Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Cancer Letters 331 (2013) 35–45 Contents lists available at SciVerse ScienceDirect Cancer Letters journal homepage: www.elsevier.com/locate/canlet Original Articles MYCN-mediated overexpression of mitotic spindle regulatory genes and loss of p53-p21 function jointly support the survival of tetraploid neuroblastoma cells Sina Gogolin a, Richa Batra b,1, Nathalie Harder b,1, Volker Ehemann c,1, Tobias Paffhausen a,1, Nicolle Diessl b,2, Vitaliya Sagulenko a, Axel Benner d, Stephan Gade e, Ingo Nolte f, Karl Rohr b, Rainer König b, Frank Westermann a,⇑ a Division of Tumor Genetics, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg, Germany Department of Bioinformatics and Functional Genomics, University of Heidelberg, BIOQUANT, IPMB and German Cancer Research Center (DKFZ), Im Neuenheimer Feld 267, 69120 Heidelberg, Germany c Department of Pathology, University of Heidelberg, Im Neuenheimer Feld 224, 69120 Heidelberg, Germany d Division of Biostatistics, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 580/581, 69120 Heidelberg, Germany e Division of Molecular Genetics, Cancer Genome Research, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg, Germany f Small Animal Clinic, University of Veterinary Medicine Hannover, Bünteweg 9, 30559 Hannover, Germany b a r t i c l e i n f o Article history: Received 25 July 2012 Received in revised form 5 November 2012 Accepted 8 November 2012 Keywords: p53 pRB Genomic instability Mitotic catastrophe Aneuploidy specific lethality genes a b s t r a c t High-risk neuroblastomas often harbor structural chromosomal alterations, including amplified MYCN, and usually have a near-di/tetraploid DNA index, but the mechanisms creating tetraploidy remain unclear. Gene-expression analyses revealed that certain MYCN/MYC and p53/pRB-E2F target genes, especially regulating mitotic processes, are strongly expressed in near-di/tetraploid neuroblastomas. Using a functional RNAi screening approach and live-cell imaging, we identified a group of genes, including MAD2L1, which after knockdown induced mitotic-linked cell death in MYCN-amplified and TP53-mutated neuroblastoma cells. We found that MYCN/MYC-mediated overactivation of the metaphase–anaphase checkpoint synergizes with loss of p53-p21 function to prevent arrest or apoptosis of tetraploid neuroblastoma cells. Ó 2012 Elsevier Ireland Ltd. All rights reserved. 1. Introduction Aneuploidy and chromosomal instability are hallmarks of most if not all cancers and play an essential role in tumor formation and progression [1]. Neuroblastoma, the most common solid extracranial tumor in early childhood, is characterized by contrasting clinical courses, ranging from low-risk to high-risk disease. To adjust therapy and improve prognosis, markers have been identified, such as loss of chromosome arm 1p/11q or MYCN amplification, that are associated with an aggressive disease and poor overall survival [2– 5]. Several studies have further shown an association of tumor ploidy and outcome in neuroblastoma [6–9]. Thus, near-diploid ⇑ Corresponding author. Tel.: +49 (0) 6221 423275; fax: +49 (0) 6221 423277. E-mail address: [email protected] (F. Westermann). These authors are contributed equally. Current address: Department of Genomics and Proteomics Core Facility, High Throughput Sequencing, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 580, 69120 Heidelberg, Germany. 1 2 0304-3835/$ - see front matter Ó 2012 Elsevier Ireland Ltd. All rights reserved. http://dx.doi.org/10.1016/j.canlet.2012.11.028 and near-tetraploid neuroblastomas are associated with poor outcome, whereas near-triploid/near-pentaploid tumors are associated with low-risk disease and may even undergo spontaneous maturation or regression [10,11]. Near-triploid/near-pentaploid neuroblastomas lack structural chromosomal alterations, whereas near-diploid and near-tetraploid neuroblastomas are frequently associated with structural chromosomal alterations, suggesting that numerical, whole-chromosome aneuploidy and ploidy changes associated with chromosomal instability may arise from at least two different mechanisms. To date, several models have been proposed about how aneuploidy might arise in cancer. One extensively investigated mechanism in recent years is the development of aneuploidy through a tetraploid genetically unstable intermediate [12,13]. An association between unscheduled tetraploidy, cell transformation and tumor formation has been shown at least in mice [14]. The appearance of tetraploid cells is characteristic especially for the pre-malignant condition Barrett’s esophagus [15] and early stages of cervical carcinogenesis [16] but can also be detected in several 36 S. Gogolin et al. / Cancer Letters 331 (2013) 35–45 other cancers independent of the tumor stage [17]. Tetraploidy can arise via cell fusion, cytokinesis failure, endoreduplication or mitotic slippage. Prolonged activation of the metaphase–anaphase checkpoint resulting from overexpressed metaphase–anaphase checkpoint genes, such as Mad2 [18], has been shown to provoke mitotic slippage associated with incomplete cytokinesis resulting in tetraploidization [19]. The main function of the metaphase–anaphase checkpoint is to inhibit the anaphase-promoting complex or cyclosome (APC/C) until the spindles have properly attached to all kinetochores, thereby preventing chromosome mis-segregation. Only one unattached kinetochore is sufficient to stop anaphase by Mad2 activation, which subsequently forms complexes with Cdc20, BubR1 and Bub3. These complexes prevent APC/C-mediated ubiquitylation of securin and, consequentially, separase-mediated cohesin degradation [20]. Deregulation of mitotic checkpoint genes, including MAD2L1, either by overexpression, reduced expression or mutation has been reported for many cancers, including neuroblastoma [1,21,22]. Recently, it has been suggested that overactivation of the metaphase–anaphase checkpoint might trigger aneuploidy induction in cells with a defective G1-S arrest as a consequence of non-functional pRB and p53-p21 [23]. Both the p53-p21 and pRB axes are deregulated especially in relapse neuroblastomas and tumor-derived cell lines through genetic aberrations that include TP53 mutation and/or amplification of MDM2, CDK4 or CCND1 [24–26]. Furthermore, MYCN impairs the p53-p21 and pRB pathway through transcriptional inhibition of p21 and upregulation of MDM2 and CDK4, which are direct p53 and pRB inhibitors, respectively [27–30]. An association between tetraploidy and loss of p53 function has been described for Barrett’s esophagus [31] and, more recently, for medulloblastoma [32]. Whether impaired p53-p21/ pRB-mediated checkpoints might further contribute to tetraploidy in neuroblastoma cells and whether deregulation of the metaphase–anaphase checkpoint contributes to the development of aneuploidy in neuroblastomas has not been investigated to date. To address both points, we analyzed the expression of MYCN/ MYC, p53 and pRB-E2F target genes, which are primarily involved in cell cycle regulation or neuronal differentiation, in association with tumor DNA index and structural chromosomal aberrations in a large cohort of primary neuroblastomas. We then used a functional siRNA screening approach combined with a live-cell imaging microscopy-based readout in two neuroblastoma cell lines with either low MYCN expression and functional p53 or amplified MYCN and mutated TP53 to determine the consequences of metaphase– anaphase checkpoint gene repression. 2. Material and methods 2.1. Tumor samples Clinical data and tumor samples from 483 patients enrolled in the German Neuroblastoma Trial and diagnosed between 1998 and 2010 were used in this study. Informed consent was collected within the trial protocol. 2.2. Cell culture Cell lines were maintained at 37 °C and 5% CO2 DMEM (SK-N-BE(2)-C) or RPMI (SH-EP and WAC2 [33,34]) supplemented with 10% FCS. SH-EP and SK-N-BE(2)-C were stably transfected with the H2B-GFP expression vector using Lipofectamine 2000 (Invitrogen Ltd., Paisley, UK) as previously described [35], and were maintained in DMEM supplemented with 10% FCS and 1.5 mg/ml G418. SH-EP-MYCN (TET21 N) cells stably expressing a tetracycline-regulatable MYCN transgene and a p21CIP1 shRNA were cultured and induced as previously described [29,36]. 