is involved in the response to salt stress. Plant molecular biology, 73, 467479.
Wang, M., Xu, Q. and Yuan, M. (2011) The unfolded protein response induced by salt
stress in Arabidopsis. Methods in enzymology, 489, 319-328.
Ye, C., Dickman, M. B., Whitham, S. A., Payton, M. and Verchot, J. (2011) The
unfolded protein response is triggered by a plant viral movement protein. Plant
physiology, 156, 741-755.
Yoshida, H. (2007) Unconventional splicing of XBP-1 mRNA in the unfolded protein
response. Antioxidants & redox signaling, 9, 2323-2333.
Zimmermann, P., Hirsch-Hoffmann, M., Hennig, L. and Gruissem, W. (2004)
GENEVESTIGATOR. Arabidopsis microarray database and analysis toolbox.
Plant physiology, 136, 2621-2632.
125
126
CHAPTER 4
NOVEL FUNCTIONS OF IRE1 AND GCN2 IN CELL DEATH CONTROL
J Lucas Boatwright 1, Danielle Robinson1, Karolina M Pajerowska-Mukhtar1
1
Department of Biology, University of Alabama at Birmingham
Birmingham, AL, 35294
Manuscript in preparation
127
Abstract—Plant survival is dependent upon stress amelioration. Since a variety of stressmediating mechanisms require extensive protein production, plants have adapted to
fluctuating demands on the endoplasmic reticulum. Some of these functions are mediated
by the UPR proteins IRE1 and GCN2. The IRE1 and GCN2 pathways are highly
conserved among multicellular organisms and have, more recently, been shown to
participate in crosstalk with a variety of other cellular pathways. In rice, UPR functions in
both salicylic acid signaling and cell death control; however, these findings are based
upon coinciding gene expression and not direct interactions. Similar functions have not
been established in Arabidopsis. Here, I demonstrate that Atire1 and Atgcn2 exhibit
diminished cell death activity and propose that the IRE1 client, bZIP60, may be repressed
by UPR-mediated miRNA expression. I further postulate that this function may allow for
either a return to homeostasis or act as a life-or-death switch. Further study of these
responses may shed light upon stress remediation at the cellular level.
Key Words: Arabidopsis, bZIP60, caspase, cell death, GCN2, Hypersensitive response,
IRE1, miRNA, UPR
128
Introduction
On a rudimentary level, plant survival is dependent upon the ability to overcome
stressors and maintain homeostasis. This can be difficult since, unlike animals, plants are
unable to relocate to less stressful environments (Fujita et al., 2006). As such, plants
struggle against a mix of biotic, including parasitism or herbivory (Walling, 2000), and
abiotic stressors, such as osmotic or salt stress (Zhu, 2002).
These abiotic and biotic stresses can cause fluctuations on the demands of the
endoplasmic reticulum (ER) as stress alleviation is facilitated, in part, by proteins. Thus,
increasing demands on the ER may exceed the protein folding and packaging capabilities
of individual cells resulting in ER stress (Schroder & Kaufman, 2005). Accumulation of
nascent proteins within the ER activates ER-signaling responses that are known
collectively as the Unfolded Protein Response (UPR). UPR acts to resolve ER stress by
inhibiting continued translation, increasing gene expression of ER-resident chaperones,
expanding the ER membrane and increasing the activation of ER-Associated Degradation
(ERAD) elements (Sitia & Braakman, 2003). Cells survive if they successfully return to
homeostasis; otherwise, stressed cells will activate apoptotic pathways leading to
localized cell death (Xu et al., 2005).
UPR stress mediation pathways are conserved throughout the Domain Eukarya. In
plants, these pathways consist of ER-bound, stress-sensing signaling proteins (Qiang et
al., 2012). In Arabidopsis, two homologs of IRE1 (Inositol-requiring enzyme 1), bZIP17
(basic leucine zipper), bZIP28 and GCN2 (general control nonrepressed 2) appear to be
the key UPR stress-sensing pathways (Duffee et al., 2012). In the uninduced state,
inactive ER chaperones bind to the ER luminal domains and suppress activation of these
129
stress-signaling pathways. Nascent protein accumulation within the ER facilitates
dissociation of the chaperones, which consequently moderate protein folding (Nuttall et
al., 2002). Activation events are distinct for each protein with events consisting of
phosphorylation, dimerization, ER membrane dissociation and subsequent proteolytic
cleavage, or activation of an endoribonuclease domain responsible for splicing client
transcripts within the cytoplasm in an atypical splicing event (Duffee et al., 2012). We
will focus on two branches of UPR, namely IRE1 and GCN2.
Plant IRE1 homologues include IRE1a and IRE1b, analogous to the mammalian
IRE1α and IRE1β (Koizumi et al., 2001). Activation of IRE1 occurs through the
previously discussed protein accumulation and chaperone dissociation method. IRE1,
consequently, homodimerizes and transautophosphorylates, leading to the activation of
its endoribonuclease domain. This domain demonstrates the ability to recognize and
splice bZIP60 transcript (Iwata & Koizumi, 2005a). GCN2 activation is accomplished by
homodimerization, transautophosphorylation and then phosphorylation of eIF2α
(eukaryotic Initiation Factor 2α). Pajerowska-Mukhtar and colleagues previously
determined that eIF2α facilitates ribosome reattachment to the translational start codon of
TBF1 downstream of upstream Open Reading Frames (uORFs), thereby allowing
initiation of TBF1 translation (Pajerowska-Mukhtar et al., 2012).
Regulatory control of gene expression has also been shown to occur via
microribonucleic acids (miRNAs) in many systems, including unicellular and
multicellular eukaryotes, prokaryotes and viruses (Huang et al., 2012, Cullen, 2012).
miRNAs bind onto perfectly or imperfectly complementary mRNAs and promote
translational repression (Cai et al., 2009, Mah et al., 2010). Whether this repression is
130
blocked during initiation of translation or blocks elongation is currently unclear.
However, miRNAs have been documented to participate in developmental switches, finetuning development, cell proliferation, apoptosis and even as regulatory feedback loops
(Bushati & Cohen, 2007). In the mammalian system, miRNAs have demonstrated
inhibitory effects on the translation of certain branches of UPR. In this scenario, the
PERK pathway manipulates XBP1 gene expression via miR-30c-2 (Byrd et al., 2012). I
theorized that a similar mechanism may function in the plant system. As such, miRNAs
can either function in the restoration of homeostasis or alteration of gene expression to a
new regime during stress. These miRNAs may function in either positive or negative
feedback loops and add not only another regulatory aspect to UPR but may also bridge
two branches of UPR (Leung & Sharp, 2010a).
The evolution of plant defenses is of vital importance to understanding the plantpathogen arms race. Since plants do not possess mobile immune cells, they have
developed a diverse spectrum of defense strategies for dealing with pathogen invasion
(Jones & Dangl, 2006). One method of plant defense depends upon the detection of
avirulent effectors, which initiate Effector Triggered-Immunity (ETI). ETI is often
characterized by an early defense response that regulates Programmed Cell Death (PCD)
as part of an attempt to restrict pathogen growth, known as the hypersensitive response
(HR) (Gohre & Robatzek, 2008).
The hypersensitive response (HR) is a key example that utilizes the plant’s ability
to undergo PCD as a defense strategy (Lam, 2004). In this scenario, localized cell death
attempts to prevent further pathogen ingress and spread to neighboring plant cells. HR is
initiated upon recognition of pathogen avirulence (Avr) factors and often involves
131
vacuole disruption for cell lysis (Ebel & Cosio, 1994). These instances of vacuolemediated cell death may occur via two distinct methods: destructive or non-destructive.
The destructive method is initiated by vacuolar collapse and occurs in response to viral
pathogens, induction by fungal toxins and integument and tracheary element
development (Hatsugai et al., 2006). The non-destructive method requires fusion of the
vacuolar and cytoplasmic membranes and is induced upon avirulent pathogen detection
(Hara-Nishimura & Hatsugai, 2011).
Crosstalk between stress and cell death pathways appears to be conserved
between plants and animals as well as apoptosis and Programmed Cell Death (PCD),
which are genetically regulated processes that may occur in response to abiotic or biotic
stressors (Lam et al., 2001). In mammals, ER stress and UPR have been linked with
extrinsic and intrinsic apoptotic pathways regulated by caspase activity (Kumar, 2007).
While plants do not possess classical caspases, up to eight different caspase-like activities
have been described (YVADase, DEVDase, VEIDase, IETDase, VKMDase, LEHDase,
TATDase and LEVDase). Vacuolar processing enzyme (VPE) is one of the several
proteins responsible for this activity (Bredesen et al., 2006).
VPE demonstrates catalytic activities against YVAD, a known caspase-1
substrate, ESEN and AAN and is necessary for Tobacco Mosaic Virus (TMV)-induced
PCD in Nicotiana benthamiana (Kuroyanagi et al., 2002, Chen et al., 1997). VPE is also
necessary for fumonisin-induced cell death and developmental cell death (Hatsugai et al.,
2004). Metacaspase activity has also been shown to be required for PCD regulation in
plants; as metacaspase knockout lines demonstrate reduced cell death (Xu & Zhang,
2009). Interestingly, Arabidopsis metacaspases AtMC1 and AtMC2 were shown to
132
control PCD antagonistically, with AtMC1 positively regulating PCD and AtMC2
negatively regulating PCD. Also, AtMC1 required functioning caspase-like residues
whereas, AtMC2 did not. The metacaspase, AtMC1, is a key component to establishing
both HR mediated by nucleotide-binding leucine-rich repeats and superoxide-dependent
cell death (Coll et al., 2010).
While the complicated interactions between pathogen-induced stress, UPR and
cell death are far from clear (Iwata & Koizumi, 2005b), I demonstrate several links
between UPR pathways, IRE1 and GCN2, upon various pathogen infections and the PCD
that follows, uniting defense, ER stress and cell death control in these two pathways.
Materials and Methods
Plant Growth Conditions and Pathogen Treatments
Growth Conditions
For the protein, DNA and RNA sampling and pathogen infections, seeds were
sown on MetroMix 360 soil and incubated for 72 h at 4°C. Seeds were then transferred to
a growth room (12 h light/12 h dark) at 65% humidity for one week. Seedlings were
transplanted into 72 well trays and continued growing for two additional weeks at growth
room conditions before treatments.
Bacterial Inoculation Procedures
Infection of Arabidopsis plants with Pseudomonas syringae pv. maculicola (Psm)
ES4326 or Psm harboring the avirulence gene avrRpm1 was performed on four-week-old
plants. To test for enhanced disease susceptibility, a bacterial suspension of OD 600
133
=0.0002 was infiltrated into two to three leaves per plant and 12 plants/genotype.
Enhanced disease resistance was tested with OD=0.002. To test for SAR, plants were pretreated with 1 mM SA or mock (H2O) spray 16 hours prior to infection and subsequently
inoculated with Psm ES4326 (OD600 = 0.001) into two to three leaves per plant and 12
plants/genotype/treatment. Sampling in both EDS and SAR required the removal of two
6-mm leaf discs per plant from six to twelve plants three days post inoculation. Two leaf
discs per genotype/treatment were placed in 500 μL of 10 mM MgCl2 and homogenized
to break open the plant tissue and release the bacteria. Aliquots of 20 μL were taken from
each homogenized mixture and placed into a 96-well plate containing 180 μL of MgCl2
per well. Serial dilutions (1:10) were made from the first row down to the sixth row by
removing 20 μL from each preceding well to the one beneath it. These dilutions were all
plated onto a plate of KB media containing either streptomycin (Psm) or both
streptomycin and tetracycline (Psm avrRpm1). Bacterial growth was quantified 3 days
later.
