Download Overexpression of CRK13, an Arabidopsis cysteine‐rich receptor

The Plant Journal (2007) 50, 488–499
doi: 10.1111/j.1365-313X.2007.03064.x
Overexpression of CRK13, an Arabidopsis cysteine-rich
receptor-like kinase, results in enhanced resistance to
Pseudomonas syringae
Biswa R. Acharya1, Surabhi Raina1, Shahina B. Maqbool1, Guru Jagadeeswaran1, Stephen L Mosher2, Heidi M. Appel3,
Jack C. Schultz3, Daniel F. Klessig2 and Ramesh Raina1,*
1
Department of Biology, Syracuse University, Syracuse, NY 13244, USA,
2
Boyce Thompson Institute for Plant Research, Tower Road, Ithaca, NY 14853, USA, and
3
Department of Entomology, Pennsylvania State University, University Park, PA 16802, USA
Received 31 October 2006; revised 19 December 2006; accepted 10 January 2007.
*
For correspondence (fax +1 315 443 2012; e-mail [email protected]).
Summary
Protein kinases play important roles in relaying information from perception of a signal to the effector genes in
all organisms. Cysteine-rich receptor-like kinases (CRKs) constitute a sub-family of plant receptor-like kinases
(RLKs) with more than 40 members that contain the novel C-X8-C-X2-C motif (DUF26) in the extracellular
domains. Here we report molecular characterization of one member of this gene family, CRK13. Expression of
this gene is induced more quickly and strongly in response to the avirulent compared with the virulent strains
of Pseudomonas syringae, and peaks within 4 h after pathogen infection. In response to dexamethasone (DEX)
treatment, plants expressing the CRK13 gene from a DEX-inducible promoter exhibited all tested features of
pathogen defense activation, including rapid tissue collapse, accumulation of high levels of several defenserelated gene transcripts including PR1, PR5 and ICS1, and accumulation of salicylic acid (SA). In addition, these
plants suppressed growth of virulent pathogens by about 20-fold compared with the wild-type Col-0. CRK13conferred pathogen resistance is salicylic acid-dependent. Gene expression analysis using custom cDNA
microarrays revealed a remarkable overlap between the expression profiles of the plants overexpressing
CRK13 and the plants treated with Pst DC3000 (avrRpm1). Our studies suggest that upregulation of CRK13
leads to hypersensitive response-associated cell death, and induces defense against pathogens by causing
increased accumulation of salicylic acid.
Keywords: cysteine-rich receptor-like kinase, salicylic acid, pathogen defense, Arabidopsis, signaling, cell
death.
Introduction
Plants are well equipped to sense invasion of pathogenic
micro-organisms and have the ability to employ multiple
strategies for self-defense. The hypersensitive response
(HR), a type of programmed cell death (PCD) induced at the
site of infection, is one of the most robust forms of active
defenses employed by plants to prevent pathogen invasion.
Recent studies have shown that, in most plant–pathogen
interactions, activation of HR requires effector proteins
produced by the pathogen and their indirect recognition by
R gene products produced by the plant (reviewed in
Chisholm et al., 2006). Activation of R genes leads to
488
induction of several defense responses by the plant, including changes in ion fluxes, production of reactive oxygen
species (ROS), accumulation of salicylic acid (SA), reinforcement of the cell wall, synthesis of phytoalexins, and
transcriptional activation of many defense and pathogenesisrelated genes (Dempsey et al., 1999; Hammond-Kosack and
Jones, 1996). In many cases, HR is followed by activation of
systemic acquired resistance (SAR), which provides resistance against a wide variety of pathogens. SA potentiates
HR-associated cell death and plays a crucial role in establishment of SAR (Durrant and Dong, 2004; Ryals et al., 1996).
ª 2007 The Authors
Journal compilation ª 2007 Blackwell Publishing Ltd
Overexpression of CRK13 induces pathogen defense 489
The Arabidopsis genome has more than 600 receptor-like
kinases (RLKs). Of these, 400 have an extracellular receptor
domain, a transmembrane domain and an intracellular
kinase domain (Shiu and Bleecker, 2001a). However, the
function of very few RLKs is known. RLKs are involved in
regulating a variety of plant physiological processes, including growth and development, symbiosis, hormone signaling, transpiration and pathogen defense (reviewed in
Dievart and Clark, 2004; Johnson and Ingram, 2005; Shiu
and Bleecker, 2001b). RLK genes implicated in pathogen
defense include (i) FLS2, encoding an Arabidopsis flagellinsensing LRR-RLK that plays an important role in plant innate
immunity (Gomez-Gomez and Boller, 2000), (ii) rice resistance gene Xa21, which confers resistance to Xanthomonas
oryzae pv. oryzae in a race-specific manner (Song et al.,
1995), and (iii) barley Rpg1, which confers resistance to the
stem rust fungus Puccinia graminis (Brueggeman et al.,
2002).
A sub-family of 41 RLKs of Arabidopsis contains 1–4
copies of the ‘domain of unknown function 26’ (DUF26)
consisting of a C-X8-C-X2-C motif that is located in the
extracellular part of the protein in most members (Chen,
2001; Shiu and Bleecker, 2001b). Because of this domain,
members of this sub-family have been classified as cysteinerich receptor-like kinases (CRKs; Chen, 2001). The functions
of only very few members of the CRK sub-family are known.
Seven members of this sub-family are induced by SA and
pathogens (Chen et al., 2003, 2004; Czernic et al., 1999).
Among these, CRK5 and its three closest homologs have
been implicated in regulating cell death (Chen et al., 2003,
2004).
In this study, we have characterized CRK13, a member of
the CRK gene sub-family. The CRK13 gene is induced rapidly
in response to bacterial pathogens. Our results demonstrate
that overexpression of CRK13 leads to HR-like cell death,
activation of all tested cellular and molecular markers of
defense, accumulation of SA, and enhanced resistance to
virulent and avirulent strains of bacterial pathogens.
Results
CRK13 is a member of the CRK sub-family of receptor-like
kinases
We previously constructed several suppression subtractive
hybridization (SSH) libraries enriched for Arabidopsis genes
that are differentially expressed in response to defenseinducing chemicals and pathogens (Mahalingam et al.,
2003). One of the cDNAs in these libraries represents a gene
that is induced in response to virulent and avirulent strains
of Pst DC3000. A BLAST search of GenBank revealed that this
cDNA represents a receptor-like kinase gene (At4g23210)
that contains cysteine-rich repeat (CRR) domains and
corresponds to the CRK13 gene of the 41-member CRK
sub-family of RLKs. The full-length cDNA of CRK13 was
isolated by RACE and RT-PCR (see Experimental procedures) and was found to contain an open reading frame of
2019 bp. Search of the public sequence databases revealed
two more cDNAs representing this gene. These cDNAs
contain open reading frames of 1830 and 1572 bp (accession
numbers AY142503 and BT001110), respectively. Together,
these three cDNAs represent alternatively spliced transcripts
of the CRK13 gene (Figure 1a,b). We named these alternatively spliced transcripts CRK13.1 (identified in our cDNA
library, accession number DQ680080), CRK13.2 (accession
number AY142503) and CRK13.3 (accession number
BT001110). To determine which of these alternative spliced
transcripts are preferentially produced, if any, in response
to pathogen infection, we used splicing variant-specific
primers to determine the level of each transcript by
1
(a)
CRK13.1
1
2
CRK13.2
3
4
CRK13.3
2
(b)
CRK13.1
TM CRR
(c)
CRR TM
STYKc
40 cycles
24 cycles
3
2
1
3.
3.
3.
tin RK1
K1 RK1 ctin
K1 RK1 RK1
Ac
A
C
CR
C
C
C
CR
Treatment M R M R M R M R M R M R M R M R
1
3.
2
3.
3
3.
Gene
Figure 1. Genomic organization and expression of the CRK13 gene.
(a) CRK13 codes for at least three alternatively spliced forms: CRK13.1,
CRK13.2 and CRK13.3. Exons are represented by boxes. Arrows represent
primers used for RT-PCR in (c). Primer 1 spans the boundaries of exons 5 and
6 of CRK13.1 and CRK13.2, primer 2 spans the boundaries of exons 6 and 7 of
CRK13.1 and exons 5 and 6 of CRK13.3, primer 3 corresponds to exon 5 of
CRK13.3, and primer 4 corresponds to exon 6 of CRK13.2.
