Download The Role of Amino-Terminal Residues of the Heavy

From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
The Role of Amino-Terminal Residues of the Heavy Chain of Factor IXa in
the Binding of Its Cofactor, Factor VIIIa
By Nobuko Hamaguchi, S. Paul Bajaj, Kenneth J. Smith, and Darrel W. Stafford
The purpose ofthis study isto determine which residues of
the factor IXa heavy chain areimportant for interactionwith
the cofactor of factor IXa, factor Vllla. Because the monoclonal antibody(MoAb) FXCOO8 inhibitsinteractionbetween
factors IXa and Vllla, and becauseit also reactswith residues
181-310 ofthe factor IXa heavy chain,we usedthe computermodelled structure of the factor IXa heavy chain to select
charged surface residues
likely to interact with FXCOOZ)and/
or factor Vllla.We made mutations in the region of residues
181-310 of the heavy chain of factor IX, and replaced these
amino acids individuallywith those located at the same position in factor X. The mutated factor IX retained complete
clotting activity and thus interacted normally with factor
Vllla. Five mutant proteins (factorIXW,W,factor IX-,
factor IXE2400, factor lXIUIIV, and factor IX-1
reacted with
heavy chain-specificMoAbr FXCOO8 and A-5.Neither factor
l&2,M norfactorIXWm bound to FXCOO8. Factor
had
reduced affinity to FXCOOZ). Our results suggestthe following: (1) factor IXa residues 214,228,240,247,248,252,260,
and 276 are not involved in specific interaction with factor
Vllla; and (2) the FXCOO8 and factor Vllla binding sitesmay
not share critical residues.
0 1994 by The American Society of Hematology.
F
recombinant techniques, we made FIXs with various amino
acid substitutions in the heavy chain region.
Because intermolecular interactions commonly involve
solvent-accessible surface regions, the water-accessible surface area of each residue of FIX was calculated from the
computer model of the catalytic domain of FIXa based on
trypsin x-raystructure. These calculations were used to select
candidates for the critical residues for FXC008binding. Even
though a large part of the intermolecular binding energy
is from hydrophobic interactions, the complementarity of
hydrophobic interactions is relatively inducible, and the
specificity of intermolecular interaction is mainly achieved
by hydrogen bondelectrostatic interactions. Thus to decrease
the affinity of two proteins for each other, it is reasonable
to alter the electrostatic properties of the surface residues.
Based on the structural model of the heavy chain of FIXa,
seven charged surface residues between amino acids 181 and
310 were selected for creating mutant proteins. In addition,
residue 260 was mutated because this residue is located on
the surface, and a naturally occurring mutation at this position is known to cause hemophilia B.’ To minimize structural
distortion in the mutant molecules, FIX residues were individually replaced by FX residues from the homologous position. The mutant molecules were characterized by MoAb
binding and characterized for functional properties.
ACTOR (F)IX is the precursor of the protease FIXa
required for blood coagulation. People with defective
FIX molecules suffer from hemophilia B, an X-linked hereditary bleeding disorder.’ The structural organization of FIX is
similar to the other vitamin K-dependent blood coagulation
proteins including FX and FVII. The light chain of FIXa
contains the N-terminal 145 amino acids of FIX. It consists
of the y-carboxyglutamic acid (Gla) domain, necessary for
binding to negatively charged phospholipid membranes and
to endothelial cells,’ the hydrophobic domain, and the two
epidermal growth factor-like (EGF) domains. The EGF domains have been suggested to be parts of the FVIIIa binding
site.3 Sequence analysis of several species has shown that
the activation peptide (residues 146-180), which is released
on conversion of FIX to FIXa, is the least conserved region
among the vitamin K-dependent zymogens. The heavy
chain (residues 181-415) of FIXa contains the active site
triad of histidine 221, aspartic acid 269, and serine 365. The
amino acid sequence of the catalytic domain of FIXa is
highly homologous to other serine proteases such as trypsin,
chymotrypsin, and thrombin.
