Download The Effects of recQ, uvrD, and recD Mutants of Deinococcus

Louisiana State University
LSU Digital Commons
LSU Master's Theses
Graduate School
2007
The Effects of recQ, uvrD, and recD Mutants of
Deinococcus radiodurans on Resistance to DNA
Damaging Agents
Stephannie Gauthier Ruiz
Louisiana State University and Agricultural and Mechanical College
Follow this and additional works at: http://digitalcommons.lsu.edu/gradschool_theses
Recommended Citation
Ruiz, Stephannie Gauthier, "The Effects of recQ, uvrD, and recD Mutants of Deinococcus radiodurans on Resistance to DNA
Damaging Agents" (2007). LSU Master's Theses. 3734.
http://digitalcommons.lsu.edu/gradschool_theses/3734
This Thesis is brought to you for free and open access by the Graduate School at LSU Digital Commons. It has been accepted for inclusion in LSU
Master's Theses by an authorized administrator of LSU Digital Commons. For more information, please contact [email protected].
THE EFFECTS OF recQ, uvrD, AND recD MUTANTS OF DEINOCOCCUS RADIODURANS
ON RESISTANCE TO DNA DAMAGING AGENTS
A Thesis
Submitted to the Graduate Faculty of the
Louisiana State University and
Agricultural and Mechanical College
In partial fulfillment of the
requirements for the degree of
Master of Science
In
The Department of Biological Sciences
By
Stephannie Gauthier Ruiz
B.S., University of Louisiana at Lafayette, 2004
May, 2008
TABLE OF CONTENTS
ABSTRACT…………………………………………………………………………………..….iii
CHAPTER 1 INTRODUCTION…………………………………………………………………1
1.1 Background ……………………………………………………………………………..1
1.2 DNA Damage……………………………………………………………….……..........4
1.3 What Is Known of Deinococcal Repair?..........................................................................5
1.4 Role of Helicases in Repair for E. coli………………………………………….....……8
1.5 Rationale for Conducting Studies………………………………………...….……..….11
1.6 Methods…………………………………………………………….………….........….12
CHAPTER 2 RESULTS…………………………………………………………………………25
2.1 The Construction and Characterization of the ∆recD Strain SG4………..….……….. 25
2.2 The Construction and Characterization of the ∆recQ Strain SG5…………….…….…30
2.3 The Construction and Characterization of the ∆recQ, ∆uvrD Strain SG8-2….….…....37
2.4 Transformation Efficiencies Using ∆recD Strain SG4………………………...…........42
2.5 Results Summary………………………………………………………..…..…...….…44
2.6 Discussion………………………………………………………………….………..…45
REFERENCES………………………………………………………………….........………….50
VITA………………………………………………………………………………………..……59
ii
ABSTRACT
The genes encoding the putative nuclease RecD and the helicase RecQ were deleted from
Deinococcus radiodurans R1 and replaced with constructs conferring hygromycin or
spectinomycin resistance. The ∆recD and ∆recQ strains were found to be similar to wild type
R1 strain in resistance to gamma irradiation. In contrast to the single mutant strains, the ∆uvrD,
∆recQ double mutant was found to be extremely radiation sensitive, indicating that these
proteins share a complementary activity needed for radioresistance. ∆recD mutants have higher
transformation efficiencies than the wild type R1 strains, suggesting an association of RecD with
nucleases that degrade single stranded DNA. Mitomycin C and ultraviolet light, DNA damaging
agents that generate different patterns of DNA damage relative to ionizing radiation, were also
used to induce damage in the wild type strain mutant strains. The ∆uvrD, ∆recQ double mutant
exhibited the highest sensitivity to these mutagens, reiterating that RecQ and UvrD have
overlapping activities. Hydrogen peroxide increased the sensitivity of the RecQ mutant
approximately ten fold, suggesting that RecFOR protein complex may be important in repairing
damage mediated by oxygen radicals.
iii
CHAPTER 1 INTRODUCTION
1.1 Background
•
Ionizing Radiation Resistance
Ionizing radiation is strong enough remove electrons from atoms to form ions. Gamma
radiation reacts with material to form high kinetic energy electrons by three methods:
photoelectric, Compton-scatter, and pair-production processes (VanZile, 2004; McCann, 2006).
The absorbed dose is the energy exchange from the radiation field to a substance (measured in
Gray), which is calculated as energy deposited per unit mass. One Gray (Gy) is 10,000 ergs per
gram (VanZile, 2004; McCann, 2006). The resulting ions cause damage to cellular
macromolecules by either directly modifying the macromolecule or by generating reactive
intermediates (such as the hydroxyl radicals formed in aqueous environments) that in turn
modify the macromolecule. Ionizing radiation causes many types of cellular damage, but the
most detrimental is the DNA double strand break. This type of damage effectively destroys the
genome by causing irreparable damage that ultimately leads to the loss of essential genes.
•
Deinococcus radiodurans
Most ionizing radiation resistant organisms are found in domains Bacteria and Archaea
(Rainey et al., 2005). The genus Deinococcus includes twenty three validly named species (Cox
and Battista, 2005). In 1956 a reddish pigmented bacterium was discovered spoiling canned
ground horse meat following a sterilizing dose of gamma rays; it was termed Micrococcus
radiodurans due a phenotypic appearance similar to Micrococcus roseus (Anderson et al., 1956).
The bacterium was designated strain R1, and grew in tetrads as spheres from 1.5 to 3 microns in
diameter in aerated TGY broth. Non sporulating pink round colonies were observed on TGY
agar and high catalase activity was present (Anderson et al., 1956). In 1980, fifty individual
strains of Micrococcus radiodurans were further characterized along with other radiation
1
resistant strains including Micrococcus radioproteolyticus, Micrococcus radiophilus, and
Micrococcus radiopugnans, to determine the differences from other micrococcal species such as
M. roseus, M. agilis, and M. luteus (Brooks et al., 1980). Based on all differences found in 16s
rRNA, DNA, fatty acid composition, and cell wall structures between the radiation resistant
micrococci and the regular micrococci, a separate genus name was proposed. The family name
Deinococcaceae is given for the radiation resistant species, and the designation Deinococcus
radiodurans is given meaning strange or unusual berry that withstands radiation (Brooks and
Murray, 1981).
D. radiodurans is a nearly ubiquitous bacterium, mainly found in soil (Battista, 1997;
Rainey et al., 2005). The deinococcal species can endure dosing as high as 25kGy and recover
(Rainey et al., 2005). These amazing bacteria are able to grow normally with a dose of 60Gy per
hour (Lipton et al., 2002). D. radiodurans is 50-100 times more radiation resistant than
Escherichia coli, and survives 5,000 to 15,000Gy exposures to ionizing radiation (Smith et al.,
1988; Daly et al., 1994; Lipton et al., 2002). The dose needed to kill 63% of an exponentially
growing population is approximately 6,000Gy. These high doses of ionizing radiation cause
large amounts of double strand breaks in the genomic DNA which these bacteria are able to
efficiently repair.
Deinococcus radiodurans is non-motile, aerobic, non spore-forming, and exist as tetrads
or dyads in broth. The size of the bacterium varies from 1.5 to 3.5µm across the sphere and stains
gram positive, however contains a cell envelope concordant with a gram negative bacterium
(Battista, 1997). These cells grow best in tryptone-glucose-yeast extract (TGY) media at 30ºC.
During exponential phase, cells contain 8-10 copies of its genome and 4 copies during stationary
phase (Hansen, 1978; Masters, 1991). When cells are grown in TGY, they have the capacity to
double in an hour and twenty minutes (Hansen, 1978; Battista, 1997). The genome of
2
Deinococcus radiodurans consists of a 2.68Mb chromosome, a 0.41Mb chromosome, a 0.18Mb
megaplasmid, and a 0.045Mb plasmid. Overall, the genome is 3.28Mb and has a high GC
content of 66.6% (Lin et al., 1999). The nucleoid is a tightly packaged structure that appears as a
single ring within each cell (Zimmerman and Battista, 2006). Deinococcus radiodurans is
transformable species and competent throughout exponential phase, similar to Neissaria
meningitidis (Tigari and Moseley, 1980; White et al., 1999). In 1968, Mosely and Setlow
determined that Deinococcus (Micrococcus) radiodurans is able to pick up genomic DNA
extracted from mutant deinococcal strains resistant to streptomycin to yield resistant
transformants (Moseley and Setlow, 1968).
Deinococcus radiodurans is highly resistant to desiccation, and a 10% survival rate has
been reported after 6 years of desiccation (Battista, 1997). Desiccation introduces numerous
double strand breaks to the genome, similar to ionizing radiation induced damage (Mattimore
and Battista, 1996; Cox and Battista, 2005). Deinococcus does not prevent damage or protect its
DNA since the genome of a cell in exponential phase is broken down to 10,000-50,000 base pair
fragments (Cox and Battista, 2005; Mattimore and Battista, 1996). In order to provide evidence
suggesting that the ability to survive extreme drying is connected to the ability to survive
ionizing radiation, a study of 41 ionizing radiation sensitive strains was conducted (Mattimore
and Battista, 1996). Each ionizing radiation sensitive strain was also sensitive to desiccation,
suggesting that D. radiodurans ionizing radiation resistance evolved incidentally as part of an
adaptation to repair extensive amounts of double strand breaks from severe drying (Mattimore
and Battista, 1996).
Most DNA repair genes encoded by D. radiodurans have orthologs found in E. coli
(Makarova et al., 2001; White et al., 1999; Liu et al., 2003). The number of repair enzymes
found so far is fewer than those identified in E. coli (Lipton et al., 2002). There are orthologs of
3
11 genes from the 26 genes involved in E. coli’s SOS response, and of those only 7 genes are
induced after exposure to radiation in D. radiodurans (Makarova et al., 2001; Liu et al., 2003).
1.2 DNA Damage
Ionizing radiation causes the ionization of molecules by the deposition of energy into
matter. Gamma rays are photons and have three separate reactions that form ions, but the
Compton Effect is the most common and happens as the kinetic energy released following the
interaction of of x-rays or gamma rays with a substrate expels electrons creating ions. Cells are
damaged via the free radicals released once the gamma particle hits a substrate (Cox and Battista,
2005). Ionizing radiation damage is greatly increased by aqueous environments able to produce
oxygen free radicals to attack cell membranes, proteins, and DNA (Markillie et al., 1999).
Ionizing radiation usually results in modification of the bases in DNA; a less common effect is
damage to sugar-phosphate backbone causing a single strand break. Double strand breaks are
one of the most detrimental forms of damage to DNA in most bacteria.
Hydrogen peroxide constitutes a reactive oxygen molecule often involved in DNA
damage. Hydrogen peroxide produces radicals that cause significant damage to proteins, lipids,
carbohydrates and DNA (Friedberg et al., 1996). Hydrogen peroxide alone is not as damaging as
the products it forms. These include hydroxyl radical, hydroxide ion, or superoxide, formed
once hydrogen peroxide contacts any transition metal like Fe normally present within cells
(Henle and Linn, 1997). During the Fenton reaction an iron atom is oxidized as hydrogen
peroxide molecule is reduced, forming the unstable hydroxyl radical (Imlay et al., 1988).
Mitomycin C halts DNA synthesis in bacterial cells and prevents cell division (Tomasz et
al., 1988; Weissbach and Lisio, 1964). The drug/mutagen is a bioreductive alkylating agent
(Weissbach and Lisio, 1964; Pan et al., 1986) and acts by ‘cross-linking’ to DNA. Interstrand
cross-links in DNA inhibit separation of the DNA duplex during semiconservative replication
4
(Kitayama et al., 1983). Interstrand crosslinks are formed when this bifunctional agent reacts
with guanines on opposite strands (Sharma et al., 1994).
1.3 What Is Known of Deinococcal Repair?
Although there is no evidence of passive protection of DNA following gamma irradiation,
Deinococcus appears to have characteristics that passively aid in radioresistance. The organism
is multigenomic; Deinococcus carries at least four copies of its genome. This reserve of genetic
information can serve as backup material for use in recombinational repair (Cox and Battista,
2005). Deinococcus also sequesters high concentrations of manganese within the cell, which has
been shown assist in the recovery from damage induced by irradiation, by reacting with
superoxide ions to prevent further damage (Daly et al., 2004).
Nucleotide excision repair functions to remove cross-linked DNA and UV induced lesions
by removing adducted DNA, creating a single-stranded gap allowing de novo DNA synthesis to
fill in the gap.
Homologous recombination repair is mediated by many proteins including RecA,
RecFORQ, and RecD (Makarova et al., 2001). RecA dependent homologous recombination is
necessary for double strand break repair, and post-replication daughter-strand gap repair
(Morimatsu and Kowalczykowski, 2003).
Synthesis dependent strand annealing is another pathway of repair for D. radiodurans
requiring a double strand break nearby an undamaged identical strand (Cox and Battista, 2005;
Lovett, 2006). First, 3’ overhangs are made on the double strand breaks which invade the
homologous region on the undamaged duplex creating a D loop and serve as primers for new
DNA synthesis (Fig 1.). Once the ends are sufficiently extended, the newly synthesized strands
dissociate and anneal to complementary regions where further synthesis continues until the gaps
5
are filled and the double strand break is repaired (Cox and Battista, 2005; Haber, 2000; Lovett,
2006).