Fungal droplet assay
Fungal pathogens Alternaria brassicicola and Botrytis cinerea were grown on V8
media for three weeks prior to spore collection. Spores were collected with one-half
potato dextrose solution (12 g/L) to a concentration of 450 spores/µL, determined using a
hemocytometer. Plants were either sprayed with spore solution (1 mL per plant) or
treated with 10 µL of the spore solution per leaf and covered with a plastic dome sprayed
with water to maximize humidity. Plants remained under the dome for 12-14 days, until
leaves began showing signs of necrosis. Necrosis was estimated both qualitatively and
134
quantitatively with the Arabidopsis mutant pad2 acting as a hypersusceptible control.
Pictures of infected leaves were taken after leaf removal followed by leaf disc removal at
infection sites and DNA extraction of leaf discs via Cetyltrimethylammonium Bromide
(CTAB) methods. Genes examined include the A. brassicicola-specific gene cutinase
(AbrCUT) and Alternaria 115, a gene encoding a nonribosomal peptide synthetase.
Plant Molecular Procedures
RNA extraction and RT PCR
Arabidopsis leaves were harvested in liquid nitrogen and subsequently
homogenized using a Fischer Scientific PowerGen™ High Throughput Homogenizer.
RNA extraction was performed using TRIzol reagent (Invitrogen) and followed by
treatment with DNase I. TRIzol (1 mL) was added to homogenized tissue samples and
briefly vortexed. Samples were incubated for five minutes at room temperature followed
by addition of 0.2 mL of chloroform. Samples were vortexed again and then centrifuged
at 12,000 rpm for 15 minutes at 4°C. RNA was transferred to another centrifuge tube
containing and precipitated using 500 uL of 100% isopropanol. Samples were
subsequently incubated at room temperature for 10 minutes and centrifuged at 12,000
rpm for 10 minutes at 4°C. The resulting RNA pellet was washed with 70% ethanol made
with diethylpyrocarbonate (DEPC) water. Samples were then centrifuged at 7,500 rpm
for 10 minutes at 4°C. The supernatant was then aspirated and the samples were
centrifuged again for 10 seconds to remove remaining droplets. The pellet was dried at
room temperature for five to ten minutes and resuspended in 20 µL of DEPC water. RNA
was then transferred to a PCR strip and diluted with water, DNase buffer and DNase
135
enzyme to a volume of 20 µL at 500 ng of RNA per µL. Strips were incubated at 37°C
for 25 minutes using an Applied Biosystems Veriti 96-Well Thermal Cycler. DNase was
then deactivated with 5 µL of Ambion’s DNase-free resin suspension. cDNA was
synthesized using a SuperScript II first-strand RT-PCR kit (Invitrogen) following
manufacturer’s protocol.
DNA extraction
Leaf discs were homogenized after treatment with liquid nitrogen. For less than
50 mg of leaf tissue, 300 µL of CTAB were applied to the tissue followed by incubation
at 65°C for 10 minutes. 300 µL of cholorform:isoamyl alcohol were transferred to the
CTAB solution and tubes were mixed gently. Samples were centrifuged for 15 minutes at
13.3 krpm at 4°C. The supernatant was then transferred to 210 µL of isopropanol, mixed
and incubated for 10 minutes at room temperature. Samples were centrifuged again for 15
minutes at 4°C. The DNA pellets were washed with 500 µL of 95% ethanol (EtOH) for 5
minutes at 13.3 krpm. The EtOH was removed and centrifugation was repeated for 1
minute to remove remaining droplets. Samples were air-dried for 5 minutes after which
20 µL of dH2O was added and samples were stored at 4°C. Samples were analyzed using
qPCR, Arabidopsis ubiquitin primers and Alternaria-specific primers (Guillemette et al.,
2004).
Quantitative real-time PCR (qPCR) analysis
The qPCR master mix contained 1.5 µL of nuclease-free water, 2 µL forward
primer, 2 µL reverse primer and 7.5 µL of SYBR GREEN PCR Master Mix per sample.
136
Each reaction well contained 13 µL of the corresponding master mix and 2 µL cDNA. An
Eppendorf realplex2 Mastercycler® was used to measure sample fluorescence. qPCR
cycles ran at 95°C for 10 min, followed by 40 cycles at 95°C for 15 seconds, 55°C for 30
seconds and 72°C for 30 seconds. Melt curve ran at 95°C for 15 seconds, 60°C for 15
seconds and increased incrementally to 95°C over 20 minutes. Means and standard errors
were calculated from three replicate measurements per genotype per treatment.
miRNA qPCR
RNA extraction was performed as detailed above. Reverse transcription master
mix included 0.5 µL of 10mM dNTP mix, 11.15 µL of nuclease-free water and 1 µL of
appropriate stem-loop primer per sample. Mixture was heated to 65°C for 5 minutes
followed by 2 minutes on ice. Then, 4 µL of 5x First-Strand buffer, 2 µL of 0.1 M of
DTT and 0.25 µL of SuperScript III RT were added per sample. RT reaction included 19
µL of the RT master mix along with 1 µL of RNA.
Pulsed RT PCR ran for 30 minutes at 16°C, followed by pulsed RT of 60 cycles at
30°C for 30 seconds, 42°C for 30 seconds and 50°C for 1 second and lastly, reverse
transcriptase was deactivated by heating samples at 85°C for 5 minutes. qPCR master
mix included 6 µL of nuclease-free water, 10 µL of GoTaq® BRYT Green, 1 µL forward
primer at 10 µM and 1 µL reverse primer at 10 µM per sample. Reaction wells contained
18 µL of master mix and 2 µL of the RT product. Samples were incubated at 95°C for 5
minutes, followed by 40-45 cycles of 95°C for 5 seconds, 60°C for 10 seconds and 72°C
for 1 second. For melting curve analysis, samples were denatured at 95°C, and then
cooled to 65°C by 20°C per second. Readings were then taken continuously from 65°C to
137
95°C with temperatures increasing at 0.2°C per second (Varkonyi-Gasic et al., 2007).
Means and standard errors were calculated from three replicate measurements per
genotype per primer set.
Illumina-based next-generation sequencing
Plants were treated with 1mM SA for 4 hrs. Shoots and leaves were collected in
50 mL polypropylene tubes, flash-frozen in liquid N2 and stored at -80°C. Tissue was
later homogenized using mortar and pestle techniques and homogenized tissue was
subsequently returned to the 50mL tubes. RNA extraction was performed using TRIzol
techniques. Samples submitted for sequencing contained 13 µL of suspended RNA at 500
ng/µL. RNA quality control and library formation were performed at the Genomics Core
on UAB’s campus. Samples were run on an Illumina HiSeq2000 sequencer and data
rendered were in fastq format. Fastq files were used to produce both .bam and .bai files
so that data could be visually examined using the Integrative Genome Viewer (IGV) for
splice variants (Thorvaldsdottir et al., 2012, Robinson et al., 2011). Data were further
quantitatively analyzed with Cufflinks, an isoform assembly and quantitation program for
RNA-Seq, and Tophat, a fast splice junction mapper for RNA-Seq reads, to compare fold
changes, p-values, q-values, read quality and for significance between differential
expression (Trapnell et al., 2009, Trapnell et al., 2010).
Ion Leakage assay
Plants were treated with OD600=0.1 of Psm avrRpm1 and immediately collected.
All OD measurements were taken on an Eppendorf BioPhotometer ™ Plus. Leaf discs
138
were punched from treated leaves and floated in distilled water for 30-45 minutes to
remove ions leaking from wounding effect. 15 discs per sample were then transferred to
18 mL of distilled water in 50 mL polypropylene tubes for conductivity measurements.
Measurements were taken at the zero hour time point and every 30 minutes afterward for
up to 8 hours using a Fisher Scientific Accumet AP85 conductivity meter.
Caspase assay
Plants leaves were treated with OD600=0.1 Psm avrRpm1 for 0, 3 and 5 hrs. Six
leaves were collected per genotype per treatment in liquid N2 and homogenized. Protein
extraction from tissue was performed using 100µL of extraction buffer. Extraction buffer
was composed of 100mM sodium acetate, 100mM sodium chloride, 1mM EDTA and
1mM PMSF at a pH of 5.5. Samples were vortexed for 3 minutes per sample, centrifuged
at 13, 300 rpm for 15 minutes and 40µL of the protein extracts were subsequently placed
in a black, corning 96-well plate. Caspase substrates were diluted in DMSO, added to
assay buffer and subsequently 40µL were added to the appropriate wells using a
multichannel pipette at a final concentration of 0.5mM per well. Fluorescence was
measured at 0, 0.5 and 1 hrs post substrate addition with an infinite 200Pro. Substrate
fluorescence was measured after excitation at 360 nm with emission measured at 465 nm
for both Ac-ESEN-MCA and AC-YVAD-MCA. A Bradford assay was used to quantify
protein concentrations.
Bradford assay
139
Bradford assay was performed just prior to fluorescence measurements to prevent
protein crystallization with an infinite 200Pro. Bradford protein assay solution was
diluted 1 part solution to 4 parts with Protease-free water and appeared a bluish-brown
color. Assay solution was added to a corning 96 flat bottom clear polystyrol plate with
100µL per well. Protein was added at 2 µL per well and solution color changed to blue.
The Bradford plate was shaken at an amplitude of 1mm for 30 s by the infinite 200Pro.
Absorbance was measured at 595 nm.
Homozygous gcn2 mutant confirmation and uORF-TBF1 construct insertion and
verification
gcn2 genotyping
Six independent plants of both gcn2-1 and gcn2-3 were selected for screening for
homozygosity. Electrophoresis was performed on 0.8%, ethidium bromide agarose gels at
80-100 volts. Gels were run on a Bio-Rad PowerPac™ Basic and imaged using the BioRad Molecular Imager® Gel Doc™ XR+ with Image Lab™ software. Primers are included
in appendix B.
uORF-TBF1 construct floral dips
The homozygous gcn2-1 mutants were selected for the floral dip in addition to the
Landsberg (Ler) wild type. Agrobacterium tumefaciens clones carrying the respective
plasmids were grown in 5mL of YEB medium with antibiotics kanamycin (25 mg/L) and
rifampicin (50 mg/L) at 27°C. Cultures were then used to inoculate 400 mL of YEB
medium and grown overnight (16-20hrs). Cells were harvested by centrifugation at 4.9
140
krpm and resuspended in 50mL of 5% sucrose solution. Cultures were brought to
OD600=0.8 and Silwet L-77 (500µL/L) and benzylaminoprine (10µL/L) were added to the
cultures. The Arabidopsis plants were grown under greenhouse conditions at a density of
5 plants/pot. Primary floral bolts were removed to encourage secondary bolting.
Transformation occurred 5-10 days post clipping. Plants were dipped for 30 s into A.
tumefaciens cultures and covered with a plastic lid for 24 hrs to sustain high humidity.
After 24 hrs, plants were transferred to a growth-chamber for two days and subsequently
transferred to the greenhouse until harvested.
Seeds from Landsberg erecta wild-type and gcn2 plants dipped in Agrobacterium
were selected for T-DNA inserts on MS hygromycin (35 µg/mL) plates. Plants exhibiting
growth and green coloration were then transplanted onto soil and incubated in the growth
room under a plastic dome. Later, seeds were harvested and used in GUS assay to further
validate T-DNA insertion.