Approximately 70% of the point mutations in FIX that
cause hemophilia B are found in the heavy chain region of
the m01ecule.~Some mutations directly affect FIX function,
whereas others may affect the structural stability of the molecule. Possible mechanisms of the functional defects can be
divided into three classes: (1) defects in the proteolytic activity; (2) defects in the substrate (FX) and cofactor (calcium,
FVIIIa, and platelets) recognition sites; and (3) defects in
the activation by FXIa and the FVIIa-tissue factor complex.
The anti-FIX monoclonal antibody (MoAb) FXC008 has
been reported to interfere with the binding of FIXa to F V I Ea.’ FXC008 binds to an immunodominant site in the heavy
chain of FIXa between residues 181 and 310.6 These results
led to the suggestion that the FVIIIa binding site may reside
between residues 181 and 310 of FIXa. Because the affinity
of FIXa for FVIIIa in the absence of a surface membrane is
known to be weak (kd of 1 pmol/L), and because activated
FVIIIa is very unstable, it has been difficult to measure the
binding between these two macromolecules. Thus, we chose
an alternative approach to investigate FIXalFVIIIa interactions by further defining the epitope of FXC008 in the heavy
chain and determining if the same residues are involved
in FVIIIa recognition by FIXa. To accomplish this using
-
Blood, Vol 84, No 6 (September 15). 1994: pp 1837-1842
From the Department of Biochemistry, Duke University Medical
Center, Durham, NC; the Departments of Medicine and Pathology,
University of New Mexico School of Medicine and United Blood
Services, Albuquerque, NM; the Department of Biochemistry, St
Louis University, St Louis, MO; and the Department of Biology and
Center for Thrombosis and Hemostasis, University of North Carolina at Chapel Hill, NC.
Submitted January 19, 1994; accepted May 6, 1994.
Supported by National Institutes of Health Grant No. R01
HL38973, and by a grant from Blood Systems Research Foundation,
Scottsdale, AZ.
Address reprint requests to Darrel W. Stafford, PhD, Department
of Biology and Center for Thrombosis and Hemostasis, University
of North Carolina at Chapel Hill, Chapel Hill, NC 27599-3280.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
“advertisement” in accordance with 18 U.S.C. section 1734 solely to
indicate this fact.
0 1994 by The American Society of Hematology.
0006-497I/94/84W-Oll5$3.00/0
1837
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
1838
HAMAGUCHI ET AL
Table 1. Oligonucleotides Used for In Vitro Mutagenesis
Position
214
228
240
247
248
252
260
276
Mutation
K-F
K-R
E-.Q
K-V
R-H
R-V
N-T
D-K
Oligonucleotide (5'
-
3')
CGlTAATGAAlTCGTGAlTGTAAC
GAAACTGGTGTACGTAlTACAGlTGTC
CATAATATTGAGCAGACAGAGCACACAGAGCAMAG
ACAGAGGAAGlTCGAAATGTG
GAGCAAAAGCATAACGTGATTCGA
CGAAATGTGAlTGTAATCATCCCTCACCACAAC
CACAACTACCACAGCTGCTATTAATAAG
GCCCTTCTGGAGCTCAAAGAAACCCTTAGTG
based on the bovine thrombin x-ray crystallographic
structure and
energy-minimized using Amber version 3.1 (Department of Pharmacy, University of California, San Francisco) with explicit solvent
using periodic boundary condition. The solvent-accessible surface
area was calculated using the Determination of Secondary Structure
of Protein (DSSP) program (Brookhaven National Laboratory,Upton, NY).I3
RESULTS AND DISCUSSION
Selection of the charged sugace residues
in factor 1x for
the
study
o
f
factor
VIIIa
binding.