2.3. Ploidy and cell cycle analysis Native cryo-conserved tumor samples were minced with scissors in 2.1% citric acid/0.5% Tween-20 [37,38]. Phosphate buffer (7.2 g Na2HPO4 2H2O in 100 ml distilled water, pH 8.0) containing 50 lg/ml 2,4 diamino-2-phenylindole (DAPI) was used to stain DNA. High resolution flow cytometric analyses were performed on the Galaxy pro flow cytometer (Partec, Münster, Germany) equipped with a mercury vapor lamp 100 W and DAPI filter. Data was acquired in the FCS-mode and histogram analyses were generated using the Multicycle program (Phoenix Flow Systems, San Diego, CA). Each histogram included 30,000–100,000 cells to calculate the DNA index and for cell cycle analysis. Human lymphocytes from healthy donors were used as an internal standard to calibrate the diploid DNA index. The mean coefficient of variation for diploid lymphocytes was 0.9. For cell cycle analysis, cells were plated in 75 cm2 flasks, and 24 h later induced with doxycycline and/or treated with vincristine or doxorubicin. 2.4. Reverse transfection on cell arrays Two different siRNAs (Ambion, Austin, Texas, USA) were used for knockdown of G2/M regulatory genes chosen from the microarray analysis [28]. Two control siRNAs (Ambion) and mock-transfection were used as negative controls. Transfection mixtures were prepared and one-chamber LabTeks (#155361, Thermo scientific nunc, Langenselbold, Germany) were spotted using an automated system in duplicates for each siRNA and dried as previously described [39]. To create cell array, 60,000 SH-EP/H2B-GFP or 100,000 SK-N-BE(2)-C/H2B-GFP were seeded per chamber and incubated with 1.5 ml growth medium at 37 °C and 5% CO2. The experiment was repeated four times for each cell line. 2.5. Image acquisition, image analysis Live-cell imaging was performed 16 h after transfection for 5 days at an acquisition rate of 35–40 min using an automated wide-field fluorescence microscope with 10 magnification as previously described [39]. Automatic segmentation and tracking was performed for all images, and mitotic events were detected using morphological features [40]. Images of cell nuclei were classified into interphase (round/elliptical nuclei with smooth boundaries), apoptotic (small bright nuclear fragments), mitotic (prometaphase, metaphase or anaphase nuclei) or clusters (two or more nuclei grouped too closely to be identified as separate objects) using Support Vector Machines (SVMs) in R with package e1071. Nuclei classified as artifacts (very low contrast) were discarded. The classification protocol was optimized for both neuroblastoma cell lines, where the performance of the classifier was manually evaluated. Classification errors were automatically corrected by checking the computed class sequences along the respective trajectories regarding their biological validity using a state transition model. The average classification accuracy for SH-EP and SK-N-BE(2)-C nuclei were 90% and 79%, respectively. Automatic error correction was only applied for SH-EP nuclei, since the tracking result for SK-NBE(2)-C nuclei was less reliable due to frequent unresolvable cell clusters. 2.6. Quantitative analysis of classified images The classified time series were further processed to identify the consequences of gene knockdown and to cluster genes with similar phenotype profiles. Our quantitative analysis included the following steps: (1) An adapted Z-Score normalization was performed as described elsewhere [41] for each cell array, time point and phenotype class to account for edge effects and other spatial errors on the cell arrays. (2) The time series for each gene was integrated in overlapping time windows for each well and phenotype class, yielding 13 time windows per 120 h of imaging with a single time window spanning 24 h including an 8 h overlap with the previous time window. The integrated time series of each time window was designated the ‘‘phenotype signal’’ for that time window. (3) The phenotype signals for each gene (four replicates using two siRNA constructs per gene) were compared to the phenotype signals to the phenotype signals of all other genes assayed using the Wilcoxon rank-sum test to determine if the gene phenotype was higher or lower than the overall population (significant if p-value 60.05). (4) For each gene, a ‘‘phenotype signature’’ was defined by the time window with the lowest p-value as computed above, and the first time window with a significant p-value. The ‘‘phenotype signature’’ included all phenotype classes (interphase, apoptosis, mitosis). (5) For further analysis, we only considered genes, which exhibited higher cell death, higher mitotic index and lower interphase counts than the overall population. (6) Genes were clustered into ‘‘phenoclusters’’ based on their phenotype signatures. Euclidean distances were computed, as similarity measure, for phenotype signatures of all pairs of genes. Using this similarity measure, hierarchical clustering of genes was performed using the R software package pvclust. 2.7. RNA interference WAC2 (SH-EPMYCN) or parental SH-EP cells were stably transfected with the doxycycline-inducible pcDNA6TR repressor following the manufacturer’s protocol (Invitrogen). Specific shRNA fragments targeting MAD2L1 (AATACGGACTCACCTTGCTTG, Gen BankTM accession number NM_002358) or, as control, SCRAMBLE (AACAGTCGCGTTTGCGACTGG, Ambion) were cloned into the pTER+vector [42]. WAC2pcDNA6TR or SH-EPpcDNA6TR cells were stably transfected with the pTER+ vector harboring shMAD2L1 or shSCRAMBLE using Effectene (QIAGEN, Hilden, Germany). Zeocin-resistant clones were cultured in RPMI supplemented with 10% 37 S. Gogolin et al. / Cancer Letters 331 (2013) 35–45 FCS, and selected for with 7.5 lg/ml blasticidine and 50 lg/ml zeocin. WAC2shMAD2L1 or SH-EP-shMAD2L1 clones were assayed for efficient MAD2L1 downregulation (western blotting upon doxycycline addition (100 nM)). not be rejected. (2) Implement a binary split in the DNA index. (3) Recursively repeate steps (1) and (2). For a general description of the methodology see Hothorn et al. [50]. 2.8. Protein expression 2.14. Gene expression analysis Whole cell lysates were prepared as previously described [43]. 50 lg of protein lysate was separated per lane on 12% SDS–PAGE. Blots were probed with antibodies directed against hMAD2 (1:2000; #610679, BD Biosciences, Franklin Lakes, NJ, USA), MYCN (1:1000; #sc-53993, Santa Cruz, CA, USA) and b-actin (1:5000; #A5441, Sigma–Aldrich, St. Louis, Missouri, USA). HSR–peroxidase labeled antimouse antibody (1:1000; #115-035-003, Dianova, Hamburg, Germany) was used as secondary antibody. Proteins were visualized using the ECL detection system (Amersham/GE Healthcare, Freiburg, Germany) and a chemiluminescence reader (VILBER Eberhardzell, Germany). Differential expression of the 144 oligonucleotide probes from a previously published gene expression-based classifier [47] was assessed for primary neuroblastomas from 133 patients out of the whole patient cohort and used for two-way hierarchical cluster analysis as previously described [28]. 3. Results 3.1. Tumor DNA index cut-off points 1.11 and 1.77 separate neuroblastoma patients with different outcomes 2.9. Fluorescence in situ hybridization (FISH) 2.10. Indirect immunofluorescence microscopy Cells were washed in PBS, then fixed in ice-cold methanol/acetone (1:1) onto microscope slides for 7 min. Fixed cells were then directly used for indirect immunofluorescence microscopy or stored at 20 °C. Following fixation cells were blocked in PBS-GSA (136.9 mM NaCL, 2.68 mM KCL, 0.01 M Na2HPO4, 1.76 mM KH2PO4, pH 7.4, 1% GSA) for 30 min, then incubated with primary human anti-centromere antibodies (CREST, 1:20) [46] in PBS-GSA for 60 min at ambient temperature in a humidified chamber. Slides were washed several times with PBS, incubated with a species-specific fluorescent secondary antibody (Alexa Fluor 488 mouse anti-human, 1:1000; Molecular Probes Invitrogen) for 30 min at ambient temperature, then washed several more times with PBS, once with distilled H2O and once with 100% ETOH. Slides were counterstained for 2 min with DAPI (0.25 lg/ml ddH2O; Sigma–Aldrich) and mounted in VECTASHIELD (Vector Laboratories, Inc., Burlingame, CA, USA). Immunofluorescence images were collected using a Zeiss ImagerZ.1 microscope and the Isis Metasystems, Version 5.0 software (MetaSystems, Altlussheim, Germany). 