Figure 1. Image is taken from Lovett 2006 and depicts steps involved in synthesis dependent
strand annealing. The color red denotes old DNA blue indicates newly synthesized DNA.
Zahradka and colleagues detected a form of synthesis dependent strand annealing that
they referred to as extended synthesis dependent strand annealing (ESDSA). ESDSA requires
large amounts of new DNA synthesis and necessitates two identical strands with double strand
breaks at different loci. When dissociated overhanging strands serve as primers and anneal for
synthesis of complementary single strands (Zahradka et al., 2006; Jones, 2006).
The mismatch repair system is necessary to avoid mutations incurred during replication and
recombination. However mismatch repair is not necessary for repair after DNA damage. Unlike
E. coli (and many other bacterial genera including Salmonella, Klebsiella and Haemophilus,
Yersinia, and Vibrio) there is neither dam methylase, nor MutH involved in the repair pathway.
6
Deinococcus radiodurans contains the three main genes necessary to code for proteins used in
the mismatch repair system such as mutS, mutL and mutU/uvrD. When UvrD is nonfunctional,
cells become sensitive to a variety of mutagens, thus implicating other roles such as UvrABC
pathway which mediates nucleotide excision repair necessary for removing crosslinks and
mutations acquired from exposure to ultraviolet irradiation (Menecier et al., 2004; Minton,
1994). Disrupting the uvrD gene yields a mutator strain, indicating that mismatch repair must
function in Deinococcus radiodurans (Menecier et al., 2004). Mutation frequencies in UvrD
mutants were determined to be 8.3 x 10-8 as compared to wild type at 1.5 x 10-8 (Kim et al.,
2004).
Deinococcus radiodurans lacks a recBCD pathway for homologous recombination, which is
present in many bacteria where it is necessary for repair of double strand breaks. The proteins
RecB and RecC have not been found in D. radiodurans, however RecFOR proteins are present.
In E. coli the RecBCD trimer uses helicase and nuclease activity to process double strand breaks
and load RecA onto single stranded DNA for homologous recombinational repair (Dillingham et
al., 2003). Apparently, the RecFOR pathway is more important in Deinococcus for homologous
recombinational repair and mending of halted replication forks. Proteins RecF, RecO, RecR,
RecQ 3’-5’ helicase and RecJ 5’-3’ nuclease are involved in this repair pathway (Leiros et al.,
2005). Although this protein plays an important role in recovering stalled replication forks,
helicase RecQ does not appear to be induced after exposure to DNA damaging agents (Lipton et
al., 2002; Liu et al., 2003).
The RecD protein is the only part of the RecBCD complex expressed by Deinococcus
radiodurans, and it appears to function independently. The recD gene found in Deinococcus is
most similar to its homologues found in Bacillus subtilis and Chlamydia whose RecD proteins
also function independently in the absence of a RecBCD complex (White et al., 1999; Makarova
7
et al., 2001; Wang and Julin, 2004). RecD has been expressed and purified and in vitro it
unwinds short lengths of double stranded DNA fragments with 5’ single stranded tails. The
protein seems to have low processivity because it dissociates after unwinding about 20 base
pairs, and may require other proteins in vivo to increase processivity (Wang and Julin, 2004).
1.4 Role of Helicases in Repair for E. coli
UvrD or DNA helicase II functions to unwind DNA in a 3’ to 5’ direction, and is implicated
to have a role in methyl directed mismatch repair, nucleotide excision repair, and possibly in
replication and recombination. After DNA damage, UvrD is highly induced, and when
concentrations are high in vitro this protein is able to fully unwind long segments of DNA when
blunt ends or a nick are present (Runyon et al., 1990; Runyon and Lohman, 1989). Nonhomologous recombination in wild type strains is thought to be prevented by a functioning
mismatch repair system where recombination is halted when mismatches are detected in the
invading strand (Zhang et al., 2006). Deletion of the uvrD gene results in a 250 fold rise in the
spontaneous mutation rate in Escherichia coli (Zhang et al., 1998).
RecQ is a ubiquitous helicase conserved from bacteria to humans (Hishada et al., 2004).
In Escherichia coli, RecQ functions as an ATP dependent helicase unwinding from 3’ to 5’, and
is thought to function as a monomer (Zhang et al., 2006). This helicase is highly processive; the
rate of unwinding is very fast with an unwinding step size of 4 base pairs (Zhang et al., 2006).
RecQ may function independently of RecFOR to generate ssDNA at a stalled replication fork in
order to stimulate the SOS response (Hishada et al., 2004). Helicase RecQ will unwind large
segments of DNA in the presence of single strand binding protein, but does not load RecA onto
the unwound strand (which is RecFOR’s purpose) (Kowalczykowski, 2000).
RecFOR pathway for homologous recombination requires RecQ and is involved in the
repair of gapped DNA, the preservation of the newly synthesized strand at a halted replication
8
fork, and the recommencement of halted replication forks (Ishino et al., 2006). The RecFOR
pathway is not well understood as its assembly mechanism is not completely elucidated nor is
the molecular ratio of the assembly known (Morimatsu and Kowalczykowski, 2003). The
RecFOR protein complex mediates the repair of UV induced lesions, ssDNA gaps, plasmid
recombination, and recombination via conjugation at locations far from the double stranded ends
(Morimatsu and Kowalczykowski, 2003). Recombination is initiated by first processing blunt
ends of double strand DNA breaks using helicase RecQ to unwind and RecJ nuclease to digest
and create a free 3’ single stranded end (Kowalczykowski, 2000).
Double strand breaks yield one of two outcomes: a paradoxical role of either
initiating recombination or causing cell death. Homologous recombination is mediated by only
two complexes in Escherichia coli. The RecFOR protein complex specializes in single strand
gaps whereby the RecBCD protein complex specializes in double strand breaks; however
RecFOR functions to repair double strand breaks when RecBCD is inactivated. When RecBCD
is inactivated, RecQ helicase functions to unwind and cause recombination 75% of the time and
the other 25% of activity resumes by UvrD helicase and HelD (Kowalczykowski, 2000). Both of
these pathways function as a backup system for the other in addition to specializing in separate
repair functions.
The RecD protein is a 58KDa polypeptide and is considered to be the essential third
subunit of exonuclease V (RecBCD). When RecD is removed from the complex, nuclease
activity decreases, and recombination rates increase occurring independently of chi sites known
as recombination sites (Amundsen et al., 2000; Kowalczykowski et al., 1994). As a part of the
complex, high levels of nuclease activity occurs when incubated with either single or double
stranded DNA (Chen et al., 1997). Wild type Escherichia coli strains are not naturally
transformable when cells are mixed with linear fragments of DNA. ∆recD mutants become
9
highly transformable with linear plasmid DNA, indicative of the robust nuclease activity RecD
provides when complexed with RecBC (Russell et al., 1989; Courcelle et al., 1997). Protein
RecD plays an essential role as the main nuclease in Eschericha coli, since ∆recBC mutants are
inadequate for digesting double stranded DNA substrates, and processing for repair is not as
efficient (Kuzminov and Stahl, 1999).
In Escherichia coli, the most important role of exonuclease V is to process double strand
breaks to form ssDNA to bind RecA, and initiate homologous recombination. This is essential
because any unrepaired double strand break is lethal (Morimatsu and Kowalczykowski, 2003;
Kowalczykowski, 2000; Ishino et al., 2006). The RecBCD protein complex is a heterotrimer
composed of subunits of RecB, RecC, and RecD (Kowalczykowski, 2000; Anderson et al., 1997;
Ivancic-Bace et al., 2003). The entire RecBCD complex is 330kDa, and functions to unwind and
digest dsDNA, and load RecA onto ssDNA (Ishino et al., 2006). The RecBCD repair pathway
has a variety of functions in the cell including acting as: ssDNA exonuclease, ssDNA
endonuclease, dsDNA exonuclease, DNA dependent ATPase, forming chi specific fragments,
and DNA a helicase (Kowalczykowski, 2000; Ivancic-Bace et al., 2005). In addition,
exonuclease V degrades 90% of foreign DNA that enters the Escherichia coli cell
(Kowalczykowski, 2000).
RecJ and RecD are known to be 5’ to 3’ exonucleases (Lloyd and Buckmam, 1991). It
was recently found that although the ∆recD deficient RecBC complex lacks nuclease activity; the
proficiency of recombination and repair remains because of the activity of other 5’ to 3’
nucleases such as RecJ and exonuclease VII, which compensate for the activity of exonuclease
RecD. Mutants deficient in all three 5’-3’ nucleases lose recombination proficiency (Dermic et
al., 2006).
10
Recent reviews provide strong evidence indicating that protein RecD functions as a 5’ to
3’ helicase in addition to its previously found nuclease role (Dillingham et al., 2003; Taylor and
Smith, 2003; Singleton et al., 2004; Ishino et al., 2006). Protein RecD contains super family 1
helicase domains, and exhibits DNA dependent ATPase activity (Dillingham et al., 2003; Taylor
and Smith, 2003). The complex roles that each enzyme plays in the RecBCD pathway (such as
cleavage), may further be related to other non helicase domains that have yet to be found in the
three subunits (Dillingham et al., 2003). The lack of nuclease activity in a RecD subunit alone
may indicate the requirement for direct contact with subunits RecB and RecD to stimulate the
nuclease function of RecD in order to prevent nonspecific DNA degradation (Taylor and Smith,
2003).
1.5 Rationale for Conducting Studies
RecD, RecQ, and UvrD are three important repair proteins found in E. coli, and were
chosen as target proteins in Deinococcus radiodurans in order to determine their importance in
DNA damage repair in this species. These genes were inactivated to gain insight into the role
theses proteins play in this species ability to withstand DNA damage. In Deinococcus
radiodurans, protein RecD is the only homologue of the RecBCD complex found in Escherichia
coli. The protein RecD in D. radiodurans is a helicase and a putative nuclease. A recD gene
replacement mutant was created in order to elucidate the function of the protein in repair after
exposure to different DNA damaging agents and to test for possible nuclease activity by
transformation assays. In D. radiodurans, RecD protein seems to play a minimal role in repair
and decreases transformation efficiency, a similar effect found in E. coli ∆recD mutants.
UvrD and RecQ are helicases that unwind DNA from 3’ to 5’ direction. UvrD functions
in mismatch repair and in UvrABC nucleotide excision repair in E. coli. In Deinococcus,
nucleotide excision repair is mediated by protein complex UvrABC. The RecFOR repair
11
pathway is important in Deinococcus as it is believed to be the main pathway of double strand
break repair, requiring RecQ helicase and RecJ nuclease.
In Deinococcus radiodurans, it is known that a single ∆uvrD mutant is insensitive to
ultraviolet and ionizing radiation (Chris Davis Guillot, unpublished data). In order to determine
whether these helicases in Deinococcus were able to complement each other in different repair
pathways single and double mutants were created to test the effect on survival following DNA
damage.
1.6 Methods
Deinococcus strains were all grown in tryptone-glucose-yeast extract (TGY) broth or agar
(0.5% tryptone, 0.3% yeast extract, 0.1% glucose) at 30ºC broths with agitation at 200rpms.
Solid media plates were grown without agitation. All E. coli strains were grown in Luria-Bertani
(LB) broth or plates (1% tryptone, 1%NaCl, 0.5% yeast extract) at 37ºC with agitation for broth.
Frozen stocks were made of all strains and consist of 150µL dimethyl sulfoxide and 850µL of
culture.
Table 1. Strains used in all studies.