The
purpose
of this study
MATERIALS AND METHODS
wastodeterminewhether
the binding of FIX to M I I I a
The oligonucleotides
used for in vitro mutagenesis were purchaseddepends on the LlX-specific residues required for binding
fromOligo(Wilsonville, OH) (Table 1). Theseoligonucleotides
FIX to MoAb FXCOO8. The alignment of the amino acid
(except for an oligonucleotide mutation at residue 247) were also
designed to createnew restriction enzyme recognition sites; EcoRI, sequence of the catalytic domain of FIXa and other related
serine proteases was based on published topologic similariSnaBI,HgiAl,MaeII, FokI, PvuIIorSacI. 'l7 DNApolymerase
ties between residuesin thrombin and ~hymotrypsin.'~ There
(Sequenase),polynucleotidekinase,andT4 DNA ligase were obare 25 charged residues between residues 181-310. These
tained from Bethesda Research Laboratory (Bethesda, MD), New
residues are likely to be on the surfaceof the molecule
England Biolabs (Beverly, MA), and Boehringer Mannheim (Chirespectively. [12SI]Protein
A, [12sI]Na, and [%]dATP were and are thereforepotentially involvedinmacromolecular
cago, L),
L),
Afpurchased from Amersham Corporation (Arlington Heights,
interactions. Based on the high homology among enzymes
fiPrep 10 was obtained from Bio-Rad (Richmond, CA), Iodobeads
and cofactors in coagulation factors,
it is verylikely that
fromPierce(Rockford,IL),andGeneticin(G418)fromGibco
these factors interact in a similar manner and that a few
(Grand Island, NY). FIX was purified from pooled plasma as despecific interactions between correct partners such as FIXascribed previously.8 FIX-deficient plasma was purchased from Sigma
FVIIIa
and F X a - M a are responsible for the recognition. At
(St Louis, MO). All other reagents were of the highest purity comthe same time, these interactions are conserved among spemercially available.
cies (cow, mouse) because the clotting time of human FIXThe anti-human FIX MoAbs used in this study are: A-l, A-5, A7, and FXC008. The amino acid sequences of human FIX recognized deficient plasma can becorrected by FIX from otherspecies.
by these antibodies are:A-l in residues 147-153 (activation peptide), As candidates of residues involved in FIXa-specific interacand A-5 and FXC00S in residues 181-310 (the heavy chain). A-7 is
tion with FVIIIa, the following charged residues were omita calcium-dependent conformation specific antibody that recognizes ted in this study because they are either identical in FIX
amino acids 1-42 (the Gla domain).
and FX or not conserved among species: aspartic acid 186
In vitromutagenesis and construction of expressionplasmids.
(asparagine in mouse), lysine 188 (glutamic acid in cow),
Site-directed mutagenesis was performed as described by Kunkel.'
mouse), glutamicacid 213,
lysine 201 (glutamicacidin
Each mutated cDNA was sequenced by the dideoxy-chain terminaglutamic
acid
239
(aspartic
acid
in mouse), glutamic acid
tion method," and mutated cDNA was inserted
into pCMV4 vector."
242,
and
aspartic
acid
269.
Production of recombinant FIX. Humanembryokidney293
The computer modelof the catalytic domainof FIXa was
cells were grown in a mixture of Dulbecco's modified Eagle's meused topredictthe
water-accessible surfacearea of the
diumand F-l2 medium (1:l) supplementedwith10%fetalcalf
~ r 0 g r a m . I(Fig
~ 1). The
serum. pCMV4 FIX expression vectors were co-transfected into cellscharged residues using the DSSP
with pSV2neo (selection marker plasmid) using the calcium-phosresults indicate that residues235 and 274, which are respecphate co-precipitation method. Selectionof cells for production and
tively equivalent to 70 and 107 in p p s i n , have low waterpurificationofrecombinant FIxs fromculturemediumwaspreaccessible surface areas (16 and 35 A', respectively). This reviously described.12Stable cell lines expressing each
of the different
sult is consistent with thex-ray crystallographic structure of
recombinant FIX moleculesproducedseveralhundredpg/L/din
trypsin (Brookhaven Protein Data Base, PDB2TPT, 11 and
roller bottles. Recombinant FIXs were purified from culture media
36 A' for residues 70 and 107, respectively). Thus the data
throughanA-7MoAbcolumn,concentratedusing
Centriprep 30
on water accessibility suggest that residues
235 and 274 were
(Amicon,Danvers,MA),anddialyzedagainstTBS
(10 m m o E
not
directly
involved
in
binding
to
other
macromolecules.