Fluorometric MUG assay
Plant tissue was treated with OD600=0.1 of Psm avrRpm1. Tissue was collected at
0, 0.5 and 1 hr post inoculation. Approximately 100 mg of leaf tissue were collected in
centrifuge tubes and frozen using liquid nitrogen. This tissue was homogenized and
subsequently vortexed for 3 minutes per sample in 100 µL of extraction buffer.
Extraction buffer consists of 50 mM NaPO4 at a pH of 7.0, 10 mM β-mercaptoethanol, 10
mM PMSF (phenylmethylsulfonyl fluoride), 1 mM Na2EDTA
(Ethylenediaminetetraacetic acid) and 0.1% SDS (sodium dodecyl sulfate). Subsequently,
samples were centrifuged for 5 minute at 4°C at 15 krpm and the supernatant transferred
141
to a new centrifuge tube. Assay buffer was preheated to 37C in a water bath. Assay buffer
was composed of 1 mM MUG (4-methylumbelliferyl-beta-D-glucuronide) in extraction
buffer. 10 µL of the protein extract was added to the wells of a deep, 96-well box. Assay
buffer was distributed at 190 µL per well using a multichannel pipette. GUS (βGlucuronidase) activity was stopped at 0, 1, 2 and 3 hrs using stop buffer (0.2 M
Na2CO3), returned to the water bath between stop buffer applications and measured with
an infinite 200Pro spectrofluorometer; excitation was at 365 nm and emission at 455 nm.
A Bradford assay was used to quantify protein concentrations.
Client transcript search
Arabidopsis candidate transcripts spliced by IRE1 were established based upon
homologues of the mammalian IRE1α client transcripts from (Identification of a
consensus element recognized and cleaved by IRE1α). Coding sequences were derived
from both TAIR and MIPS databases and compared using Blast 2 (Lamesch et al., 2012,
Arabidopsis Genome, 2000, Schoof et al., 2002, Altschul et al., 1997). From this, a
possible consensus sequence was established for clients (5’- C [U, A, C] G C [U, A, C]
[G, A] - 3’). Clients were searched for the presence of the consensus sequence. Using
possible splicing locations, alternative splicing variants of the plant homologues were
established and protein prediction (ExPASy) used to give all possible protein sequences
(Artimo et al., 2012). These sequences were then searched for possible nuclear
localization signals (NLS). Top prospects were then selected for client splicing activity.
BioBasic TBE buffer and a 2% agarose D gel were used to detect minute
differences in splicing lengths. Gels were run on a Bio-Rad PowerPac™ Basic and imaged
142
using the Bio-Rad Molecular Imager® Gel Doc™ XR+ with Image Lab™ software. Primer
sequences are listed in appendix B.
143
Results
Illumina-based Next-Generation Sequencing
Results from sequencing were processed and examined using the described
methods (see Materials and Methods). Using the Integrated Genome Viewer, sample
reads (for sample list see appendix B) were aligned onto the TAIR10 reference genome.
Initial analyses included verification of splicing activity in the known client bZIP60 as
well as all homologues identified from mammalian IRE1 clients. After considerable
analysis, it was concluded that visual identification of splicing activity required the client
transcripts to exist, almost completely, in spliced form; otherwise, reads of unspliced
clients would interfere. Output from TopHat and Cufflinks was analyzed to determine
genes either up- or down-regulated upon treatment with SA.
Of the 908 genes induced by IRE1, a majority encoded proteins involved in
defense, phosphorylation, and suppression of apoptosis and existed as secreted or
transmembrane proteins (Figure 1). Of the 224 genes suppressed by IRE1, many of these
functioned as nucleases, proteases, lipases, glycosidases, motor proteins or in
photosynthesis. Genes that demonstrated significant changes in expression (p<0.05) were
selected and compared with a duplicate sample to determine consistency in gene
expression between duplicate sets. However, similarity of significantly up- or downregulated genes varied between 25-60% similarity. If the entire raw data lists were
compared, the similarity was 98-99% between the two replicates. For continued
processing, samples were sent to the Section on Statistical Genetics at UAB for a
thorough analysis. However, no conclusive results on possible IRE1 clients have been
obtained to date.
144
TIME
Mild ER Stress
Acute ER Stress
IRE1-mediated
pro-survival signaling
IRE1-mediated
pro-death signaling
IRE1-Induced
Transmemebrane
Defense-Related
Phosphorylation
Anti-apoptotic
Secreted Proteins
IRE1-Repressed
Photosynthesis
Glycosidases
Proteases
Nucleases
Lipases
Motor Proteins
Current and Ongoing
study
Figure 1. IRE1: a life-or-death switch.
A model for IRE1-signaling in pro-survival (dark green) and pro-death (bright green)
cellular states, based on RNA-seq data.
145
Candidate Gene Approach for IRE1 Client Splicing
The mammalian client transcripts, CD59 (NM_203331), PPP2R1A
(NM_014225), RUVBL1 (NM_003707), GEMIN5 (NM_015465), YWHAQ
(NM_006826), PEPD (NM_000285), PDK2 (NM_002611), MKRN2 (NM_014160),
PRKCD (NM_006254), XBP1 (NM_005080), were used in the identification of plant
homologues (Oikawa et al., 2010). Identified plant homologues included AT5G26360,
AT5G20090, AT4G09000, AT3G06483, AT3G08505, AT4G34650, AT1G09300.1,
AT1G09300.2, AT1G25490 and AT5G22330, respectively (Altschul et al., 1997). These
homologues were then searched for all variants of the IRE1α consensus sequence
identified in mammals (Oikawa et al., 2010) and used to establish primers (appendix B)
flanking the theorized splicing locations. All primer pairs failed to establish any
alternative splicing in theorized clients.
146
gcn2-1 and gcn2-3 genotyping
Using primers established for multiple exons of GCN2 (appendix B), gcn2
mutants were screened to determine whether plants were homozygous for T-DNA
insertions (Figure 2-3). PCR analysis confirmed the homozygosity of gcn2-1; whereas
gcn2-3 demonstrated a mix of homozygous and heterozygous plants. This determination
allowed for continued experimentation to be performed solely on homozygous gcn2-1.
*
Ler
gcn2-1
*
Ler
gcn2-3
Figure 2. gcn2 Mutant Screen Spanning Exon 1 to Exon 2
Landsberg (Ler) wild type acted as a negative control for T-DNA screening. The asterisk
indicates gcn2 mutants that are heterozygous for the T-DNA insertion. All other samples
are homozygous for the insertion.
*
Ler
gcn2-1
Ler
*
gcn2-3
Figure 3. gcn2 Mutant Screen Spanning Exon 1 to Exon 3
Landsberg (Ler) wild type acted as a negative control for T-DNA screening. The asterisk
indicates gcn2 mutants that are heterozygous for the T-DNA insertion. All other
individuals are homozygous for the insertion.
147
uORF-TBF1 Construct Screening
The homozygous gcn2-1 was selected for floral dips to produce transgenic gcn2
and Ler lines expressing uORF-TBF1 constructs. Seeds from dipped plants were grown
on hygromycin plates to select transformants. Plants that successfully grew on selection
plates were then screened using a MUG assay. Plants were treated with Psm avrRpm1 to
promote GUS activity. Seeds were collected from lines that exhibited the most consistent
GUS activity. Selection and MUG assessment were performed through the T2 generation
at which point another graduate student continued the processing and continued through
the T3 generation.
gcn2 Phenotyping
To test the gcn2-1 phenotype under various pathogen treatments, gcn2-1 plants
were treated with necrosis-inducing Alternaria brassicicola spores (Figure 4) and
quantified using qPCR (Figure 5) as well as infected with virulent Psm and avirulent Psm
avrRpm1 (Figures 6). Dual bacterial infections were performed using Enhanced Disease
Resistance protocols for both strains.
Infection with A. brassicicola resulted in a strong phenotypic difference between
Ler and gcn2-1 plants with gcn2 demonstrating a more resistant phenotype. However, an
analysis with qPCR indicated that gcn2 plants accumulated more fungal biomass than the
wild-type. When the same plants were infected with Psm, the quantified phenotype
agreed with the observed phenotype, which indicated a trend toward a more resistant
gcn2 during virulent infection, though the differences were not significant. The avirulent
148
infection, however, neither demonstrated a trend nor a significant difference between the
two lines.
149
Ler
gcn2-1
Figure 4. Qualitative analysis of A. brassicicola growth on Ler and gcn2-1 plants
Ler and gcn2-1 were treated with A. brassicicola spores and photographed 2 weeks later.
150
A
.
0.000200
Alt 115/UBQ5
0.000150
0.000100
0.000050
0.000000
Ler
gcn2
Ler
gcn2
-0.000050
B
.
0.000060
0.000050
AbrCUT/UBQ5
0.000040
0.000030
0.000020
0.000010
0.000000
-0.000010
Figure 5. qPCR Analysis of A. brassicicola Proliferation
Results based upon biological triplicates with error bars indicating standard error. A.
Transcript accumulation of the A. brassicicola gene, Alternaria 115, a gene encoding a
nonribosomal peptide synthetase compared to Arabidopsis ubiquitin 5 levels using
delta/delta Ct scoring. B. Transcript accumulation of the A. brassicicola-specific gene,
cutinase, compared to Arabidopsis ubiquitin 5 levels using relative delta/delta Ct
quantification.
151
Bacterial growth log cfu/leaf disc
1.E+08
1.E+07
1.E+06
1.E+05
1.E+04
1.E+03
Figure 6. Enhanced Disease Resistance Assay of Ler and gcn2-1 plants
Bacterial growth (colony forming unit – cfu/leaf disc, expressed on a log scale) of leaves
of the indicated genotypes infected with Psm ES4326 or Psm avrRpm1 (OD = 0.0002).
Error bars: 95% confidence interval of the mean (n = 6). Overlapping bars did not differ
from each other at p<0.05 (Tukey's HSD tests). The experiment was repeated three times
with similar results.
152
Cell Death Assays in IRE1 and GCN2 lines
To assess whether phenotypes demonstrated enhanced or deficient PCD, gcn2-1
and IRE1 lines were subjected to both ion leakage assays and caspase-like activity assays.
Preliminary results from ion leakage also indicated that gcn2 mutants were deficient in
initiating cell death responses, as mutants exhibited decreased ion leakage (Figure 7)
(Epple et al., 2003). This was in agreement with caspase-like activities in gcn2 mutants,
since mutants demonstrated reduced caspase-like activity (Figure 8) (Hatsugai et al.,
2004).
110
100
90
80
70
µS
60
gcn2
50
Ler
40
30
20
10
0
0
0.5
1
1.5
2
2.5
3
3.5
4
4.5
5
5.5
6
6.5
7
Time (Hrs)
Figure 7. Preliminary Ion Leakage Data on gcn2-1
Plants were treated with OD600=0.1 of Psm avrRpm1 and ion leakage was measured up to
7.5 hrs post inoculation. Ler was used as a control for the gcn2-1 mutant.
153
Figure 8. Caspase-like activity on Ac-YVAD-MCA substrate in the Arabidopsis
gcn2-1 mutant
The Ler wild type functioned as the control for the assay. Plants were treated with
OD600=0.1 Psm avrRpm1 for 0, 3 and 5 hrs to initiate cell death and the fluorescence
was measured at 0, 0.5 and 1 hrs post substrate addition.