2.11. Pharmacological inhibition Cell cultures were treated with 0.1 lg/ml doxorubicin (TOC-2252-M010, Biozol Eching, Germany) and 0.05 lM vincristine (BML-T117-0005, Alexis Biochemicals, Lörrach, Germany), where indicated. To test the association of tumor ploidy with clinical and genetic markers, we analyzed the DNA indices of 483 primary tumors from patients enrolled in the German Neuroblastoma Trial (Supplementary Table 1) using flow cytometry. The frequency of tumor DNA indices peaked primarily at 1.0 and 1.5, and to a lesser extent at 2.0 and 2.5 (Fig. 1), which each defined tumor subtypes in the near-diploid, near-triploid, near-tetraploid and near-pentaploid range, respectively. We further analyzed the biological relevance of these subtypes by assessing their correlation with clinical outcome. A maximally selected log-rank statistic was used to analyze the relationship between overall survival and tumor DNA index. Using all 483 cases, we identified a DNA index cut-off value of 1.11 (maximally selected log-rank statistics, p < 0.001, Fig. 1) that separates two patient subgroups with significantly different outcome. Intriguingly, a second DNA index cut-off value at 1.77 was identified, when all near-diploid tumors with a DNA index 6 1.11 were excluded from the analysis (maximally selected log-rank statistics, p < 0.001, Supplementary Fig. 1), indicating that the group of aneuploid tumors (DNA index > 1.11) consists of at least two distinct subtypes associated with significantly different patient outcomes. Using maximally selected log-rank statistics, we did not find a third DNA index cut-off value that further separates the tumors in the higher aneuploid range (>1.77). We also applied classification and regression trees to evaluate the functional dependency between the tumor cell DNA index and overall survival (Supplementary Fig. 2A). This confirmed the two DNA index 40 Centromeric regions of chromosomes 3, 6, 8 and 18 were localized with fluorescently labeled plasmids (chromosome 3: pAE0.68 – Cy3 (GE Healthcare), chromosome 6: pEDZ6 – Cy3.5, chromosome 8: pZ8.4 – FITC (Molecular Probes, Eugene, Oregon, USA), and chromosome 18: 2Xba – DEAC (Molecular Probes)) as previously described [44], and 4-color FISH analysis was performed as previously described [45]. Images were analyzed using a Zeiss axiophot microscope and IPLap 10 software. 6 2.12. GO term enrichment/cluster analysis 4 20 3 Frequency 30 5 p=0.05 10 2 1 2.13. Statistics 0 0 To identify a model describing the relationship between survival and tumor cell DNA index (tumor cell ploidy), the functional form of this relationship was tested by maximally selected log-rank statistics as previously described [49]. Statistical analyses were conducted using the R software package, version 2.12.1. We also applied classification and regression trees to evaluate the functional dependency between the tumor cell DNA index (tumor cell ploidy) and age, stage, MYCN amplification and overall survival. Conditional inference trees were used to estimate the regression relationship by binary recursive partitioning in a conditional inference framework. At each node of the tree multiplicity-adjusted Monte-Carlo tests were applied using 10,000 random permutations. In order to split a node the p-value of the corresponding Monte-Carlo test had to be smaller than alpha = 5%. The algorithm works as follows: (1) Test the global null hypothesis of independence between the DNA index and the response. Stop if this hypothesis can- Standardized log-rank statistic Oligo sequences of 144 probes from the custom Agilent gene expression array [47] were mapped to the current version of the human genome (Genome Reference Consortium GRCh37) using BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi). A total of 123 probes had mapped perfect matches to confirmed transcripts. Gene ontology (GO) term enrichment and annotation cluster analysis was performed using the DAVID Bioinformatics Database 6.7 [48]. The transcript IDs mapped to 115 unique DAVID IDs. GO terms were enriched with an ease score <0.001. The ‘‘highest’’stringency settings were chosen to generate functional groups with tightly associating genes for annotation cluster analysis. 1.11 1.0 1.5 1.77 2.11 2.0 2.5 3.0 DNA index Fig. 1. Tumor near-di/tetraploidy correlates with poor outcome in neuroblastoma patients. Overlay of a maximally selected log-rank statistic of overall survival and a histogram of the DNA indices of 483 neuroblastomas. The DNA index cut-off points, 1.11 (⁄P = 1.155e 07) and 1.77, separate neuroblastoma patient subgroups with significantly different outcome. Tumors with DNA indices between 1.0 and 1.11 and between 1.77 and 2.11 (near-di/tetraploidy) were correlated with unfavorable patient outcome. Tumors with DNA indices between 1.11 and 1.77 or >2.11 (neartri/pentaploidy) were correlated with favorable patient outcome. 38 S. Gogolin et al. / Cancer Letters 331 (2013) 35–45 cut-off values at 1.11 and 1.77 (p = 0.039 and p = 0.004, respectively) and revealed a third DNA index cut-off value at 2.11 (p = 0.032). Together, these analyses defined patients with favorable outcomes as having near-triploid tumors (57%) with DNA indices between 1.11 and 1.77 or near-pentaploid (>2.11) tumors (4%) and patients with poor outcomes as having near-diploid tumors (28%) with DNA indices between 1.0 and 1.11 or near-tetraploid tumors with DNA indices between 1.77 and 2.11 tumors (11%) (Fig. 1). Furthermore, we evaluated a functional dependency between the DNA index cut-off values and the clinical or genetic markers, MYCN status, age at diagnosis >1.5 years, and stage 4, showing a significant association of these markers of unfavorable biology with near-di/tetraploidy subtypes (Supplementary Fig. 2B–D, Table 1). This supports not only that tumor DNA index is a prognostic marker for neuroblastoma patients, but also suggests that at least two distinct modes of mitotic failure result in either near-di/tetraploid or near-tri/pentaploid neuroblastomas. 3.2. Mitotic regulatory genes are overexpressed in neuroblastomas with unfavorable biology Oncogenic mutations in pathways (e.g. MYC, pRB, p53) that regulate genomic stability may trigger aneuploidy and chromosomal instability through the activation of transcriptional programs [51]. However, aneuploidy itself may induce transcriptional responses because aneuploid cells need to develop specific adaptations in order to proliferate with their altered genomes. To get insights into transcriptional changes associated with near-di/tetraploid and/or near-tri/pentaploid neuroblastomas, we analyzed gene expression profiles from our primary neuroblastoma cohort for expression of the 144 genes in a previously published gene expression-based classifier that distinguishes high- from low-risk neuroblastomas [47] and is enriched with MYCN/MYC target genes and p53/pRB-E2F-regulatory genes [28,52]. Signature expression profiles from 133 primary neuroblastomas from our patient cohort were analyzed using a two-way hierarchical cluster analysis. Expression of the 144-gene signature classified these 133 patients into four distinct subgroups that were enriched with either neardi/tetraploid or near-tri/pentaploid tumors: Group I patients were <1.5 years of age at diagnosis, had tumors with favorable prognostic markers, including tumor stage 1 or 2, near-tri/pentaploidy, normal MYCN status and normal chromosome 1p/11q status, and a favorable outcome. Patients in group II had tumors that were characterized by near-di/tetraploidy, amplified MYCN, deletion or imbalance of chromosome arm 1p and poor outcome. Group III patients had near-di/tetraploid, single-copy MYCN tumors with deletion or imbalance of chromosome arm 11q. Tumors from groups II and III patients had similar expression profiles of the 144-gene classifier with strong expression of direct MYCN/MYC and p53/ pRB-E2F target genes and low expression of neuronal differentiation genes. Gene expression profiles from group I tumors were reversed, with low expression of MYCN/MYC and p53/pRB-E2F target genes and strong neuronal differentiation gene expressions. Patients in group IV had tumors that were characterized by favorable clinical markers, near-tri/pentaploidy, normal 1p or 11q and normal MYCN status as well as favorable outcome, but presented an intermediate phenotype between groups I and II/III regarding the expression of the 144 genes of the gene expression-based classifier. Expression levels