(b) Schematic representation of CRK13.1 protein. TM, transmembrane
domain (amino acids 5–24 and 301–320); CRR, cysteine-rich repeat/DUF26
domain (amino acids 73–130 and 198–249); STYKc, dual-specificity serine/
threonine and tyrosine kinase domain (amino acids 358–627). Protein
domains were predicted using the Simple Modular Architecture Research
Tool (http://smart.embl-heidelberg.de) and the NCBI domain searching databases (http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi).
(c) Expression analysis of splicing variants of the CRK13 gene. The relative
abundance of the three splicing variants in response to pathogen infection
was determined using the transcript-specific primers shown in (a). Actin genespecific primers were used as internal control. M, RNA isolated from 10 mM
MgCl2-treated plants; R, RNA isolated from plants treated with Pst DC3000
(avrRpm1; 5 · 107 CFU ml)1 in 10 mM MgCl2). PCR was performed for 24 and
40 cycles. PCR amplification at 40 cycles demonstrates that all three splicing
variants do exist and can be amplified using the primers shown in (a). This
experiment was performed twice using different sets of RNA samples with
similar results.
ª 2007 The Authors
Journal compilation ª 2007 Blackwell Publishing Ltd, The Plant Journal, (2007), 50, 488–499
490 Biswa R. Acharya et al.
CRK13 is rapidly induced in response to bacterial pathogens
To determine the kinetics of induction of the CRK13 gene in
response to bacterial pathogens, we monitored accumulation of CRK13 transcripts over a 24 h period in response to
Pst DC3000 (virulent) and Pst DC3000 (avrRpm1; avirulent)
strains of bacterial pathogen by Northern blot analysis.
Expression of the CRK13 gene was induced within 1 h postinfiltration (hpi) in response to Pst DC3000 (avrRpm1) and
within 2 hpi in response to Pst DC3000. In both cases, transcript accumulation peaked within 4 hpi (Figure 2a).
To compare the kinetics of accumulation of the CRK13
transcript relative to a known pathogen-inducible gene, we
hybridized these blots with PR1 gene probe. As expected, PR1
gene transcript was readily detected by 8 hpi in response to
Pst DC3000 (avrRpm1) and by 12 hpi in response to Pst
DC3000 (Figure 2a). These results demonstrate that CRK13 is
an early bacterial pathogen-inducible gene, and as expected
for a typical defense-related gene, it is induced more quickly
and to higher levels in response to an avirulent pathogen
compared with a virulent pathogen. Similarly, the CRK13
gene was also induced in response to other bacterial pathogens (Figure 2b). Expression of the CRK13 gene was also
analyzed in response to fungal pathogens (Alternaria brassicicola and Fusarium oxysporum), virus (turnip crinkle
virus), insects (Spodoptera exigua and Myzus persicae),
abiotic stresses (cold, heat, salinity, osmotic, freezing,
wounding, drought), chemicals that induce oxidative stress
(H2O2, paraquat, glucose/glucose oxidase, xanthine/xanthine
oxidase), and the defense hormones SA and jasmonic acid
(JA). None of these treatments induced expression of the
CRK13 gene (Figure S2, and data not shown). These results
suggest that the CRK13 gene is induced specifically in
response to bacterial pathogens. Because CRK13 seems to
be specifically induced in response to bacterial pathogens,
we tested its expression in response to flg22 peptide, a wellcharacterized bacterial pathogen-associated molecular pattern molecule (PAMP; Gomez-Gomez and Boller, 2000).
(a)
MgCl2
Pst DC3000
Pst DC3000 (avrRpm1)
hpi 1 2 4 6 8 12 24 1 2 4 6 8 12 24 1 2 4 6 8 12 24
CRK13
PR1
CRK13
rRNA
C
DM l2
S
fig O
22
Ps
tD
C
30
(c)
Mg
(b)
00
rRNA
Mg
Cl
Ps 2
m
Ea
3
Xc 21
c80
04
semi-quantitative RT-PCR. We found that the CRK13.1
transcript was predominantly produced in response to
avirulent pathogen Pst DC3000 (avrRpm1; Figure 1c).
Therefore, for studies involving use of CRK13 cDNA in this
study, we used the cDNA corresponding to the CRK13.1
splicing variant.
To determine the structural similarity of CRK13 with other
members of CRK sub-family, we performed phylogenetic
analysis of predicted full-length proteins of all members by
the CLUSTAL W method. Our analysis revealed that CRK13
falls in a sub-group of seven members, consisting of CRK22,
CRK11, CRK33, CRK34, CRK12 and CRK14 (Figure S1). The
sequence identity of CRK13 with other members in the subfamily ranges from 26% to 67% at amino acid level, and
CRK22 is its closest homolog.
CRK13
rRNA
Figure 2. Expression analysis of the CRK13 gene in response to bacterial
pathogens and flg22 peptide.
Total RNA was isolated from the leaves of 4-week-old Col-0 plants inoculated
with the indicated pathogens, and tissue samples were harvested at the
indicated times after inoculation. Transcript levels were determined by RNA
gel-blot analysis. Blots were stained with methylene blue to show the relative
amounts of RNA in each lane (28S rRNA). Blots were probed with the CRK13
gene probe, stripped and reprobed with the PR1 gene probe, as indicated. All
experiments were repeated at least once with similar results.
(a) Treatment with virulent bacterial pathogen Pst DC3000 and avirulent
bacterial pathogen Pst DC3000 (avrRpm1) at a titer of 5 · 107 CFU ml)1 in
10 mM MgCl2. Mock treatment was performed with 10 mM MgCl2.
(b) Treatment with Psm, virulent bacterial pathogen P. syringae pv. maculicola ES4326; Ea321, Erwinia amylovora; Xcc, Xanthomonas campestris pv.
campestris 8004. All pathogens were used at a titer of 5 · 107 CFU ml)1 and
infiltrated leaves were harvested 4 hpi for RNA analysis.
(c) Col-0 plants were infiltrated with 1 lM flg22 in 0.01% DMSO and leaves
were harvested 4 hpi. Mock treatment was performed with 0.01% DMSO. For
positive control, plants were treated with Pst DC3000 (avrRpm1) at a titer of
5 · 107 CFU ml)1 in 10 mM MgCl2 and tissue was harvested 4 hpi.
Northern analysis revealed that flg22 induces expression of
CRK13 within 4 hpi (Figure 2c). This result suggests a possible involvement of CRK13 in PAMP-triggered immune
responses.
To determine whether expression of the CRK13 gene is
regulated in a tissue- or developmental-specific manner, we
analyzed expression of CRK13 in 1-week-old seedlings and
in leaves, stems, roots and flowers of 6-week-old Col-0
plants and senescing tissue by Northern blot analysis. We
were unable to detect expression of CRK13 in the seedlings,
or any of the organs of the 6-week-old plants or senescing
tissue (Figure S2d).
Overexpression of CRK13 leads to HR-like cell death
To investigate the role of the CRK13 gene in regulating
resistance against pathogens, we identified two T-DNA
insertion lines that had a T-DNA insertion in the CRK13 gene.
One of these (crk13-1) was obtained from the Salk T-DNA
insertional collection (Alonso et al., 2003), and the other
ª 2007 The Authors
Journal compilation ª 2007 Blackwell Publishing Ltd, The Plant Journal, (2007), 50, 488–499
Overexpression of CRK13 induces pathogen defense 491
(crk13-2) was obtained from the SAIL collection (Sessions
et al., 2002). These lines harbor null alleles of the CRK13
gene, as confirmed by Northern blot analysis (Figure S3). To
evaluate the role of the CRK13 gene in regulating resistance
against bacterial pathogens, we monitored the growth of
virulent bacterial pathogens [Pst DC3000 and Pseudomonas
syringae pv. maculicola (Psm ES4326)] and avirulent bacterial pathogens [Pst DC3000 (avrRpm1) and Pst DC3000
(avrRpt2)] in these plants up to the 5th day post-infiltration
(dpi). We did not observe any significant difference in the
growth of these pathogens between the mutants and wildtype plants (data not shown).
Because loss of function of CRK13 had no affect on
growth of the bacterial pathogens, to further analyze the
role of the CRK13 gene in regulating defense against
pathogens, we tested the effect of overexpressing the
CRK13 gene in transgenic Arabidopsis plants. We constructed transgenic plants expressing the full-length CRK13
cDNA under the control of the constitutive CaMV 35S
promoter (35S::CRK13). Plants overexpressing CRK13 were
stunted and did not survive to maturity, suggesting that
overexpression of the CRK13 in Arabidopsis is lethal
(Figure S4).