Strain Name
Bacteria
Phenotype
Drug Cassette
R1 ATCC 13939
Wild type
None
recD
Hygromycin
recQ
Spectinomycin
uvrD, uvrA
Chloramphenicol
uvrD, recQ
Chloramphenicol,
Spectinomycin
pSG11
Deinococcus
radiodurans
Deinococcus
radiodurans
Deinococcus
radiodurans
Deinococcus
radiodurans
Deinococcus
radiodurans
Escherichia coli
Hygromycin
pSG27
Escherichia coli
Upstream HYG
downstream recD
Upstream CAT
downstream recJ
SG4
SG5
CD571
SG8-2
12
Chloramphenicol
pTNK104
Escherichia coli
Drug cassette only
Hygromycin
pTNK101
Escherichia coli
Drug cassette only
Chloramphenicol
Pino103-2
Escherichia coli
Upstream Spec
downstream recQ
Spectinomycin
•
Chromosomal DNA Purification from D. radiodurans
Strains are inoculated from frozen stocks into 4mL tubes of TGY broth, and are allowed
to grow for 2 days until cells reach stationary phase. Every Deinococcal culture is incubated in
the Innova™ 4300 incubator shaker at 30ºC with agitation at 200rpms (New Brunswick
Scientific). Cultures are separated into 2mL microcentrifuge tubes, and then spun down for 5
minutes at 5x1000 rpms using an Eppendorf Centrifuge model 5415 D. The supernatant is
poured off and cells are resuspended by vortexing in 400mL of 70% ethanol to remove the outer
membrane. Cells are centrifuged again, and the ethanol is drained off to add 150µL distilled deionized water on ice and 300µL of SDS-EB buffer (Sodium Dodecyl Sulfate-Elution Buffer:
2%SDS, 400mM NaCL, 40mM EDTA, 100mM Tris-HCl, pH 8.0). Tubes are vortexed after
water and buffer are added and 350µL phenol/Choroform isoamyl alcohol (1:1) is used to extract
cellular debris by inverting. The extraction is repeated 2-3 times. Phases are separated by
centrifugation for 5 minutes at 5rpms and aqueous solution is added to a new tube after each
extraction. One last extraction is performed by using 300µL chloroform isoamyl alcohol (24:1),
centrifuging and transferring aqueous phase to new tube. To precipitate the DNA, 2 volumes of
absolute ethanol is used, then tubes are inverted to mix and placed on ice for 30 minutes. The
tubes are then centrifuged for 10 minutes at 13.2x1000 rpms and the pellet is washed once with
200µL of 70% ethanol. The microcentrifuge tube cap is then opened, inverted onto chemwipe
tissues, and allowed to dry for 15 to 20 minutes. Pellet is then resuspended in 40µL Qiagen
elution buffer (10mM Tris–HCl).
13
•
PCR Conditions
Taq polymerase with standard 10X Taq buffer (10 mM Tris-HCl, 50 mM KCl,
1.5 mM MgCl2, pH 8.3) and 10mM deoxynucleotide solution mix is used from New England
Biolabs. dNTP solutions are diluted to 2.5mM and are stored in separate tubes. All primers are
ordered from Integrated DNA technologies, Inc. and are resuspended in deionized water for a
200mM concentration, then are diluted to 10µm concentration. All PCR reactions took place
with a max volume of 20µL, with 20ng of DNA used per reaction. The thermocycler model used
is Bio-Rad iCycler. Cycles were repeated 30X for most amplifications.
•
Plasmid Purification from E. coli
Plasmid-carrying E. coli strains are inoculated from a frozen stock and incubated
overnight in tubes containing in 4mL of LB broth containing 100µg/mL ampicillin. Qiagen kits
were used, specifically the QIAprep Spin Miniprep Kit. The Eppendorf Centrifuge model
5415D was used spin buffers through the filter columns.
•
Protocol for Generating ∆recD Mutant
The hygromycin drug cassette with the deinococcal pKat promoter was amplified from
pTNK104. The fragment upstream from gene recD is 1KB of sequence upstream, and the
downstream fragment is composed of 800 base pairs directly downstream of the recD gene. R1
genomic DNA is used for polymerase chain reaction amplification of upstream and downstream
regions at a concentration of 1ng of DNA per microliter of PCR reaction mixture. Final products
are excised from gels, and purified using the QIAquick Gel Extraction Kit, and then fragments
were cloned into plasmids for easy amplification.
14
Using the splicing by overlap extension (SOE) technique, tails made on the primers of the
drug cassette overlap with upstream and downstream regions (Horton et al., 1989; HowardFlanders and Bardwell, 1981). Using this technique the upstream region was fused to the drug
cassette, and the downstream region was separately fused to the drug cassette. The entire
upstream-drug cassette-downstream construct was not made by SOEing, but by ligation using T4
DNA ligase (NEB). Upstream-drug cassette (2,119bp) and Downstream-drug cassette (1,919bp)
were digested using restriction endonuclease DraIII to create overlapping ends for ligation. After
digestion, these products were then cut out of the gel and purified using the QIAquick Gel
Extraction Kit to prepare for ligation.
Table 2. List of primers used for generating plasmid and for verifying presence of homozygous
recD gene knockout.
Name
RecDup1
RecDup2-r
RecDdown5b
RecDdown800-r
RecD-Hy7
RecD-Hy8
HygDownL
DownR
RecDa
RecDb
Sequence
AGACCGTCCGGGGGTCGC
GACGCCTTAAGAGTTCT
GCCAGGCAGGATAGCGCGGAAGG
GCCTTGCTCACCACCTCGCC
AGAACTCTTAAGGCGTCGCGAGGGCCTGAGGGCCAT
TATCCTGCCTGGCTCAGGCGCCGGGGGCGGT
GACCTGCACGGGACCAACAT
TCCCATTTCCCCACCAGACG
GGAAGACGATTCGCCGCTCT
GCAGCCGGTGAACGGTACT
Tm(oC)
69
55
72
69
76
79
60
60
60
60
The Promega PGEM®-T Kit protocol was used to ligate the two fragments overnight,
clone into a PGEM®-T vector, and perform the subsequent transformation using JM109 high
efficiency competent cells. Transformants were plated on LB/Ampicillin/IPTG/X-Gal plates and
white colonies were picked. Plasmid pSG11 contains all 3 pieces in the forward orientation, as
determined using restriction endonucleases BstX1 and DraIII ordered from New England
Biolabs.
15
The plasmids were linearized using restriction endonuclease PstI (NEB), and transformed
into Deinococcus radiodurans R1. Transformants were plated on TGY plates with 37.5µg/mL
hygromycin to select for mutants containing the antibiotic marker. Mutants lacking the recD
gene were verified through PCR. Primers were designed to amplify a 1,461 base pair region
within the drug cassette, and extending outside of the construct into genomic DNA. This primer
was designed to verify the construct underwent homologous recombination at the proper site.
Another primer was designed to amplify a short 404 base pair region within the recD gene to
verify absence of gene in all mutants.
•
Transformation Protocol
Deinococcus is grown to exponential phase as described. CaCl from a 1M stock is added
to a flask containing about 10mL TGY to get a final concentration of 30mM. The flask is then
returned to the Innova™ incubator shaker for 80 minutes. Once proper incubation time is
achieved, 1mL of culture is added to a large tube on ice, and 1µg of linearized plasmid or
genomic DNA is immediately added. Strains are incubated on ice for 30 minutes prior to
diluting with 9mL of fresh TGY broth. The tubes are incubated overnight for 18 hours shaking
at 30ºC. The next day cells are plated on TGY media selecting for the appropriate antibiotic
resistance marker. In order to obtain homozygous knockouts, isolated colonies are picked and
inoculated in TGY broth containing the antibiotic marker, and grown for 48 hours to stationary
phase. Frozen permanents are made of these stocks. Next, the strains are then inoculated in
TGY broth media without antibiotics and grown to stationary phase. These strains are plated
onto TGY plates with the appropriate antibiotic and isolated colonies are picked and grown up in
broth also containing the correct antibiotic. More frozen stocks are made after the cells reach
stationary phase, and the remaining culture is used for DNA purification for PCR verification of
16
the absence of the targeted gene. The transformation protocol was adapted from papers (Tigari
and Moseley, 1980), and (Moseley and Setlow, 1968).
•
Protocol Used for Ionizing Radiation
The Shepherd Co60 gamma-emitting irradiator was used for all ionizing irradiation
experiments with supervision from radiation safety officers. Initial dose rates started at
0.2Gy/sec at the center of the irradiator around January of 2006. In September of 2006, it was
determined that at 8cm away from the source, a dose rate of 18Gy/min (1,080Gy/hr) was
absorbed. Pre-irradiation samples were diluted and plated on plain TGY prior to bringing
samples to the irradiator. All samples were irradiated in 1.5mL microcentrifuge tubes,
containing roughly 1mL of exponentially growing strains of D. radiodurans. Overnight cultures
were grown and used to inoculate a 125mL flask containing 10mL of fresh TGY broth where
cultures grew for 3 to 4 hours. Absorbance was measured at 600nm using a SmartSpec™ 3000
by Bio Rad until an optical density was reached between 0.1 and 0.2. 600µL of each sample was
transferred into a clean 10 x 4 x 45nm cuvette by Sarstedt. All samples of culture were irradiated
in Styrofoam racks, with strain R1 serving as a control. After the appropriate dose was given,
the samples were removed, lightly vortexed and immediately placed into 10mM magnesium
sulfate to stop growth. All cultures were serially diluted to obtain the appropriate dilution factor
to obtain adequate isolated colonies for plate counts. TGY plates were used containing no
antibiotics and cultures were incubated for 2 to 3 days before colony forming units were counted
(Zimmerman and Battista, 2006).
•
Protocol for Generating ∆recQ Mutant
Plasmid Pino 103-2 was obtained from Nicole Pino, the plasmid constructs were digested
with restriction endonuclease DraIII to check for 3 distinct bands that should appear, confirming
the presence of the upstream-spectinomycin drug cassette-downstream construct. The plasmid
17
was linearized with restriction endonuclease PstI before transformation and transformants were
plated on TGY agar with 75µg/mL spectinomycin. PCR was used to verify whether the recQ
gene was absent in the transformants, however ambiguous results ensued. Bands were present
which could be interpreted as nonspecific amplification in the mutants, or possibly the recQ gene
amplified to a lesser extent. Another PCR analysis was conducted to determine where the drug
cassette was inserted. Primers were designed to start upstream from the gene and amplify into
the spectinomycin drug cassette to determine if the recombination occurred in the correct place.
Table 3. List of primers used for generating plasmid and for verifying presence of homozygous
recQ knockouts.
Name
RecQb
RecQa
SpecUp
SpecDown
RecQ1
RecQ2
Sequence
ATGACCGCTGCTCCTGCCGCCCT
TTATCCATCGAGCACCGTGTT
AGTTCGCCGCGCTCATTGGT
TGCCCGAGGCATAGACTGTACC
CCGCAGTTCGTCTCCTCCTT
AGCACCTTGTCGGTTTCGCG
Tm*(oC)
55
70
63
61
59
61
Southern blot analysis was conducted to determine with certainty whether a homozygous
knockout was present in strain SG5. Restriction endonuclease KpnI produced a fragment
surrounding the recQ gene of 5.6Kb, and endonuclease ClaI produced a 4.1Kb fragment
surrounding the recQ gene. The genomic DNA digest was incubated overnight at 37ºC. The
digest ran overnight using gel electrophoresis at 15V on a 0.8% gel. The southern blot protocol
was followed from “Current Protocols In Molecular Biology”. Nytran filter and wick from
Shleicher&Schuell were used for transfer pyramid apparatus or blotting procedure. Primers were
designed to amplify a 746 base pair region in the center of the recQ gene to serve as a probe.
The probe was labeled with deoxy-cytidine-5’-triphosphate α-32P ordered form MP
Biomedicals. The NEBlot® Kit was used for a random priming reaction to label the probe. 25ng
of template probe DNA was denatured by boiling in a water bath for 5 minutes, and then
18
immediately placed on ice for another 5 minutes. P32 dCTP is incorporated into the probe by a
random-primed DNA polymerization using the DNA polymerase I-klenow fragment. The probe
was then cleaned using the PCR Qiagen Cleanup Kit to remove unincorporated P32 dCTP. Some
alterations were made to the protocol as the nitrocellulose filter was baked for 3 hours at 70ºC
instead of 2 hours at 80ºC. Herring sperm was used instead of salmon sperm in the
prehybridization solution. Prehybridization and hybridization were incubated at 40ºC, rotating
overnight and placed in glass cylinders using a Hybaid rotating hybridization chamber by
Labnet. After the filter was rinsed off, it was tapped to blotting paper, inverted over saran wrap,
which was taped to the back of the blotting paper to secure and seal. In a dark room the X-ray
film was placed over the filter and placed into a cassette. The cassette is then placed in a -80ºC
freezer for 3 hours of exposure.
•
Protocol for Generating a ∆uvrD, ∆recQ Double Mutant
The strain CD571, a ∆uvrA and ∆uvrD mutant was used to create a ∆recQ, ∆uvrD double
mutant strain called SG8-2 derived from an SG8 strain. 1µg of CD571 genomic DNA was used
to transform SG5 into a ∆uvrD, ∆recQ double mutant. Transformants were plated on 3µg/mL
chloramphenicol due to the drug cassette contained a Tn7-based transposon inserted within the
uvrD gene. The inactivated uvrD gene including the transposon insertion is approximately 4,247
base pairs in size. The original SG8 strain contained the transposon insertion and lacked the
recQ gene but did not appear to be a homozygous recessive strain. SG8 stock was inoculated
and grown to stationary phase twice, once with Spectinomycin and Chloramphenicol, and once
without any antibiotics. After cells reached stationary phase without antibiotics, these cells were
plated on chloramphenicol plates, colonies were isolated, and frozen stocks were made of eight
strains. Of these strains, SG8-1, SG8-2, and SG8-7 seemed to have homozygous recessive gene
knockouts.
19
Table 4. List of primers used for verifying lack of uvrD gene and recQ gene in double mutants.