of neuronal differentiation genes were similar to tumors in group I, whereas expression of p53/pRB-E2F target genes were similar to group II/III tumors, and MYCN/MYC target gene expression was lower than in group II/III tumors (Fig. 2 and Supplementary Table 2). We classified the genes making up the 144-gene expression classifier according to their biological function using Gene Ontology (GO) term enrichment, then used annotation cluster analysis to create larger functionally descriptive groups using the DAVID Bioinformatics Database. Most genes in the 144-gene classifier are involved in chromosome segregation, spindle organization, microtubule-based processes, nuclear division or DNA replication. These could be clustered together into one main group regulating mitosis. A small subset of genes was involved in processes necessary for DNA repair and to respond to DNA damaging stimuli. Annotation cluster analysis of significantly enriched cellular components showed that genes in the classifier were assigned functions associated with the kinetochore or centromeric region (Supplementary Table 3). Both, results of the gene expression and GO term enrichment analyses revealed that near-di/tetraploid neuroblastomas possess functional expression signatures associated with mitotic checkpoint activation, which argues in favor of a MYCN/MYC-induced mitotic stress response and checkpoint activation via suppressed p53 and pRB functionality in these tumors. In contrast, near-tri/pentaploid neuroblastomas showed low MYCN/MYC target gene activation and retained neuronal differentiation signatures. However, mitotic checkpoint activation controlled by p53 and pRB was variable (low in group I versus high in group IV), which could argue for a weakening of p53 and pRB functionality at least in a subset of favorable near-tri/pentaploid tumors. 3.3. Loss of p53-p21 function is associated with tetraploidization in neuroblastoma cells Similar to the metaphase–anaphase checkpoint, the p53-p21 axis has an important role in limiting the expansion of aneuploid human cells. Loss of p53-p21 has been shown to result in cycling Table 1 Correlation of tumor ploidy and prognostic markers. Tumor ploidy Near-tri/pentaploidy (favorable) Fisher’s exact test Age in years <1.5 P1.5 76 113 204 90 <0.001 Stagea 1, 2, 3, 4s 4 86 103 240 54 <0.001 Amplified MYCN No Yes 126 63 276 18 <0.001 88 86 220 52 <0.001 1p Deletion/imbalance No Yes a P Near-di/tetraploidy (unfavorable) INSS = International Neuroblastoma Staging System. 39 S. Gogolin et al. / Cancer Letters 331 (2013) 35–45 Outcome MYCN group I group II group III group IV Neuronal differentiation (e.g. NTRK1, CAMTA1) MYCN/ MYC p53/pRB-E2F 1p Status 11q Status Ploidy Age Stage 133 patients p53/pRB-E2F target genes Array probe A _23_P 415443 A _23_P 88331 A _32_P 62997 A _24_P 323598 A _23_P 138507 A _23_P 51085 A _23_P 115872 A _23_P 65757 A _24_P 297539 A _23_P 74349 A _23_P 7636 A _23_P 48669 A _23_P 104651 A _23_P 107421 A _23_P 49972 A _23_P 50096 A _23_P 28886 A _24_P 234196 A _23_P 401 A _24_P 96780 A _23_P 23303 A _23_P 10385 A _24_P 53519 A _23_P 254733 Hs8 7 5 0 7 .1 A _23_P 155765 A _23_P 131866 A _23_P 96325 A _24_P 413884 A _23_P 323751 A _23_P 122197 Hs2 3 9 6 0 .1 A _32_P 151800 A _23_P 71727 Hs7 9 0 7 8 .1 0 A _23_P 92441 A _23_P 133123 A _23_P 252740 A _23_P 87351 A _23_P 18196 Hs4 2 2 7 8 9 .1 A _23_P 373119 A _23_P 90612 Hs1 5 5 4 6 2 .1 A _23_P 88740 Hs2 4 7 6 3 .1 A _23_P 36076 A _23_P 35219 A _23_P 122 443 Gene sym bol B RRN1 D LG7 PBK ESC O2 CDC2 S p c2 5 C 1 0 o rf3 C C NB 2 UB E 2 C CDCA1 P TTG 1 C D K N3 CDCA5 TK 1 CDC6 TYM S P C NA RRM 2 C E NP F C E NP F EXO1 RA M P C HA F 1 A M L F 1 IP B RIP 1 HM G B 2 S TK 6 F L J2 0 1 0 5 C E NP A C 2 0 o rf1 2 9 C C NB 1 C C NB 1 MGC 57827 CKS2 MA D 2L1 MA D 2L1 GAJ DCC1 RRM 1 RF C 4 V RK 1 HM G 4 L MCM6 MCM6 B M039 RA NB P 1 S S RP 1 NE K 2 HIS T1 H1 C MYCN/MYC target genes Array probe A _23_P 41280 A _23_P 21033 A _23_P 143958 A _23_P 17575 A _24_P 57367 A _23_P 114232 A _24_P 182182 A _32_P 98348 A _23_P 217609 A _23_P 126291 A _23_P 18422 A _23_P 78888 A _23_P 200507 Hs5 5 4 2 4 .1 A _23_P 58280 A _32_P 73903 Gene sym bol P A IC S GMPS LOC 200916 A HC Y A HC Y P RD X 4 S LC 25A 5 ZNF 5 2 5 RP L 3 6 A S NRP E M RP L 3 FBL HS P C 1 6 3 F L J1 0 1 5 1 NO L A 1 B X 119435 Fig. 2. Mitosis regulatory genes are strongly expressed targets of MYCN/MYC and p53/pRB-E2F signaling in unfavorable neuroblastomas. Two-way hierarchical cluster analysis of the 144 genes in the previously published gene expression-based classifier in 133 primary neuroblastomas (blue = high expression, green = low expression). The clinical covariates, patient outcome (black = death from disease, grey = progression/relapse, white = no event), MYCN status (black = amplified, white = non-amplified), chromosome arm 1p or 11q status (black = deletion/imbalance, grey = not defined, white = normal), ploidy (black = near-di/tetraploidy, white = near-tri/pentaploidy), age at diagnosis (white <1.5 years, black P1.5 years) and tumor stage using the International Neuroblastoma Staging System (black = 4, grey = 3, white = 1 or 2, yellow = 4s), were added to the gene expression heatmap. Patients were classified into four groups (I-IV). The gene expression cluster of direct MYCN/MYC and p53/pRB-E2F target genes is highlighted. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.) 4 N cells that underwent endoreduplication [53,54]. To investigate whether loss of p53-p21 function favors the propagation of viable tetraploid neuroblastoma cells, we analyzed the DNA index of SK- N-BE(2)-C cells, which harbor both amplified MYCN and mutated TP53. These cells are characterized by an impaired p53-p21/pRBmediated G1 arrest and low levels of apoptosis upon irradation-in- 40 S. Gogolin et al. / Cancer Letters 331 (2013) 35–45 duced DNA damage [55] and resistance to various chemotherapeutic drugs [56]. Flow cytometric analysis identified both diploid and tetraploid cell clones in SK-N-BE(2)-C cell cultures. The tetraploid cell clone expanded from 16% to 90% within nine rounds of passaging. DNA damage prior mitosis may increase tetraploidy in cells with impaired cell cycle checkpoints as a consequence of non-functional p53-p21 signaling [57]. Treatment of SK-N-BE(2)-C cultures with the DNA damage-inducing drug, doxorubicin, expanded the tetraploid fraction to 80% in only four rounds of passaging, and created an entirely tetraploid cell culture by passage 18. The diploid fraction was reduced accordingly in each passage after doxorubicin treatment (Table 2). To test the consequence of p21 inhibition at varying levels of MYCN on tumor cell ploidy, we used the SH-EP-MYCN cell model, which stably express a tetracyclineregulatable MYCN transgene allowing MYCN induction by removal of tetracycline from the culture medium [36]. Targeted MYCN expression in these cells caused a transient down-regulation of p21, which was compensated for over time (24 h) through p53 induction by MYCN [29]. To further abrogate p21 levels, we stably transfected SH-EP-MYCN cells with a shRNA targeting p21CIP1, or with scrambled shRNA as a control. Expression of the p21 protein was consistently reduced to <10% whether MYCN was induced or not in SH-EP-MYCN cells stably expressing p21CIP1 shRNA compared to the control cells (Supplementary Fig. 3). Repression of p21CIP1 by shRNA resulted in tetraploidization of about 30% of SH-EP-MYCN cells. Provoking DNA damage by using doxorubicin treatment increased the tetraploid fraction to 76%, similar to SK-N-BE(2)-C cells (Table 2), while targeted MYCN induction in SH-EP-MYCN cells expressing scrambled shRNA control did not induce tetraploidization (Supplementary Fig. 4). Furthermore, enhanced MYCN expression did not significantly further increase tetraploidization after shRNA-mediated p21 repression. These results indicate that an impaired p53-p21 axis is involved in tetraploidization of neuroblastoma cells, whereas transcriptional repression of p21CIP1 by targeted MYCN induction is insufficient to induce tetraploidization at least in MYCN-single-copy neuroblastoma cells. 