Because we were unable to construct transgenic plants
overexpressing CRK13 cDNA from a strong constitutive
promoter, we constructed transgenic Col-0 plants overexpressing CRK13 cDNA under the control of a steroidinducible Gal4 promoter (Aoyama and Chua, 1997). Transgenic Col-0 plants containing empty vector pTA7002 were
constructed as a control. Seven transgenic lines that accumulated varying levels of CRK13 transcript in a DEXdependent manner were identified, and the results of
Northern analysis for three of these are shown in Figure 3(a). These lines, but not the transgenic plants containing vector alone, induced HR-like cell death upon treatment
with 5.0 lM DEX (see below). Based on segregation analysis
of the hygromycin gene (selection marker linked to the
vector) in the T3 progeny, we determined that the lines DEX26 and DEX-33 and transgenic lines harboring vector alone
(DEX-V1 and DEX-V3) contained a single copy of the
transgene, and these were selected for further studies. In
response to DEX treatment, the leaves of DEX-26 and DEX33 showed massive HR-like tissue collapse within 24 hpi. In
contrast, none of the infiltrated leaves of DEX-V1 and DEXV3 plants or ethanol-treated DEX-26 and DEX-33 plants
showed any visible cell death (Figure 3b, and data not
shown). This cell death phenotype was observed in all
independent transgenic lines harboring DEX::CRK13 except
DEX-40, in which infiltrated leaves turned slightly yellow at
5 dpi (data not shown). Expression analysis revealed that the
CRK13 gene was induced to very low levels in response to
DEX treatment in this line (Figure 3a). These data suggests
that ectopic expression of CRK13 results in HR-like cell
death.
(a)
(b)
1
V
X-
3
V
X-
6
2
X-
3
3
X-
0
4
X-
DEX-V1/EtOH
DEX-V1/DEX
-0
ol
E
DE DE D
DE DE
C
E D E D E D E D E D Rpm1
CRK13
rRNA
(c)
DEX-V1
DEX-26/EtOH DEX-26/DEX
DEX-26
hpi 4 12 24 48 4 12 24 48
CRK13
(d)
DEX-V1/DEX
DEX-V3/DEX
DEX-26/DEX
DEX-33/DEX
PR1
PR5
ICS1
rRNA
Figure 3. Overexpression of the CRK13 gene induces cell death and expression of defense-related markers.
(a) Total RNA was isolated from 4-week-old DEX-26, DEX-33 and DEX-40
transgenic lines expressing CRK13 cDNA from the DEX-inducible system, and
DEX-V1 and DEX-V3 lines containing empty vector. Rosette leaves were
infiltrated with 5.0 lM DEX in 0.016% ethanol (d) or with 0.016% ethanol (e),
and tissue was harvested 4 hpi. Col-0 treated with Pst DC3000 (avrRpm1) was
used as a positive control. The blot was stained with methylene blue to show
relative amounts of RNA in each lane (28S rRNA), and hybridized with the
CRK13 gene probe.
(b) Leaves of 4-week-old DEX-V1 and DEX-26 transgenic plants were
infiltrated with 5.0 lM DEX or 0.016% ethanol. Collapse of infiltrated leaves
was observed within 24 h; the photograph was taken at 4 dpi. Similar results
(not shown) were obtained for DEX-V3 (empty vector line) and DEX-33
(CRK13-expressing line).
(c) Transcript levels of PR1, PR5 and ICS1 genes in DEX-V1 and DEX-26 lines
were determined by RNA gel-blot analysis. Rosette leaves of 4-week-old
plants were infiltrated with 5.0 lM DEX, and tissue samples were harvested at
indicated time points. The blot was stained with methylene blue to show the
relative amounts of RNA in each lane (28S rRNA), and sequentially hybridized
with the indicated probes. Similar results (not shown) were obtained for DEXV3 (empty vector line) and DEX-33 (CRK13-expressing line).
(d) Rosette leaves of 4-week-old transgenic plants overexpressing CRK13
(DEX-26 and DEX-33) and empty vector lines (DEX-V1 and DEX-V3) were
infiltrated with 5.0 lM DEX and stained with DAB at 24 hpi as described in
Experimental procedures.
Overexpression of CRK13 leads to activation of pathogenesis-related genes
HR-associated programmed cell death is frequently accompanied by activation of many pathogenesis-related genes
(Nimchuk et al., 2003). In order to test whether cell death
associated with overexpression of the CRK13 gene mimics
HR-associated cell death, we analyzed the expression of a
variety of pathogenesis-related (PR) genes in DEX-26, DEX33 and control DEX-V1 and DEX-V3 plants in response to
5.0 lM DEX treatment. High levels of the CRK13 transcript
were detected within 4 h of DEX infiltration and remained
high until at least 48 hpi (Figure 3c). Overexpression of
CRK13 induced accumulation of transcripts of SA-responsive PR genes such as PR1 and PR5. We also analyzed these
ª 2007 The Authors
Journal compilation ª 2007 Blackwell Publishing Ltd, The Plant Journal, (2007), 50, 488–499
492 Biswa R. Acharya et al.
(a)
ng/g FW
lines for the expression of the isochorismate synthase 1
(ICS1) gene, which is involved in biosynthesis of SA
(Wildermuth et al., 2001). Similar to other PR genes, the ICS1
gene was also induced within 12 hpi. The abundance of the
JA-regulated PDF1.2 transcript did not increase in these
plants (data not shown). These results suggest that ectopic
expression of CRK13 induces expression of defense-related
genes that are regulated by the SA-mediated defense pathway.
10 000
9000
8000
7000
6000
5000
4000
3000
2000
1000
0
Free SA
0hr
12hr
24hr
DEX-V1
DEX-V3
DEX-26
DEX-33
DEX-26
DEX-33
(b)
Activation of PR genes in CRK13 overexpressing plants
prompted us to test whether defense-related cellular markers are also induced in these plants. Among these, we tested
production of H2O2 and electrolyte leakage caused by
membrane damage. Production of H2O2 was tested by in situ
histochemical staining with 3,3¢-diaminobenzidine (DAB)
(Throdal-Christensen et al., 1997). A reddish-brown precipitate of oxidized DAB was observed in response to DEX
treatment in the leaves of the transgenic DEX-26 and DEX-33
plants collected 24 hpi, but not in the treated control vector
lines (Figure 3d). This result suggests that H2O2 accumulation in these plants parallels (and perhaps precedes) cell
death, a response typically associated with many pathogeninduced HR responses. To test whether CRK13-conferred cell
death is associated with membrane damage, we analyzed
electrolyte leakage from DEX-26, DEX-33 and empty vector
lines DEX-V1 and DEX-V3 in response to DEX treatment. DEX
treatment lead to significantly higher ion leakage in DEX-26
and DEX-33 lines compared with the control DEX-V1 and
DEX-V3 vector lines, suggesting that CRK13 overexpression
leads to membrane damage (Figure S5a).
Overexpression of CRK13 leads to accumulation of SA
Induction of ICS1 in plants overexpressing CRK13 prompted us to test whether overexpression of the CRK13 gene
also led to accumulation of SA. To this end, we determined
the levels of SA and SA glucoside (SAG) in DEX-26, DEX33, DEX-V1 and DEX-V3 plants in response to DEX treatment at 0, 12 and 24 hpi. The DEX-26 and DEX-33 plants,
but not the DEX-V1 or DEX-V3 plants, accumulated high
levels of SA and SAG in response to DEX treatment. Within
12 h after DEX treatment, levels of SA and SAG were
approximately 100-fold and 20-fold higher, respectively,
than at 0 h (Figure 4a,b). SAG levels continued to rise to
24 hpi, while SA levels declined modestly between 12 and
24 hpi, perhaps due to continued conversion of SA to SAG.
The high levels of SA and SAG accumulation by 12 hpi
suggest that accumulation of SA precedes cell death.
These data suggest that SA may be important for CRK13conferred cell death.
ng/g FW
Overexpression of CRK13 leads to activation of defenserelated cellular markers
20 000
18 000
16 000
14 000
12 000
10 000
8000
6000
4000
2000
0
SAG
0hr
12hr
24hr
DEX-V1
DEX-V3
13
EX
Na
/
d2
si
K1
R
::C
R
::C
EX
X
DE
/D
hG
3
3
K1
RK
::C
(c)
/D
-0
ol
C
CRK13
PR1
rRNA
Figure 4. SA positively regulates CRK13-conferred cell death.
(a, b) Free SA and SAG were extracted from leaves of transgenic plant
overexpressing CRK13 (DEX-26, DEX-33) and empty vector lines (DEX-V1 and
DEX-V3) at 0, 12 and 24 h after 5.0 lM DEX treatment. The values are
presented as means SD of three replicates, each consisting of leaves from
eight plants per genotype.
