Download Calcium signalling in malaria parasites

Calcium signalling in malaria parasites
Is it important for transmission to the mosquito vector?
Kimberley Kissling1 and Noëmi Sterchi2
1
Kantonsschule Baden
Gymnasium Neufeld
2
Prof. Mathieu Brochet3
3
Medical Faculty
Department of Microbiology and Molecular
Medicine, CMU, Geneva
ABSTRACT
Malaria is a mosquito-borne disease caused by
Plasmodium parasites. Transmission of Plasmodium parasites relies on the gametocytes sexual stages. After mosquito ingestion, gametocytes undergo an explosive development:
within ten minutes they undergo 3 rounds of mitosis, assemble 8 flagella and escape from the
red blood cell, a process called exflagellation.
CDPK4 is a calcium-dependent protein kinase
that was shown to be essential for DNA replication prior to the first mitosis. For this reason
CDPK4 is considered as an attractive drug target to block transmission of malaria to the mosquito vector. CDPK4 is modified by myristic
acid possibly affecting its activity or its localisation in the cell.
We have analysed a mutant (CDPK4G2A) that
cannot be myristoylated to study the role of this
modification during exflagellation and DNA
replication?
Here, we found CDPK4 myristoylation is essential for exflagellation, but not for DNA replication indicating CDPK4 plays multiple role during gametogenesis of malaria parasites
.
INTRODUCTION
Malaria is a mosquito-borne infectious disease
of humans and animals caused by parasites belonging to the Plasmodium type.
There are about 200 different types of Plasmodia. But only five of them are infectious to humans. The most dangerous one is Plasmodium
falciparum. Even though these five are the most
interesting to science we use Plasmodium
berghei that is found in the forests of Central
Africa and infectious to rodents, as a model.
Plasmodium berghei is similar to the ones that
infect humans in most essential aspects. The life
cycle of these parasites, including mosquito infections, is simple and safe. In addition P.
berghei can be genetically manipulated in the
laboratory using various genetic engineering
technologies.
The parasite has two hosts in its life cycle i.e. an
insect vector and a vertebrate host. Sexual reproduction only occurs in the insect definite
host (also known as the disease vector). The disease is most common in Africa, Asia and South
America. Malaria causes symptoms that include
fever, fatigue, vomiting and headaches. In severe cases it can cause death. This disease is
most commonly transmitted by an infected female Anopholes mosquito. The life-cycle of the
parasite is involves sequences of different
stages in both hosts. These stages are sporozoites, which are introduced via the bite from the
mosquito’s saliva into the vertebrate host’s
blood and travel to the liver where they mature
and reproduce asexually to form thousands of
merozoites. Merozoites are then released into
the bloodstream and infect red blood cells. Parasites then multiply asexually in red blood cells
causing the clinical symptoms of malaria. A
small proportion of parasites develop into male
and female gametocytes. When the infected organism is bitten by another mosquito, the sexual
gametocytes are transmitted into the guts of the
mosquito. The gametocytes develop into gametes and reproduce sexually. The motile zygotes
escape the blood meal, develop into oocysts.
One oocyst gives rise to thousands of sporozoites, which reach the insect’s salivary glands.
The sporozoites can now be transmitted to a
new host.
While the mosquito is intaking the blood of an
infected vertebrate, the transmission of the parasites takes place. The gametocytes undergo
cell division and differentiation to form mature
gametes, which is a biological process that is
called gametogenesis. This process is activated
through three physiological triggers: a drop in
temperature and a rise in pH that the parasite experiences as it leaves the vertebrate host system,
and xanthurenic acid (XA) which in insects is a
major catabolite of tryptophan.
At a permissive temperature, P. berghei gametocytes respond to stimulation by XA with the
release of Ca2+ from internal stores after a typical lag phase of ten seconds. This calcium signal
is translated into a cellular response by CDPK4,
a member of a family of plant-like calcium dependent protein kinases. The protein kinase regulates the cell cycle that leads to mature gametes
(as shown in figure 1). These form axonemes,
begin to flagellate and move to reach a female
gamete.
from Qiagen, according to manufacturer’s instructions. To confirm the genotype of both
lines, we PCR amplified CDPK4 gene using
Gotaq polymerase with primers HF31
(CTTCACCAAATGAACCCTTTC) and HF34
(CTCCAGCATATACTTGCATAG).
The polymerase chain reaction (PCR) was executed as follows.





Initialization step: the reaction was
heated up to a temperature of 94–96 °C,
which was held for 1–9 minutes.