Tris, 150 m m o E NaCl, pH 7.2) overnight.
The epitopeof FXCOO8, reported to inhibitM I I I a binding
of
Iodination of protein and radioimmunoassay.Iodination
to FIXa, requires at least 130 residues for mapping.6 This
MoAb and radioimmunoassays (RIA) performed by the sandwich
method have been described previously.12 Either A-5,A-l, or FXCsuggests thatthe epitope for this MoAb is discontinuous
and/
008 MoAb was used to coat the wells and 1251-labeled A-7 MoAb
or requiresspecific internal residues to support
the structure.
was used to detect the bound FIX antigen level in each well.
Based on this assumption, we eliminated residues185,224,
Clottingassay.One-stageactivatedpartialthromboplastintime
265, and 301 as primary candidates for mutation because
(m)
assays were performed according to the manufacturer's inthese residues are located at the edge of the surface constructions (Organon Teknika, Durham, NC). The abilityof the protaining the epitope (residues 181-310, shown in white in Fig
teins to correct the clotting time
of FIX-deficient plasma was calcu2A).
lated from a standard curve derived from pooled normal plasma.
There are a number of point mutations in the catalytic
Molecular modeling. The original model for factor IX was dedomain of FIX that cause hemophilia B. The majority of
veloped from the x-ray crystallographic coordinatesof bovine panknown mutations are internal, nonpolar residues such asalacreatic trypsin as described previously." The structure
was modified
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
IX HEAW CHAIN IMMUNODOMINANT SITES
200
1839
I
I
too
0
residue number
Water-accsdble s
u
h
c
e area of s e l e c t e d residua in the catalytic domain of FIXa. The water-accsdble surface orear
r a i d u r within fint 130 residua of tho catrrlytk domain calculated uringDSSP."
nine 220 to valine," and alanine 233 to threonine,I6 and
seem likely to destabilize the molecule. However, some defective FIXs seem to have a point mutation on the surface;
for example, asparagine to serine at 260 and threonine to
methionine at 296. The antigen level of FIX with a point
mutation at residue 296 is reported to be less than 10%of
normal. Thus, mutations at this position probably affect the
overall stability of the molecule. The plasma antigen level
of defective FIX with a mutation at 260 has not been reported7; it was therefore included in this study.
Finally, based on the above considerations, residues at
214,228,240, 247,248,252,260,and 276 were exchanged
for residues found at the equivalent positions in FX (shown
in purple in Fig 2A). Each mutation in the FIX cDNA was
accomplished by in vitro mutagenesis using the oligonucleotides listed in Table 1.
Clotting activity and reactivity with MoAb of mutatedfactor Ixs. The results of the clotting assay and RIA are shown
in Table 2. F I X D 2 7 6 K bound 15% as well as plasma FIX to
MoAb A-5. The same assay using FXC008 failed to detect
binding Of m D ' 2 7 6 K and F I X R X ~ ~F .I X ~ 2 5 2 vhad reduced affinity for FXC008.Our results with F I X R X s H are similar to
those obtained with the m m 4 8 9 mutant with respect to
MoAb FXC008 binding.I7 Overall, the results indicate that
the epitopes of A-5 and FXCOO8 overlap, but are not identical. In the computer model, residues 248, 252, and 276 are
linearly arranged with residue 276 in the center. The distances between alpha carbonsoof residue 276 and residues
248 and 252 are 6.4, and 8.6 A, respectively (Fig 2B). Be-
of charaed
-
cause these residues are located in the center of the surface
defined by residues 181-310 of the catalytic domain, they
must be part of the epitopes for several known MoAbs such
as A-4, A-5, CD10, and FXC008.6
However, in the one stage ap?T assay, mmgH,
FIXRzszv,
and m D 2 7 6 K retained normal activity. After preincubation
had
prowith excess FXC008, normal FIX and
longed clotting time, whereas the clotting times of F I X m H
and
were unaffected by the presence of FXC008.