(c) Rosette leaves of 4-week-old plants of T1 transgenic lines of NahG/
DEX::CRK13, sid2/DEX::CRK13 and Col/DEX::CRK13 were infiltrated with
5.0 lM DEX, and tissue samples were harvested 24 hpi for RNA isolation.
Blots were probed with the CRK13 gene probe, stripped and reprobed with the
PR1 gene probe.
To test the role of SA in regulating CRK13-conferred cell
death and induction of defense genes, we transformed
DEX::CRK13 construct into plants that have reduced levels of
SA. We used plants expressing the bacterial salicylic
hydroxylase gene (NahG) and the sid2 mutant for this
purpose. The presence of the NahG gene in transgenic
plants prevents accumulation of SA by catabolizing it to
catechol (Friedrich et al., 1995), and the sid2 mutant is
deficient in SA biosynthesis (Wildermuth et al., 2001). In
ª 2007 The Authors
Journal compilation ª 2007 Blackwell Publishing Ltd, The Plant Journal, (2007), 50, 488–499
Overexpression of CRK13 induces pathogen defense 493
parallel, wild-type Col-0 plants were transformed with the
DEX::CRK13 construct for comparison. The level of CRK13
expression in response to DEX treatment in these plants was
analyzed by Northern blot analysis, and lines with varying
levels of expression were obtained for all three genotypes
(data not shown). To compare the cell death phenotype,
plants with similar levels of CRK13 expression were analyzed. None of the NahG/DEX::CRK13 and sid2/DEX::CRK13
plants had any visible cell death in response to DEX
treatment after 24 h, while approximately 50% of the infiltrated leaves of the Col-0/DEX::CRK13 plants had developed
HR-like cell death. By 48 hpi, approximately 50% of infiltrated leaves of the NahG/DEX::CRK13 and sid2/DEX::CRK13
plants developed mild to moderate cell death, while most
leaves of the Col-0/DEX::CRK13 plants developed massive
HR-like cell death. Seventy-two hours after DEX infiltration,
all infiltrated leaves of all genotypes developed massive HRlike cell death (Figure S5b). These results suggest that SA
positively regulates CRK13-conferred cell death.
To test whether CRK13-conferred PR1 expression is
dependent on SA accumulation, we compared the expression of PR1 in response to DEX treatment in NahG/
DEX::CRK13 and sid2/DEX::CRK13 plants with that in Col-0/
DEX::CRK13 plants. We selected plants that induced CRK13
expression to similar levels in response to DEX. Figure 4(c)
shows the levels of CRK13 transcript in response to DEX in
representative lines of all three genotypes. In spite of similar
levels of CRK13 transcript, PR1 transcript levels were much
lower in NahG/DEX::CRK13 and sid2/DEX::CRK13 plants
compared with the Col-0/DEX::CRK13 plants. These results
suggest that SA potentiates CRK13-conferred expression of
PR1 and possibly other defense-related genes.
Overexpression of CRK13 confers resistance to Pst DC3000
The results described above demonstrate that overexpression of CRK13 results in activation of several pathogen defense responses. To assess whether overexpression of
CRK13 would also confer resistance to virulent strains of
bacterial pathogens, we determined the growth of Pst
DC3000 in response to DEX treatment in DEX-26, DEX-33 and
control DEX-V1 and DEX-V3 plants. Because DEX treatment
of DEX-26 and DEX-33 plants leads to rapid cell death, first
we determined the minimum concentration of DEX that was
sufficient to induce expression of PR genes without any
visible cell death. For this, we syringe-infiltrated increasing
concentrations of DEX solution (0.001–20.0 lM) into the
DEX-26 and DEX-33 plants and monitored accumulation of
PR1 gene transcripts at 24 hpi and cell death over a period of
5 days, which is the time required to determine in planta
growth of virulent bacterial pathogens. As little as 0.05 lM
DEX was sufficient to induce PR1 gene expression in DEX-26
and DEX-33 plants without causing visible cell death,
although some yellowing of leaves was observed at 5 dpi
(Figure 5a). No PR1 transcript was detected in response to
0.01 lM DEX. Based on these results, a concentration of
0.05 lM DEX was chosen for determining the growth of the
virulent bacterial pathogen in these plants (Figure 5b).
Leaves of 4-week-old plants were infiltrated with 0.05 lM
DEX, and 18 h later these leaves were re-infiltrated with Pst
DC3000 at a titer of 1 · 104 CFU ml)1. At 4 dpi, an approximately 20-fold reduction in the growth of bacteria was
observed in DEX-26 and DEX-33 lines compared with the
Col-0, DEX-V1 and DEX-V3 vector control lines (Figure 5c,
and data not shown). These results demonstrate that
overexpression of CRK13 results in enhanced resistance
against virulent Pst DC3000. We also analyzed growth of the
avirulent pathogen Pst DC3000 (avrRpm1) in these plants.
Similar to Pst DC3000, at 4 dpi, an approximately 10-fold
reduction in the growth of bacteria was observed in DEX-26
and DEX-33 lines compared with the DEX-V1 and DEX-V3
vector control lines (data not shown). These results suggest
that CRK13 also potentiates resistance against avirulent
bacterial pathogen Pst DC3000 (avrRpm1).
To analyze the role of SA in regulating CRK13-conferred
defense, we tested the growth of Pst DC3000 in response to
DEX treatment in NahG/DEX::CRK13 and sid2/DEX::CRK13
plants as described above. The suppression of SA accumulation in these plants compromised the resistance conferred
by DEX::CRK13 (Figure 5c). These results suggest that
CRK13-conferred resistance is dependent on SA and are
consistent with the suppression of defense gene expression
in NahG/DEX::CRK13 and sid2/DEX::CRK13 plants (Figure 4c).
Transcriptome profiling reveals significant overlap between
CRK13 and avirulent pathogen-modulated gene expression
The results described above suggest that the CRK13-conferred response mimics many of the responses induced by
avirulent pathogens. To further identify the genes regulated
by CRK13, we analyzed the transcriptome of plants overexpressing the CRK13 gene using a custom microarray representing 199 Arabidopsis genes. Most of these genes are
differentially expressed in response to a variety of pathogen
defense-related biotic stresses [predominantly Pst DC3000
(avrRpm1)] and abiotic stresses (Table S1). We analyzed
changes in the transcriptome of DEX-26 and DEX-33 in response to 0.05 lM DEX treatment using these arrays. DEXtreated empty vector lines DEX-V1 and DEX-V3 were used as
controls. Only those genes whose expression changed by
more than two-fold in both lines (DEX-26 and DEX-33)
compared with the vector controls were considered differentially expressed. Out of 199 genes, 101 (51%) were differentially expressed; of these, 93 were induced and eight were
suppressed (Table S2). The results of the microarray analysis were evaluated by Northern blot analysis of a few
randomly selected genes that were either induced or
ª 2007 The Authors
Journal compilation ª 2007 Blackwell Publishing Ltd, The Plant Journal, (2007), 50, 488–499
suppressed in microarray experiments. The results of Northern blot analysis were in agreement with those of the
microarray experiments (Figure S6).
For a different project, we performed transcriptome
analysis of Col-0 in response to a variety of biotic stresses,
including Pst DC3000 (avrRpm1), and abiotic stresses (Maqbool et al., unpublished). To compare changes in gene
expression due to overexpression of CRK13 with avirulent
pathogen-mediated responses, we compared the transcriptome of DEX-treated DEX::CRK13 plants with that of Col-0
plants treated with Pst DC3000 (avrRpm1). Tissue samples
were collected 24 h after DEX treatment or pathogen infiltration. This analysis revealed a significant overlap between
the transcriptome of CRK13- and pathogen-induced genes
(Table S2). Among the genes induced by CRK13, 60% were
also induced by Pst DC3000 (avrRpm1), and all eight genes
that were suppressed by CRK13 were also suppressed by Pst
DC3000 (avrRpm1; Table S2). Together, these results suggest that induction of CRK13 mimics the plant’s response to
avirulent pathogens at the molecular and cellular level.
20.0
5.0
1.0
0.5
0.1
0.05
DEX (µM)
0.01
(a)
0.005
494 Biswa R. Acharya et al.
DEX-26
DEX-33
(b)
PR1
rRNA
(c)
107
DAY 0
DAY 4
Bacterial count (cfu/leaf disc)
106
105
CRK13 expression in defense signaling mutants
104
103
102
102
1
-1
-0
ol
C
EX
D
6
13
G
ah
-2
EX
D
R
::C
EX
a
N
K
R
::C
EX
/D
hG
13
d2
si
K
N
/D
d2
si
Figure 5. Overexpression of CRK13 confers resistance against virulent bacterial pathogen.