Denaturation step: the reaction was
heated up to 94–98 °C for 20–30 seconds. DNA melting of the DNA template was caused.
Annealing step: The reaction temperature was lowered to 50–65 °C for 20–
40 seconds allowing annealing of the
primers.
Extension/elongation step: The temperature was increased to 75–80 °C. The
amount of DNA target was doubled,
leading to exponential amplification of
the specific DNA fragment.
Final elongation: The temperature was
lowered to 70–74 °C for 5–15 minutes
after the last PCR cycle to ensure that
any remaining single-stranded DNA
was fully extended.
Steps 2.2. to 2.4. are regular cycling events and
were repeated several times, in order to multiply
the DNA.
With the resulting product from the PCR a gel
electrophoresis was made. The PCR result was
later purified and sent to Fasteris for Sanger sequencing.
Figure 1: gametogenesis, male gamete
development (duration 10-12 minutes)
MATERIAL AND METHODS
1. Genotyping
Two mice were infected with wild type and
CDPK4G2A P. berghei, respectively. Infected
blood was collected and the parasite DNA was
extracted using DNeasy blood and tissue kit
2. Exflagellation assay
Purified gametocytes were resuspended in
RPMI, pH 7.1 without xanthurenic acid. Then
RPMI, pH 7.8, 200uM XA, of 1:1 volume were
added. The resulting product was loaded into a
hemocytometer. After waiting 10 minutes the
exflagellation centres were counted under a microscope using a 100x magnification.
2
3. Staining of parasite DNA for flow cytometry
XA-activated and unactivaetd parasites were
fixed with paraformaldehyde and stained for
one hour with the fluorescent DNA dye Vybrant
blue from Invitrogen. After staining the DNA
content of WT and CDPK4G2A parasites was analysed by flow cytometry.
The wild type is exflagellating, while the
CDPK4G2A mutant is not exflagellating.
Flow cytometry analysis
The DNA levels, as quantified by fluorescence
were similar in the WT and in the CDPK4G2A
mutant. This suggests the genome replications
also occurred in the mutant parasite.
Parasite genotyping
A transgenic line expressing a non-myristoylable cdpk4G2A allele was generated previously.
We confirmed the transgenic parasites had incorporated the mutation.
Gel electrophoresis
1
Number of WT parasites
RESULTS
Fluorescence intensity
2
Figure 3: digital image of PCR result run
CDPK4
G2A
Wild
type
Figure 4: sequence traces of both PCR products
Number of CDPK4G2A parasites
1 = WT ; 2 = CDPK4G2A
Fluorescence intensity
Figures 5: DNA content of WT and CDPK4G2A
parasite as determined by flow cytometry. DNA
was stained with the fluorescent dye Vybrant blue
Activated with XA
Exflagellation
Not activated
DISCUSSION
The sequence of the wild type is normal, while
the sequence of the mutant is changed. It is confirmed that the mutant really is CDPK4G2A (as
shown in figure 2). In this mutant CDPK4 can
therefore not be myristoylated.
The CDPK4G2A mutant did not exflagellate indicating myristoylation of CDPK4 is essential
for its activity. A mutant lacking CDPK4 was
3
previously shown to be unable to replicate its
genome during gametogenesis (Billker et al,
2004). However DNA replication did not seem
to require myristoylation of CDPK4. This
would require further confirmation.
We thus propose that myristoylated CDPK4 is
essential to regulate a yet unknown biological
processes after DNA replication but prior to exflagellation.
ACKNOWLEDGEMENTS
First of all we want to thank the organisation
“Schweizer Jugend Forscht” for planning a
great week full of new experiences.
Also we want to thank Professor M. Brochet for
giving us the opportunity to work on a very interesting topic and for giving us an understanding of a scientist’s everyday life. The spirit and
motivation of everyone in the lab was very inspiring.
Furthermore we thank Hanwei Fang, who made
cool experiments with us, for his patience.
REFERENCES
•
Billker, Oliver and Dechamps,
Sandrine and Tewari, Rita and Wenig,
Gerald and Franke-Fayard, Blandine
and Brikmann, Volker : Calcium and a
Calcium-Dependen Protein Kinase
Regulate Gamete Formation and
Mosquito Transmission in a Malaria
Parasite (14.05. 2004)
•
Plasmodium,
in:
Wikipedia,
https://en.wikipedia.org/wiki/Plasmodi
um, Date of download: 15.03.2016
•
Brochet, Mathieu and Billker, Oliver :
Calcium signalling in malaria parasites
in: MicroReview january 05. 2016, S.
1-7
4