This result is consistent with the results from FUA.
If any of the charged residues that were changed made
contact with FVIIIa, then a change of at least 3 kcal per mole
in binding energy would be expected." The concentration of
M I I I in plasma is estimated to be about 0.5 nmoyL. This
concentration is close to the dissociation constant estimated
for IXa-VIIIa in the presence of phospholipid membrane^.'^
It was shown with a chimera molecule (m)
that a slightly
reduced (15-fold) affinity to M a of this chimera resulted in
significantly reduced FXa physiologic activity in the presence of membrane.20 Therefore the changes that affect the
FIXa specific interaction with MIIIa should dramatically
affect the FIXa procoagulant activity. Because no activity
was lost, we can conclude that these residues have no critical
direct role in binding FVIIIa.
The interaction of an antibody with a prottin antigen
might involve surface areas witha25 to 30 A diameter
containing 13 to 16 residues on each molecule." Accordingly, the binding site for FXC008 must interface with residues other than these three residues. Mutated residues 214
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
HAMAGUCHI ET AL
1840
L-
-
Fig 2. FlXa computer model showing residues relevant to this
study. (A) The relative positions of the active site, the binding site
for EGF2 (based on the FXa structure)," and the surface residues
constituting part of the FXCOO8 MoAb binding site. The backbone
ribbon ofresidues 181-310 is shownin blue, and thatof residues 311415 in green. Residues, including side chains, of the catalytic triad
are shown in red. Side chains of residues likely t o contact the EGF2like domain are depicted in green at the bottomof the figure. The
side chains of residues subjected t o in vitro mutagenesis are shown
in purple. Residues that differ between FIX and FX, but that were
omitted from this studybecause of their positions, are depicted in
white. (B) A side view of Fig 2A. The backbone ribbon of residues
181-310 is blue, and thatof residues 311-415 is yellow. Mutatedresidues are shown in purple. Residues in the catalytic triadare in red.
A calcium ion in the putativecalcium binding loop is shown
in green
between glutamic acid residues 235 and 245 (in yellow).
and 228 are located close to resjdue 276 with inter-alpha
carbon distances of 7.7 and 11.7 A, respectively. These residues are linearly arranged with residue 276 in the center, and
perpendicular to residues 248 and 252 (Fig 2B). Mutations at
214 and 228 had no effect on clotting activity or binding to
FXC008. These results imply that charged residues 248,252,
and 276 play a key role in binding to MoAb FXC008 and
that the epitope consists of discontinuous sequences. Bajaj
et al showed that a synthetic peptide corresponding to FIX
residues 231-265 binds MoAb FXC008 with 5Clo-fold reduced affinity." The reduced affinity may be caused by the
peptide missing a part of the epitope containing residue 276
and adjacent residues.
Wildgoose et al reported that a peptide containing the
sequence corresponding to residues 195-206 of FVII inhibits
the interaction between FVII and tissue factor.z3This region
is equivalent to residues 223-231 in FIX and is close to
histidine in the catalytic triad of FVII and FIX. In the x-ray
crystallographic structure of thrombin, this region is found
to have a 10-amino acid insertion compared with chymotrypsin and forms a loop structure protruding into the active
site cleft. This presumably affects the substrate and inhibitor
~pecificity.'~
If this region of FIX were responsible for substrate specificity, it would presumably not be involved in
the FVIIIa binding site because it would compete with the
substrate. The mutation in the center of this region in FIX,
lysine to arginine at position 228, did not affect its clotting
activity. Furthermore, the sequence of residues 223-228 of
FIX is not conserved among different ~pecies.2~
These data
imply that residues 223-23 1 may not be directly involved in
FIX specific functions.
and F I X N z m had reduced affinity for the MoAb
A-l, whose epitope was mapped to residues 147-153 of the
activation peptide: These mutants had approximately 50%
and 80% affinity for A-l, respectively, compared with A-5.