3.4. Selective inhibition of mitotic checkpoint genes causes mitoticlinked cell death in MYCN-amplified and TP53-mutated neuroblastoma cells Mitotic regulatory genes are overexpressed in unfavorable neuroblastomas with suppressed p53 and pRB functionality. To test whether an overactivated metaphase–anaphase checkpoint supports the survival of cells lacking functional p53-p21 signaling, we performed a functional siRNA screen targeting mitotic regulatory genes controlled by MYCN/MYC and p53/pRB-E2F. We focused on a set of 240 genes with significantly higher expression in neu- roblastomas with unfavorable than favorable biology, which included those in the 144 gene-expression classifier (Supplementary Table 4). Each candidate gene was silenced using two different small interfering siRNAs. Two unrelated scrambled siRNAs were used as negative controls. Screening was performed in two neuroblastoma cell lines with different MYCN and TP53 genetic backgrounds stably expressing the H2B-GFP fluorescent chromatin marker to allow live-cell imaging microscopy-based readout. SH-EP were used as the control since they harbor singlecopy MYCN and wild-type TP53. SK-N-BE(2)-C harbor both amplified MYCN and mutated TP53. Cells were classified as being in interphase, mitosis or apoptosis during a 5-day culture period using 24-h time windows with an 8-h overlap to the previous time window. Genes were then clustered depending on the specific RNAi-mediated knockdown phenotype, which were defined as follows: (1) interphase arrest, (2) mitotic arrest, (3) primary apoptosis, (4) mitotic-linked cell death (secondary apoptosis out of mitotic arrest) and (5) mitotic slippage followed by interphase arrest and/or cell death (Fig. 3). Knockdown of 108 out of 240 genes significantly induced a phenotype in both cell lines, while knockdown of 56 and 39 genes induced a phenotype in only SK-NBE(2)-C or SH-EP cells, respectively. Mitotic-linked cell death was induced in SK-N-BE(2)-C cells via knockdown of a group of seven genes that included MAD2L1, ANLN, NCD80, RAD51, DPH5, ECSIT and SLC1A5, which are associated with metaphase–anaphase checkpoint regulation, mitotic exit or DNA repair [58–61]. Knockdown of any of these genes except RAD51 induced mitotic or interphase arrest in SH-EP cells instead of mitotic-linked cell death (Fig. 3). These results indicate that functional p53 compensates for a non-functional metaphase–anaphase checkpoint. In line with this, TP53 knockdown in SH-EP cells resulted in mitotic-linked cell death (Fig. 3, blue box). These results demonstrate that deregulating distinct genes downstream of p53/pRB-E2F at the mitotic checkpoint, and probably downstream of high MYCN activity, support the survival of MYCN-amplified neuroblastoma cells during mitotic arrest and checkpoint activation. 3.5. MAD2L1 repression in the presence of vincristine induces tetraploidization in neuroblastoma cells with functional p53-p21 Tetraplodization, however, was not only observed in neuroblastomas harboring mutated TP53 but also in primary tumors with functional p53 but deregulated MYCN. We further investigated this apparent interplay between deregulated MYCN and the metaphase–anaphase checkpoint in cells with functional p53-p21 in the WAC2-neuroblastoma cell model, which stably expresses a MYCN transgene driven by a CMV promoter in a wild-type TP53 genetic background. WAC2 cells are characterized by a near-diploid DNA index and express high levels of MYCN protein [33,34], which Table 2 Loss of p53–p21 functionality is associated with tetraploidization in neuroblastoma cells. Untreated SK-N-BE(2)-Ca passage 7 passage 9 passage 13 passage 18 SH-EP-MYCNb p21off + MYCNon p21off + MYCNoff * Doxorubicin-treated % Diploid % Aneuploid DI* % Diploid % Aneuploid DI* 83.4 ± 1.0 69.8 ± 2.0 36.9 ± 1.8 9.2 ± 0.5 16.6 ± 1.0 30.2 ± 2.0 63.1 ± 1.8 90.8 ± 0.5 1.92 1.91 1.89 1.87 12.1 ± 3.1 24.4 ± 2.1 19.5 ± 13.7 - 87.9 ± 3.1 75.6 ± 2.1 80.5 ± 13.7 100.0 ± 0.0 2.00 1.99 1.97 2.00 66.1 ± 3.7 66.8 ± 3.3 33.9 ± 3.7 33.2 ± 3.3 1.93 1.92 21.1 ± 6.4 27.4 ± 8.0 78.9 ± 6.4 72.6 ± 8.0 1.98 1.97 DI = DNA index (SD < 0.02). Mean ± SD of triplicates from one representative experiment. b Mean ± SD of triplicates from two independent experiments. a 41 S. Gogolin et al. / Cancer Letters 331 (2013) 35–45 Height 0 5 10 Height 15 5 0 SK-N-BE(2)-C 10 15 SH-EP # ** * interphase arrest interphase arrest * ** mitotic arrest primary apoptosis *** primary apoptosis mitotic-linked cell death mitotic-linked cell death cluster dendrogramm eith AU/BP values (%) mitotic arrest distance: euclicean cluster method: centroid mitotic-linked cell death: gene symbol full gene name function MAD2L1 mitotic arrest deficient-like 1 mitotic cell cycle checkpoint ANLN anillin, actin binding protein septin ring assembly (regulation of exit from mitosis) DPH5 DPH5 homolog (S. cerevisiae) diphthine synthase activity ECSIT evolutionary conserved signaling intermediate in Toll pathways RAD51 homolog (S. cerevisiae) cytoplasmic signaling in Toll-like and BMP signal transduction pathways mitotic recombination/DNA repair NDC80 homolog, kinetochore complex component (S. cerevisiae) solute carrier family 1 (neutral amino acid transporter), member 5 mitotic checkpoint signaling RAD51 NDC80 SLC1A5 neutral amino acid transmembrane transporter activity Fig. 3. Mitotic-linked cell death after selective inhibition of metaphase–anaphase checkpoint genes in MYCN-amplified neuroblastoma cells. Genes were grouped according to the phenotype after specific gene knockdown in SK-N-BE(2)-C/H2B-GFP (MYCN-amplified and TP53 inactivating mutation) and SH-EP/H2B-GFP (MYCN-single-copy and wildtype TP53) cells using hierarchical cluster analysis. ⁄Gene knockdown in this cluster revealed interphase arrest escape into mitotic arrest or vice versa. ⁄⁄Gene knockdown in this cluster caused secondary cell death after interphase arrest. ⁄⁄⁄Gene knockdown in this cluster caused a mixture of mitotic-linked cell death, secondary apoptosis after interphase arrest and mitotic slippage into interphase arrest followed by secondary apoptosis. # Knockdown of KIF11 caused primary apoptosis and knockdown of SIAH2 caused mitotic-linked cell death. (1) MYCN/MYC target gene and (2) E2F target gene, (NA) = neither MYCN/MYC nor E2F target gene. Phenoclusters were generated using Euclidean distance as a dissimilarity measure. Values on branches are in percentages. P-values are shown for the approximate unbiased test (red) and bootstrap probabilities (green). The group of seven genes that induced ‘‘mitotic-linked cell death’’ in SK-N-BE(2)-C but not in SH-EP cells is highlighted (red boxes). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.) 42 S. Gogolin et al. / Cancer Letters 331 (2013) 35–45 A WAC2shMAD2L1 SH-EPshMAD2L1 96% 58% MAD2L1 MYCN β-actin doxycycline + B - + - G0/G1 G2/M S 2N cells [%] 80 4N 2N control 80 4N 2N 80 MAD2L1 expressed + vincristine 60 60 60 40 40 40 20 20 20 0 0 G0/1 2N S G2/M 4N 8N MAD2L1 repressed + vincristine 0 G0/1 2N 8N 4N S G2/M 4N G0/1 2N 8N S G2/M 4N 8N C 2N 4N 8N D Fig. 4. MAD2L1 silencing after vincristine treatment induces tetraploidization in neuroblastoma cells with functional p53-p21. (A) Western blot showing MAD2L1 and MYCN expression in whole-cell lysates from WAC2 and SH-EP cells stably transfected with shRNA targeting MAD2L1. (B) Flow cytometric analysis of cell cycle and ploidy in WAC2shMAD2L1 cell cultures 36 h after treatment. Curves are paired with bar-graph quantifications (below) for each treatment group. (C) 2-color FISH of WAC2-shMAD2L1 after 36 h of vincristine treatment and MAD2L1 shRNA induction using centromeric probes for chromosome 6 and 8 (pink and green, respectively) and counterstained with DAPI (blue). Representative images from 250 interphases are shown. (D) Merged immunofluorescence images of WAC2-shMAD2L1 stained for centromers with CREST antibodies (green) and DNA (blue) to visualize altered nuclear size after combined MAD2L1 silencing and vincristine treatment. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.) 