(a) Leaves of transgenic CRK13 plants (DEX-26 and DEX-33) were infiltrated
with the indicated concentrations of DEX. The photograph of representative
leaves was taken at 5 dpi.
(b) DEX-26 plants were treated with DEX at the concentrations shown in (a),
and tissue was harvested at 24 hpi for RNA isolation. Blots were stained
with methylene blue to show the relative amounts of RNA in each lane (28S
rRNA). The level of PR1 expression was determined by RNA gel-blot
analysis. Similar results were obtained for the DEX-33 line (data not
shown).
(c) In planta growth of virulent bacterial pathogen Pst DC3000 in 5-week-old
Arabidopsis plants of the indicated genotypes. Plants were infiltrated with
0.05 lM DEX, and 18 h later leaves were re-infiltrated with a suspension of
virulent bacterial pathogen at a titer of 104 CFU ml)1. For each genotype, 10
discs from 10 plants were used. The mean bacterial counts SD are
presented as colony forming units (CFU) per leaf disc, and represent the
averages of four independent experiments. Similar results were obtained
with DEX-33 and a second independent transgenic line for other genotypes
(data not shown).
To determine the epistatic relationship of CRK13 with other
defense-related genes, we determined expression of the
CRK13 gene in response to bacterial pathogens in variety of
defense mutants and transgenic plants unable to accumulate SA. These include eds1 (Parker et al., 1996), ndr1
(Century et al., 1995), pad3 (Glazebrook and Ausubel, 1994),
pad4 (Glazebrook et al., 1997), eds5 (Rogers and Ausubel,
1997), npr1 (Cao et al., 1997), NahG (Lawton et al., 1995) and
etr1 (Pieterse et al., 1998). Leaves of 4-week-old plants of
these mutants and control wild-type Col-0 plants were infiltrated with Pst DC3000 or Pst DC3000 (avrRpm1). Infiltrated
leaf tissues were harvested at 4 hpi, and CRK13 gene
expression was analyzed by Northern blot analysis. None of
these mutations had any significant effect on accumulation
of CRK13 transcripts in response to virulent or avirulent
bacterial pathogens (Figure 6a, and data not shown). These
results suggest that the CRK13 gene might function
upstream of these defense signaling genes or that its
expression is regulated through a novel signaling pathway(s) independent of these genes.
Many lesion-mimic mutants constitutively express several
defense-related genes. We tested the accumulation of the
CRK13 gene in several lesion-mimic mutants, namely lsd1
(Dietrich et al., 1997), acd2 (Mach et al., 2001), hrl1 (Devadas
et al., 2002) and dll1 (Pilloff et al., 2002). While these mutants
accumulated high levels of PR1 transcripts, CRK13 transcripts were not detected in any of these mutants (Figure 6b).
Finally, to test whether expression of CRK13 required
bacterial pathogens or whether the presence of avirulence
factor was sufficient to induce its expression, we analyzed
the accumulation of CRK13 transcript in transgenic plants
ª 2007 The Authors
Journal compilation ª 2007 Blackwell Publishing Ltd, The Plant Journal, (2007), 50, 488–499
etr1
npr1
nahG
eds5
pad3
pad4
ndr1
eds1
Pst (avrRpm1)
Col-0
(a)
Col-0Mg
Overexpression of CRK13 induces pathogen defense 495
CRK13
rRNA
EtOH
DE
CRK13
DEX
X-
l-0 rl1 l1 d1 d2
Co h dl ls ac
DE V1
XDE Rp
X t2(
DE -Rp rps
X- t2( 2)
DE V1 RP
S2
X)
DE Rp
X- t2(r
Rp ps
t2 2)
(R
PS
2)
(c)
(b)
PR1
CRK13
rRNA
rRNA
Figure 6. Expression analysis of CRK13 in defense signaling mutants, lesionmimic mutants and plants expressing the bacterial avrRpt2 gene.
The levels of CRK13 gene expression were determined by RNA gel-blot
analysis. Blots were stained with methylene blue to show the relative
amounts of RNA in each lane (28S rRNA) and were probed with the indicated
gene probes. All experiments were repeated at least once more and similar
results were obtained.
(a) Rosette leaves of 4-week-old plants of the indicated genotype were
infiltrated with Pst DC3000 (avrRpm1) at a titer of 5 · 107 CFU ml)1 or with
10 mM MgCl2 (Col-0/Mg), and tissue was harvested at 4 hpi.
(b) Rosette leaves of 4-week-old plants of the indicated genotype were used
for RNA analysis. All lesion-mimic mutants had lesions.
(c) Leaves of 4-week-old transgenic plants of the indicated genotype were
infiltrated with 5.0 lM DEX (DEX) or mock-treated with 0.016% ethanol (EtOH),
and tissue was harvested at 4 hpi.
expressing avirulence gene avrRpt2 from a DEX-inducible
promoter (DEX::avrRpt2). In response to DEX treatment,
DEX::avrRpt2 plants in the RPS2 genetic background, but not
in the rps2 mutant background, show induced HR-like cell
death and activatation of several PR genes (McNellis et al.,
1998). CRK13 transcript accumulated at 4 hpi in response to
DEX treatment in DEX::avrRpt2 plants in the RPS2 genetic
background but not in the rps2-101C mutant background
(Figure 6c). These results suggest that in planta expression
of the avrRpt2 avirulence gene is sufficient to induce CRK13
transcript accumulation in the presence of a functional RPS2
gene in the absence of any other pathogen-derived factors.
Discussion
CRKs have been identified in various plant species, and
some members of this gene sub-family are induced in
response to a variety of stimuli, including pathogens, symbionts and defense-inducing signals (Czernic et al., 1999; Du
and Chen, 2000; Lange et al., 1999; Montesano et al., 2002;
Ohtake et al., 2000). We have isolated and characterized the
CRK13 gene of Arabidopsis. Several observations suggest
that CRK13 is associated with activation of HR-like cell death
and defense against virulent and avirulent bacterial pathogens. First, like a typical defense-related gene, CRK13 is
induced more rapidly and to higher levels in response to
avirulent bacterial pathogens compared with virulent pathogens (Figure 2a). Second, in planta expression of avrRpt2
in wild-type Arabidopsis plants with a functional RPS2 is
sufficient to induce expression of the CRK13 gene (Figure 6c), suggesting that avr–R interaction is sufficient for
induction of the CRK13 gene. Third, overexpression of the
CRK13 gene leads to rapid HR-like cell death (Figure 3),
accumulation of SA (Figure 4), induction of several defenserelated genes (Figure 3, Table S2) and accumulation of
cellular and biochemical markers of defense against pathogens (Figures 3 and S5a). Finally, overexpression of CRK13
suppresses the growth of virulent bacterial pathogens about
20-fold (Figure 5c) and that of avirulent pathogens about
10-fold. Furthermore, we tested expression of CRK13 in
response to a variety of other biotic and abiotic stresses,
none of which induced expression of CRK13. These results
suggest that CRK13 might be a bacterial pathogen-responsive gene, probably involved in regulating an early step of
defense signaling. Induction of CRK13 in response to bacterial elicitor flg22 supports this proposition (Figure 2c).
However, it should be noted that we have analyzed transcript levels of CRK13 in these studies, and early transcript
accumulation does not necessarily imply early accumulation
or activation of the protein.
Loss of function of the CRK13 gene had no significant
effect on the resistance against pathogens. There are at least
two possible explanations for this. First, CRK13 is not
involved in regulating resistance against pathogens. This
seems unlikely because overexpression of CRK13 leads to
activation of all tested defense responses, including resistance against virulent and avirulent bacterial pathogen.
Second, CRK13 represents a member of a large gene subfamily represented by 41 members with sequence identity at
the amino acid level ranging from 26% to 67%, and this
genetic redundancy may explain the lack of altered phenotype in loss-of-function alleles. Genetic redundancy has
been suggested to be one of the possible reasons for no
phenotype in loss-of-function mutants of several plant
genes, including other members of the CRK13 gene subfamily (Bouche and Bouchez, 2001; Chen et al., 2003).
SA is an important signal in defense against pathogens.
Levels of SA dramatically increase in response to pathogen
attack (Dempsey et al., 1999; Malamy et al., 1990; Metraux
et al., 1990). Studies in Nicotiana tabacum and other higher
plants have shown that SA is synthesized from cinnamate
via benzoic acid (Ribnicky et al., 1998; Yalpani et al., 1993).