Name
Sequence
Tm*(oC)
UvrD1a
GACCTGCTCCAAGCCCTCAA
60
UvrD2
CATCACAAAGCGCAGGAACG
57
GPS Primer S
ATAATCCCTAAAAACTCCATTTCCACCCCT
58
GPS Primer N
ACTTTATTGTCATAGTTTAGATCTATTTTG
51
RecQ1
CCGCAGTTCGTCTCCTCCTT
59
RecQ2
AGCACCTTGTCGGTTTCGCG
61
Both GPS primers bind to the opposite ends of the transposon and extend outward into
the gene where the transposon was inserted. Primer UvrD1a binds about 20 base pairs from the
start of the uvrD gene. Primer UvrD2 is a reverse primer, binding about 1.4Kb into the gene.
UvrD1a and GPS primer N yield a PCR product of 800 base pairs, indicating that the transposon
inserted about 820 base pairs downstream from the start of the gene. UvrD2 and GPS primer S
yield a PCR product of around 750 base pairs, indicating the transposon inserted about 1423 base
pairs from the end of the gene (Fig 2).
Figure 2. Transposon is depicted in center of diagram and Primer S and N extend away from the
transposon and into the area of insertion.
Image is taken from New England Biolab’s GPS-M instruction manual.
•
Protocol Used for Ultraviolet Irradiation Mediated Damage
125mL flasks with 10mL TGY were inoculated with an overnight culture and grown to
an optical density between 0.1 and 0.2. Sterile 60 x 15mm polystyrene Petri dishes by Falcon®
were first labeled for the strain and dose to apply. 1mL of culture of each sample was removed
and placed into each dish. A germicidal ultraviolet lamp placed approximately 5.5 inches away
from the surface was used to irradiate the cultures. The dose rate was always adjusted to 10J/m2
for each experiment. Appropriate safety measures including gloves, long sleeves, and face
20
masks were used during exposure experiments. Petri dishes had covers removed when timing
started, and were roughly agitated by hand since the broth is ultraviolet opaque. Every sample
was irradiated to the appropriate dose before dilutions were made. Samples were serially diluted
in magnesium sulfate immediately after exposure, then spread onto plain TGY plates. This
protocol was adapted from the paper by Kitayama, Asaka, and Totsuka (Kitayama et al., 1983).
•
Protocol Used for Hydrogen Peroxide Mediated Damage
Cells were grown to exponential phase as described previously, and separate flasks were
used for each concentrated dose. Hydrogen peroxide mediated DNA damage was administered
by concentrations of doses at 20mM, 40mM, and 60mM. 30% Hydrogen peroxide was used
from Fisher Scientific. Hydrogen peroxide was added directly to the flasks after the exact
volume of broth was determined. Flasks were then incubated for 1 hour at 30ºC with shaking at
200rpms. After 1 hour, cultures were immediately removed and diluted in 10mM magnesium
sulfate then plated on TGY plates. Protocol was adapted from the paper by Wang and
Schellhorn (Wang and Schellhorn, 1995).
•
Protocol Used for Mitomycin C Mediated Damage
Cultures were grown to exponential phase as previously described. Pre-exposure samples
were taken from each flask, diluted and plated. Stocks of 500µg/mL were made from 2mg
Powdered Mitomycin C containing 48mg NaCl from Acros Organics. A constant concentration
of 20µg/mL of Mitomycin C was added to each flask and samples were obtained from flasks at
5, 10, 15, and 20 minutes. The proper concentration of mitomycin C was added, and then the
flask was immediately placed in a shaking incubator at 30ºC. The same flask is removed slightly
before each time point, and a sample is taken and placed in a microcentrifuge tube containing
10mM magnesium sulfate. The flask is quickly placed into the incubator, serial dilutions are
21
made, and samples are plated while waiting for the next time point. This protocol was adapted
from Kitayama, Asaka, and Totsuka (Kitayama et al., 1983).
•
Protocol for Generating Plasmid SG27
A plasmid was created to make a ∆recJ mutant, however after multiple transformation
attempts, it was discovered that the plasmid had a non-functional chloramphenicol drug cassette.
pTNK101 was used to amplify the chloramphenicol cassette, and strain R1 was used to reamplify the upstream and downstream regions using Vent polymerase (NEB). The plasmid was
thus re-engineered using Vent instead of Taq polymerases. The construct was inserted into
pBlueScript KS2, plasmid strain pDD769. The plasmid vector was first linearized using KpnI
and PstI prior to transformation. New primers were designed to amplify the upstream region
fused to the drug cassette the forward primer containing a KpnI restriction site on the 5’ end.
The reverse primer was designed with complementarity to the chloramphenicol drug cassette,
and has an EcoRI restriction site on the 5’ end of the primer. The 1Kb downstream region was
amplified using a forward primer with an EcoRI restriction site on the 5’ end, and a reverse
primer with a PstI site on the 5’ end. The 1.8Kb upstream region of the recJ gene and the
chloramphenicol drug cassette were cloned into a PGEM®-T vector, and the construct was
subsequently excised using EcoRI and KpnI. The downstream region was similarly excised from
a PGEM®-T vector using EcoRI and PstI. Using these specific restriction endonucleases, the 3
pieces should ligate together according to the complementary overlapping sticky ends generated
by the restriction enzymes. Ligations using T4 ligase (NEB) took place overnight and were at
16ºC in an iCycler thermocycler (Bio-Rad). The plasmids were transformed into JM109
competent cells using the PGEM®-T Promega transformation kit. White colonies were picked
22
and patched onto LB plates containing 34µg/mL chloramphenicol to ensure the drug cassette
worked. Growing transformants were selected, and the plasmids were purified and underwent
restriction endonuclease analysis to determine if the correct parts of the construct were present.
Table 5. Lists primers used for generating pSG27.
Name
RecJupRE
CatDownbRE
RecJDownRE
RecJDown2RE
•
Sequence
GTTACCGTCAGACCAACGCCGGTT
GAATTCTTAAGGGCACCAATAACTGC
GAATTCAGCGCTCGAGCGCCTGCT
CTGCAGCGCCCCCGAGATGGTGCC
Tm*(oC)
65
57
67
70
Protocol Used for Determining Transformation Efficiencies
All transformations for transformation efficiency calculations were conducted using
pSG27 and strains R1 and SG4 (∆recD). Plasmids were digested with endonuclease DraIII, and
run on a gel to ensure DNA was linear. Circular plasmids were also used, along with a no DNA
control to calculate efficiencies, and a total of 42 separate transformations were conducted.
486.055ng of undigested circular plasmid and 532.266ng of linear plasmid were used for
individual transformations. Three separate flasks of R1 (called R1a, R1b, and R1c) were grown
up to exponential phase, and the optical densities measured were respectively: 0.164, 0.101, and
0.160. Three separate flasks of the ∆recD strain or SG4 (Da, Db, and Dc) were grown up to
exponential phase, and the optical densities measured were respectively: 0.139, 0.149, and
0.144. 282µL of 1M CaCl was added to each flask of culture once cells were determined to have
entered exponential phase (9.4mL left in each flask) to obtain a 30mM concentration.
For each flask, three transformations were conducted for circular plasmids and for linear
plasmids. Only one blank or mock transformation was conducted for each flask (Table 6)
23
Table 6. Depicts each separate transformation using individual strains inoculated separately and
form of DNA used for each transformation.
Flask
R1a
R1b
R1c
Da
Db
Dc
Linear DNA
3 transformations/ tubes
3 transformations/ tubes
3 transformations/ tubes
3 transformations/ tubes
3 transformations/ tubes
3 transformations/ tubes
Circular DNA
3 transformations/ tubes
3 transformations/ tubes
3 transformations/ tubes
3 transformations/ tubes
3 transformations/ tubes
3 transformations/ tubes
No DNA
1 transformation/tube
1 transformation/tube
1 transformation/tube
1 transformation/tube
1 transformation/tube
1 transformation/tube
1mL of culture was placed into a plastic 25mL corning tube, along with 7µL of the DNA
mixture (both linear and circular contained identical concentrations of NEB3, BSA, and elution
buffer used to purify plasmids). Each individual transformation (tube) was plated on 3 TGY
plates with 3µg/mL chloramphenicol, and colony forming units were counted. 50µL of the
culture was directly placed onto each plate except for mock transformations (no DNA control)
for those plates. Serial dilutions were made at 10-4, 10-5, and 10-6 with three plates for each
dilution.
24
CHAPTER 2 RESULTS
2.1 The Construction and Characterization of the ∆recD Strain SG4
In order to determine the importance of the protein RecD in repair processes, the gene
was removed via gene replacement by homologous recombination using a construct containing
1kb of homologous sequence upstream and an 800 base pair sequence downstream of the gene
with a hygromycin drug cassette inserted between the two regions. Transformants were screened
on selective media containing hygromycin, and resistant strains were isolated. Genomic DNA
was purified from each putative deletion, and PCR based analysis was used to verify the
presence of the construct and to verify the presence of a gene knockout. The construct was
confirmed using primers that amplified a 1,461 base pair fragment that included a portion of the
hygromycin drug cassette and 300 base pair of genomic DNA downstream from this insert (Fig
4).
Figure 3. 1 Kb upstream and 800bp downstream region of recD gene are labeled in red.
1,119bp hygromycin drug cassette insert is orange rectangle in center. Locations of two primers
used are indicated with blue arrows. Image is taken from Vector NTI Suite.
25
1
2
3
4
5
6
Kb
1.5
0.4
Figure 4. Verification of recD gene replacement by hygromycin resistance drug cassette. Lane 1
2-log DNA ladder (0.1-10kb), Lane 2, SG1, Lane 3, SG4, Lane 4 SG9, Lane 5, negative R1
control, Lane 6, no DNA control
The size of the band is slightly smaller than the 1.5Kbp ladder marker, indicating that the
construct has indeed inserted and has undergone recombination at the proper site. PCR analysis
reveals the presence of the drug cassette, and the downstream region crossed over at the
appropriate place within the genome. The fragments in lane 3 were generated from a strain
designated SG4, the mutant strain used for all future studies of the ∆recD mutant. Amplification
of this fragment was not visible when R1 genomic DNA was used. A second intense band
appeared on the gel at approximately 0.4 Kbp, but it appears in all of the strains examined,
indicating that these primers bind nonspecifically to at least one other site.
PCR analysis was also implemented to establish that SG4 was homozygous recessive for
the ∆recD allele. The sensitivity of PCR allows detection of even a single copy of the recD gene
within SG4’s polyploid genome. Primers were designed to amplify a 404 base pair region in the
26
center of the recD gene to determine if the gene is present in the mutant strains. Two R1
controls were used as a positive control and, three mutant strains were analyzed with the same
primer (Fig. 5).
1
2
3
4
5
6
7
Kb
1
0.4
Figure 5. Verification that SG4 is homozygous recessive for ∆recD allele. Lane 1, 2-log ladder
(0.1-10kb), Lanes 2-3, positive R1 control, Lane 4 SG1, Lane 5, SG4 Lane 6 SG9, Lane 7 no
DNA control
The results from the gel indicate that allele is homozygous. No banding pattern is visible
in the three mutant strains, as expected for a complete deletion of the gene. Strain SG4 is
depicted in lane 5. Both R1 positive controls (lanes 2 and 3) show the expected recD bands,
indicating that the primers amplify the recD gene.
•
The Role of RecD in the DNA Damage Tolerance of Deinococcus radiodurans
(Ionizing Radiation)
Once strain SG4 was determined to be a homozygous ∆recD mutant, further studies were
conducted to determine if the recD gene product contributes to DNA damage repair processes in
D. radiodurans. Fig. 6 depicts the effect that deletion of the recD gene has on the ionizing
radiation resistance of this species. The putative 5’ to 3’ helicase activity RecD in wild type
strain R1 does not appear to be necessary for ionizing radiation resistance. The only indication
of loss of the RecD protein is observed at the highest dose administered where there is a slight
27
(1.5 fold) difference (unpaired student t-test, p=0.0006221378, df=22) of means in survival when
R1 and the ∆recD mutant strain SG4 are compared. These results suggest that protein RecD may
be involved in repair of ionizing radiation-mediated damage. The initial increase in colony
forming units is most likely a consequence of the long exposure time needed to acquire the dose
indicated. The rate of exposure is 1,080Gy per hour. The lengthy exposure time allows cell
division, initiated before irradiation, to be completed causing a slight increase in cell numbers.
Figure 6. Ionizing radiation resistance of SG4. Each value is the mean of 3 experiments four
replicates per experiment n=12 for SG4. Each value is the mean of six experiments, four
replicates per experiment n=24 for R1
The error bars in the above graph show the standard deviation for the surviving fraction
data points. The standard deviations are plotted in this fashion for all of the remaining graphs in
this thesis.
(Ultraviolet Light)
SG4 was exposed to UV light generated by a germicidal lamp. As seen in Fig. 7, gene
replacement by homologous recombination of recD had little effect on survival.
28
Figure 7. UV radiation resistance of SG4. Each value is the mean of at least three experiments
three replicates per experiment n=9
Strain SG4 exhibited the same shoulder resistance as wild type strain R1. There is no
drop in viability until a dose of 400 J/m2 was reached. The mutant strain was twofold more
sensitive to UV light relative to R1 at the 1200 and 1600 J/m2 doses, but this difference is not
statistically significant (unpaired student t-test, p=0.6852260000, df=34).