43 S. Gogolin et al. / Cancer Letters 331 (2013) 35–45 Activated aneuploid checkpoints Impaired p53-p21-dependent aneuploid checkpoint high MYCN high MYCN * p53 pRB p21 p53 pRB p21 metaphase-anaphase checkpoint activation e.g. MAD2L1 metaphase-anaphase checkpoint activation e.g. MAD2L1 near-diploid neuroblastomas elevated cellular fitness tetraploid neuroblastomas elevated cellular fitness *inactivating mutation ** **MAD2L1 inhibition reduces cellular fitness Fig. 5. Schematic model describing the role of MYCN and aneuploidy checkpoints in the development of tetraploid neuroblastomas. results in metaphase–anaphase checkpoint overactivation. The parental SH-EP cell line, which is characterized by single-copy MYCN, barely detectable MYCN levels and a lower metaphase–anaphase checkpoint activation status, was used as a control. To test the effect of metaphase–anaphase checkpoint deregulation in a functional p53-p21 background, we stably transfected the WAC2 and SH-EP cell lines with a doxycycline-inducible shRNA targeting the metaphase–anaphase checkpoint regulator, MAD2L1. The SHEP-MYCN neuroblastoma cell model was not suitable for these experiments because these cells already express a tetra-/doxycycline inducible system. MAD2L1 was effectively repressed upon shMAD2L1 induction in both SH-EP and WAC2 cells, as demonstrated by western blotting (Fig. 4A). The cell proportions in different phases of the cell cycle were similar for SH-EP-shMAD2L1 and WAC2-shMAD2L1 cells with or without MAD2L1 knockdown and to control cells expressing scrambled shRNA. To mimic a weakened p53-p21 checkpoint, we treated both cell lines with vincristine, which disrupts microtubule formation and reduces nuclear accumulation of p53, consequently preventing the transcriptional activation of p21 [62]. Vincristine treatment resulted in G2/M arrest of 4 N cells in both WAC2-shMAD2L1 and SH-EP-shMAD2L1 cells expressing MAD2L1 (Fig. 4B and Supplementary Fig. 5). Combined inhibition of the p53-p21 axis (vincristine treatment) and the metaphase–anaphase checkpoint (MAD2L1 silencing) resulted in approximately 40% of the WAC2-shMAD2L1 cells being 8 N, indicative of cycling tetraploid cells (Fig. 4B and Supplementary Fig. 5A). Only about 5% of SH-EP-shMAD2L1 cells were 8 N following combined vincristine treatment and MAD2L1 silencing (Supplementary Fig. 5B). These results strengthen our hypothesis that deregulated MYCN is associated with tetraploidization when p53-p21 signaling is weakened and the metaphase–anaphase checkpoint unbalanced. To further verify induction of tetraploidization in WAC2shMAD2L1 cells, centromeric regions of chromosome 6 and 8 were labeled with fluorescent dyes (Cy3.5 and FITC, respectively) and 2color FISH was performed. In addition to cells with two signals for each centromer, indicative of normal diploid cells, interphase nuclei with four or eight centromeric signals, indicative of cycling tetraploid cells, were also observed after MAD2L1 repression and vincristine treatment in WAC2-shMAD2L1 cells (Fig. 4C). For complete confirmation, 4-color FISH for chromosome 3, 6, 8 and 18 centromeres was also performed, and at least 250 interphase nuclei were manually counted from WAC2-shMAD2L1 cell cultures treated with vincristine and expressing MAD2L1 or not. The numerical index of centromeric signals was used as a direct indicator for nuclear DNA content. The fraction of 8 N cells reached 8.7% 18 h after shMAD2L1 induction and vincristine treatment. After 36 h, the 8 N fraction had increased from 8.7% to 30.1% (Supplementary Table 5). Interphase nuclei of 8 N cells appeared strongly enlarged with an asymmetrical shape in contrast to small, round diploid cells (Fig. 4C and D). We also detected 3.5% 16 N cells 36 h after induction and treatment. Vincristine treatment alone resulted in 5.1% 8 N cells after 36 h of treatment (Supplementary Table 5). Immunofluorescence imaging using a CREST antibody that unspecifically binds to centromeric regions further supported the observation of polyploidization after MAD2L1 knockdown and vincristine treatment (Fig. 4D). 4. Discussion In this study, we show that overactivation of the metaphase– anaphase checkpoint acts as a pro-survival mechanism in the development of tetraploid neuroblastoma cells lacking functional p53-p21 signaling. Elevated expression of mitotic spindle regulatory genes has been shown to be associated with MYCN amplification and 1p loss in neuroblastomas [52,63,64]. This is consistent with our gene expression analyses in primary neuroblastoma tumors, which further showed that overexpression of MYCN/MYC and p53/pRB-E2F target genes, especially those involved in regulating mitotic processes, such as sister chromatid segregation, microtubule organization or metaphase–anaphase checkpoint regulation, is associated with near-di/tetraploidy and poor outcome in neuroblastoma patients. One gene we identified in this regard was MAD2L1, which is a direct MYC and E2F-1 target [22,65]. This suggests that MYCN/MYC-mediated overactivation of the metaphase–anaphase checkpoint might be causally involved in the development of near-di/tetraploidy by initially provoking sustained mitotic arrest, as shown for Mad2 overexpression [66]. Cells might escape this sustained arrest by mitotic slippage – an adaptation that consequently results in the failure of cytokinesis and tetraploidy [1]. Our observation that neuroblastoma cells lacking p53- 44 S. Gogolin et al. / Cancer Letters 331 (2013) 35–45 p21 function, either through TP53 mutation or mediated by p21CIP1 knockdown, consist of diploid and tetraploid cell fractions indicates that functional p53-p21-mediated checkpoints are required to arrest these cells [53,67] and to subsequently initiate cell death or senescence programs [57]. Evidence that p53 and p21 inactivation is mainly involved in the origin of tetraploidy exists in the mouse model p53-R172P equivalent to R175P in human, which harbor an Arg-to-Pro TP53 mutation. The p53 in cells from these mice is incapable of inducing apoptosis, but still activated p21-mediated G1-S arrest [68]. Accordingly, these mice developed tumors with a diploid DNA index. Crossing the TP53-mutant mice into a p21 / background resulted in formation of aneuploid tumors. Some evidence exists for a potential association between tetraploidy and loss of p53-p21 functionality in neuroblastoma. Additionally to SK-N-BE(2)-C cells, other neuroblastoma cell lines harboring mutant TP53 are characterized by a near-tetraploid DNA index, including LA-N-1, NMB and NB-6 [69–72]. Whole genome sequencing of primary neuroblastomas revealed that at least some tetraploid tumors harbored TP53 mutations (unpublished data). This genetic alteration, although frequent in many other cancers, occurs mainly in relapse neuroblastomas and is associated with therapy resistance [55], suggesting a direct connection of p53 functionality to neuroblastoma biology. A direct connection between the p53-p21 axis, mitotic spindle regulatory genes and tetraplodization was presented by Schvartzman, et al. using the same TP53-mutant and p21-deficient mice. He showed that p21 is a direct negative Mad2 regulator and that normalization of Mad2 expression reduced the aneuploid cell fraction in these murine tumors [73]. In cells lacking p53 and/or p21 function, overactivation of metaphase–anaphase checkpoint members might, therefore, facilitate the development and survival of tetraploid cells (Fig. 5). We observed that tetraploid cell fractions increased after several passages or drug-induced DNA damage in both the TP53-mutated neuroblastoma cell line and in neuroblastoma cells silenced for p21CIP1 expression. Our siRNA screening approach also demonstrated that knockdown of genes involved in metaphase–anaphase checkpoint regulation, including MAD2L1, induced mitotic-linked cell death only in neuroblastoma cells lacking p53-p21 function as a consequence of TP53 mutation. These results from various in vivo and in vitro studies show that functional p53-p21 signaling is crucial to control the expression of metaphase–anaphase checkpoint genes and to inhibit the survival of tetraploid cells. In summary, the results we present here reveal novel insights into how genetic aberrations of the p53-p21 axis contribute to tetraploidy in neuroblastoma cells. These data enhance our understanding of how MYCN/MYC mediates aggressive behavior in neuroblastomas. Since overactivation of the metaphase–anaphase checkpoint supports the survival of tetraploid cells lacking p53p21 function, targeted inhibition of certain metaphase–anaphase checkpoint members, such as MAD2L1, may provide a therapeutic option for neuroblastomas harboring genomic alterations reducing p53-p21 function. Acknowledgments We thank Geoffrey M. Wahl for providing the H2B-GFP expression vector, Frank Berthold, Barbara Hero and the German Neuroblastoma Study Group for providing clinical data, and Kathy Astrahantseff for manuscript editing. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.canlet.2012. 