These results were mirrored in the ire1 plants (Figures 9-10), as mutants again
demonstrated decreased ion leakage and caspase-like activity; however, double mutants
did not demonstrate the lowest ion leakage as expected and seen in the caspase assay.
NPR1 was also examined due to its known functions as a cell death suppressor
(Hoeberichts & Woltering, 2003).
154
120
100
Col
µS
80
ire1a-2
ire1b-4
60
ire1a-3
ire1a-3 ire1b-4
40
ire1a-2 ire1b-4
bzip60
20
npr1
0
0
0.5
1 1.58 2.08 2.58 3 3.58 4
4.5
5
5.5
6
6.5
Time (Hrs)
Figure 9. Preliminary Ion Leakage Data on ire1 lines
Plants were treated with OD600=0.1 of Psm avrRpm1 and ion leakage was measured up to
7 hrs post inoculation. Columbia wild type plants acted as the control. Two independent
mutant alleles of ire1a were used along with an ire1b mutant and two double mutants.
The bzip60 mutant was used to determine whether absence of one IRE1 client resulted in
a partial phenotype. npr1 was also examined, since NPR1 functions in cell death control.
155
Figure 10. Caspase-like activity on Ac-YVAD-MCA substrate in the Arabidopsis
IRE1 mutants
The Columbia wild type plants functioned as the control for the assay. Plants were
treated with OD600=0.1 Psm avrRpm1 for 0, 3 and 5 hrs to initiate cell death and the
fluorescence was measured at 0, 0.5 and 1 hrs post substrate addition.
156
MicroRNA Activity in UPR
Our hypothesis that miRNAs may interact with bZIP60 transcript was tested in
Columbia plants. The candidate miRNA were identified using miRBase and plant
miRNA database using bZIP60 mRNA as the target sequence (Kozomara & GriffithsJones, 2011, Griffiths-Jones et al., 2008, Griffiths-Jones et al., 2006, Griffiths-Jones,
2004, Zhang et al., 2010). Primers were synthesized for six miRNAs (miR414, miR397b,
miR2933a/b, miR5658, miR5029 and miR5012) most likely to regulate bZIP60
expression. Plants were treated for 4 hrs with either exogenous application of SA or Psm
avrRpm1 (Figure 11). The greatest up-regulation was demonstrated by miR5658 after
treatment with Psm avrRpm1. Since miR5658 may regulate additional targets, I used
psRNATarget: A Plant Small RNA Target Analysis Server (Dai & Zhao, 2011) to
identify possible clients. This list included NF-YA5, chr31, EXO70G2, FBA6, GNC,
MKK9, RHS16 and TIM17-2 as well as several kinase and zinc-binding proteins (for full
list see appendix B).
157
150
Basal
miRNA/UBQ5
100
SA
avrRpm1
50
0
Figure 11. miR5658 is Specifically Induced During Cell Death Induced by Psm
avrRpm1
Plants were screened for miRNAs after being treated for 4 hrs with either exogenous
application of SA or Psm avrRpm1. Fold changes of miRNAs are based upon
accumulation of Arabidopsis ubiquitin 5 transcripts using a delta/delta Ct quantification
system.
158
The highly induced miR5658 was then examined over a six hour period to
determine how bZIP60 expression coincided with miR5658 expression (Figure 12). In
mammals, IRE1α is responsible for NF-κB expression (Hu et al., 2006). Since NPR1 is
structurally similar to NF- κB (Cao et al., 1997) and NF-κB has been shown to regulate
stress-related miRNAs (Leung & Sharp, 2010b), specifically miR-30c-2* targeting XBP1 (Byrd et al., 2012), I decided to determine whether NPR1 had a role in regulating
miR5658 expresssion in a similar manner to NF-κB. Therefore, npr1 was examined over
a 6 hr interval as well (Figure 12). Preliminary results indicate that NPR1 may contribute
to miR5658 expression and that miR5658 expression appears to be reversely correlated
with bZIP60 repression, indicating that bZIP60 mRNA may be a target of this miRNA.
159
Figure 12. Expression of bZIP60 and miR5658
Columbia and npr1 plants were treated every hour up to six hours with Psm avrRpm1.
Values are based upon transcript accumulation of the bZIP60 gene compared to ubiquitin
5 levels using delta/delta Ct quantification.
160
Discussion
How plants deal with stress has long been an area of interest for researchers
attempting to understand the underlying systems regulating stress tolerance and plant
survival (Kramer, 1963). Understanding how the growth-to-defense and stress-to-death
transitions occur has also been of great interest to researchers (Wang et al., 2012, Lam,
2004). Studies of apoptosis, the intensely studied form of animal PCD, have resulted in
the recognition of cell death regulators known as caspases (Lam & del Pozo, 2000).
Since the detection of caspase-like activity in plants, the search for caspases has
led to the discovery of saspases and metasaspases (Bonneau et al., 2008). Caspase-like
activities have also been shown to function in plant development, organ senescence and
HR after pathogen challenge (Piszczek & Gutman, 2007, del Pozo & Lam, 1998).
In the current study, I attempted to establish the stress-mediating functions of
GCN2 as a part of the UPR as well as identify novel IRE1 client transcripts. I also
attempted to establish whether the IRE1 pathway, a major part of UPR signaling, is
involved in cross-talk with the GCN2 pathway to integrate pathogen-mediated stress
responses that ultimately result in the initiation of PCD.
Determination of homozygous gcn2 lines was performed using PCR analysis
(Figures 2-3). In all instances, gcn2-1 exhibited homozygosity. Therefore, gcn2-1 was
selected as the principal mutant for all experiments conducted.
Initial findings on the GCN2 pathway indicate an unusual set of circumstances.
While gcn2 mutants exhibit an enhanced disease resistance phenotype to infection by
necrotrophic A. brassicicola (Figure 4), these mutants also demonstrate a trend toward
resistance to virulent Psm, a hemibiotroph (Figures 6). This is unusual since resistance
161
mechanisms toward necrotrophic and biotrophic pathogens are typically antagonistic
(Glazebrook, 2005, Spoel et al., 2007).
Few previous studies have identified mutants demonstrating increased resistance
to both necrotrophic and biotrophic infection (Nickstadt et al., 2004, Wally et al., 2009).
As such, these results may indicate that GCN2 acts as a regulator of SA and JA crosstalk,
and therefore gcn2 mutants demonstrate increased pathogen resistance in both regulatory
pathways (Nickstadt et al., 2004). Alternatively, it has been shown that AtNPR1
overexpressing carrots demonstrated increased resistance to biotrophic and necrotrophic
infection (Wally et al., 2009). Therefore, it is possible that some key regulatory defense
protein is down-regulated by GCN2 and overexpressors demonstrate increased resistance
to a broad-spectrum of pathogens.
However, phenotypic and quantitative data for the necrotrophic fungal infection
by A. brassicicola are in conflict, as qPCR analysis indicated an increased susceptibility
in gcn2 mutants (Figure 5). It is possible that the fungal infections progressed past peak
developmental periods and that the loss of both plant and fungal tissue had occurred by
the time a phenotypic difference between genotypes was visible. As such, tissue samples
should be taken over a time course and quantified at intervals of pathogen ingress.
Since there has been considerable difficulty in separating a clear phenotype
between virulent and avirulent biotrophic infections, future experiments should include
infections with Hyaloperonospora arabidopsidis. H. arabidopsidis is a biotrophic
oomycete and comes in several different isolates including Noco, Emwa, Cala Both
Noco and Emwa would serve as avirulent isolates for the gcn2 mutant that is in the Ler
background, whereas Cala would serve as a virulent isolate (Slusarenko & Schlaich,
162
2003). Six days after inoculation, the number of asexual spores of H. arabidopsidis
would be counted to quantify susceptibility to biotrophic virulent or avirulent infection
(Petersen et al., 2010). Ideally this system would allow for a more fine-tuned assessment
of Ler and gcn2 phenotypic differences towards virulent and avirulent pathogens.
In yeast, GCN2 is necessary for starvation-induced, autophagic cell death
(Gozuacik & Kimchi, 2004); thus, the plant GCN2 homolog may also be involved in cell
death regulation. Interestingly, plant autophagy has been tied to pathogen-induced cell
death, which may further support a dual of GCN2 as regulator of both pathogen-induced
stress and cell death responses (Yoshimoto et al., 2010). The mammalian PERK pathway,
which is functionally similar to GCN2, has been shown to function in life-to-death
signaling, supporting a similar function for GCN2 (Lin et al., 2009). I demonstrated that
the Arabidopsis gcn2 mutants exhibited deficient cell death responses, as demonstrated
by decreased ion leakage (Figure 7) (Epple et al., 2003) and reduced caspase-like activity
(Figure 8) (Hatsugai et al., 2004) upon treatment with Psm avrRpm1. Collectively, these
data indicate that the GCN2 pathway regulates some cell death functions in response to
avirulent pathogenic infections. However, further studies should include periodic
quantification of fungal development as well as replicate sets of ion leakage and caspaselike activity.
Ongoing study in Ler and gcn2 mutants includes the production of wild type and
mutant lines carrying uORF-TBF1 constructs. This study is based upon previous results
found by Pajerowska-Mukhtar and colleagues, who established that the GCN2 pathway
regulated eIF2α upon stress induction due to an accumulation of uncharged tRNAPhe
(Pajerowska-Mukhtar et al., 2012). In this scenario, phosphorylated eIF2α accumulated
163
after pathogen infection and facilitated ribosome reattachment to the TBF1 translation
start codon downstream of uORFs (upstream Open Reading Frames) to initiate TBF1
translation. Therefore, it was determined that TBF1 expression was dependent upon
translational control through uORFs (Pajerowska-Mukhtar et al., 2012).
In an attempt to understand regulatory changes upstream of TBF1, Ler wild type
and gcn2 mutant plants were given either wild type or mutant constructs. All plants
containing the mutant construct will constitutively express TBF1-GUS fusion reporter,
since the uORFs responsible for TBF1 suppression no longer facilitate ribosomal binding.
If GCN2 is the only kinase responsible for phosphorylation of eIF2α, then wild type
constructs in the gcn2 background will not exhibit TBF1 expression even when induced.
However, if another protein activates eIF2α, then TBF1 expression will occur.
While identification of IRE1 client transcripts was unproductive, a significant
amount of transcriptomics data was collected. Genes both up- and down-regulated by
IRE1 were characterized (Figure 1), creating a list of functional GO categories to study in
the future. Moreover, I determined that IGV is not a valid method for detecting
alternative splicing. To overcome low similarity between replicates, it would have been
better to have sequenced fewer mutants and added a third replicate. This alteration could
have included the sole use of IRE1 double mutants and Columbia wild type plants, which
would have allowed higher significance comparisons. It would require future experiments
to separate IRE1 homologue specific clients with qPCR; however, these assays could
have additionally allowed for investigation of abiotic-dependent splicing activity.
ire1 mutant plants were found to exhibit decreased ion leakage and reduced
caspase-like activity (Figures 9-10). These data suggest that IRE1, a universal pro-
164
survival sensor, may also regulate cell death responses, since mutants are less competent
at mounting cell death activities. This is consistent with known functions of IRE1 in the
mammalian system, where IRE1 associates with the apoptosis-regulating BCL2 family
proteins, BAK and BAX, and activates the JNK pathway (Lin et al., 2007). IRE1 has also
been shown to function as an important switch in the transition from pro-life mechanisms
to apoptosis. These pro-survival functions were demonstrated by artificially extending
IRE1’s RNAse function, which enhanced survivability under stress conditions, and
IRE1’s up-regulation of cell proliferation (Lin et al., 2009, Jager et al., 2012). Further
studies should attempt to assess sensitivity of IRE1 lines to necrotrophic infections to
determine whether mutant lines exhibit enhanced disease resistance or susceptibility.