(Mitomycin C)
Since strain SG4 had shown high resistance to other DNA damaging agents, mitomycin C
was chosen to observe the role of protein RecD in repairing DNA interstrand cross-links. SG4
was challenged with constant exposure to mitomycin C at a concentration of 20µg/mL. At
varying time intervals, aliquots of the cultures were serially diluted and plated onto TGY agar
that did not contain mitomycin C. Survival was evaluated at time intervals beginning 5 minutes
after exposure to mitomycin C. Mitomycin C exposure resulted in a rapid drop in viability (Fig.
8) in both the wild type and mutant ∆recD strain.
29
Figure 8. Mitomycin C resistance of SG4. Each value is the mean of three experiments three
replicates per experiment n=9
Exposure to cross-linking agent, mitomycin C, yields a 1000-fold decrease in survival in
the wild type strain after a 20 minute exposure. The lower mean survival of SG4 (5 fold relative
to R1) observed after 20 minutes is statistically significant (unpaired student t-test,
p=0.0103162990, df=16), otherwise the survival of R1 and SG4 are identical. The RecD protein
does not appear to be necessary for repair of DNA cross-links caused by the effects of mitomycin
C.
2.2 The Construction and Characterization of the ∆recQ Strain SG5
In order to characterize the role of helicase RecQ in DNA repair processes, the gene was
replaced with a gene conferring spectinomycin resistance using gene replacement by
homologous recombination as previously described. Putative ∆recQ transformants were selected
on media containing spectinomycin, and PCR based analysis was used to verify whether the
resistance gene was present and the recQ gene absent.
30
Figure 9. Diagram of the recQ replacement construct engineered depicting where primers bind
to upstream region of recQ gene, and the location within the spectinomycin/streptomycin drug
cassette. Image created with Vector NTI software.
Primers were made to amplify a 263bp portion of the drug cassette and a 237bp region
immediately upstream region of the recQ gene (Fig. 9). The amplified fragment is 500 base
pairs in length, and includes a portion of the drug cassette. These primers verified the presence
of the construct within the transformed genome, and verified that recombination took place in the
correct location.
1
2
3
4
5
6
7
8
Kb
1
0.5
Figure 10. Verification of recQ gene replacement by spectinomycin resistance drug cassette.
Lane 1 2-log DNA ladder (0.1-10kb), Lane 2, negative R1 control, Lane 3, SG5, Lane 4 SG2,
Lane 5, SG3 putative mutant strains, Lane 6, plasmid pino103-2 as positive control, Lane 7 no
DNA control
31
The gel depicted (Fig. 10), indicates ample amplification of an appropriately sized
fragment, and this band is only present in the putative mutant strains. Lane 3 was generated
from a strain designated SG5; the mutant strain used for all future studies of the ∆recQ mutant.
Amplification was specific for strains carrying the spectinomycin cassette. Strain R1 showed no
evidence of amplification (lane 2). A plasmid carrying the construct used to construct SG5
served as the positive control (lane 6).
To establish that the strain was homozygous for the ∆recQ allele, an attempt was made to
amplify recQ using primers that anneal upstream and downstream of the intact gene. The intact
recQ gene yields produce a 2,475 base pair fragment.
1
2
3
4
5
6
Kb
3
2
1
Figure 11. Gel does not verify that SG5 is homozygous recessive for ∆recQ allele. Lane 1 2log DNA ladder (0.1-10kb), Lane 2, positive R1 control, Lane 3, SG5, Lane 4 SG2, Lane 5 SG3
putative mutant strains, Lane 6 no DNA control
The results of this analysis (Fig. 11) were ambiguous and inconclusive. A band of
approximately 2500bp appeared in the putative mutant strain, but it could be the result of
nonspecific amplification; the strain R1 control (lane 2) contains several non-specific bands.
32
Repeated attempts were made to remove possible nonspecific banding pattern, however none
were successful, so the Southern blot technique was employed in an attempt to resolve the
ambiguity.
Primers RecQ1 and RecQ2 were used to amplify a 746 base pair region in the center of
the recQ gene to serve as a labeled probe. The probe detected the presence of the gene in the R1
strains for each separate digest, but there was no evidence of the gene in the strain SG5 as there
are no bands present in the SG5 lanes (Fig 12).
Ladder
R1 SG5 R1 SG5
Kb
5.6
4.1
Figure 12. Verification that SG5 is homozygous recessive for ∆recQ allele using Southern Blot.
Lane 1, Ladder, Lane 2, R1 genomic DNA digested by Kpn1, Lane 3, SG5 genomic DNA
digested by Kpn1, Lane 4, R1 genomic DNA digested by ClaI, Lane 5, SG5 genomic DNA
digested by ClaI
The first two lanes are R1 and SG5 strains digested with restriction endonuclease Kpn1
producing a 5.6Kb fragment surrounding the recQ gene. The last two lanes are R1 and SG5
strains digested with endonuclease ClaI, producing a 4.1Kb fragment surrounding the recQ gene.
The probe bound to the recQ gene within restriction fragments produced by KpnI and ClaI in
33
both of the lanes containing wild type strain R1 genomic DNA. The dark spots are the locations
where the radioactive labeled probe bound to the gene. The probe did not bind either digested
SG5 lanes, confirming that strain SG5 is a homozygous mutant lacking the gene.
•
The Role of RecQ in the DNA Damage Tolerance of Deinococcus radiodurans
(Ionizing Radiation)
SG5 was not sensitive to the effects of ionizing radiation. As indicated in Fig. 13, there is
no difference between R1 and SG5 mutant strain when the strains are exposed to ionizing
radiation. Apparently, the 3’ to 5’ helicase apparently is not necessary to repair damage incurred
by gamma ionizing radiation.
Figure 13. Ionizing radiation resistance of SG5. Each value is the mean of three experiments
four replicates per experiment n=12 for SG5. Each value is the mean of six experiments, four
replicates per experiment n=24 for R1 at 0Gy only
(Ultraviolet Light)
Ultraviolet light doses were administered to SG5 and compared to R1 to determine the
importance of RecQ helicase in repairing pyrimidine dimers. There is no difference in between
these strains viability the UV dose exceeds 1200J/m2 (Fig. 15).
34
Figure 14. UV radiation resistance of SG5. Each value is the mean of six experiments three
replicates per experiment n=18 for SG5. Each value is the mean of 9 experiments three
replicates per experiment n=27 for R1.
(Mitomycin C)
Mitomycin C was used to observe the effects of RecQ on repairing cross-linked DNA.
SG5 was challenged with constant exposure to mitomycin C at a concentration of 20µg/mL.
Exposure to cross-linking agents such as mitomycin C does not significantly decrease the
surviving fraction of the ∆recQ mutant as compared to R1 (Fig. 15).
35
Figure 15. Mitomycin C resistance of SG5. Each value is the mean of three experiments, three
replicates per experiment n=9
The last time interval measured approximately yields a 5-fold decrease in survival
compared to the wild type strain.
Hydrogen peroxide mediated damage was chosen to further characterize the role of the
helicase since it did not appear sensitive to any prior challenges. Lastly the single mutant was
exposed to the oxidizing agent hydrogen peroxide to determine the effects on survival. R1 and
SG5 strains were exposed to 20mM, 40mM and 60mM concentrations of hydrogen peroxide
constantly for one hour before cultures were serially diluted and plated on plain TGY media.
36
Figure 16. Hydrogen peroxide resistance of SG5.
R1 values are mean of 9 experiments 3 replicates per experiment for 0mM
R1 values are mean of 3 experiments, 3 replicates per experiment for 20-60mM concentrations
SG5 values are mean of 14 experiments, 3 replicates per experiment for 0mM
SG5 values are mean of 4 experiments for 20 and 60mM concentrations
SG5 values are mean of 3 experiments, 3 replicates each for 40mM concentration
After the first exposure, the surviving fraction of SG5 immediately decreases as
compared to R1. The largest difference in survival observed is a ten-fold decrease at both 40mM
and 60mM concentrations. At a concentration of 20mM hydrogen peroxide, there is statistically
significant difference found when comparing R1 to SG5 (unpaired student t-test,
p=0.0407191298, df=19). All other values have significance indicating that helicase RecQ is
important for repairing oxygen radical mediated DNA damage.
2.3 The Construction and Characterization of the ∆recQ, ∆uvrD Strain SG8-2
In order to determine whether there was a functional overlap between RecQ and UvrD
(helicase II); both of which are 3’ to 5’ helicases, a double mutant strain was constructed.
37
Genomic DNA was purified from CD571 a uvrD :TnDrCat, ∆uvrA strain created by Chris Davis
Guillot (unpublished data) and one µg of DNA from this strain was used to transform strain SG5
to a uvrD ::TnDrCat, ∆recQ strain. CD571 carries a 4,247 base pair Tn7-like transposon
inserted into the uvrD gene, rendering its gene product nonfunctional.
PCR amplification was used to verify the recQ disruption in the double mutant strains.
The primers used in the gel below were designed to amplify a 746 base pair portion in the center
of the recQ gene. The gel (Fig. 17) verifies the presence of the gene in R1.
Kb
1
2
3
4
5
6
7
3
1
0.7
Figure 17. Verification that putative mutant strains are homozygous recessive for ∆recQ allele.
Lane 1, 2-log DNA ladder (0.1-10kb), Lane 2, R1, Lane 3, CD571, Lane 4, SG8-1, Lane 5
SG8-2, Lane 6, SG8-7, Lane 7 no DNA control
Primers were designed to amplify a small 473 base pair portion near the center of the
uvrD gene, which surrounds the transposon insertion. The size of uvrD gene without an
insertion is 473 base pairs. If the gene is present in an uninterrupted copy, the primers should
amplify a 473 base pair portion; and if the transposon is present a 4,720 base pair region will be
amplified.
38
1
2
3
4
5
6
7
Kb
4
2
0.5
Figure 18. Verification of transposon insertion in putative mutant strains. Lane 1, 2-log DNA
ladder (0.1-10kb), Lane 2, R1, Lane 3, CD571, Lane 4, SG8-1, Lane 5, SG8-2, Lane 6, SG8-7,
Lane 7, no DNA control. Bright bands at bottom of gel are primer dimers.
The gel above (Fig. 18) shows evidence that the transposon insertion is present in
all mutant strains, including CD571 in lane 3, and the wild type portion of uvrD gene is found in
R1 (lane 2) but not the other strains. There are nonspecific amplification bands but they are very
faint and are identical to those exhibited in the original CD571 mutant strain while R1 displays
very high amplification of the 473 base pair product of the uvrD gene.
•
The Role of UvrD and RecQ in the DNA Damage Tolerance of Deinococcus
radiodurans
Once the strain was verified to be a ∆recQ, ∆uvrD double mutant, it was termed strain
SG8-2 and further studies were conducted to characterize the double mutant strain. The first
study conducted was the comparison ionizing radiation resistance of strain CD571 with strain
SG8-2, since the recQ gene has already been analyzed and determined to yield a radiation
resistant strain.
39
Figure 19. Ionizing radiation resistance of CD571, NS113 and SG8-2. Each value is the mean
of three experiments three replicates per experiment n=9
The highest dose applied to strain SG8-2 was 5,400Gy, and no further data was collected
beyond that dosage. Data from the other strains were collected by Chris Davis Guillot. Strain
CD571 and R1 have the same shoulder resistance from 0 to 1,000Gy absorbed dose, differing
from the double mutant strain. Strain NS113 (∆ uvrD), the single helicase mutant exhibits the
same resistance as R1, which is similar to ∆recQ and ∆recD mutants. The largest difference in
survival between strains NS113 and SG8-2 is a 7-fold decrease at 5,400Gy, indicating that there
is some overlapping activity between the RecQ and UvrD helicases.
40
Figure 20. UV radiation resistance of SG8-2 and CD571. Each value is the mean of at least 4
experiments three replicates per experiment n=9
Ultraviolet radiation survival was the next DNA mutagen examined. The single ∆recQ
mutant, strain SG5 is not sensitive to ultraviolet irradiation (Fig. 14). Overall, there are no
significant differences between R1 and SG8-2 when ultraviolet irradiation is applied (unpaired
student t-test, p= 0.7820207436, df=49).
Lastly, mitomycin C was used to observe the importance of genes uvrD and recQ in the
repair of intrastrand crosslinks. Differences were observed between the single mutant strain SG5
(Fig. 15) and strain CD571 versus the double mutant strain SG8-2 (Fig. 20). After 10 minutes of
exposure, there were no countable plates for strain SG8-2.
41
Figure 21. Mitomycin C resistance of CD571 and SG8-2. Each value is the mean of three
experiments, three replicates per experiment n=9.