11.028. References [1] B.A. Weaver, D.W. Cleveland, Does aneuploidy cause cancer?, Current Opinion in Cell Biology 18 (2006) 658–667 [2] R. Spitz, B. Hero, T. Simon, F. Berthold, Loss in chromosome 11q identifies tumors with increased risk for metastatic relapses in localized and 4S neuroblastoma, Clinical Cancer Research 12 (2006) 3368–3373. [3] E.F. Attiyeh, W.B. London, Y.P. Mosse, Q. Wang, C. Winter, D. Khazi, P.W. McGrady, R.C. Seeger, A.T. Look, H. Shimada, G.M. Brodeur, S.L. Cohn, K.K. Matthay, J.M. Maris, Chromosome 1p and 11q deletions and outcome in neuroblastoma, New England Journal of Medicine 353 (2005) 2243–2253. [4] G.M. Brodeur, R.C. Seeger, M. Schwab, H.E. Varmus, J.M. Bishop, Amplification of N-myc in untreated human neuroblastomas correlates with advanced disease stage, Science 224 (1984) 1121–1124. [5] R.C. Seeger, G.M. Brodeur, H. Sather, A. Dalton, S.E. Siegel, K.Y. Wong, D. Hammond, Association of multiple copies of the N-myc oncogene with rapid progression of neuroblastomas, New England Journal of Medicine 313 (1985) 1111–1116. [6] R. Ladenstein, I.M. Ambros, U. Potschger, G. Amann, C. Urban, F.M. Fink, K. Schmitt, R. Jones, M. Slociak, F. Schilling, J. Ritter, F. Berthold, H. Gadner, P.F. Ambros, Prognostic significance of DNA di-tetraploidy in neuroblastoma, Medical and Pediatric Oncology 36 (2001) 83–92. [7] R. Bagatell, P. Rumcheva, W.B. London, S.L. Cohn, A.T. Look, G.M. Brodeur, C. Frantz, V. Joshi, P. Thorner, P.V. Rao, R. Castleberry, L.C. Bowman, Outcomes of children with intermediate-risk neuroblastoma after treatment stratified by MYCN status and tumor cell ploidy, Journal of Clinical Oncology 23 (2005) 8819–8827. [8] R.E. George, W.B. London, S.L. Cohn, J.M. Maris, C. Kretschmar, L. Diller, G.M. Brodeur, R.P. Castleberry, A.T. Look, Hyperdiploidy plus nonamplified MYCN confers a favorable prognosis in children 12–18 months old with disseminated neuroblastoma: a Pediatric Oncology Group study, Journal of Clinical Oncology 23 (2005) 6466–6473. [9] J. Schneiderman, W.B. London, G.M. Brodeur, R.P. Castleberry, A.T. Look, S.L. Cohn, Clinical significance of MYCN amplification and ploidy in favorable-stage neuroblastoma: a report from the Children’s Oncology Group, Journal of Clinical Oncology 26 (2008) 913–918. [10] G.M. Brodeur, Neuroblastoma: biological insights into a clinical enigma, Nature Reviews. Cancer 3 (2003) 203–216. [11] F. Westermann, M. Schwab, Genetic parameters of neuroblastomas, Cancer Letters 184 (2002) 127–147. [12] N.J. Ganem, Z. Storchova, D. Pellman, Tetraploidy, aneuploidy and cancer, Current Opinion in Genetics & Development 17 (2007) 157–162. [13] Z. Storchova, D. Pellman, From polyploidy to aneuploidy, genome instability and cancer, Nature Reviews 5 (2004) 45–54. [14] T. Fujiwara, M. Bandi, M. Nitta, E.V. Ivanova, R.T. Bronson, D. Pellman, Cytokinesis failure generating tetraploids promotes tumorigenesis in p53-null cells, Nature 437 (2005) 1043–1047. [15] M.T. Barrett, D. Pritchard, C. Palanca-Wessels, J. Anderson, B.J. Reid, P.S. Rabinovitch, Molecular phenotype of spontaneously arising 4N (G2-tetraploid) intermediates of neoplastic progression in Barrett’s esophagus, Cancer Research 63 (2003) 4211–4217. [16] A.J. Olaharski, R. Sotelo, G. Solorza-Luna, M.E. Gonsebatt, P. Guzman, A. Mohar, D.A. Eastmond, Tetraploidy and chromosomal instability are early events during cervical carcinogenesis, Carcinogenesis 27 (2006) 337–343. [17] Z. Storchova, C. Kuffer, The consequences of tetraploidy and aneuploidy, Journal of Cell Science 121 (2008) 3859–3866. [18] R. Sotillo, E. Hernando, E. Diaz-Rodriguez, J. Teruya-Feldstein, C. Cordon-Cardo, S.W. Lowe, R. Benezra, Mad2 overexpression promotes aneuploidy and tumorigenesis in mice, Cancer Cell 11 (2007) 9–23. [19] C.L. Rieder, H. Maiato, Stuck in division or passing through: what happens when cells cannot satisfy the spindle assembly checkpoint, Developmental Cell 7 (2004) 637–651. [20] A. Musacchio, E.D. Salmon, The spindle-assembly checkpoint in space and time, Nature Reviews 8 (2007) 379–393. [21] A.J. Holland, D.W. Cleveland, Boveri revisited: chromosomal instability, aneuploidy and tumorigenesis, Nature Reviews 10 (2009) 478–487. [22] E. Hernando, Z. Nahle, G. Juan, E. Diaz-Rodriguez, M. Alaminos, M. Hemann, L. Michel, V. Mittal, W. Gerald, R. Benezra, S.W. Lowe, C. Cordon-Cardo, Rb inactivation promotes genomic instability by uncoupling cell cycle progression from mitotic control, Nature 430 (2004) 797–802. [23] M. Malumbres, Oncogene-induced mitotic stress: p53 and pRb get mad too, Cancer Cell 19 (2011) 691–692. [24] J. Carr-Wilkinson, K. O’Toole, K.M. Wood, C.C. Challen, A.G. Baker, J.R. Board, L. Evans, M. Cole, N.K. Cheung, J. Boos, G. Kohler, I. Leuschner, A.D. Pearson, J. Lunec, D.A. Tweddle, High Frequency of p53/MDM2/p14ARF Pathway Abnormalities in Relapsed Neuroblastoma, Clinical Cancer Research 16 (2010) 1108–1118. [25] J.J. Molenaar, M.E. Ebus, J. Koster, P. van Sluis, C.J. van Noesel, R. Versteeg, H.N. Caron, Cyclin D1 and CDK4 activity contribute to the undifferentiated phenotype in neuroblastoma, Cancer Research 68 (2008) 2599–2609. [26] J.J. Molenaar, P. van Sluis, K. Boon, R. Versteeg, H.N. Caron, Rearrangements and increased expression of cyclin D1 (CCND1) in neuroblastoma, Genes, Chromosomes & Cancer 36 (2003) 242–249. [27] A. Slack, Z. Chen, R. Tonelli, M. Pule, L. Hunt, A. Pession, J.M. Shohet, The p53 regulatory gene MDM2 is a direct transcriptional target of MYCN in S. Gogolin et al. / Cancer Letters 331 (2013) 35–45 [28] [29] [30] [31] [32] [33] [34] [35] [36] [37] [38] [39] [40] [41] [42] [43] [44] [45] [46] [47] neuroblastoma, Proceedings of the National Academy of Sciences of the United States of America 102 (2005) 731–736. F. Westermann, D. Muth, A. Benner, T. Bauer, K.O. Henrich, A. Oberthuer, B. Brors, T. Beissbarth, J. Vandesompele, F. Pattyn, B. Hero, R. Konig, M. Fischer, M. Schwab, Distinct transcriptional MYCN/c-MYC activities are associated with spontaneous regression or malignant progression in neuroblastomas, Genome Biology 9 (2008) R150. I. Eckerle, D. Muth, J. Batzler, K.O. Henrich, W. Lutz, M. Fischer, O. Witt, M. Schwab, F. Westermann, Regulation of BIRC5 and its isoform BIRC5-2B in neuroblastoma, Cancer Letters 285 (2009) 99–107. J. Seoane, H.V. Le, J. Massague, Myc suppression of the p21(Cip1) Cdk inhibitor influences the outcome of the p53 response to DNA damage, Nature 419 (2002) 729–734. P.C. Galipeau, D.S. Cowan, C.A. Sanchez, M.T. Barrett, M.J. Emond, D.S. Levine, P.S. Rabinovitch, B.J. Reid, 17p (p53) allelic losses, 4N (G2/tetraploid) populations, and progression to aneuploidy in Barrett’s esophagus, Proceedings of the National Academy of Sciences of the United States of America 93 (1996) 7081–7084. D.T. Jones, N. Jager, M. Kool, T. Zichner, B. Hutter, M. Sultan, Y.J. Cho, T.J. Pugh, V. Hovestadt, A.M. Stutz, T. Rausch, H.J. Warnatz, M. Ryzhova, S. Bender, D. Sturm, S. Pleier, H. Cin, E. Pfaff, L. Sieber, A. Wittmann, M. Remke, H. Witt, S. Hutter, T. Tzaridis, J. Weischenfeldt, B. Raeder, M. Avci, V. Amstislavskiy, M. Zapatka, U.D. Weber, Q. Wang, B. Lasitschka, C.C. Bartholomae, M. Schmidt, C. von Kalle, V. Ast, C. Lawerenz, J. Eils, R. Kabbe, V. Benes, P. van Sluis, J. Koster, R. Volckmann, D. Shih, M.J. Betts, R.B. Russell, S. Coco, G.P. Tonini, U. Schuller, V. Hans, N. Graf, Y.J. Kim, C. Monoranu, W. Roggendorf, A. Unterberg, C. Herold-Mende, T. Milde, A.E. Kulozik, A. von Deimling, O. Witt, E. Maass, J. Rossler, M. Ebinger, M.U. Schuhmann, M.C. Fruhwald, M. Hasselblatt, N. Jabado, S. Rutkowski, A.O. von Bueren, D. Williamson, S.C. Clifford, M.G. McCabe, V.P. Collins, S. Wolf, S. Wiemann, H. Lehrach, B. Brors, W. Scheurlen, J. Felsberg, G. Reifenberger, P.A. Northcott, M.D. Taylor, M. Meyerson, S.L. Pomeroy, M.L. Yaspo, J.O. Korbel, A. Korshunov, R. Eils, S.M. Pfister, P. Lichter, Dissecting the genomic complexity underlying medulloblastoma, Nature 488 (2012) 100–105. L. Schweigerer, S. Breit, A. Wenzel, K. Tsunamoto, R. Ludwig, M. Schwab, Augmented MYCN expression advances the malignant phenotype of human neuroblastoma cells: evidence for induction of autocrine growth factor activity, Cancer Research 50 (1990) 4411–4416. L. Schweigerer, P. Scheurich, T. Fotsis, Enhanced MYCN oncogene expression in human neuroblastoma cells results in increased susceptibility to growth inhibition by TNF alpha, Biochemical and Biophysical Research Communications 170 (1990) 