Additional research has indicated that the IRE1 client, bZIP60, may be regulated
by miR5658 (Figures 11-12). This is largely based upon sequence homology between the
miRNA and bZIP60 and that an analogous observation has been made in the mammalian
system, where the PERK pathway promotes miR-30c-2* expression, which consequently
suppresses XBP-1, a bZIP60 homolog, expression (Byrd et al., 2012). However, until a
direct binding between bZIP60 transcript and miR5658 has been illustrated or overexpressors of miR5658 have been shown to possess reduced bZIP60 expression, these
results are merely promising observations and need to be followed upon in subsequent
studies. Further experiments may include the production of lines mis- or over-expressing
miR5658. These mutant miRNA lines should exhibit over- or under-expression of
bZIP60, respectively. Since a single miRNA may regulate multiple transcripts, this
method may also reveal addition targets of miR5658 (Bushati & Cohen, 2007).
165
While preliminary results indicate a contribution of the GCN2 pathway in
pathogen-induced cell death regulation, further study is needed to solidify these results.
Additionally, continued study is necessary to evaluate the efficacy of the uORF-TBF1
construct lines. Similar to GCN2, the IRE1 pathway has demonstrated regulatory effects
on cell death, even though it was originally identified as a pro-life pathway (Lin et al.,
2009).
While much progress has been made in understanding cellular stress regulation,
much remains to be discovered, especially in regard to plant life-or-death decisions
(Aouacheria et al., 2005, Walter & Ron, 2011, Schroder, 2006). However, a
comprehensive knowledge of these systems promises great benefits for agricultural
progress (Peleg & Blumwald, 2011).
166
Literature Cited
Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W., et al.
(1997) Gapped BLAST and PSI-BLAST: a new generation of protein database
search programs. Nucleic acids research, 25, 3389-3402.
Aouacheria, A., Brunet, F. and Gouy, M. (2005) Phylogenomics of life-or-death switches
in multicellular animals: Bcl-2, BH3-Only, and BNip families of apoptotic
regulators. Molecular biology and evolution, 22, 2395-2416.
Arabidopsis Genome, I. (2000) Analysis of the genome sequence of the flowering plant
Arabidopsis thaliana. Nature, 408, 796-815.
Artimo, P., Jonnalagedda, M., Arnold, K., Baratin, D., Csardi, G., de Castro, E., et al.
(2012) ExPASy: SIB bioinformatics resource portal. Nucleic acids research, 40,
W597-603.
Bonneau, L., Ge, Y., Drury, G. E. and Gallois, P. (2008) What happened to plant
caspases? Journal of experimental botany, 59, 491-499.
Bredesen, D. E., Rao, R. V. and Mehlen, P. (2006) Cell death in the nervous system.
Nature, 443, 796-802.
Bushati, N. and Cohen, S. M. (2007) microRNA functions. Annual review of cell and
developmental biology, 23, 175-205.
Byrd, A. E., Aragon, I. V. and Brewer, J. W. (2012) MicroRNA-30c-2* limits expression
of proadaptive factor XBP1 in the unfolded protein response. The Journal of cell
biology, 196, 689-698.
167
Cai, Y., Yu, X., Hu, S. and Yu, J. (2009) A brief review on the mechanisms of miRNA
regulation. Genomics, proteomics & bioinformatics / Beijing Genomics Institute,
7, 147-154.
Cao, H., Glazebrook, J., Clarke, J. D., Volko, S. and Dong, X. N. (1997) The Arabidopsis
NPR1 gene that controls systemic acquired resistance encodes a novel protein
containing ankyrin repeats. Cell, 88, 57-63.
Chen, J. M., Dando, P. M., Rawlings, N. D., Brown, M. A., Young, N. E., Stevens, R. A.,
et al. (1997) Cloning, isolation, and characterization of mammalian legumain, an
asparaginyl endopeptidase. The Journal of biological chemistry, 272, 8090-8098.
Coll, N. S., Vercammen, D., Smidler, A., Clover, C., Van Breusegem, F., Dangl, J. L., et
al. (2010) Arabidopsis type I metacaspases control cell death. Science, 330, 13931397.
Cullen, B. R. (2012) MicroRNA expression by an oncogenic retrovirus. Proceedings of
the National Academy of Sciences of the United States of America, 109, 26952696.
Dai, X. and Zhao, P. X. (2011) psRNATarget: A Plant Small RNA Target Analysis
Server, Nucleic Acids Research, doi: 10.1093/nar/GKR319.
del Pozo, O. and Lam, E. (1998) Caspases and programmed cell death in the
hypersensitive response of plants to pathogens. Current Biology, 8, 1129-1132.
Duffee, L. E., Boatwright, J. L., Pacha, F. H., Shockley, J. M., Pajerowska-Mukhtar, K.
and Mukhtar, M. S. (2012) Eukaryotic Endoplasic Reticulum Stress-Sensing
Mechanisms. Advances in Life Sciences, 2, 148-155.
168
Ebel, J. and Cosio, E. G. (1994) Elicitors of Plant Defense Responses. Int Rev Cytol, 148,
1-36.
Epple, P., Mack, A. A., Morris, V. R. F. and Dangl, J. L. (2003) Antagonistic control of
oxidative stress-induced cell death in Arabidopsis by two related, plant-specific
zinc finger proteins. Proceedings of the National Academy of Sciences of the
United States of America, 100, 6831-6836.
Fujita, M., Fujita, Y., Noutoshi, Y., Takahashi, F., Narusaka, Y., Yamaguchi-Shinozaki,
K., et al. (2006) Crosstalk between abiotic and biotic stress responses: a current
view from the points of convergence in the stress signaling networks. Current
opinion in plant biology, 9, 436-442.
Glazebrook, J. (2005) Contrasting mechanisms of defense against biotrophic and
necrotrophic pathogens. Annual review of phytopathology, 43, 205-227.
Gozuacik, D. and Kimchi, A. (2004) Autophagy as a cell death and tumor suppressor
mechanism. Oncogene, 23, 2891-2906.
Griffiths-Jones, S. (2004) The microRNA Registry. Nucleic acids research, 32, D109111.
Griffiths-Jones, S., Grocock, R. J., van Dongen, S., Bateman, A. and Enright, A. J. (2006)
miRBase: microRNA sequences, targets and gene nomenclature. Nucleic acids
research, 34, D140-144.
Griffiths-Jones, S., Saini, H. K., van Dongen, S. and Enright, A. J. (2008) miRBase: tools
for microRNA genomics. Nucleic acids research, 36, D154-158.
169
Guillemette, T., Iacomi-Vasilescu, B. and Simoneau, P. (2004) Conventional and realtime PCR-based assay for detecting pathogenic Alternaria brassicae in cruciferous
seed. Plant Dis, 88, 490-496.
Hara-Nishimura, I. and Hatsugai, N. (2011) The role of vacuole in plant cell death. Cell
death and differentiation, 18, 1298-1304.
Hatsugai, N., Kuroyanagi, M., Nishimura, M. and Hara-Nishimura, I. (2006) A cellular
suicide strategy of plants: vacuole-mediated cell death. Apoptosis : an
international journal on programmed cell death, 11, 905-911.
Hatsugai, N., Kuroyanagi, M., Yamada, K., Meshi, T., Tsuda, S., Kondo, M., et al.
(2004) A plant vacuolar protease, VPE, mediates virus-induced hypersensitive
cell death. Science, 305, 855-858.
Hoeberichts, F. A. and Woltering, E. J. (2003) Multiple mediators of plant programmed
cell death: interplay of conserved cell death mechanisms and plant-specific
regulators. Bioessays, 25, 47-57.
Hu, P., Han, Z., Couvillon, A. D., Kaufman, R. J. and Exton, J. H. (2006) Autocrine
tumor necrosis factor alpha links endoplasmic reticulum stress to the membrane
death receptor pathway through IRE1alpha-mediated NF-kappaB activation and
down-regulation of TRAF2 expression. Molecular and cellular biology, 26, 30713084.
Huang, P. J., Lin, W. C., Chen, S. C., Lin, Y. H., Sun, C. H., Lyu, P. C., et al. (2012)
Identification of putative miRNAs from the deep-branching unicellular
flagellates. Genomics, 99, 101-107.
170
Iwata, Y. and Koizumi, N. (2005a) An Arabidopsis transcription factor, AtbZIP60,
regulates the endoplasmic reticulum stress response in a manner unique to plants.
Proceedings of the National Academy of Sciences of the United States of America,
102, 5280-5285.
Iwata, Y. and Koizumi, N. (2005b) Unfolded protein response followed by induction of
cell death in cultured tobacco cells treated with tunicamycin. Planta, 220, 804807.
Jager, R., Bertrand, M. J., Gorman, A. M., Vandenabeele, P. and Samali, A. (2012) The
unfolded protein response at the crossroads of cellular life and death during
endoplasmic reticulum stress. Biology of the cell / under the auspices of the
European Cell Biology Organization, 104, 259-270.
Jones, J. D. and Dangl, J. L. (2006) The plant immune system. Nature, 444, 323-329.
Koizumi, N., Martinez, I. M., Kimata, Y., Kohno, K., Sano, H. and Chrispeels, M. J.
(2001) Molecular characterization of two Arabidopsis Ire1 homologs,
endoplasmic reticulum-located transmembrane protein kinases. Plant physiology,
127, 949-962.
Kozomara, A. and Griffiths-Jones, S. (2011) miRBase: integrating microRNA annotation
and deep-sequencing data. Nucleic acids research, 39, D152-157.
Kramer, P. J. (1963) Water stress and plant growth. Agron J, 55, 31-35.
Kumar, S. (2007) Caspase function in programmed cell death. Cell death and
differentiation, 14, 32-43.
171
Kuroyanagi, M., Nishimura, M. and Hara-Nishimura, I. (2002) Activation of Arabidopsis
vacuolar processing enzyme by self-catalytic removal of an auto-inhibitory
domain of the C-terminal propeptide. Plant & cell physiology, 43, 143-151.
Lam, E. (2004) Controlled cell death, plant survival and development. Nature reviews.
Molecular cell biology, 5, 305-315.
Lam, E. and del Pozo, O. (2000) Caspase-like protease involvement in the control of
plant cell death. Plant molecular biology, 44, 417-428.
Lam, E., Kato, N. and Lawton, M. (2001) Programmed cell death, mitochondria and the
plant hypersensitive response. Nature, 411, 848-853.
Lamesch, P., Berardini, T. Z., Li, D., Swarbreck, D., Wilks, C., Sasidharan, R., et al.
(2012) The Arabidopsis Information Resource (TAIR): improved gene annotation
and new tools. Nucleic acids research, 40, D1202-1210.
Leung, A. K. and Sharp, P. A. (2010a) MicroRNA functions in stress responses.
Molecular cell, 40, 205-215.
Leung, A. K. L. and Sharp, P. A. (2010b) MicroRNA Functions in Stress Responses.
Molecular cell, 40, 205-215.
Lin, J. H., Li, H., Yasumura, D., Cohen, H. R., Zhang, C., Panning, B., et al. (2007) IRE1
signaling affects cell fate during the unfolded protein response. Science, 318, 944949.