CD571 and SG8-2 lack components of the UvrABC excision repair pathway which is
required for the repair of cross-linked DNA. As indicated, strains CD571, and SG8-2 are 100
fold more sensitive than R1 for both time exposures at 5 and 10 minutes, indicating that UvrD is
necessary for the repair of mitomycin C mediated damage. Strain SG8-2 is 1,500X more
sensitive after 5 minutes and is 1,200X more sensitive than R1 at 10 minutes. No growth was
detected on plates exposed after 10 minutes. These results are statistically significant (unpaired
student t-test, p=0.0000001242, df=16) indicating that both helicases are very important for
repairing cross-linked DNA.
2.4 Transformation Efficiencies Using ∆recD Strain SG4
Plasmid SG27 was generated for the purpose of deleting the gene recJ by gene
replacement, and subsequently to create a ∆recD ∆recJ double mutant strain. A
chloramphenicol drug cassette was inserted between the sequence corresponding to 1kb
42
upstream and downstream of the recJ gene of D. radiodurans R1. In order to verify the
construct, the plasmid was digested with endonucleases EcoRI and KpnI which excise a 1.8kb
upstream region fused to the chloramphenicol drug cassette, and EcoRI and PstI which excise the
1kb downstream region (Fig. 22).
Kb
1
2
3
4
5
6
7
8
9
10
11
13
14
15
16
17
18
19
20
21
22
2
12
1
Figure 22. Verification of construct present in all plasmid strains isolated.
Lanes 1 and 12 are 2-log DNA ladder (0.1-10kb), Lane 2, pSG21, Lane 3, pSG22, Lane 4,
pSG23, lane 5, pSG24, lane 6, pSG25, lane 7, pSG26, Lane 8, pSG27, Lane 9, pSG28, Lane 10,
pSG29, Lane 11, pSG30, Lanes 2-11 are putative plasmid constructs digested with EcoRI and
KpnI, Lane 12, 2-log DNA ladder (0.1-10kb), Lane 13, pSG21, Lane 14, pSG22, Lane 15,
pSG23, Lane 16, pSG24, Lane 17, pSG25, Lane 18, pSG26, Lane 19, pSG27, Lane 20, pSG28,
Lane 21, pSG29, Lane 22, pSG30, Lanes 13-22 are putative plasmid constructs digested with
EcoRI and PstI
The results (Fig. 22) indicate that all plasmids in lanes 2-11 have the upstream region and
chloramphenicol drug cassette. Lanes 13-22 have a band the size of the 1kb marker in the ladder
indicating that the 1kb downstream fragment is also present within the plasmid. All plasmids
have the proper construct present, including pSG27 which is used for all transformation
experiments.
43
When transformations were conducted to obtain ∆recJ single mutants and ∆recD, ∆recJ
double mutants, it appeared that ∆recD strain SG4 incorporated linearized DNA with greater
efficiency. Strains SG4 and R1 were grown under identical conditions in 10mL TGY until they
reached early-log phase (optical density of at least 0.1), and cultures were transformed with an
equivalent amount of linearized plasmid. Transformation of SG4 yielded between 68-98
chloramphenicol-resistant colonies when 30µL of undiluted culture was plated, whereas wild
type strain R1 only produced 4-5 colonies for the same amount, suggesting that protein RecD
was limiting transformation efficiency.
As in E. coli, it appears that the deletion of the recD gene in Deinococcus yields highly
transformable strains without the need for complicated chemical treatments (Russell et al., 1989;
Courcelle et al.). The transformation of linear and circular plasmids (pSG27) was positively
affected by removal of the recD gene (Table 7). On average there was an approximately sixteenfold increase in transformation efficiency in the mutant ∆recD strain when 500ng of DNA was
used in the transformation protocol.
Table 7. Increased efficiency of natural transformation in SG4 (recD). Values are the
average of 42 separate transformation experiments.
pSG27 DNA
Type
Circular
Linear
Strain
R1
Average Efficiency
25cfu/µg DNA
14cfu/µg DNA
Strain
SG4 (recD)
Average Efficiency
454 cfu/µg DNA
201 cfu/µg DNA
2.5 Results Summary
Protiens RecQ and RecD individually are not essential for ionizing radiation, ultraviolet
radiation, or mitomycin C resistance. Hydrogen peroxide yielded interesting results for strain
SG5 (∆recQ) indicating the 3’ to 5’ helicase may play an important role the repair of the
oxidative damage generated by this mutagen. Strain SG4 yielded interesting results when
44
transformation efficiencies were compared with wild type, and similar results were observed
with E. coli ∆recD mutants (Russell et al. 1989). Recombination rates greatly increased,
presumably due to the lack of exonuclease activity necessary to degrade foreign DNA due to the
anti-recombinational activity of protein RecD.
Both single and double ∆uvrD mutants are highly sensitive to mitomycin C. It is known
that a single uvrD mutant is insensitive to ultraviolet and ionizing radiation (Chris Davis Guillot,
unpublished data). Strain SG8-2 consistently has lower survival levels in most experiments
conducted. These mutants lack two 3’ to 5’ helicases, and are defective in RecFOR repair, base
excision repair (targets alkylation, and base mismatches), nucleotide excision repair (targets
cross-links, and pyrimidine dimers), and the mismatch repair system due to lack of both RecQ
and UvrD helicases. These mutants are more sensitive to all DNA damaging agents, and there is
a significant decrease in resistance, especially visible with mitomycin C and ionizing radiation
exposure.
2.6 Discussion
Removal of the uvrD and recQ genes in Deinococcus radiodurans resulted in a tenfold
decrease in survival. It is uncertain how these proteins fit into unique models of DNA repair. In
light of these results, it is thought that there must be other systems involved in DNA damage
repair. The results in the study presented indicate that ∆recQ strain SG5 is insensitive to ionizing
radiation, ultraviolet radiation, and mitomycin C exposure as there is little difference between the
mutant and wild type strain R1 survival in all trials. This could be due in part to a redundant
helicase functioning in the absence of helicase RecQ to unwind the strands for homologous
recombinational repair. RecQ 3’-5’ helicase functions in conjunction with RecFOR and RecJ
repair pathways. When RecQ helicase is removed from the complex, it is thought that another
3’-5’ helicase, UvrD may function in its place.
45
Recently, there have been two separate accounts describing the effect of different
mutagens on Deinococcus radiodurans.∆recD mutants with differing results. Insertional
mutagenesis was the technique used by both studies to inactivate the recD gene along with a
separate gene replacement (Servinsky and Julin 2007; Zhou et al., 2007). The results found by
Zhou and colleagues seem to parallel the results found in this study. The results found by
Servinsky and Julin contradict the results found in this study, indicating the mutant strain is
much more sensitive than the wild type strain.
In the first study a ∆recD mutant was created and compared to wild type strain R1 ATCC
13939 for its ability to survive exposure to various DNA damaging agents (Zhou et al., 2007).
The mutants were exposed to ionizing radiation and ultraviolet radiation. The results reported
coincide with the results stated previously in this thesis. The ∆recD mutant was insensitive to
exposure for neither damaging agent as compared to strain R1. Cells were exposed to ionizing
radiation at room temperature while cells were growing in exponential phase. Ultraviolet
irradiation was conducted after dilutions were plated onto TGY plates exposed to different doses.
The mutant strain was found to be only slightly more sensitive to ultraviolet light than the wild
type strain, again similar to the study in this thesis. The above two results from Zhou and
colleagues bolster the results presented in this paper, indicating that the role of protein RecD is
not necessary for ionizing radiation or UV resistance.
In contrast, the second study which compared the recD strain and BAA-816 provided
evidence that inactivation of this gene leads to ionizing radiation sensitivity, ultraviolet radiation
sensitivity, and no sensitivity to mitomycin C exposure (Servinsky and Julin, 2007). Since
ATCC13939 and BAA-816 are not the same genotype, it is plausible that unknown
polymorphisms found in these strains are responsible for the differences.
46
As reported previously (Servinsky and Julin, 2007), our ∆recD strain showed a increase
in transformation efficiency using a slightly different protocol, suggesting that RecD is involved
in the destruction of DNA as it enters the cells in a manner not unlike that described for RecD
function in E. coli.
An interesting finding by Lovett and Sutera identified two helicases that together function
to suppress a recombinational deficient ∆recJ mutant in Escherichia coli (Lovett and Sutera,
1995). This finding parallels the result found in Deinococcal ∆uvrD, ∆recQ mutants in that each
single mutant is not sufficient to confer sensitivity to mutagens. UvrD and HelD are both
helicases, which work in conjunction to prevent recombinational intermediates otherwise formed
in the absence of exonuclease RecJ. Neither helicase mutation is sufficient to restore
recombinational proficiency because the helicases either work together or have some
overlapping activity. UvrD in Deinococcus radiodurans is thought to have the same activities as
the identical protein in E. coli. Apparently UvrD in both E. coli and D. radiodurans contain
overlapping activities, and this finding may give some valuable insight into future mutational
analysis to pursue in D. radiodurans.
Strain SG5 was found to have sensitivity to hydrogen peroxide mediated damage which
causes oxidation of bases, abasic sites, DNA-DNA intrastrand adducts, strand breaks, and DNAprotein crosslinks (Cadet et al., 1999; Imlay and Linn, 1988). A ten fold decrease in survival is
observed for 40mM and 60mM exposures to hydrogen peroxide as compared to wild type.
Helicase RecQ is necessary for repairing hydroxyl radical mediated damage, and helcase UvrD
may not be an efficient replacement helicase for the type of damage incurred.
Helicase UvrD is involved in mismatch repair and nucleotide excision repair in
Deinococcus while helicase RecQ is involved in RecFOR mediated recombinational repair (Kim
et al., 2004; Makarova et al., 2001; Killoran and Keck, 2006). Both 3’-5’ helicases bind
47
specifically to free 3’ ends of a double strand break. These helicases are thought to function in
the place of each other when cells undergo DNA damage repair. Strain NS113 is a ∆uvrD strain,
and this strain was used as a control to compare the role of UvrD in repair with wild type strain
R1 (Chris Davis Guillot, unpublished), and the double helicase mutant strain SG8-2 after
exposure to ionizing radiation.
All helicase mutants show the same resistance as wild type, indicating that there must be
an alternative substitute helicase able to unwind DNA for repair. Strain NS113, SG4, and SG5,
all ∆uvrD, ∆recD, and ∆recQ helicase mutants, respectively must have other compensatory
helicases in the genome. Ionizing radiation experiments yielded interesting results in that the
deletion of both helicases in the double mutant strain SG8-2 appears to have a cumulative effect
on surviving fractions because due to a 7 fold decrease in the double mutant as compared to the
single mutant strains. ∆recQ strain SG5, and ∆uvrD strain, NS113 display no sensitivity to
ionizing radiation; while strain CD571 has the same shoulder dose as strain R1 up to 1,620Gy it
is at least 20 fold less sensitive than SG8-2. Strain SG8-2 drastically decreases after the first
dose while strain CD571 gradually decreases. The difference in survival in strain SG8-2 is due
to the lack of overlapping activity shared by both 3’-5’ helicases.
Exposure to ultraviolet light had a minimal effect on all three single and double mutants.
SG5, a ∆recQ mutant, displayed the least sensitivity to ultraviolet radiation as the surviving
fraction remained above wild type strain R1 for all doses. Helicase RecQ is not necessary for
repairing UV induced damage. Strain CD571 showed little sensitivity as the shoulder dose
paralleled strain R1 until a dose of 1,200J/m2 was reached. The results indicated that the ∆uvrD,
∆uvrA double mutant strain is not sensitive to ultraviolet radiation until high exposures are
reached, so some form of dimer repair is still functional. Strain SG8-2 displayed the lowest
surviving fraction, for most doses where the largest decrease in survival was a 5 fold difference
48
at 800 and 1,200J/m2. This indicates that both helicase deletions do have some effect on the
repair of UV mediated DNA lesions.
Exposure to mitomycin C revealed significant differences between both single helicase
mutant strains and the double helicase mutant strain. Strain SG5 was not sensitive to mitomycin
C as compared to the wild type strain, and the RecQ protein was not needed to repair crosslinked DNA. Strain CD571 was sensitive to the mutagen and displayed an immediate decrease
in survival after 5 minutes of exposure to 20µg/mL of mitomycin C. The uvrD and uvrA genes
have importance in maintaining the genome after exposure to mitomycin C. The double mutant
strain SG8-2 displayed an even greater decrease after a 5 minute exposure, suggesting a
synergistic effect due to the deletion of both helicases. Strain CD571 decreased 100 fold as
compared to R1 after 5 minutes, while strain SG8-2’s surviving fraction decreased 1,500 fold as
compared to the wild type strain R1. There was a 15 fold difference between strains CD571 and
SG8-2, and a 1,500 fold difference between strains SG5 and SG8-2 as the survival curve of SG5
closely paralleled the R1 curve. The difference in survival is due to the overlapping activities of
both helicases. Helicase RecQ may be able to function in the UvrABC nucleotide excision repair
pathway to unwind the damaged strand for repair, in addition to functioning in the RecFOR
homologous repair pathway. The UvrD helicase also may be able to function in both repair
pathways once the additional 3’-5’ helicase RecQ is rendered nonfunctional. It is uncertain how
these proteins fit into unique models of DNA repair. Further studies are needed to elucidate how
these two helicases function in the absence of the other.