This suggests that residues 214 and 260 may be located
topologically close to the activation peptide. It would be
interesting to know how the activation peptide connects the
light chain and the heavy chain. This would aid in understanding the domain construction of FIX, the structural importance of the activation peptide, and the activation process.
Among the residues changed from FIX to FX in this study,
residues 248, 252, and 260 are found at positions known to
cause hemophilia B. Several hemophilia B patients have
arginine 248 substituted by glutamine at residue 248.15.17.z5
In our study, arginine 248 was changed to histidine, the
Table 2. Clotting Activity and Antigenicity of
FlXs With Mutations
in an lmmunodominant S i e in the Catalytic Domain
FXCOOB and
and
A-l
Mutants
K214F
K228R
E240Q
K247V
R248H
R252V
N260T
D276K
A-7*
(%)
52 2 2
95 ? 10
902 3
90 ? 6
89 2 4
94 t 1
79 2 3
92 ? 5
A-5 and A-7t
(%)
97 ? 1
95 ? 5
98 ? 2
91 ? 2
93 ? 1
95 2 1
90 2 8
13 ? 3
a P T Assay
(%)
1%)
-100
-100
-100
90 2 4
85 2 5
94 ? 5
90 5 8
86 2 4
94 ? 5
95 ? 3
92 2 4
-100
ND
-20
-100
ND
Antigenicities are shown as relative to plasma-purified FIX; normal
in aPlTassay indicates 80% to 100% of plasma-purified FIX.
Abbreviation: ND, not detected.
The wells were coated with A-l MoAb and '251-labeled A-7MoAb
was used as a second antibody.
t The wells were coated with A-5 MoAb and '251-labeled A-7MoAb
was used as a second antibody.
+The wells were coated with FXCOO8 MoAb and '251-labeled A-7
MoAb was used as a second antibody. The data were obtained from
a single experiment; however, similar results were obtained from
Western blotting with FXCOO8as an antibody.
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
FACTOR IX HEAW CHAIN IMMUNODOMINANT SITES
residue found in FX at the equivalent position. This change
had no effect on the procoagulant activity, indicating that
this residue has no specific Fu( function. This observation
agrees with that of Ludwig et al, who found that purified
FIX from a patient with glutamine at 248 had 41% normal
activity.I7 The mutation at 252 found in a patient was arginine to leucine: whereas the substitution in our study is
valine. Another mutation at 260 found in patients was asparagine to serine7; the substitution in the present study is to
threonine. The antigen level of FIX in patients with mutations at 252 or 260 has not been reported. Because our results
indicate that these residues are not critical for the clotting
activity, these naturally occumng mutations may cause the
defect by affecting the half-life in circulation of the molecule. Alternatively, the known mutations may cause a global
conformational change rendering its physiologic function inactive.
It has been shown that platelet binding of a FIX mutant
with its second EGF domain changed to that of FX, is enhanced by FVIIIa.26This indicates that the FIX molecule
with the second EGF domain from FX still recognizes FVIIIa. Thus, the second EGF domain may not be solely responsible for the binding to FVIIIa. This leads to the previously
proposed hypothesis that the heavy chain and the light chain
share the FVIIIa binding site.3 Inthis case, it is possible that
the immunodominant site of the catalytic domain of FIXa
contributes to the binding of FVIIIa, but that the residues in
FX can be substituted without changing the FVIIIa binding
capability.