1301–1307. T. Kanda, K.F. Sullivan, G.M. Wahl, Histone-GFP fusion protein enables sensitive analysis of chromosome dynamics in living mammalian cells, Current Biology 8 (1998) 377–385. W. Lutz, M. Stohr, J. Schurmann, A. Wenzel, A. Lohr, M. Schwab, Conditional expression of N-myc in human neuroblastoma cells increases expression of alpha-prothymosin and ornithine decarboxylase and accelerates progression into S-phase early after mitogenic stimulation of quiescent cells, Oncogene 13 (1996) 803–812. V. Ehemann, B. Hashemi, A. Lange, H.F. Otto, Flow cytometric DNA analysis and chromosomal aberrations in malignant glioblastomas, Cancer Letters 138 (1999) 101–106. V. Ehemann, J. Sykora, J. Vera-Delgado, A. Lange, H.F. Otto, Flow cytometric detection of spontaneous apoptosis in human breast cancer using the TUNELtechnique, Cancer Letters 194 (2003) 125–131. H. Erfle, B. Neumann, U. Liebel, P. Rogers, M. Held, T. Walter, J. Ellenberg, R. Pepperkok, Reverse transfection on cell arrays for high content screening microscopy, Nature Protocols 2 (2007) 392–399. N. Harder, R. Batra, S. Gogolin, N. Diessl, R. Eils, F. Westermann, R. König, K. Rohr, Large-scale tracking for cell migration and proliferation analysis and experimental optimization of high-throughput screens, in: Proc. 6th Internat. Workshop on Microscopic Image Analysis with Applications in Biology (MIAAB ‘11), 2011. C. Brideau, B. Gunter, B. Pikounis, A. Liaw, Improved statistical methods for hit selection in high-throughput screening, Journal of Biomolecular Screening 8 (2003) 634–647. M. van de Wetering, I. Oving, V. Muncan, M.T. Pon Fong, H. Brantjes, D. van Leenen, F.C. Holstege, T.R. Brummelkamp, R. Agami, H. Clevers, Specific inhibition of gene expression using a stably integrated, inducible smallinterfering-RNA vector, EMBO Reports 4 (2003) 609–615. E.A. Afanasyeva, P. Mestdagh, C. Kumps, J. Vandesompele, V. Ehemann, J. Theissen, M. Fischer, M. Zapatka, B. Brors, L. Savelyeva, V. Sagulenko, F. Speleman, M. Schwab, F. Westermann, MicroRNA miR-885-5p targets CDK2 and MCM5, activates p53 and inhibits proliferation and survival, Cell Death and Differentiation 18 (2011) 974–984. O. Henegariu, P. Bray-Ward, D.C. Ward, Custom fluorescent-nucleotide synthesis as an alternative method for nucleic acid labeling, Nature Biotechnology 18 (2000) 345–348. L. Savelyeva, E. Sagulenko, J.G. Schmitt, M. Schwab, The neurobeachin gene spans the common fragile site FRA13A, Human Genetics 118 (2006) 551–558. P. Kett, B. Geiger, V. Ehemann, D. Komitowski, Three-dimensional analysis of cell nucleus structures visualized by confocal scanning laser microscopy, Journal of Microscience 167 (1992) 169–179. A. Oberthuer, F. Berthold, P. Warnat, B. Hero, Y. Kahlert, R. Spitz, K. Ernestus, R. Konig, S. Haas, R. Eils, M. Schwab, B. Brors, F. Westermann, M. Fischer, Customized oligonucleotide microarray gene expression-based classification [48] [49] [50] [51] [52] [53] [54] [55] [56] [57] [58] [59] [60] [61] [62] [63] [64] [65] [66] [67] [68] [69] [70] [71] [72] [73] 45 of neuroblastoma patients outperforms current clinical risk stratification, Journal of Clinical Oncology 24 (2006) 5070–5078. W. Huang da, B.T. Sherman, R.A. Lempicki, Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources, Nature Protocols 4 (2009) 44–57. K.O. Henrich, M. Fischer, D. Mertens, A. Benner, R. Wiedemeyer, B. Brors, A. Oberthuer, F. Berthold, J.S. Wei, J. Khan, M. Schwab, F. Westermann, Reduced expression of CAMTA1 correlates with adverse outcome in neuroblastoma patients, Clinical Cancer Research 12 (2006) 131–138. T. Hothorn, K. Hornik, A. Zeileis, Unbiased recursive partitioning: a conditional inference framework, Journal of Computational and Graphical Statistics 15 (2006) 651–674. D.J. Gordon, B. Resio, D. Pellman, Causes and consequences of aneuploidy in cancer, Nature Reviews. Genetics 13 (2012) 189–203. F. Westermann, K.O. Henrich, J.S. Wei, W. Lutz, M. Fischer, R. Konig, R. Wiedemeyer, V. Ehemann, B. Brors, K. Ernestus, I. Leuschner, A. Benner, J. Khan, M. Schwab, High Skp2 expression characterizes high-risk neuroblastomas independent of MYCN status, Clinical Cancer Research 13 (2007) 4695–4703. J.S. Lanni, T. Jacks, Characterization of the p53-dependent postmitotic checkpoint following spindle disruption, Molecular and Cellular Biology 18 (1998) 1055–1064. Z.A. Stewart, D. Mays, J.A. Pietenpol, Defective G1-S cell cycle checkpoint function sensitizes cells to microtubule inhibitor-induced apoptosis, Cancer Research 59 (1999) 3831–3837. D.A. Tweddle, A.J. Malcolm, N. Bown, A.D. Pearson, J. Lunec, Evidence for the development of p53 mutations after cytotoxic therapy in a neuroblastoma cell line, Cancer Research 61 (2001) 8–13. N. Keshelava, R.C. Seeger, S. Groshen, C.P. Reynolds, Drug resistance patterns of human neuroblastoma cell lines derived from patients at different phases of therapy, Cancer Research 58 (1998) 5396–5405. M.V. Blagosklonny, Mitotic arrest and cell fate: why and how mitotic inhibition of transcription drives mutually exclusive events, Cell Cycle (Georgetown, Tex) 6 (2007) 70–74. W.M. Zhao, G. Fang, Anillin is a substrate of anaphase-promoting complex/ cyclosome (APC/C) that controls spatial contractility of myosin during late cytokinesis, Journal of Biological Chemistry 280 (2005) 33516–33524. J.V. Shah, D.W. Cleveland, Waiting for anaphase: Mad2 and the spindle assembly checkpoint, Cell 103 (2000) 997–1000. S. Martin-Lluesma, V.M. Stucke, E.A. Nigg, Role of Hec1 in spindle checkpoint signaling and kinetochore recruitment of Mad1/Mad2, Science 297 (2002) 2267–2270. J. Thacker, The RAD51 gene family, genetic instability and cancer, Cancer Letters 219 (2005) 125–135. P. Giannakakou, D.L. Sackett, Y. Ward, K.R. Webster, M.V. Blagosklonny, T. Fojo, P53 is associated with cellular microtubules and is transported to the nucleus by dynein, Nature Cell Biology 2 (2000) 709–717. W.F. Ooi, A. Re, V. Sidarovich, V. Canella, N. Arseni, V. Adami, G. Guarguaglini, M. Giubettini, P. Scaruffi, S. Stigliani, P. Lavia, G.P. Tonini, A. Quattrone, Segmental chromosome aberrations converge on overexpression of mitotic spindle regulatory genes in high-risk neuroblastoma, Genes, Chromosomes & Cancer (2012). A.L. Krasnoselsky, C.C. Whiteford, J.S. Wei, S. Bilke, F. Westermann, Q.R. Chen, J. Khan, Altered expression of cell cycle genes distinguishes aggressive neuroblastoma, Oncogene 24 (2005) 1533–1541. A. Menssen, A. Epanchintsev, D. Lodygin, N. Rezaei, P. Jung, B. Verdoodt, J. Diebold, H. Hermeking, C-MYC delays prometaphase by direct transactivation of MAD2 and BubR1: identification of mechanisms underlying c-MYC-induced DNA damage and chromosomal instability, Cell Cycle (Georgetown, Tex) 6 (2007) 339–352. G. Fang, H. Yu, M.W. Kirschner, The checkpoint protein MAD2 and the mitotic regulator CDC20 form a ternary complex with the anaphase-promoting complex to control anaphase initiation, Genes & Development 12 (1998) 1871–1883. S.L. Thompson, D.A. Compton, Proliferation of aneuploid human cells is limited by a p53-dependent mechanism, Journal of Cell Biology 188 (2010) 369–381. J.A. Barboza, G. Liu, Z. Ju, A.K. El-Naggar, G. Lozano, P21 delays tumor onset by preservation of chromosomal stability, Proceedings of the National Academy of Sciences of the United States of America 103 (2006) 19842–19847. D.A. Tweddle, A.D. Pearson, M. Haber, M.D. Norris, C. Xue, C. Flemming, J. Lunec, The p53 pathway and its inactivation in neuroblastoma, Cancer Letters 197 (2003) 93–98. G.M. Brodeur, A.A. Green, F.A. Hayes, K.J. Williams, D.L. Williams, A.A. Tsiatis, Cytogenetic features of human neuroblastomas and cell lines, Cancer Research 41 (1981) 4678–4686. R.C. Seeger, S.A. Rayner, A. Banerjee, H. Chung, W.E. Laug, H.B. Neustein, W.F. Benedict, Morphology, growth, chromosomal pattern and fibrinolytic activity of two new human neuroblastoma cell lines, Cancer Research 37 (1977) 1364– 1371. A. Valent, J. Benard, B. Clausse, M. Barrois, D. Valteau-Couanet, M.J. TerrierLacombe, B. Spengler, A. Bernheim, In vivo elimination of acentric double minutes containing amplified MYCN from neuroblastoma tumor cells through the formation of micronuclei, American Journal of Pathology 158 (2001) 1579– 1584. J.M. Schvartzman, P.H. Duijf, R. Sotillo, C. Coker, R. Benezra, Mad2 is a critical mediator of the chromosome instability observed upon Rb and p53 pathway inhibition, Cancer Cell 19 (2011) 701–714.