49
REFERENCES
1.
Agostini, H. J., J. D. Carroll, and K. W. Minton. 1996. Identification and characterization
of uvrA, a DNA repair gene of Deinococcus radiodurans. J. Bacteriol 178:6759-6756.
2.
Ahn, B. 2000. A physical interaction of UvrD with nucleotide excision repair protein
UvrB. Mol. Cells 10:592-597.
3.
Amundsen, S. K., A. F. Taylor, and G. R. Smith. 2000. The RecD subunit of the
Escherichia coli RecBCD enzyme inhibits RecA loading, homologous recombination,and
DNA repair. Proc Natl Acad Sci 97:7399-7404.
4.
Anderson, D. G., J. J. Churchill, and S. C. Kowalczykowski. 1997. Chi-activated
RecBCD enzyme possesses 5’-3’ nucleolytic activity, but RecBC enzyme does not:
evidence suggesting that the alteration induced by Chi is not simply ejection of the RecD
subunit. Genes Cells 2:117-128.
5.
Anderson, A. W., H. C. Nordon, R. F. Cain, G. Parrish, and D. Duggan. 1956. Studies on
a radio-resistant micrococcus: Isolation, morphology, cultural characteristics, and
resistance to gamma radiation. Food Technol 10:575-578.
6.
Arnold, D. A., and S. Kowalczykowski. 2000. Facilitated loading of RecA protein is
essential to recombination by RecBCD enzyme. J Biol Chem 275:12261-12265.
7.
Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and
K. Struhl. 1988. Current Protocols in Molecular Biology. John Wiley & Sons, Inc., New
York.
8.
Battista, J. R. 1997. Against all odds: the survival strategies of Deinococcus radiodurans.
Annu Rev Microbiol 51:203-224.
9.
Battista, J. R., A. M. Earl, M-J. Park. 1999. Why is Deinococcus radiodurans so resistant
to ionizing radiation? Trends Microbiol 7:362-365.
10.
Battista, J. R., A. M. Earl, O. White. 2000. The stress responses of Deinococcus
radiodurans In: Bacterial Stress Responses, (Eds.) G. Storz and R. Hengge-Aronis, ASM
Press, Washington D. C. 383-391.
11.
Brooks, B. W., and R. G. E. Murray 1981. Nomenclature for "Micrococcus radiodurans"
and other radiation-resistant cocci: Deinococcaceae fam. nov. and Deinococcus gen.
nov., including five species. Int J Syst Bacteriol 31:353-360.
12.
Brooks, B. W., R. G. E. Murray, J. L. Johnson, E. Stackebrandt, C. R. Woese, and G. E.
Fox 1980. Red-Pigmented Micrococci: a Basis for Taxonomy. Int J Syst Bacteriol
30:627-646.
13.
Cadet, J., T. Delatour, T. Douki, D. Gasparutto, J-P. Pouget, J-L. Ravanat, and S.
Sauvaigo 1999. Hydroxyl radicals and DNA base damage. Mutat Res 242:9-21.
50
14.
Chen, H-W., B. Ruan, M. Yu, J-D Wang, D. A. Julin. 1997. The RecD subunit of the
RecBCD enzyme from Escherichia coli is a single-stranded DNA-dependent ATPase. J
Biol Chem 272:10072-10079.
15.
Courcelle, J., C. Carswell-Crumpton, and P. C. Hanawalt. 1997. recF and recR are
required for the resumption of replication ant DNA replication forks in Escherichia coli.
Proc Natl Acad Sci 94:3714-3719.
16.
Courcelle, J., D. J. Crowley, and P. C. Hanawalt. 1999. Recovery of DNA replication in
UV-irradiated Escherichia coli requires both excision repair and RecF protein function. J
Bacteriol 181:916-922.
17.
Courcelle, J., and P. C. Hanawalt. 1999. RecQ and RecJ process blocked replication forks
prior to the resumption of replication in UV-irradiated Escherichia coli. Mol Gen Genet
262:543-551.
18.
Cox, M. M., and J. R. Battista. 2005. Deinococcus radiodurans -- the consummate
survivor. Nature Rev Microbiol 3:882-892.
19.
Daly, M. J, E. K. Gaidamakova, V. Y. Matrosova, A. Vasilenko, M. Zhai, A.
Venkateswaran, M. Hess, M. V. Omelchenko, H. M. Kostandarithes, K. S. Makarova, L.
P. Wackett, J. K. Fredrickson, and D. Ghosal. 2004. Accumulation of Mn(II) in
Deinococcus radiodurans facilitates gamma-radiation resistance. Science 306:10251028.
20.
Daly, M. J., L. Ouyang, P. Fuchs, and K. Minton. 1994. In vivo damage and recAdependent repair of plasmid and chromosomal DNA in the radiation-resistant bacterium
Deinococcus radiodurans. J Bacteriol 176:3508-3517.
21.
Daly, M. J., and K. W. Minton. 1996. An alternative pathway of recombination of
chromosomal fragments precedes recA-dependent recombination in the Radioresistant
bacterium Deinococcus radiodurans. J Bacteriol 178:4461-4471.
22.
Daly, M. J., and K. W. Minton. 1997. Recombination between a resident plasmid and the
chromosome following irradiation of the Radioresistant bacterium Deinococcus
radiodurans. Gene 187:225-229.
23.
Dermic, D., D. Zahradka, and M. Petranovic. 2006. Exonuclease requirements for
recombination of a λ-Phage in recD mutants of Escherichia coli. Genetics 173:23992402.
24.
Dillingham, M. S., M. Spies, and S. C. Kowalczykowski. 2003. RecBCD enzyme is a
bipolar DNA helicase. Nature 423:893-897.
25.
Earl, A. M., S. K. Rankin, K-P. Kim, O. N. Lamendola, and J. R. Battista. 2002. Genetic
evidence that the uvsE gene product from Deinococcus radiodurans R1 is a UV damage
endonuclease. J Bacteriol 184:1003-1009.
51
26.
Franklin, W. A., P. W. Doetsch, and W. A. Hasteline. 1985. Structural determination of
the ultraviolet light-induced thymine-cytosine pyrimidine-pyrimidone (6-4)
photoproduct. Nucleic Acids Res 13:5317-5325.
27.
Franklin, W. A., and W. A. Hasteline. 1984. Removal of UV-light induced pyrimidinepyrimidone (6-4) products from Escherichia coli DNA requires uvrA, uvrB, and uvrC
gene products. Proc Natl Acad Sci 81:3821-3824.
28.
Friedberg, E. C., G. C. Walker, and W. Siede. 1995. DNA repair and mutagenesis. ASM
press, Washington DC.
29.
Haber, J. E. 2000. Partners and pathways repairing a double-strand break. Trends Genet.
16:259-264.
30.
Hansen, M. T. 1978. Multiplicity of genome equivalents in the radiation-resistant
bacterium Micrococcus radiodurans. J Bacteriol 134:71-75.
31.
Henle, E. S., and S. Linn. 1997. Formation, prevention, and repair of DNA damage by
iron/hydrogen peroxide. J Biol Chem 272:19095-19098.
32.
Hishada, T., Y-W. Han, T. Shibata, Y. Kubota, Y. Ishino, H. Iwasaki, and H. Shinagawa.
2004. Role of the Escherichia coli RecQ DNA helicase in SOS signaling and genome
stabilization at stalled replication forks. Genes & Dev 18:1886-1897.
33.
Ho, S. N., H. D. Hunt, R. M. Horton, J. K. Pullen, and L. R. Pease. 1989. Site-directed
mutagenesis by overlap extension using the polymerase chain reaction. Gene 77:51-59.
34.
Horton, R. M., H. D. Hunt, S. N. Ho, J. K. Pullen, and L. R. Pease. 1989. Engineering
hybrid genes without the use of restriction enzymes: gene splicing by overlap extension.
Gene 77:61-68.
35.
Howard-Flanders, P., and E. Bardwell. 1981. Effects of recB21, recF143, and uvrD152
on recombination in lambda bacteriophage-prophage and Hfr by F- crosses. J Bacteriol
148:739-743.
36.
Imlay, J. A., S. A. Chin, S. Linn. 1988. Toxic DNA damage by hydrogen peroxide
through the Fenton reaction in vivo and in vitro. Science 240:640-642.
37.
Imlay, J. A., and S. Linn. 1987. Mutagenesis and stress responses induced in Escherichia
coli by hydrogen peroxide. J Bacteriol 169:2967-2976.
38.
Imlay, J. A., and S. Linn. 1988. DNA damage and oxygen radical toxicity. Science
240:1302-1309.
39.
Ishino, Y., T. Nishino, and K. Morikawa. 2006. Mechanisms of maintaining genetic
stability by homologous recombination. Chem Rev 106:324-339.
52
40.
Ivancic-Bace, I., P. Peharec, S. Moslavac, N. Skrobot, E. Salaj-Smic, and K. BrcicKostic. 2003. RecFOR function is required for DNA repair and recombination in a RecA
loading-deficient recB mutant of Escherichia coli. Genetics 163:485-494.
41.
Ivancic-Bace, I., E. Salaj-Smic, and K. Brcic-Kostic. 2005. Effects of recJ, recQ, and
recFOR mutations on recombination in nuclease-deficient recB recD double mutants of
Escherichia coli. J Bacteriol 187:1350-1356.
42.
Iyer, R. R., A. Pluciennik, V. Burdett, P. L. Modrich. 2006. DNA Mismatch Repair:
functions and mechanisms. Chem Rev 106:302-323.
43.
Jolivet, E., F. Lecointe, G. Coste, K. Satoh, I. Narumi, A. Bailone, and S. Sommer. 2006.
Limited concentration of RecA delays DNA double-strand break repair in Deinococcus
radiodurans R1. Mol Microbiol 59:338-349.
44.
Jones, S. 2006. Deinococcus does the two-step. Nature 4:803.
45.
Killoran, M. P., and J. L. Keck. 2006. Three HRDC domains differentially modulate
Deinococcus radiodurans RecQ DNA helicase biochemical activity. J Biol Chem
281:12849-12857.
46.
Kim, J., and M. M. Cox. 2002. The RecA proteins of Deinococcus radiodurans and
Escherichia coli promote DNA strand exchange via inverse pathways. Proc Natl Acad
Sci U S A 99:7917-21.
47.
Kim, M., E. Wolff, T. Huang, L. Garibyan, A. M. Earl, J. R. Battista, and J. J. Miller.
2004. Developing a genetic system in Deinococcus radiodurans for analyzing mutations.
Genetics 166:661-668.
48.
Kitayama, S., S. Asaka, and K. Totsuka. 1983. DNA double-strand breakage and removal
of cross-links in Deinococcus radiodurans. J Bacteriol 155:1200-1207.
49.
Kitayama, S., I. Narumi, T. Funayama, and H. Watanabe. 2003. Cloning of structural
gene of Deinococcus radiodurans UV-endonuclase ß. Biosci. Biotechnol Biochem
67:613-616.
50.
Kowalczykowski, S. C. 2000. Initiation of genetic recombination and recombinationdependent replication. Trends Biochem Sci 25:156-165.
51.
Kowalczykowski, S. C, D. A. Dixon, A. Eggleston, S. Lauder, and W. Rehrauer. 1994.
Biochemistry of homologous recombination in Escherichia coli. Microbiol Rev 58:401465.
52.
Kuzminov, A., and F. W. Stahl. 1999. Double-strand end repair via the RecBC pathway
in Escherichia coli primes DNA replication. Genes Dev 13:345-356.
53.
Leiros, I., J. Timmins, D. R. Hall, and S. McSweeney. 2005. Crystal structure and DNAbinding analysis of RecO from Deinococcus radiodurans. EMBO 24:906-918.
53
54.
Li-fen, H., H. Xiao-ting, L. Hui-ming, G. Guan-jun, T. Bing, S. Bing-hui, and H. Yue-jin.
2006. Functional analysis of helicase and three tandem HRDC domains of RecQ in
Deinococcus radiodurans. J. Zhejiang Univ. Science 5:373-376.
55.
Lin, J., R. Qi, C. Aston, J. Jing, T. S. Anantharaman, B. Mishra, O. White, M. J. Daly, K.
W. Minton, J. C. Venter, and D. C. Schwartz. 1999. Whole-genome shotgun optical
mapping of Deinococcus radiodurans. Science 285:1558-1562.
56.
Lipton, M. S, L. Pasa-Tolic, G. A. Anderson, D. J. Anderson, D. L. Auberry, J. R.
Battista, M. J. Daly, J. Fredrickson, K. K. Hixson, H. Kostandarithes, C. Masselon, L. M.
Markillie, R. J. Moore, M. F. Romine, Y. Shen, E. Stritmatter, N. Tolic, H. R. Udseth, A.
Venkateswaran, K-K. Wong, R. Zhao, and R. D. Smith. 2002. Global Analysis of the
Deinococcus radiodurans proteome using accurate mass tags. Proc Natl Acad Sci U S A
99:11049-11054.
57.