More recent studies have shown that SA can also be
synthesized from chorismate, and that the bulk of SA
ª 2007 The Authors
Journal compilation ª 2007 Blackwell Publishing Ltd, The Plant Journal, (2007), 50, 488–499
496 Biswa R. Acharya et al.
produced in response to pathogen infection is produced
from chorismate in Arabidopsis (Wildermuth et al., 2001).
Our results show that overexpression of CRK13 leads to
induction of ICS1 (involved in biosynthesis of SA from
chorismate) within 12 h and of EDS5 (suggested to be
involved in the transport of precursors of SA) (Nawrath
et al., 2002) within 24 h. However, PAL1, PAL2 and PAL3
genes (involved in SA biosynthesis from phenylalanine)
were not induced significantly (data not shown). This raises
the possibility that overexpression of CRK13 might induce
accumulation of SA and SAG probably by upregulating
expression of ICS1 and possibly other genes involved in SA
biosynthesis from chorismate.
How does ectopic expression of CRK13 lead to cell death
and defense activation? Our results demonstrate that,
despite overexpression of CRK13, cell death was delayed
in NahG/DEX::CRK13 and sid2/DEX::CRK13 plants compared
with Col-0/DEX::CRK13 plants. These findings suggest that
CRK13-conferred cell death is regulated by both SA-dependent and -independent pathways. Studies on lesion-mimic
mutants and pathogen-induced cell death have indicated the
existence of SA-dependent and -independent pathways for
regulating cell death (Lorrain et al., 2003; Nawrath and
Metraux, 1999; Rate et al., 1999). These studies indicate that
some pathogens, as well as some lesion-mimic mutants,
activate pro-cell death signals distinct from SA. Our studies
suggest that CRK13 promotes both of these signals. Reactive
oxygen species may be one such signal involved in inducing
cell death in plants overexpressing CRK13. Nonetheless,
induction of cell death by CRK13 overexpression due to
metabolic perturbation cannot be ruled out. Our results
suggest that CRK13-conferred resistance against pathogens
is mainly regulated by a SA-dependent pathway(s), because
resistance was compromised in NahG/DEX::CRK13 and sid2/
DEX::CRK13 plants.
CRK13 is likely to be an early component of the plant
defense response, because of the following observations.
First, expression of CRK13 in response to pathogen infection
was not attenuated in any of the tested defense mutants,
including eds1, ndr1, pad4, eds5, NahG, npr1 and etr1. In
addition, expression of CRK13 was not induced in any of the
tested lesion-mimic mutants, including lsd1, acd2, hrl1 and
dll1. Some of these genes, such as NDR1 and EDS1, function
early in defense signaling. These results suggest that either
CRK13 functions upstream of these defense genes or it is
part of a novel defense signaling pathway that converges
into a signaling pathway upstream of ICS1, as overexpression of CRK13 induces expression of ICS1. Second, analysis
of gene expression revealed a remarkable overlap between
the expression profiles of the plants overexpressing CRK13
and the plants treated with avirulent bacterial pathogen Pst
DC3000 (avrRpm1). For example, many of the known
defense-related genes such as PR1, PR5, ICS1, chitinase
genes, AIG1, several WRKY protein-encoding genes, protein
kinase genes, RLKs, etc. were induced in plants overexpressing CRK13 and in response to Pst DC3000 (avrRpm1).
Similarly, all eight genes suppressed in plants overexpressing CRK13 were also suppressed in response to Pst DC3000
(avrRpm1). Because CRK13 gene expression is induced in
plants expressing avrRpt2 in planta with functional RPS2,
CRK13 appears to function downstream of resistance genes.
In addition, induction of CRK13 in response to a variety of
avirulence factors suggests that signals generated by these
avr–R interactions might funnel into CRK13-mediated signaling to activate downstream pathogen defense pathways.
Functional characterization of other CRK13 splicing variants
and identification of CRK13-interacting proteins should help
to elucidate mechanisms regulating defense and host cell
death conferred by CRK13.
Experimental procedures
Plant growth, chemical treatment and pathogen infection of
plants
Plants were grown and treated with SA or methyl jasmonate (MJ) as
described previously (Devadas et al., 2002). Dexamethasone (DEX)
treatment was performed by syringe infiltration of the indicated
concentrations of DEX solution in 0.016% ethanol. Bacterial pathogen infiltration and growth estimation were performed as described
previously (Devadas et al., 2002). Plants were syringe-infiltrated
with 1 lM flg22 peptide (Sigma Genosys, www.sigmaaldrich.com)
in 0.01% dimethyl sulfoxide (DMSO).
RNA analysis, RACE PCR and RT-PCR
Total RNA was isolated and Northern blot analysis was performed as
described previously (Devadas et al., 2002). To obtain the full-length
cDNA corresponding to CRK13, amplification of the 5¢ and 3¢ ends of
the CRK13 gene was performed by RNA ligase-mediated rapid
amplification of cDNA ends (RLM-RACE) using a GeneRacer kit (Invitrogen; http://www.invitrogen.com/) and four gene-specific primers according to the manufacturer’s instructions. GSP1 (5¢GTCCCGGTTGTCTGCAGAAGG-3¢), GSP2 (5¢-CACAGGACGTTGCAGTGGAGG -3¢) were used for 5¢ RACE, and GSP3 (TGCCCAACAGAAGTCTCGACT) and GSP4 (GGAGGAACTGCTAGAGGGATTC) for 3¢
RACE. This sequence information was used to design forward and
reverse gene-specific primers to amplify the full-length cDNA by RTPCR using 1 lg of total RNA and Powerscript reverse transcriptase
according to the manufacturer’s protocol (BD Biosciences, www.
bdbiosciences.com). Primers for RT-PCR to check splicing variants
were: primer 1, 5¢-CCGGAACTCCCGGTTACATG-3¢; primer 2, 5¢-ACCTCCAGACATATGTGACA-3¢; primer 3, 5¢-CCGGAACTCCGTAAAATTCT-3¢; primer 4, 5¢-CCTCCAGACCTGAAACAAAA-3¢.
Construction of transgenic plants
To construct transgenic plants overexpressing CRK13, the fulllength CRK13 cDNA was amplified by RT-PCR. For cloning purposes,
AscI and BamHI sites were introduced at the 5¢ end of the forward
primer and at the 3¢ end of the reverse primer, respectively. The
sequences of the forward and reverse primers were 5¢-CAGGCGCGCCTGCTAAGGAACGAACAGATG-3¢ and 5¢-CAGGATCCCGGATTTTATAACAAAGAGCTCGT-3¢, respectively (restriction sites
ª 2007 The Authors
Journal compilation ª 2007 Blackwell Publishing Ltd, The Plant Journal, (2007), 50, 488–499
Overexpression of CRK13 induces pathogen defense 497
underlined). The PCR-amplified products were cloned in pCR2.1TOPO TA cloning vector (Invitrogen) to construct TOPO-CRK13. The
sequence of the amplified product was confirmed by DNA sequencing. The insert was isolated by restriction digestion and cloned
downstream of the 35S promoter in AscI–BamHI-digested binary
vector pSR3000 (derived from pCAMBIA 2300). Arabidopsis plants
(Col-0) were transformed by Agrobacterium-mediated transformation (Clough and Bent, 1998), and transgenic plants were selected on
MS medium containing 75 lg ml)1 kanamycin.
To construct transgenic plants expressing DEX-inducible CRK13,
full-length cDNA was excised from TOPO-CRK13 as an AscI–BamHI
fragment, ends were flushed by a fill-in reaction using Klenow
enzyme (New England Biolabs, www.neb.com), and the fragment
was cloned in XhoI-digested, Klenow filled-in binary vector
pTA7002. The orientation of the insert was confirmed by PCR using
an hptII-specific forward primer (5¢-TTTAGCGAGAGCCTGACCTATTGC-3¢) and a CRK13-specific reverse primer (5¢-ACTCAAGTACGCCTCGTTGG-3¢). Arabidopsis plants (Col-0), NahG
transgenic plants and sid2 mutant plants were transformed by
Agrobacterium-mediated transformation (Clough and Bent, 1998).
Transgenic plants were selected on MS medium containing
40 lg ml)1 hygromycin.