The other possible explanation is that the binding of FXC008 has an allosteric effect on other parts of the surface that
involve the FVIIIa binding. It is known that allosteric effects
from binding between macromolecules can be shown as far
away as 20 A.” Because the activation of FIX is required
before its binding to FVIIIa, the part of the catalytic domain
that becomes solvent accessible on the release of the activation peptide may play acritical role in the binding to FVIIIa.
In this case, the binding of FXC008 may be disrupting the
normal conformational changes that occur in other parts of
the heavy chain surface after activation.
Three residues (R248, R252, D276) that are found to be
responsible for FXC008 binding are also found in mouse
FIX.27Nonetheless, mouse FIX does not react with MoAb
FXC008. This means that there are other crucial structural
determinants in human FIX that play a substantial role in
binding to the MoAb. The additional determinants for MoAb
FXC008 may be shared in part by the FVIIIa binding region.
It will be necessary to take several different approaches to
thoroughly understand the interaction between FIXa and
FVIIIa.
ACKNOWLEDGMENT
We would like to thank Dr Paul Charifson for help in molecular
modeling and Dr David Straight and Byron Woods for reviewing
the manuscript.
REFERENCES
1. Mann KG, Neshiem ME, Church WR, Haley P, Krishnaswamy
S: Surface-dependent reactions of the vitamin K-dependent enzyme
complexes. Blood 76:1, 1990
1841
2. Cheung W, Hamaguchi N. Smith KJ, Stafford DW: The binding of human factor M to endothelial cells is mediated by residues
3-11. J Biol Chem 267:20529, 1992
3. Astermark A, Stenflo J: The epidermal growth factor-like domains of factor IX. J Biol Chem 266:2438, 1991
4. Ginnelli F, Green PM, High KA, Sommer S, Lillicrap DP,
Ludwig M, Olek K, Reitsma PH, Goossens M, Yoshioka A,
Brownlee GG: Haemophilia B: Database of point mutations and
short additions and deletions, ed 4, 1993. Nucleic Acids Res 21:3075,
1993
5. Bajaj P, Rapaport SI, Maki SL: A monoclonal antibody to
factor M that inhibits the factor VII1:Ca potentation of factor X
activation. J Biol Chem 26011574, 1985
6. Frazier D, Smith K, Cheung W, Ware J, Lin S, Thompson A,
Reisner H, Bajaj P, Stafford D: Mapping of monoclonal antibodies
to human factor M.Blood 74:971, 1989
7. Koeberl DD, Bottema CDK, Buerstedde JM, Sommer SS:
Functionally important regions of the factor IX gene have a low rate
of polymorphism and a high rate of mutations in the dinucleotide
CpG. Am J Hum Genet 45448, 1989
8. Smith KJ, Ono K: Monoclonal antibodies to factor IX: Characterization and use in immunoassays for factor IX. Thromb Res
33:211, 1984
9. Kunkel TA: Rapid and efficient site-specific mutagenesis without phenotypic selection. Proc Natl Acad Sci USA 82:488, 1985
10. Tabor S , Richardson CC: DNA sequence analysis with a modified bacteriophage T7 DNA polymerase. Proc Natl Acad Sci USA
84:4767, 1987
11. Anderson S, Davis DL, Dahlback H, Jornvall H, Russell
DW: Cloning, structure and expression of the mitochondrial cytochrome P-450 sterol 26-hydroxylase, a bile acid biosynthetic enzyme. J Biol Chem 264:8222, 1989
12. Hamaguchi N, Charifson PS, Pedersen LG, Brayer GD, Smith
JK, Stafford DW: Expression and characterization of human factor
IX. J Biol Chem 266:15213, 1991
13. Kabsch W, Sander C: Dictionary of protein secondary structure: Pattern recognition of hydrogen-bonded and geometrical features. Biopolymers 22:2577, 1983