Lin, J. H., Li, H., Zhang, Y. H., Ron, D. and Walter, P. (2009) Divergent Effects of
PERK and IRE1 Signaling on Cell Viability. PloS one, 4.
172
Mah, S. M., Buske, C., Humphries, R. K. and Kuchenbauer, F. (2010) miRNA*: a
passenger stranded in RNA-induced silencing complex? Critical reviews in
eukaryotic gene expression, 20, 141-148.
Nickstadt, A., Thomma, B. P. H. J., Feussner, I., Kangasjarvi, J., Zeier, J., Loeffler, C., et
al. (2004) The jasmonate-insensitive mutant jin1 shows increased resistance to
biotrophic as well as necrotrophic pathogens. Molecular plant pathology, 5, 425434.
Nuttall, J., Vine, N., Hadlington, J. L., Drake, P., Frigerio, L. and Ma, J. K. (2002) ERresident chaperone interactions with recombinant antibodies in transgenic plants.
European journal of biochemistry / FEBS, 269, 6042-6051.
Oikawa, D., Tokuda, M., Hosoda, A. and Iwawaki, T. (2010) Identification of a
consensus element recognized and cleaved by IRE1 alpha. Nucleic acids
research, 38, 6265-6273.
Pajerowska-Mukhtar, K. M., Wang, W., Tada, Y., Oka, N., Tucker, C. L., Fonseca, J. P.,
et al. (2012) The HSF-like transcription factor TBF1 is a major molecular switch
for plant growth-to-defense transition. Current biology : CB, 22, 103-112.
Peleg, Z. and Blumwald, E. (2011) Hormone balance and abiotic stress tolerance in crop
plants. Current opinion in plant biology, 14, 290-295.
Petersen, K., Qiu, J. L., Lutje, J., Fiil, B. K., Hansen, S., Mundy, J., et al. (2010)
Arabidopsis MKS1 Is Involved in Basal Immunity and Requires an Intact Nterminal Domain for Proper Function. PloS one, 5.
Piszczek, E. and Gutman, W. (2007) Caspase-like proteases and their role in programmed
cell death in plants. Acta Physiol Plant, 29, 391-398.
173
Qiang, X., Zechmann, B., Reitz, M. U., Kogel, K. H. and Schafer, P. (2012) The
mutualistic fungus Piriformospora indica colonizes Arabidopsis roots by inducing
an endoplasmic reticulum stress-triggered caspase-dependent cell death. The
Plant cell, 24, 794-809.
Robinson, J. T., Thorvaldsdottir, H., Winckler, W., Guttman, M., Lander, E. S., Getz, G.,
et al. (2011) Integrative genomics viewer. Nature biotechnology, 29, 24-26.
Schoof, H., Zaccaria, P., Gundlach, H., Lemcke, K., Rudd, S., Kolesov, G., et al. (2002)
MIPS Arabidopsis thaliana Database (MAtDB): an integrated biological
knowledge resource based on the first complete plant genome. Nucleic acids
research, 30, 91-93.
Schroder, M. (2006) The unfolded protein response. Molecular biotechnology, 34, 279290.
Schroder, M. and Kaufman, R. J. (2005) ER stress and the unfolded protein response.
Mutat Res-Fund Mol M, 569, 29-63.
Sitia, R. and Braakman, I. (2003) Quality control in the endoplasmic reticulum protein
factory. Nature, 426, 891-894.
Slusarenko, A. J. and Schlaich, N. L. (2003) Downy mildew of Arabidopsis thaliana
caused by Hyaloperonospora parasitica (formerly Peronospora parasitica).
Molecular plant pathology, 4, 159-170.
Spoel, S. H., Johnson, J. S. and Dong, X. (2007) Regulation of tradeoffs between plant
defenses against pathogens with different lifestyles. Proceedings of the National
Academy of Sciences of the United States of America, 104, 18842-18847.
174
Thorvaldsdottir, H., Robinson, J. T. and Mesirov, J. P. (2012) Integrative Genomics
Viewer (IGV): high-performance genomics data visualization and exploration.
Briefings in bioinformatics.
Trapnell, C., Pachter, L. and Salzberg, S. L. (2009) TopHat: discovering splice junctions
with RNA-Seq. Bioinformatics, 25, 1105-1111.
Trapnell, C., Williams, B. A., Pertea, G., Mortazavi, A., Kwan, G., van Baren, M. J., et
al. (2010) Transcript assembly and quantification by RNA-Seq reveals
unannotated transcripts and isoform switching during cell differentiation. Nature
biotechnology, 28, 511-515.
Varkonyi-Gasic, E., Wu, R. M., Wood, M., Walton, E. F. and Hellens, R. P. (2007)
Protocol: a highly sensitive RT-PCR method for detection and quantification of
microRNAs. Plant Methods, 3.
Walling, L. L. (2000) The myriad plant responses to herbivores. J Plant Growth Regul,
19, 195-216.
Wally, O., Jayaraj, J. and Punja, Z. K. (2009) Broad-spectrum disease resistance to
necrotrophic and biotrophic pathogens in transgenic carrots (Daucus carota L.)
expressing an Arabidopsis NPR1 gene. Planta, 231, 131-141.
Walter, P. and Ron, D. (2011) The unfolded protein response: from stress pathway to
homeostatic regulation. Science, 334, 1081-1086.
Wang, W., Tada, Y., Oka, N., Tucker, C. L., Fonseca, J. P. and Dong, X. (2012) The
HSF-like Transcription Factor TBF1 Is a Major Molecular Switch for Plant
Growth-to-Defense Transition. Current Biology, 22, 10p.
175
Xu, C. Y., Bailly-Maitre, B. and Reed, J. C. (2005) Endoplasmic reticulum stress: cell
life and death decisions. Journal of Clinical Investigation, 115, 2656-2664.
Xu, Q. and Zhang, L. (2009) Plant caspase-like proteases in plant programmed cell death.
Plant signaling & behavior, 4, 902-904.
Yoshimoto, K., Takano, Y. and Sakai, Y. (2010) Autophagy in plants and
phytopathogens. FEBS letters, 584, 1350-1358.
Zhang, Z., Yu, J., Li, D., Zhang, Z., Liu, F., Zhou, X., et al. (2010) PMRD: plant
microRNA database. Nucleic acids research, 38, D806-813.
Zhu, J. K. (2002) Salt and drought stress signal transduction in plants. Annual review of
plant biology, 53, 247-273.
176
177
FINAL DISCUSSION
How a plant responds to stress will ultimately determine its fate (Chen et al.,
2003). While cellular stress is regulated by several compartments including the
mitochondria, chloroplasts and endoplasmic reticulum (Sweetlove et al., 2002, Phee et
al., 2004, Schroder & Kaufman, 2005b), these stressors can also be quite varied (Kreps et
al., 2002, Mahalingam et al., 2003, Desikan et al., 2001). Therefore, it is necessary that
plant regulatory pathways be studied extensively, especially those controlling plant lifeor-death switches (Aouacheria et al., 2005, Walter & Ron, 2011, Schroder, 2006) and
hormone signaling under stress responses (Gazzarrini & McCourt, 2003, Spoel & Dong,
2008a). Future studies in hormone signaling and stress management should allow the
development of crops effective at regulating stress and growth responses to
environmental cues and help avoid yield loss (Peleg & Blumwald, 2011).
178
GENERAL REFERENCES
Aouacheria, A., Brunet, F. and Gouy, M. (2005) Phylogenomics of life-or-death switches
in multicellular animals: Bcl-2, BH3-Only, and BNip families of apoptotic
regulators. Molecular biology and evolution, 22, 2395-2416.
Apel, K. and Hirt, H. (2004) Reactive oxygen species: Metabolism, oxidative stress, and
signal transduction. Annual review of plant biology, 55, 373-399.
Boller, T. and He, S. Y. (2009) Innate Immunity in Plants: An Arms Race Between
Pattern Recognition Receptors in Plants and Effectors in Microbial Pathogens.
Science, 324, 742-744.
Chen, K. G., Du, L. Q. and Chen, Z. X. (2003) Sensitization of defense responses and
activation of programmed cell death by a pathogen-induced receptor-like protein
kinase in Arabidopsis. Plant molecular biology, 53, 61-74.
Chisholm, S. T., Coaker, G., Day, B. and Staskawicz, B. J. (2006) Host-microbe
interactions: Shaping the evolution of the plant immune response. Cell, 124, 803814.
Desikan, R., S, A. H.-M., Hancock, J. T. and Neill, S. J. (2001) Regulation of the
Arabidopsis transcriptome by oxidative stress. Plant physiology, 127, 159-172.
Dodds, P. N. and Rathjen, J. P. (2010) Plant immunity: towards an integrated view of
plant-pathogen interactions. Nature Reviews Genetics, 11, 539-548.
179
Duffee, L. E., Boatwright, J. L., Pacha, F. H., Shockley, J. M., Pajerowska-Mukhtar, K.
and Mukhtar, M. S. (2012) Eukaryotic Endoplasic Reticulum Stress-Sensing
Mechanisms. Advances in Life Sciences, 2, 148-155.
Durrant, W. E. and Dong, X. (2004) Systemic acquired resistance. Annual review of
phytopathology, 42, 185-209.
Fu, Z. Q. and Dong, X. (2013) Systemic Acquired Resistance: Turning Local Infection
into Global Defense. Annual review of plant biology.
Fu, Z. Q., Yan, S., Saleh, A., Wang, W., Ruble, J., Oka, N., et al. (2012) NPR3 and
NPR4 are receptors for the immune signal salicylic acid in plants. Nature, 486,
228-232.
Gazzarrini, S. and McCourt, P. (2003) Cross-talk in plant hormone signalling: What
arabidopsis mutants are telling us. Ann Bot-London, 91, 605-612.
Gohre, V. and Robatzek, S. (2008) Breaking the barriers: Microbial effector molecules
subvert plant immunity. Annual review of phytopathology, 46, 189-215.
Hayashi, S., Wakasa, Y. and Takaiwa, F. (2012) Functional integration between defence
and IRE1-mediated ER stress response in rice. Scientific reports, 2, 670.
He, P., Shan, L. and Sheen, J. (2007) Elicitation and suppression of microbe-associated
molecular pattern-triggered immunity in plant-microbe interactions. Cellular
microbiology, 9, 1385-1396.
Heath, M. C. (2000) Nonhost resistance and nonspecific plant defenses. Current opinion
in plant biology, 3, 315-319.
Jones, J. D. and Dangl, J. L. (2006) The plant immune system. Nature, 444, 323-329.
180
Kreps, J. A., Wu, Y., Chang, H. S., Zhu, T., Wang, X. and Harper, J. F. (2002)
Transcriptome changes for Arabidopsis in response to salt, osmotic, and cold
stress. Plant physiology, 130, 2129-2141.
Mahalingam, R., Gomez-Buitrago, A., Eckardt, N., Shah, N., Guevara-Garcia, A., Day,
P., et al. (2003) Characterizing the stress/defense transcriptome of Arabidopsis.
Genome biology, 4, R20.
Martinez, I. M. and Chrispeels, M. J. (2003) Genomic analysis of the unfolded protein
response in Arabidopsis shows its connection to important cellular processes. The
Plant cell, 15, 561-576.
Moreno, A. A., Mukhtar, M. S., Blanco, F., Boatwright, J. L., Moreno, I., Jordan, M. R.,
et al. (2012) IRE1/bZIP60-mediated unfolded protein response plays distinct roles
in plant immunity and abiotic stress responses. PloS one, 7, e31944.