Liu, Y-H., A-J Cheng, and T-C. V. Wang. 1998. Involvement of recF, recO and recR
genes in UV-radiation mutagenesis of Escherichia coli. J Bacteriol 180:1766-1770.
58.
Liu, Y-H., J. Zhou, M. V. Omelchenko, A. S. Beliaev, A. Venkateswaran, J. Stair, L. Wu,
D. K. Thompson, D. Xu, I. B. Rogozin, E. K. Gaidamakova, M. Zhai, K. S. Makarova, E.
V. Koonin, and M. J. Daly. 2003. Transcriptome dynamics of Deinococcus radiodurans
recovering from ionizing radiation. Proc Natl Acad Sci U S A 100:4191-4196.
59.
Lloyd, R. G., and C. Buckman. 1991. Overlapping functions of recD, recJ, and recN
provide evid of three epistatic groups of genes in Escherichia coli recombination and
DNA repair. Biochimie 73:313-320.
60.
Lovett, S. T., 2006. Resurrecting a broken genome. Nature 443:517-519.
61.
Lovett, S. T., and V. A. Sutera. 1995. Suppression of RecJ exonuclease mutants of
Escherichia coli by alterations in DNA Helicases II (uvrD) and IV (helD). Genetics
140:27-45.
62.
Makarova, K. S., L. Aravind, Y. I. Wolf, R. L. Tatusov, K. W. Minton, E. V. Koonin, M.
J. Daly. 2001. Genome of the extremely radiation-resistant bacterium Deinococcus
radiodurans viewed from the perspective of comparative genetics. Microbiol Mol Biol
Rev 65:44-79.
63.
Makharashvili, N., O. Koroleva, S. Bera, D. P. Grandgenett, and S. Korolev. 2004. A
novel structure of DNA repair protein RecO from Deinococcus radiodurans. Structure
12:1881-1889.
64.
Markillie, L. M., S. M. Varnum, P. Hradecky, and K-K Wong. 1999. Targeted
mutagenesis by duplication insertion in the Radioresistant bacterium Deinococcus
radiodurans: Radiation sensitivities of catalase (katA) and superoxide dismutase (sodA)
mutants. J Bacteriol 181:666-669.
54
65.
Masters, I. C, M. D. Smith, P. D. Gutman, and K. W. Minton. 1991. Heterozygosity and
instability of amplified chromosomal insertions in the Radioresistant bacterium
Deinococcus radiodurans. J Bacteriol 173:6110-6117.
66.
Matson, S. W., and A. B. Robertson. 2006. The UvrD helicase and its modulation by the
mismatch repair protein MutL. Nucleic Acids Res 34:4089-4097.
67.
Mattimore, V., and J. R. Battista. 1996. Radioresistance of Deinococcus radiodurans:
functions necessary to survive ionizing radiation are also necessary to survive prolonged
desiccation. J Bacteriol 178:633-637.
68.
McCann, D. 2006. Radiation poisoning: current concepts in the acute radiation syndrome.
Am J Clin Med 3:13-21.
69.
Menecier S., G. Coste, P. Servant, A. Bailone, and S. Sommer. 2004. Mismatch repair
ensures fidelity of replication and recombination in the Radioresistant organism
Deinococcus radiodurans. Mol Gen Genomics 272:460-469.
70.
Miesel, L., and J. R. Roth. 1996. Evidence that SbcB and RecF pathway functions
contribute to RecBCD-dependent transductional recombination. J Bacteriol 178:31463155.
71.
Minsky, A. 2003. Structural Aspects of DNA repair: the role of restricted diffusion. Mol
Microbiol 50:367-376.
72.
Minsky, A., E. Shimoni, and J. Englander. 2006. Ring-like nucleoids and DNA repair
through Error-free Nonhomologous end joining in Deinococcus radiodurans. J Bacteriol
188:6047-6051.
73.
Minton, K. W. 1994. DNA repair in the extremely Radioresistant bacterium Deinococcus
radiodurans. Mol Microbiol 13:9-15.
74.
Minton, K. W. 1996. Repair of ionizing-radiation damage in the radiation resistant
bacterium Deinococcus radiodurans. Mutat Res 363:1-7.
75.
Moolenaar, G. F., C. Moorman, and N. Goosen. 2000. Role of the Escherichia coli
nucleotide excision repair proteins in DNA replication. J Bacteriol 182:5706-5714.
76.
Morimatsu, K., and S. C. Kowalczykowski. 2003. RecFOR proteins load RecA protein
onto gapped DNA to accelerate DNA strand exchange: a universal step of
recombinational repair. Mol Cell 11:1337-1347.
77.
Moseley, B. E. B., and J. K. Setlow. 1968. Transformation in Micrococcus radiodurans
and the ultraviolet sensitivity of its transforming DNA. Biochemistry 61:176-183.
78.
Narumi, I., K. Cherdchu, S. Kitayama, and H. Watanabe. 1997. The Deinococcus
radiodurans uvrA gene: identification of mutation sites in two mitomycin-sensitive
55
strains and the first discovery of insertion sequence element from deinobacteria. Gene
198:115-126.
79.
Narumi, I., K. Satoh, S. Cui, T. Funayama, S. Kitayama, and H. Watanabe. 2004. PprA: a
novel protein from Deinococcus radiodurans that stimulates DNA ligation. Mol
Microbiol 54:278-285.
80.
Ohba, H., K. Satoh, T. Yanagisawa, and I. Narumi. 2005. The radiation responsive
promoter of the Deinococcus radiodurans pprA gene. Gene 363:133-141.
81.
Pan, S-S., T. Iracki, and N. Bachur. 1986. DNA alkylation by enzyme-activated
mitomycin C. Mol Pharmacol 29:622-628.
82.
Perkins, T. T., H-W. Li, R. V. Dalal, J. Gelles, and S. M. Block. 2004. Forward and
reverse motion of single RecBCD molecules on DNA. Biophys J 86:1640-1648.
83.
Rainey, F. A., K. Ray, M. Ferreira, B. Z. Gatz, M. F. Nobre, D. Bagaley, B. A. Rash, MJ. Park, A. M. Earl, N. C. Shank, A. M. Small, M. C. Henk, J. R. Battista, P. Kampfer,
and M. S. da Costa. 2005. Extensive diversity of ionizing radiation-resistant bacteria
recovered from a Sonoran Desert soil and the description of 9 new species of the genus
Deinococcus from a single soil sample. Appl Environ Microbiol 71:5225-5235.
84.
Runyon, G. T., D. G. Bear, and T. M. Lohman. 1990. Escherichia coli helicase II (UvrD)
protein initiates DNA unwinding at nicks and blunt ends. Proc Natl Acad Sci 87:683-687.
85.
Runyon, G. T., and T. M. Lohman. 1989. Eschericha coli helicase II (UvrD) protein can
completely unwind fully duplex linear and nicked circular DNA. J Biol Chem 29:1750217512.
86.
Russell, C. B., D. S. Thaler, and F. W. Dahlquist. 1989. Chromosomal transformation of
Escherichia coli recD strains with linearized plasmids. J Bacteriol 171:2609-2613.
87.
Servinsky, M., and D. Julin. 2007. Effect of a recD mutation on DNA damage resistance
and transformation in Deinococcus radiodurans. Bacteriol
88.
Sharma, M., Q-Y. He, and M. Tomasz. 1994. Effects of glutathione on alkylation and
cross-linking of DNA by mitomycin c. Isolation of a terenary glutathione-mitomycinDNA adduct. Chem Res Toxicol 7:401-407.
89.
Singleton, M. R., M. S. Dillingham, M. Gaudler, S. C. Kowalczykowski, and D. B.
Wigley. 2004. Crystal structure of RecBCD enzyme reveals a machine for processing
DNA breaks. Nature 432:187-193.
90.
Smith, M. D., E. Lennon, L. B. McNeil, and K. W. Minton. 1988. Duplication insertion
of drug resistance determinants in the radioresistant bacterium Deinococcus radiodurans.
J Bact 170:2126-2135.
56
91.
Smith, K. C., and K. D. Martignoni. 1976. Protection of Escherichia coli cells against the
lethal effects of ultraviolet and X irradiation by prior X irradiation: a genetic and
physiological study. Photochem Photobiol 24:515-523.
92.
Snyder, L., and W. Champness. 2003. Molecular Genetics of Bacteria. Second edition.
ASM Press, Washington DC.
93.
Spies, M., P. R. Blanco, M. S. Dillingham, N. Handa, R. J. Baskin, and S. C.
Kowalczykowski. 2003. A molecular throttle: the recombination hotspot χ Controls DNA
translocation by the RecBCD helicase. Cell 114:647-654.
94.
Stahl, F. W. 2005. Chi: a little sequence controls a big enzyme. Genetics 170:487-493.
95.
Tanaka, M., A. M. Earl, H. A. Howell, M-J. Park, J. A. Eisen, S. N. Peterson, and J. R.
Battista. 2004. Analysis of Deinococcus radiodurans' transcriptional response to
ionizing radiation and desiccation reveals novel proteins that contribute to extreme
radioresistance. Genetics 168:21-33
96.
Taylor, A. F., and G. R. Smith. 2003. RecBCD enzyme is a DNA helicase with fast and
slow motors of opposite polarity. Nature 423:889-893.
97.
Tigari, S., and B. E. B. Moseley. 1980. Transformation in Micrococcus radiodurans:
Measurement of various parameters and evidence for multiple, independently segregating
genomes per cell. J Gen Microbiol 119:287-296.
98.
Tomasz, M., A. K. Chawla, and R. Lipman. 1988. Mechanism of monofunctional and
bifunctional alkylation of DNA by mitomycin C. Biochemistry 27:3182-3187.
99.
Truglio J. J., D. L. Croteau, B. V. Houten, and C. Kisker. 2006. Prokaryotic nucleotide
excision repair: the UvrABC system. Chem Rev 106:233-252.
100.
Umezu, K., K. Nakayama, and H. Nakayama. 1990. Escherichia coli RecQ protein is a
DNA helicase. Proc Natl Acad Sci U S A 87:5363-5367.
101.
VanZile, J. 2004. Protecting yourself in a nuclear emergency. LEF
102.
Wang, J., and D. A. Julin. 2004. DNA helicase activity of the RecD protein from
Deinococcus radiodurans. J Biol Chem 279:52024-52032.
103.
Wang, P., and H. E. Schellhorn. 1995. Induction of resistance to hydrogen peroxide and
radiation in Deinococcus radiodurans. Can J Microbiol 41:170-176.
104.
Weissbach, A., and A. Lisio. 1964. Alkylation of nucleic acids by mitomycin C and
porfiromycin. Biochemistry 4:196-200.
105.
White, O., J. A. Eisen, J. F. Heidelberg, E. K. Hickey, J. D. Peterson, R. J. Dodson, D. H.
Haft, M. L. Gwinn, W. C. Nelson, D. L. Richardson, K. S. Moffat, H. Qin, L. Jiang, W.
Pamphile, M. Crosby, M. Shen, J. J. Vamathevan, P. Lam, L. McDonald, T. Utterback,
57
C. Zalewski, K. S. Makarova, L. Aravind, M. J. Daly, K. W. Minton, R. D. Fleischmann,
K. A. Ketchum, K. E. Nelson, S. Salzberg, H. O. Smith, J. C. Venter, and C. M. Fraser.
1999. Genome Sequence of the radioresistant bacterium Deinococcus radiodurans R1
Science 286:1571- 1577.
106.
Witkin, E. M. 1976. Ultraviolet mutagenesis and inducible DNA repair in Escherichia
coli. Bacteriol Rev 40:869-907.
107.
Zahradka, K., D. Slade, A. Bailone, S. Sommer, D. Averbeck, M. Petranovic, A. B.
Linder, and M. Radman. 2006. Reassembly of shattered chromosomes in Deinococcus
radiodurans. Nature 443:569-573.
108.
Zhang, G., E. Deng, L. Baugh, S. R. Kushner 1998. Identification and characterization of
Eschericha coli DNA helicase II mutants that exhibit increased unwinding efficiency. J
Bacteriol 180:337-387.
109.
Zhang, X-D., S-X. Dou, P. Xie, J-S. Hu, P-Y. Wang and X. G. Xi. 2006. Escherichia coli
RecQ is a rapid, efficient, and monomeric helicase. J Biol Chem 281:12655-12663.
110.
Zhou, Q., X. Zhang, H. Xu, B. Xu, and Y. Hua. 2007. A new role of Deinococcus
radiodurans RecD in antioxidant pathway. FEMS Microbiol Lett 271:118-125.
111.
Zimmerman, J. M., and J. R. Battista. 2006. Measuring survival in microbial populations
following exposure to ionizing radiation. Methods in Microbiology 35: 729-736.
58
VITA
Stephannie Gauthier Ruiz was born in April 1982 in Lafayette, Louisiana. She attended
Saint Thomas More high school. Influenced by her mother’s interest in chemistry and
microbiology, she majored in microbiology. Stephannie graduated from the University of
Louisiana at Lafayette in 2004 with a bachelor of science in microbiology. She began her
studies at Louisiana State University in July of 2005.
59