14. Bode W, Mayr I, Baumann U, Huber R, Stone SR, Hofsteenge
J: The refined 1.9 A crystal structure of human a-thrombin: Interaction with D-Phe-Pro-Arg chloromethyl ketone and significance of
the Tyr-Pro-Pro-Trp insertion segment. EMBO J 8:3467, 1989
15. Koeberl DD, Bottema CDK, Ketterling RP, Bridge PJ, Lillicrap DP, Sommer S S : Mutations causing hemophilia B: Direct estimate of the underlying rates of spontaneous germ-line transitions,
transversions and deletions in a human gene. AmJHum Genet
47:202, 1990
16. Green PM, Montandon AJ, Ljung R, Bentley DR, Kling SR,
Nilsson IM, Giannelli F: Hemophilia B mutations in a complete
Swedish population sample: A test of new strategy for the genetic
counselling of diseases with mutational heterogeneity. Br J Haematol
78:390, 1991
17. Ludwig M, Sabhanval A, Brackmann HH, Olek K, Smith
KJ, Birktoft JJ, Bajaj S P Hemophilia B caused by five different
nondeletion mutations in the protease domain of factor M.Blood
79:1225, 1992
18. Fersht AR, Shi J, Knill-Jones J, Lowe DM, Wilkinson M ,
Blow DM, Brick P, Carter P, Wayne MMY, Winter G: Hydrogen
bonding and biological specificity analysed by protein engineering.
Nature 314:235, 1985
19. Kane WH, Davie EW: Blood coagulation factors V and VIII:
Structural and functional similarities and their relationship to hemorrhagic and thrombotic disorders. Blood 71539, 1988
20. Herzberg MS, Bel-Tal 0, Furie B, Furie B: Construction,
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
1842
expression, and characterization of a chimera of factor IX and factor
X. J Biol Chem 267:14759, 1992
21. Colman PS: Structure of antibody-antigen complexes: Implications for immune recognition. Adv Immunol 43:99, 1988
22. Bajaj SP, Sabharwal AK, Gorka .I, Birktoft A: Antibodyprobed conformational transitions in the protease domain of human
factor IX upon calcium binding and zymogen activation: Putative
high-affinity Caz+-binding site inthe protease domain. Proc Natl
Acad Sci USA 89:152, 1992
23. Wildgoose P, Kazim AL, Kisiel W: The importance of residues
195-206 of human blood clotting factorVII in the interactionof factor
W with tissue factor. Proc Natl Acad Sci USA 87:7290, 1990
24. Sarkar G, Koeberl DD, Sommer SS: Direct sequencing of the
activation peptide and the catalytic domain of the factor IX gene in
six species. Genomics 6:133, 1990
HAMAGUCHI ET AL
25. Chen S-H, Zhang M, Lovrien EW, Scott CR, Thompson AR:
CG dinucleotide transitions in the factor IX gene account for about
half of thepoint mutations in hemophilia B patients: A Seattle series.
Hum Genet 87:177, 1991
26. Ahmad SS, Rawala-Sheikh R, Cheung W, Stafford DW,
Walsh PN: The role of growth factor domains of human factor IXa
in binding to platelets and in factor X activation. Thromb Haemost
65300, 1991
27. Wu S-M, Stafford DW, Ware J: Deduced amino acid sequence of mouse blood coagulation factor IX. Gene 86:275, 1990
28. Padmanabhan K, Padmanabhan KP, Tulinsky A, Park CH,
Bode W, Heiber R, Blankenship DT, Cardin AD, Kisiel W: Structure
ofhuman Des(1-45) factor Xa in 2.2 A resolution. J Mol Biol
232:947, 1993
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
1994 84: 1837-1842
The role of amino-terminal residues of the heavy chain of factor IXa in
the binding of its cofactor, factor VIIIa
N Hamaguchi, SP Bajaj, KJ Smith and DW Stafford
Updated information and services can be found at:
http://www.bloodjournal.org/content/84/6/1837.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.