Peleg, Z. and Blumwald, E. (2011) Hormone balance and abiotic stress tolerance in crop
plants. Current opinion in plant biology, 14, 290-295.
Phee, B. K., Cho, J. H., Park, S., Jung, J. H., Lee, Y. H., Jeon, J. S., et al. (2004)
Proteomic analysis of the response of Arabidopsis chloroplast proteins to high
light stress. Proteomics, 4, 3560-3568.
Schroder, M. (2006) The unfolded protein response. Molecular biotechnology, 34, 279290.
Schroder, M. and Kaufman, R. J. (2005a) ER stress and the unfolded protein response.
Mutation research, 569, 29-63.
Schroder, M. and Kaufman, R. J. (2005b) ER stress and the unfolded protein response.
Mutat Res-Fund Mol M, 569, 29-63.
181
Shimono, M., Sugano, S., Nakayama, A., Jiang, C. J., Ono, K., Toki, S., et al. (2007)
Rice WRKY45 plays a crucial role in benzothiadiazole-inducible blast resistance.
The Plant cell, 19, 2064-2076.
Spoel, S. H. and Dong, X. (2008a) Making sense of hormone crosstalk during plant
immune responses. Cell host & microbe, 3, 348-351.
Spoel, S. H. and Dong, X. N. (2008b) Making sense of hormone crosstalk during plant
immune responses. Cell host & microbe, 3, 348-351.
Sweetlove, L. J., Heazlewood, J. L., Herald, V., Holtzapffel, R., Day, D. A., Leaver, C.
J., et al. (2002) The impact of oxidative stress on Arabidopsis mitochondria. Plant
Journal, 32, 891-904.
Van Breusegem, F. and Dat, J. F. (2006) Reactive oxygen species in plant cell death.
Plant physiology, 141, 384-390.
Vitale, A. and Boston, R. S. (2008) Endoplasmic reticulum quality control and the
unfolded protein response: Insights from plants. Traffic, 9, 1581-1588.
Walter, P. and Ron, D. (2011) The unfolded protein response: from stress pathway to
homeostatic regulation. Science, 334, 1081-1086.
Wu, Y., Zhang, D., Chu, J. Y., Boyle, P., Wang, Y., Brindle, I. D., et al. (2012) The
Arabidopsis NPR1 Protein Is a Receptor for the Plant Defense Hormone Salicylic
Acid. Cell reports, 1, 639-647.
182
183
APPENDIX A
Supplemental material for Chapter 1
Figure S1
ire1a-3
WiscDsLox420D09
ire1a-1
SALK_010332
ire1a-4
SAIL_1256_F04
ire1a-2
SALK_018112
* TAA
IRE1a At2g17520
ire1b-1
GABI_638B07
ire1b-2
SAIL_252_A05
ire1b-3
SALK_018150
ire1b-4
SAIL_238_F07
* TGA
IRE1b At5g24360
Figure S1. Schematic representation of the T-DNA insertion sites in the ire1a and
ire1b mutants.
The upstream regions and genomic organizations of IRE1a and IRE1b are illustrated.
Black boxes correspond to 5’ and 3’ UTRs. White boxes represent exons, while lines
stand for introns. The bent arrow illustrates the predicted translation initiation sites.
184
Asterisks symbolize stop codons. The positions of the T-DNA insertions within IRE1a
and IRE1b are shown.
185
Figure S2
0.04
IRE1B/UBQ5
0h
SA 4h
0.03
Tm 2h
Tm 5h
0.02
0.01
0
Figure S2. IRE1b transcript accumulation in IRE1b RNAi lines in Col-0 and ire1a2.
cDNA was prepared from the leaf tissues of the indicated genotypes upon treatment with
SA for 4 hours and Tm for 2 hours and 5 hours as well as from untreated leaf tissues.
IRE1b transcript was measured using real-time RT-PCR. Transcript abundance was
normalized using UBQ5. The experiment was performed at least three times with similar
results.
186
Figure S3
% recovered seedlings
80
60
40
20
0
Figure S3. Tunicamycin sensitivity of IRE1b RNAi lines.
Seedlings were grown on MS medium containing 0.3 μg/mL Tm to induce UPR for 3
days. Subsequently, seedlings were allowed to recover for additional 10 days. Percentage
of recovery was plotted by calculating alive/dead seedlings of the indicated genotypes.
The experiment was performed at least three times with similar results.
187
Figure S4
α-PR1
IWF
α-PR1
Total
Ponceau S
Figure S4. PR1 secretion in IRE1b RNAi lines.
Intercellular wash fluid (IWF) was collected from 20 leaves derived from 10 plants per
indicated genotype treated with SA for 16 hours. Total protein was extracted from five
leaves derived from three plants per indicated genotype treated with SA for 16 hours.
Accumulation of PR1 was detected by Western blots with anti-PR1 from IWF and total
leaf extract. Ponceau S stain verifies equal loading. Experiments were repeated at least
four times with similar results.
188
Figure S5
1.E+10
Psm ES4326 growth
log cfu/leaf disc
1.E+09
1.E+08
1.E+07
1.E+06
1.E+05
1.E+04
Figure S5. Enhanced disease susceptibility test on IRE1b RNAi lines.
Bacterial growth (colony forming unit – cfu/leaf disc, expressed on a log scale) was
determined from the leaves of the indicated genotypes infected with Psm ES4326
(OD=0.0002). Bacterial population was assessed at 3 dpi. Hypersusceptible npr1 mutant
was used as control. Error bars: 95% confidence interval of the mean (n = 8). The
experiment was performed at least three times with similar results.
189
Figure S6
1.E+10
1.E+09
Psm ES4326 growth
log cfu/leaf disc
1.E+08
1.E+07
1.E+06
1.E+05
1.E+04
1.E+03
Figure S6. Establishment of systemic acquired resistance in IRE1b RNAi lines.
All the genotypes were treated with either 1 mM SA or water 16 hours prior to Psm
ES4326 infection (OD=0.001). Bacterial growth was monitored 3 days post inoculation.
Hypersusceptible npr1 mutant was used as control. Error bars: 95% confidence interval
of the mean (n = 8). The experiment was performed at least three times with similar
results.
190
Figure S7
H. sapiens XBP-1
S. cerevisiae HAC1
A. thaliana bZIP60
Figure S7. Prediction of stem-loop structures observed in XBP-1, HAC1 and bZIP60
mRNA.
191
The conserved nucleotides essential for splicing of XBP-1, HAC1 and bZIP60 mRNAs
are boxed in red.
Figure S8
A
B
bZIP60u
bZIP60s
C
bZIP60u
NLS?
bZIP60s
Figure S8. Sequence prediction of spliced and unspliced bZIP60 forms.
A, Nucleotide sequence of unspliced bZIP60 mRNA forming two hairpin structures.
Spliced portion of the sequence (23 bp) is marked in red (Top). Nucleotide sequence of
unspliced and spliced bZIP60 cDNAs around the splicing sites (Bottom). B, Schematic
representations of bZIP60u and bZIP60s cDNAs indicating positions of stop codons in
both transcripts. C, Schematic representations of bZIP60u and bZIP60s protein variants.
The amino acid sequence corresponding to the putative transmembrane domain (TM) in
192
bZIP60u is highlighted in red. A putative Nuclear Localization Signal (NLS) in bZIP60s
is marked.
Figure S9
% wild-type splicing activity
120
100
80
Tm 2h
60
Tm 5h
40
20
0
Figure S9. Quantitative measurement of bZIP60 Tm-induced splicing activity in
IRE1b RNAi lines.
cDNA was made from the leaf tissue of the indicated genotypes, non-treated or injected
with 0.5 μg/mL Tm for 2 hours and 5 hours. Ratios of fold induction of spliced and
unspliced bZIP60 are plotted, while setting ratio of Col-0 as 100%. The experiments were
performed at least three times with similar results.
193
Figure S10
Figure S10. bZIP60 processing upon diverse abiotic and biotic stresses.
RT-PCR products derived from bZIP60 mRNA were digested with Alw21I and resolved
by gel electrophoresis in agarose (3.5 % p/v). RNA samples were obtained from
seedlings (6-day-old) of wild-type plants exposed to indicated treatments. C corresponds
to a RNA sample obtained from seedlings treated with DTT (5 mM) for 2 hours (positive
control to visualize splicing). L stands for DNA ladder. Expression levels of HSP20,
CBF3, RCI2, HHP1, and LOX2 served as controls for the action of heat, cold, salt,
194
mannitol and MeJA, respectively. Elongation factor 1 alpha (EF-1α) gene expression
served as a control.
Figure S11
Figure S11. bZIP60 processing upon SA treatment in wild-type and ire1a ire1b
double mutant plants.
RT-PCR products derived from bZIP60 mRNA were digested with Alw21I and resolved
by gel electrophoresis in agarose (3.5 % p/v). RNA samples were obtained from 6-dayold seedlings treated with SA for 3 hrs. Expression levels of IRE1A and IRE1B were
determined in the same samples. No cDNA was used as a negative control for
195
background amplification. Elongation factor 1 alpha (EF-1a) gene expression served as a
loading control.
Figure S12
% wild-type splicing activity
120
100
80
60
SA 4h
Psm ES4326(avrRpt2) 4h
40
20
0
Figure S12. Pathogen infection- and SA-dependent bZIP60 splicing activity.
cDNAs were made from the leaf tissues of the indicated genotypes, untreated or treated
with Psm ES4326(avrRpt2) and SA for 4 hours. Ratios of fold induction of spliced and
unspliced bZIP60 are plotted, while adjusting ratio of Col-0 as 100%. All the experiments
were performed at least three times with similar results.
196
Figure S13
0.3
0h
bZIP60/UBQ5
0.25
SA 4h
Psm ES4326(avrRpt2) 4h
0.2
0.15
0.1
0.05
0
Figure S13. bZIP60 transcript accumulation in Col-0 and various ire1 mutants upon
SA or pathogen treatment.
cDNA was prepared from the leaf tissues of the indicated genotypes upon treatment with
SA or PsmES4326(avrRpt2) for 4 hours as well as from untreated leaf tissues. bZIP60
transcript was measured using real-time RT-PCR. Transcript abundance was normalized
using UBQ5. The experiment was performed at least three times with similar results.
197
Figure S14
α-PR1
IWF
α-PR1
Total
Ponceau S
Figure S14. Total and secreted PR1 protein accumulation in bzip60 plants.
Intercellular wash fluid (IWF) was collected from 20 leaves derived from 10 plants per
indicated genotype treated with SA 16 hours prior to sampling. Total protein was
extracted from five leaves derived from three plants per indicated genotype.
Accumulation of PR1 was detected by Western blots with anti-PR1 antibody in IWF and
total leaf extracts from the indicated genotypes. The npr1 mutant (Non-expressor of PR1)
was used as control. Ponceau S stain verifies equal loading. Experiments were repeated at
least four times with similar results.
198
Figure S15
% recovered seedlings
80
60
40
20
0
Figure S15. UPR stress tolerance in bzip60 seedlings.
Wild-type, bzip60 and ire1a-3 ire1b-4 seedlings were grown on MS medium containing
0.3 μg/mL Tm for three days. Percentage of recovery was plotted by calculating
alive/dead seedlings ten days post Tm treatment. Experiments were repeated at least three
times with similar results.
199
Table S1. List of primers used in this study. PCR primers used for RT-PCR, q-PCR,
mutants genotyping and generation of constructs described in the manuscript are listed,
alongside with the loci identifiers for the corresponding genes.