Analyses of crk-1 and crk-2 T-DNA insertional mutants
T-DNA insertion lines crk13-1 (SALK_085128) and crk13-2
(SAIL_G296G1) were obtained from the SALK T-DNA collection
(Alonso et al., 2003) and the SAIL T-DNA collection (Sessions et al.,
2002), respectively. Sequences flanking the T-DNA insertion sites
were amplified using the CRK13 gene-specific reverse primer (5¢GCTTTTCCATAACCTCCAGAC-3¢) and T-DNA left border primers (5¢TGGTTCACGTAGTGGGCCATCG-3¢) and (5¢- TAGCATCTGAATTTCATAACCAATCTCGATACAC-3¢) for crk13-1 and crk13-2, respectively.
Amplified products were sequenced to determine the site of
insertion of T-DNA in each line. Homozygous mutants were
confirmed to be null alleles by Northern blot analyses.
Histochemical analysis and electrolyte leakage
measurements
Staining for the presence of H2O2 by the DAB uptake method was
performed as described previously (Throdal-Christensen et al.,
1997). Electrolyte leakage measurements were performed as described previously (Devadas and Raina, 2002) with some modifications. For each time point, 10 leaf discs were collected from 10
plants infiltrated with 5.0 lM DEX and were shaken for 4 h in 5.0 ml
of distilled MilliQ water (Millipore, www.millipore.com) at room
temperature.
SA and SAG measurements
Free SA and SAG were extracted from Arabidopsis leaves using the
procedure described for Nicotiana tabacum and Arabidopsis
(Bowling et al., 1994). SA separation and quantification were performed by HPLC as previously described (Bowling et al., 1994).
Microarray analysis
Total RNA from 0.05 lM DEX-treated DEX-26, DEX-33 and vector
lines V1 and V3 was isolated using TRIzol reagent according to the
manufacture’s protocol (Invitrogen, www.invitrogen.com). Vector
line V1 was used as control for DEX-26 and vector line V3 was used
as control for DEX-33. About 40 lg of total RNA was used for target
preparation. The preparation of microarrays, target preparation,
hybridization, data collection and data analysis have been described
previously (Chandra-Shekara et al., 2006).
Acknowledgements
We thank Drs Nam-Hai Chua for the DEX-inducible expression
vector pTA7002, Barbara Kunkel for Pst DC3000 and Pst DC3000
(avrRpm1) strains, Fred Ausubel for PDF1.2 cDNAs, Jean Greenberg for acd2 seeds, Jeff Dangl for lsd1 seeds, Seogchan Kang for
Fusarium oxysporum, Tim McNellis for transgenic avrRpt2 seeds
in RPS2 and rps2 genetic backgrounds, Xinnian Dong for npr1-1
seeds, Steven Beer for Erwinia amylovora Ea321, and the Arabidopsis Biological Resource Center (ABRC) for etr1-1, eds5, pad4,
pad3, sid2, CS60000, CS8846 and SALK_085128 T-DNA insertion
lines. We thank Syngenta Biotechnology Inc. for NahG transgenic
seeds and the T-DNA insertion line SAIL_G296G1. We thank
Nathaniel McCartney, Raphael Kulawik and Gisella Stalloch for
technical assistance. We thank the anonymous reviewer for
excellent suggestions on the manuscript. This work was supported by grants from the Defense Advanced Research Projects
Agency (N66001-02-1-8924) and the National Science Foundation
(NSF) (IBN-0313492) to R.R. and J.C.S., and from the NSF
(IBN-0525360) to D.F.K.
Supplementary material
The following supplementary material will appear for this article
online:
Figure S1. Phylogenetic analysis of CRK proteins.
Figure S2. Expression analysis of the CRK13 gene.
Figure S3. Analysis of T-DNA mutants of CRK13 gene.
Figure S4. Analysis of CRK13 overexpressing plants.
Figure S5. Analysis of electrolyte leakage and CRK13-conferred cell
death.
Figure S6. Validation of results of micro array analysis.
Table S1. List of genes on microarray.
Table S2. Genes differentially expressed in plants overexpressing
CRK13.
This material is available as part of the online article from http://
www.blackwell-synergy.com.
References
Alonso, J.M., Stepanova, A.N., Leisse, T.J. et al. (2003) Genomewide insertional mutagenesis of Arabidopsis thaliana. Science,
301, 653–657.
Aoyama, T. and Chua, N.H. (1997) A glucocorticoid-mediated
transcriptional induction system in transgenic plants. Plant J. 11,
605–612.
Bouche, N. and Bouchez, D. (2001) Arabidopsis gene knockout:
phenotypes wanted. Curr. Opin. Plant Biol. 4, 111–117.
Bowling, S.A., Guo, A., Cao, H., Gordon, A.S., Klessig, D.F. and
Dong, X. (1994) A mutation in Arabidopsis that leads to constitutive expression of systemic acquired resistance. Plant Cell, 6,
1845–1857.
Brueggeman, R., Rostoks, N., Kudrna, D., Kilian, A., Han, F., Chen,
J., Druka, A., Steffenson, B. and Kleinhofs, A. (2002) The barley
stem rust-resistance gene Rpg1 is a novel disease-resistance
gene with homology to receptor kinases. Proc. Natl Acad. Sci.
USA, 99, 9328–9333.
Cao, H., Glazebrook, J., Clarke, J.D., Volko, S. and Dong, X. (1997)
The Arabidopsis NPR1 gene that controls systemic acquired
resistance encodes a novel protein containing ankyrin repeats.
Cell, 88, 57–63.
Century, K.S., Holub, E.B. and Staskawicz, B.J. (1995) NDR1, a locus
of Arabidopsis thaliana that is required for disease resistance to
ª 2007 The Authors
Journal compilation ª 2007 Blackwell Publishing Ltd, The Plant Journal, (2007), 50, 488–499
498 Biswa R. Acharya et al.
both a bacterial and a fungal pathogen. Proc. Natl Acad. Sci. USA,
92, 6597–6601.
Chandra-Shekara, A.C., Gupte, M., Navarre, D., Raina, S., Raina, R.,
Klessig, D. and Kachroo, P. (2006) Light-dependent hypersensitive
response and resistance signaling against turnip crinkle virus in
Arabidopsis. Plant J. 45, 320–334.
Chen, Z. (2001) A superfamily of proteins with novel cysteine-rich
repeats. Plant Physiol. 126, 473–476.
Chen, K., Du, L. and Chen, Z. (2003) Sensitization of defense
responses and activation of programmed cell death by a pathogen-induced receptor-like protein kinase in Arabidopsis. Plant
Mol. Biol. 53, 61–74.
Chen, K., Fan, B., Du, L. and Chen, Z. (2004) Activation of hypersensitive cell death by pathogen-induced receptor-like protein
kinases from Arabidopsis. Plant Mol. Biol. 56, 271–283.
Chisholm, S.T., Coaker, G., Day, B. and Staskawicz, B.J. (2006)
Host–microbe interactions: shaping the evolution of the plant
immune response. Cell, 124, 803–814.
Clough, S.J. and Bent, A.F. (1998) Floral dip: a simplified method for
Agrobacterium- mediated transformation of Arabidopsis thaliana. Plant J. 16, 735–743.
Czernic, P., Visser, B., Sun, W., Savoure, A., Deslandes, L., Marco,
Y., Van Montagu, M. and Verbruggen, N. (1999) Characterization of an Arabidopsis thaliana receptor-like protein kinase gene
activated by oxidative stress and pathogen attack. Plant J. 18,
321–327.
Dempsey, D.A., Shah, J. and Klessig, D.F. (1999) Salicylic
acid and disease resistance in plants. Crit. Rev. Plant Sci. 18, 547–
575.
Devadas, S.K. and Raina, R. (2002) Preexisting systemic acquired
resistance suppresses hypersensitive response-associated cell
death in Arabidopsis hrl1 mutant. Plant Physiol. 128, 1234–1244.
Devadas, S.K., Enyedi, A. and Raina, R. (2002) The Arabidopsis hrl1
mutation reveals novel overlapping roles for salicylic acid, jasmonic acid and ethylene signalling in cell death and defence
against pathogens. Plant J. 30, 467–480.
Dietrich, R.A., Richberg, M.H., Schmidt, R., Dean, C. and Dangl, J.L.
(1997) A novel zinc finger protein is encoded by the Arabidopsis
LSD1 gene and functions as a negative regulator of plant cell
death. Cell, 88, 685–694.
Dievart, A. and Clark, S.E. (2004) LRR-containing receptors
regulating plant development and defense. Development, 131,
251–261.
Du, L. and Chen, Z. (2000) Identification of genes encoding receptorlike protein kinases as possible targets of pathogen- and salicylic
acid-induced WRKY DNA-binding proteins in Arabidopsis. Plant
J. 24, 837–847.
Durrant, W.E. and Dong, X. (2004) Systemic acquired resistance.