Primers used for RT-PCR analysis
Name
Sequence 5'->3'
Target
Locus
hsp20.1
TCGTGTGGAGAGGTCGAGC
HSP20
At1g07400
hsp20.2
GCCAGAGATATCAATAGACTTAACTTG
hhp1.1
AGTGCCAGAAAGGCTTAAACCG
HHP1
At5g20270
hhp1.2
TTAACAACCAACGTGGTCACGC
cbf3.1
ATGCACGATGAGGCGATGTTTG
CBF3
At4g25480
cbf3.2
rci2.1
TTAATAACTCCATAACGATACGTCGTC
GCTACTTTCGTTGATATTATTATCGCC
RCI2
At3g05880
rci2.2
GTGAGGACATAAATGGCGTATATGAT
ef1a.1
TCACCCTTGGTGTCAAGCAGAT
EF1
At5g60390
ef1a.2
CAGGGTTGTATCCGACCTTCTT
Grxc9_Rt_Fw
CCTACATAAACCGCCGGTAAC
GRXC9
At1g28480
Grxc9_Rt_Rv
GAGGCTGCTTCTTGGACTTG
lox2_for
CAGTTCTCATTAACAGGGATAGAT
LOX2
At3g45140
lox2_rev
CTTTAGAGCCTCATCAACTGTC
AMV019
AGGACGTATGCTTGAGTGCTTCGT
bZIP60
At1g42990
AMV020
IRE1b_for
TTCTGGACGTAGGAGGCAACACT
GTTAATGAGGGATATAGTTGCTG
IRE1b
At5g24360
IRE1b_rev
AAGAATCCTAGAATACAGTGGTC
IRE1a_for
ATTGCAAAGGGAAGTAACGGA
IRE1a
At2g17520
IRE1a_rev
AGATCATCACCAAAGGGATGC
Primers used for q-PCR analysis
IRE1a_FWD
GCTTCAGACCTCATATCCCG
IRE1a
At2g17520
IRE1a_REV
AGCATCACGAAGGAAAGACAG
IRE1b_FWD
GGTGGGATGAGAAACTGGATAG
IRE1b
At5g24360
IRE1b_REV
SRO2_FWD
AGTTTGTTCCGTATGACCCG
TGTTCTCTACTTGCGGCTTC
SRO2
At1g23550
SRO2_REV
CACACCAGAATCAAACTCAGC
GLP1_FWD
TTGCTCTATCCAATGCCTCTG
GLP1
At1g72610
GLP1_REV
TGTAGTGTTTCCAGGAGTGC
UBQ5_FWD
UBQ5_REV
GACGCTTCATCTCGTCC
GTAAACGTAGGTGAGTCCA
UBQ5
At3g62250
200
bZIP60us_FWD GGAGACGATGATGCTGTGGCT
bZIP60u_REV
cagggattccaacaagagcacaG
bZIP60s_REV
CAGGGAACCCAACAGCAGACT
bZIP60_FWD
GCCTATTCCCTTATATGTCCCAC
bZIP60_REV
GAACCCTTACATCTCCGACTAAC
bZIP60
At1g42990
IRE1b
At5g24360
LeftBorder
SAIL lines
Primers used for ire1b-4 mutant genotyping
(WT allele: ire1b-4_for + ire1b-4_rev) (Mutant allele: ire1b-4_for + LB3)
ire1b-4_for
GACTAGAAACTCAACTGGTAA
ire1b-4_rev
TCTTGTGCTCTCGGTCTG
TAGCATCTGAATTTCATAACCAATCT
LB3
CGATACAC
Primers used for ire1a-2 mutant genotyping
(WT allele: ire1a-2_for + ire1a-2_rev) (Mutant allele: ire1a-2_for + LB3)
ire1a-2_for
ire1a-2_rev
GAAAACAACGATTCTACTGAAGG
TTGCGAGATCAATCAGTCCT
LBb1.3
ATTTTGCCGATTTCGGAAC
IRE1a
IRE1a
LeftBorder
At2g17520
At2g17520
SALK lines
Primers used for ire1a-3 mutant genotyping
(WT allele: ire1a-3_for + ire1a-3_rev) (Mutant allele: ire1a-3_for + WiscDsLox-LP )
ire1a-3_for
TATCTCCGATCCATCGTTGAC
IRE1a
At2g17520
ire1a-3_rev
CAAAATCTTCAGTGCTAGCGG
WiscDsLox-LP
AACGTCCGCAATGTGTTATTAAGTTG
IRE1a
LeftBorder
At2g17520
WiscDsLox
lines
(WT allele: ire1a-4_for + ire1a-4_rev) (Mutant allele: ire1a-4_for + LB3)
ire1a-4_for
GGCTACTACTGTCGATGGCTATC
IRE1a
At2g17520
ire1a-4_rev
CTCCTTCAATGAGCTCGAACTG
At2g17520
SAIL_LB1
GCCTTTTCAGAAATGGATAAATAGCCTTGCTTCC
IRE1a
LeftBorder
Primers used for amplification of the IRE1b RNAi fragment
Ire1b-RNAi-F
GwF-CTAAAGCCTCAAAATGTGTTGATTGT
IRE1b
At5g24360
Ire1b-RNAi-R
IRE1b
At5g24360
Primers used for ire1a-4 mutant genotyping
GwR-TCAAATTTGGATCCGGGTTTAGGAG
201
SAIL lines
APPENDIX B
Supplemental material for Chapter 4
Client transcript PCR primers include: AT5G26360: (Forward: 5'CTTGATGCTGGTGGAGGGATTG-3'), (Reverse: 5'GGTCCAGATCCAGGAGCTTGC-3'), AT5G20090: (Forward: 5'ATGGCTACATCAAGGTTCCAAG-3'), (Reverse: 5'GATGCATGGCACGCAAGTAGC-3'), AT4G09000: (Forward: 5'ATGGCGACACCAGGAGC-3'), (Reverse: 5'-GGATTGTTGCTCGTCAGCGGG-3'),
AT3G06483: (Forward: 5'-GATGGAGTTTGGTTCCAAACC-3'), (Reverse: 5'CGACATCCTCCTCAAGCGGG-3'), AT3G08505: (Forward: 5'CCACCACCCCCTCTAGGCAT-3'), (Reverse: 5'-GTTGTCATCACCACCTTGTG-3'),
AT4G34650: (Forward: 5'-GTTGAGGATGACACAAGCGTACC-3'), (Reverse: 5'CACTTACATTGGTTTGCTTTGAG-3'), AT1G09300.1: (Forward: 5,'CTAGTTCGGAGAGTATCGAG-3'), (Reverse: 5'-CTGGCGAAGTTCGCGCAGAG3'), AT1G09300.2: (Forward: 5'-CGTCAGCCCCCGTGAAGATG-3'), (Reverse: 5'CGTAGCCCGTCTCAGTGATCAG-3'), AT1G25490: (Forward: 5'GGAGAGGAGCGTACAAGGAAGGAG-3'), (Reverse: 5'CTTAACTTAACGATCATACATATG-3'), AT5G22330: (Forward: 5'GAAGTCTATGAAGGGGAGGTC-3'), (Reverse: 5'-GTGCGATTAGTGTTCTTCTC3').
202
GCN2 exon PCR primers included: AT3G59410 _Forward_Exon 1.1 (5’GGAGGTAGCGGAAGAAGGGG-3’), AT3G59410 _Forward_Exon 1.2 (5’GACCATGGATCTAATGCTGATG-3’), AT3G59410 _Reverse_Exon 2 (5’CCCTGTAACATCTGAACGATC-3’), AT3G59410_Reverse_Exon 3 (5’GCGGAGGCGAACGCGAATCAG-3’), AT3G59410_Reverse_Exon 7 (5’CATCTGGAGTCAGACTCCAA-3’).
A. brassicicola qPCR primers included: Alternaria 115 forward- (5’AACCCTATAGACCCACGTCGACTA–3’), Alternaria 115 reverse – (5’GATGGTACGCAAGGCTTGGT–3’), AbrCUT forward – (5’–
CACTGCGCCCAATGATGAAC–3’), AbrCUT reverse – (5’ –
GTAGCCGAACAACACGACACC–3’)
203
Table S2. Sample specifics for Illumina-based next-generation sequencing
Name:
JLB-1
JLB-2
JLB-3
JLB-4
JLB-5
JLB-6
JLB-7
JLB-8
JLB-9
JLB-10
JLB-11
JLB-12
JLB-13
JLB-14
JLB-15
JLB-16
JLB-17
JLB-18
JLB-19
JLB-20
JLB-21
JLB-22
JLB-23
JLB-24
Genotype:
Col-0
Col-0
ire1a-2
ire1a-2
ire1a-3
ire1a-4
ire1a-3 ire1b-4
ire1a-3 ire1b-4
ire1b-4
ire1b-4
ire1a-2 ire1b-4
ire1a-2 ire1b-4
Col-0
Col-0
ire1a-2
ire1a-2
ire1a-3
ire1a-4
ire1a-3 ire1b-4
ire1a-3 ire1b-4
ire1b-4
ire1b-4
ire1a-2 ire1b-4
ire1a-2 ire1b-4
Replicate:
1
1
1
1
1
1
1
1
1
1
1
1
2
2
2
2
2
2
2
2
2
2
2
2
SAtreated
No
Yes
No
Yes
No
Yes
No
Yes
No
Yes
No
Yes
No
Yes
No
Yes
No
Yes
No
Yes
No
Yes
No
Yes
204
Additional miR5658 hypothetical targets
AT5G48380.1, AT2G36460.1, AT2G36460.2, AT1G51640.1, AT1G54160.1,
AT1G32360.1, AT5G03340.1, AT5G56860.1, AT3G59020.1, AT3G59020.2,
AT2G37410.1, AT2G37410.2, AT3G23270.1, AT5G61510.1, AT1G29540.1,
AT4G29180.1, AT4G29180.2, AT2G21530.1, AT4G39840.1, AT5G40630.1,
AT1G05490.1, AT1G73500.1, AT4G39420.2
Media
V8 media
V8 media was composed of 150 mL of V8 vegetable juice, 3 g of CaCO 3, 15 g of
agar and filled to 1 L with H2O. Media was autoclaved using a liquid cycle, allowed to
cool and ampicillin (50 mg/L) was added to prevent bacterial growth.
KB media
1 L of King’s B (KB) media requires 1 L of distilled water, 20 g of peptone, 2 g
of K2HPO4-3H2O, 15 g of agar. This solution was autoclaved on a liquid cycle, allowed
to cool and then 6.2 mL of 1M MgCl2 and 18 mL of 80% glycerol are added, along with
required antibiotics (typically streptomycin at 50 mg/L).
YEB media
1 L of YEB was made using 1 L of distilled water, 20 grams of proteose peptone
#3, 2 grams of K2HPO4, 6.1 mL of MgCl2, 18 mL of 80% glycerol and 15 grams of agar.
205
This solution was autoclaved using a liquid cycle and allowed to cool before adding
necessary antibiotics.
MS media
Murashige and Skoog medium was prepared using a modified basal medium with
Gamborg vitamins (PhytoTechnology Laboratories ®). The medium contained the MS mix
at 4.44 g/L dissolved in H2O after which, pH levels were brought to 5.7-5.8 with KOH.
Then, 6 g of sucrose along with 7 g of agar were added before autoclaving on a liquid
cycle. The antibiotic ampicillin (50 mg/L) was used to prevent bacterial growth and
added after media was cool to touch.
206