Annu. Rev. Phytopathol. 42, 185–209.
Friedrich, L., Vernooij, B., Gaffney, T., Morse, A. and Ryals, J. (1995)
Characterization of tobacco plants expressing a bacterial salicylate hydroxylase gene. Plant Mol. Biol. 29, 959–968.
Glazebrook, J. and Ausubel, F.M. (1994) Isolation of phytoalexindeficient mutants of Arabidopsis thaliana and characterization of
their interactions with bacterial pathogens. Proc. Natl Acad. Sci.
USA, 91, 8955–8959.
Glazebrook, J., Zook, M., Mert, F., Kagan, I., Rogers, E.E., Crute, I.R.,
Holub, E.B., Hammerschmidt, R. and Ausubel, F.M. (1997)
Phytoalexin-deficient mutants of Arabidopsis reveal that PAD4
encodes a regulatory factor and that four PAD genes contribute to
downy mildew resistance. Genetics, 146, 381–392.
Gomez-Gomez, L. and Boller, T. (2000) FLS2: an LRR receptor-like
kinase involved in the perception of the bacterial elicitor flagellin
in Arabidopsis. Mol. Cell, 5, 1003–1011.
Hammond-Kosack, K.E. and Jones, J.D. (1996) Resistance genedependent plant defense responses. Plant Cell, 8, 1773–1791.
Johnson, K.L. and Ingram, G.C. (2005) Sending the right signals:
regulating receptor kinase activity. Curr. Opin. Plant Biol. 8, 648–
656.
Lange, J., Xie, Z.-P., Broughton, W.J., Vogeli-Lange, R. and Boller, T.
(1999) A gene encoding a receptor like protein kinase in the roots
of common bean is differentially regulated in response to pathogens, symbionts and nodulation factors. Plant Sci. 142, 133–145.
Lawton, K., Weymann, K., Friedrich, L., Vernooij, B., Uknes, S. and
Ryals, J. (1995) Systemic acquired resistance in Arabidopsis
requires salicylic acid but not ethylene. Mol. Plant Microbe
Interact. 8, 863–870.
Lorrain, S., Vailleau, F., Balague, C. and Roby, D. (2003) Lesion
mimic mutants: keys for deciphering cell death and defense
pathways in plants? Trends Plant Sci. 8, 263–271.
Mach, J.M., Castillo, A.R., Hoogstraten, R. and Greenberg, J.T.
(2001) The Arabidopsis-accelerated cell death gene ACD2 encodes
red chlorophyll catabolite reductase and suppresses the spread of
disease symptoms. Proc. Natl Acad. Sci. USA, 98, 771–776.
Mahalingam, R., Gomez-Buitrago, A., Eckardt, N., Shah, N., Guevara-Garcia, A., Day, P., Raina, R. and Fedoroff, N.V. (2003)
Characterizing the stress/defense transcriptome of Arabidopsis.
Genome Biol. 4, R20.1–R20.14.
Malamy, J., Carr, J.P., Klessig, D.F. and Raskin, I. (1990) Salicylic
acid: a likely endogenous signal in the resistance response of
tobacco to viral infection. Science, 250, 1002–1004.
McNellis, T.W., Mudgett, M.B., Li, K., Aoyama, T., Horvath, D., Chua,
N.H. and Staskawicz, B.J. (1998) Glucocorticoid-inducible
expression of a bacterial avirulence gene in transgenic Arabidopsis induces hypersensitive cell death. Plant J. 14, 247–257.
Metraux, J.P., Seiger, H., Ryals, J., Ward, E., Wyss-Benz, M., Guadin,
J., Raschdoorf, K., Schmid, E., Blum, W. and Inveradi, B. (1990)
Increase in salicylic acid at the onset of systemic acquired
resistance in cucumber. Science, 250, 1004–1006.
Montesano, M., Koiv, V., Maee, A. and Pava, T. (2002) Novel
receptor-like kinase induced by Erwinia carotova and short
oligogalacturonides in potato. Mol. Plant Pathol. 2, 339–346.
Nawrath, C. and Metraux, J.P. (1999) Salicylic acid induction-deficient mutants of Arabidopsis express PR-2 and PR-5 and accumulate high levels of camalexin after pathogen inoculation. Plant
Cell, 11, 1393–1404.
Nawrath, C., Heck, S., Parinthawong, N. and Metraux, J.P. (2002)
EDS5, an essential component of salicylic acid-dependent signaling for disease resistance in Arabidopsis, is a member of the
MATE transporter family. Plant Cell, 14, 275–286.
Nimchuk, Z., Eulgem, T., Holt, B.F. III and Dangl, J.L. (2003)
Recognition and response in the plant immune system. Annu.
Rev. Genet. 37, 579–609.
Ohtake, Y., Takahashi, T. and Komeda, Y. (2000) Salicylic acid
induces the expression of a number of receptor-like kinase genes
in Arabidopsis thaliana. Plant Cell Physiol. 41, 1038–1044.
Parker, J.E., Holub, E.B., Frost, L.N., Falk, A., Gunn, N.D. and
Daniels, M.J. (1996) Characterization of eds1, a mutation in
Arabidopsis suppressing resistance to Peronospora parasitica
specified by several different RPP genes. Plant Cell, 8, 2033–2046.
Pieterse, C.M., van Wees, S.C., van Pelt, J.A., Knoester, M., Laan, R.,
Gerrits, H., Weisbeek, P.J. and van Loon, L.C. (1998) A novel
signaling pathway controlling induced systemic resistance in
Arabidopsis. Plant Cell, 10, 1571–1580.
Pilloff, R.K., Devadas, S.K., Enyedi, A. and Raina, R. (2002) The
Arabidopsis gain-of-function mutant dll1 spontaneously develops lesions mimicking cell death associated with disease. Plant J.
30, 61–70.
ª 2007 The Authors
Journal compilation ª 2007 Blackwell Publishing Ltd, The Plant Journal, (2007), 50, 488–499
Overexpression of CRK13 induces pathogen defense 499
Rate, D.N., Cuenca, J.V., Bowman, G.R., Guttman, D.S. and
Greenberg, J.T. (1999) The gain-of-function Arabidopsis acd6
mutant reveals novel regulation and function of the salicylic acid
signaling pathway in controlling cell death, defenses, and cell
growth. Plant Cell, 11, 1695–1708.
Ribnicky, D.M., Shulaev, V.V. and Raskin, I.I. (1998) Intermediates
of salicylic acid biosynthesis in tobacco. Plant Physiol. 118, 565–
572.
Rogers, E.E. and Ausubel, F.M. (1997) Arabidopsis enhanced disease susceptibility mutants exhibit enhanced susceptibility to
several bacterial pathogens and alterations in PR-1 gene expression. Plant Cell, 9, 305–316.
Ryals, J.A., Neuenschwander, U.H., Willits, M.G., Molina, A.,
Steiner, H.Y. and Hunt, M.D. (1996) Systemic acquired resistance.
Plant Cell, 8, 1809–1819.
Sessions, A., Burke, E., Presting, G. et al. (2002) A high-throughput Arabidopsis reverse genetics system. Plant Cell, 14, 2985–
2994.
Shiu, S.H. and Bleecker, A.B. (2001a) Receptor-like kinases from
Arabidopsis form a monophyletic gene family related to animal
receptor kinases. Proc. Natl Acad. Sci. USA, 98, 10763–10768.
Shiu, S.H. and Bleecker, A.B. (2001b) Plant receptor-like kinase gene
family: diversity, function, and signaling. Sci. STKE, 2001, RE22.
Song, W.Y., Wang, G.L., Chen, L.L. et al. (1995) A receptor kinaselike protein encoded by the rice disease resistance gene, Xa21.
Science, 270, 1804–1806.
Throdal-Christensen, H., Zhang, Z.G., Wei, Y.D. and Collinge, D.B.
(1997) Subcellular localization of H2O2 in plants: H2O2 accumulation in papillae and hypersensitive response during the barley–
powdery mildew interaction. Plant J. 11, 1187–1194.
Wildermuth, M.C., Dewdney, J., Wu, G. and Ausubel, F.M. (2001)
Isochorismate synthase is required to synthesize salicylic acid for
plant defence. Nature, 414, 562–565.
Yalpani, N., Leon, J., Lawton, M.A. and Raskin, I. (1993) Pathway of
salicylic acid biosynthesis in healthy and virus-inoculated
tobacco. Plant Physiol. 103, 315–321.
ª 2007 The Authors
Journal compilation ª 2007 Blackwell Publishing Ltd, The Plant Journal, (2007), 50, 488–499